⚝
One Hat Cyber Team
⚝
Your IP:
216.73.216.67
Server IP:
50.6.168.112
Server:
Linux server-617809.webnetzimbabwe.com 5.14.0-570.25.1.el9_6.x86_64 #1 SMP PREEMPT_DYNAMIC Wed Jul 9 04:57:09 EDT 2025 x86_64
Server Software:
Apache
PHP Version:
8.4.10
Buat File
|
Buat Folder
Eksekusi
Dir :
~
/
opt
/
alt
/
python311
/
lib64
/
View File Name :
libpython3.11.so.1.0
ELF > @ R @ 8 @ @ @ , , , 8 8 P: P: P: ( H" = = = 8 8 8 $ $ Ptd T4 T4 T4 Qtd Rtd P: P: P: GNU MӜuhO7; ݄ l Q* A@` D % @ " $ 1D B@!2@" F, P *Q 8 @ ! ! 5B B@ 8 H B $$ %( @ @@B PC P ZX j @,*"*Ђ @ 0 E0 P @2!j $@Ā0"X 4 B@ D & xd2 Bf 8 I30@@ QDP0͎BC#Xp@ # @ - D0 !#!H$ ."A@"R(BP @0 JC P R *",! @ @H " @!P A A@C pĀ H @ P 02h ( 4 *M S " A $@ @ A JDq - P@ " $ xB0 P @0 " b 1D&)H0P1 T @A ( @ @B@2bbL D @ @ $`P "` b( "@ H QH 2 " ! ( *H 2 @ Ę@ P 0)#HD A Ȅ 4 I " d B0D @C! ! @@@@ ! 2 ! " ' LH BB ` ( &@ 0 ($ED r8E #XlP H PIga baz @& a@%!$! K@$PD 0 B L d h Q ( C@8 @ ' P 8 J,@! ȑHQA @ " ` B@aB RX@ ! @ " $%Q BH!@ ) *@ D@ Q @ aP h $ )` (H` @(F $ @ " @ (! ` h, @@F" : 0@V B Q 9B @ B 2 @@ JBA 0 H0 $ !D(Pp: 8( @ * " PBB $ ! 0 P $& #ÊЈ4BH " D ID @ , @ @ P @ @ H ,0@ @ p @ (0i B( D RĈ+@ Ф@ J $ J !p ! @i A 8 B @@i @£Afl m o s u w z } ! " # $ ) * + , / 0 4 6 7 8 ; > ? @ B F I J M Q T U V W \ ] ^ a c e f g i k l m n q r u x z | } ~ ! " % ' ( ) + - / 1 4 5 6 7 9 : ; = ? B E F G H J L M N O P Q R S W Z \ _ a d g h j l m o q r u w { | } ! " $ % & ' ) - . / 0 5 6 9 ; = ? @ C F I L O Q R T U W Z ] ` a b d h j m n o p q t u w y | ~ ! " # $ % ( * / 3 4 5 6 ; < = B C H J N O R T U V W X Y [ \ ^ ` a c d e f g j k m o r t w y | ~ " % ( * + , - . 2 3 4 6 : ; < = > A D F G H M O S T U Y ] ` b c d g i j k m o p q r t w z | } ~ ! # ' + , . 0 1 5 6 7 8 9 : < > ? @ B D F I J M P Q R S U W \ ` a c f g h i k m n q r s u v z { } 8(. I)FZguh #D[țW?H vy屌C.bPСO^$V t`8ms%8$rf=T?bD_j_# ].VKxd}bm2b`5 Nc*ey8i?,BdhIdWkm{wW4D0g,q}5d;L'XEgV ,w^Xӿ@r{HoY=GӁVxD)ھw}+> oǠ#,U>wԡ$jXn ( ha 2O@R 06ΛhsZ ΏDgIAm`,4 s%zH7#qBڌrXW JBa ~*=)ݕaRia&iĻJuhlZPb~8vv.'V q2/rIӦmڰ>`Nh6?W@txB^V$( r}Ю4H?C{͜P5bK mFrao 9UN-SgL!}02 x]ۼͱ;1ʵ˘R^m< +peH:2P ꒑s/w <X%kТ(t^Y@?R4өApZ-[C cW"г h}dtEr/y"#/8 ߤ GO G"V* j9a8~ !|COp $ D @ GVO ӏ/#a%ziQLcߺ6Nc ,zeTpo,hK9Ncx(U _J5 Z}$դw4g} R=NcG3UI }FEreQ~=I< ~Ej( m@rK4cg#dWq2y¾k֜sI7߷}ЌI攀+9]LǺ^.cD㤘7Lf'#5?Ǣ&h3p9^PpUȻ u ,*h*mRXna* 8n]-ϋ0-wm*Hub K?lb1 HmڨƑ1R*TԈ+|X>(zFT}%ȓ,Tɋ*, ꞋpF#;:| 3!ݎ!ڲ^ޠFI 8 e)'`H/t] O06`UH @r>r3ԥ:o).[V]<Eڬ`5 ԟܚɁ< ٍ ^C=B# dۙ]쯺NΧWȺo_6Ғ9 >7mZ$N)1 rWjڻ9)M,<g82( R[:e$V,dZk5k:p}c`VNTGt 2+!^d áZ\ЩF^}^`Jwg6'i7mX2.V;I ?`ˑ ~ 1<Ux? M0O3:&J]܋ mv*4y)TG}tNB|(v63oQJh 3jz'U xP%%\ XUe5H{ f|F}8R RK$ =>F7 p?Y+}Ic6W"Y~*\aUFō ; <@cՍ cuua/o҃塓F]Ū<;aix n GU~EÉ̈0ϋW GU$fHtȼ$<B'Le5 GU[G#GM{د B_6i@zzIecy_3 I vr,oIaNg#=vsDDtK6Gopղ.1t(8frݜ 9m OЊaiM@GGڅJ" b?Q_WҔFN'o/@MS sN%,3IP 7N H-$ !@gд$]U= DP 9%2LRha\F 38WI)XB62X yIO k%g;ІMP R* ?l> 3M6Q:ILZLe7ڀY SQ mm9/OpfС'm ] -e<N'o-s xRZ*u?<g_(5s[dq< ΄&C+6 )مBKG[~{r6dHG} * qrMv螮t5{D+;`X')7\Fu.p\ |8ςI L@\qLMqG4m" jǗ|u . ]Kv\AюJO[$:HKv.?Rì cĺvSl:Y> "@y(YGᵇ}2!/UR1Z}5 d $˾"(ήP9ƨK:dqwˎ T<4\P{Q;;.w[_ҮnӀdȄ3(4\e96ь23 Ba 'Bp' Vm {L_ Cij ݁Q*4^qv$'9}Kj]C ru(NWwm;2VJ9 8f)Q2mT4svn r 'ny`W~;D}O] ڔFNX UIĀ_a ll5RRz!jFU ,Q `p>`-G iwݳoPI 2 f ,ʋ!["[(u8 StbSYWVEb(& 'GbmMo3Y7/Y$i:=I;^s /-M= q1v- _ 78M Vzy( `GaP N ѷ ̈́_md<o+mQ ְG]aױ)O2\|NN8m G{#]BB@ VHK@ѝ Z x ZX='~?@7fW6TI-C~b3"yЃCx#9;pyF4NVxV[ וɹ"Z&RofXM:S|poG%K5'#%ĥnڛ~=hsPB$(a/ 7ڋPU*9agN"fBr+9=/x8 dCVtyFT̛;/XbJ$炌!<O>kTc?炌6O~(-z I` a?'|Z dIoֳ$CX%}fޘ\fuǥJ=h ]IG&&Un`*P;̘/ Pݐ}<~ Ym UO%#u_Kk0O^p3d`P\ "!p5cLXr:Q|xꫳiєd5xV.:ԞpރZϲbN81*butx7s=Ho:WH< L fueDo]ɍ;) hg -,V~0Alۂ<#gѿĐÕ\$:恡# f> ͮV8 V} `/Ӝ ÁыXgQbJKufRŃ$ ZNځϜeW5̊4hݣ`s jYZ"H)R07쇠ߣqr5C| |U)sQ@FF g]a?%ecN8pc J. Itz+M"pX(6 T<ix@z&>O1^#o$pꯌ, z)V]~ܪga&+pj$(ttwgIq&i0T ]I~<FXG楖jb7YȊ$Kz%h0fɍI)9pNwUՋb?uB䏾e 0n"*tM+_%Ka\ ,Zeذa-4pPːИM3`Ns3&G%D[ hoEC*3Z%`dbd!Q(LI]hImX{)-nj"KBm|4g+>"#=1#g8nu"?^1'q<LEoR{zk(bݲw!cx[%6^HwK}E gp^6m #) P4jr2> t&ق9/6ou410!zràbveiK+hsZ`vB`1TlIu ®Աz)XOƉ Ky W]4Dr }_oUGר D)+W0Cʎ'.IE3,qS>6 x%clX5nj=F 1y 4l\C %~GCkhYVfl2k+y {-'@ ^V:|kAC^\f|W UĚ B5Mяt63*<QAC[oШU[9B]̒,[(JL6N*RrI8~Lϲcs5 +ᰀ([H(ȂBźZ y8P#Qui2z3yU?r@,[],좦 H$ZmB* }ۮ3 i D훗5۹<zV [ jC ]Pvԭ뱢;JnMshSk 6O H'ץ/KԔ =a^`s1շWXDZB\=pqIsI,KoQ1#2:t S|&V ))`dWB8 +zA;V#sԘ5J:V&<ĺQ Xc_ :ݪanař-[gfLIF֍&m}]pOt\:L H y}\Õ߸ :cs2 -W+CO8#SLv `a/YPu2)R3N c _SY4AWگZ[0d,^mWud/zW>8Z:<;Nf1nkXDYqvA Ӎn@];NaE'Es&$?u]Ȭ%d#'L 7~T#@ M sv2z'RV])?uj缥4VJm8kH4|nX qj(n ΅ snBEcꗪ7A'ԂWؙY"I$c26ZF^XUǧY\罏 vjjgG lwH#%%lX$SYSl+-g/oP-E+dWAZ:/SeESjO.\ul3sΗ X. YlČ?+0r Z"$sa rx W؝uyy*J =z>G锛d{e*M1Zxj>6Km]M5H :[Hc\z Ow %EOs:hɷ 4I&8hr _h$Uq{80YB> +`Q0w*#f}TQ S*5_a/d0wN>G1f ]>!xqF1 Qj=g: UX,A" Kfwu&xD'`{o!5>ukaJj 4.WIÙK fѶ(N*BwKfA=?|k XϦ+Z_"%QCyޢ" GƒyFL QGM e^;65Yl&1j mN{x _tg=NMX3КqG<. gk;/NO2P,̖ܗgq - S m U O , 4q 9 ] M 7 u J A ] -E F? ) iQ v E KQ . e D 8 E t ͅ 1 8 E Rb F ͍ ` v` m l6 Q { t2 , R + ^Q jO O pF O ` m V ~ | I e Å 8= X =p ` ] A BC ` @ C P > } L 2q @ ?= d 3C ߅ d u N I \b n ׄ c Y , @ s " e S o 7 Յ k 9 c e * P F " &D % C ? 5 J c '- k` ` Z 2I j J } U ? ` E +? ] ׅ - - - { 6 b 3E ! m j J' A * % #- ^ M ? { WC | / A S & {. X` $o N fC P E 7 + e Ӊ A { : K m 2 y 4 &] V /A 8 ` J L ` H6 ; ( 3 C ? P6 d m6 u A 8 Cp ` e X d , C ZF Q 4 8 : + y dF 7 & a M` t | qH 4p X P 6 7 { O D ! - A C ~ H } O J | ' 3 ! 3q c l` b` ˅ ] &% 6 g N 2 ` @ - 7 vX A 4 5 : - 7 A= F4 #% x Pi 3 %? @ >& ^G ! n& M* ~ % L X ~ È - @P C ͓ X pj n !h 0x" " Ы# - ? P @) s + \ A ' U\ PU* c H# : / Ѝ . Z uT %? / < = @ a Qn 4 s J ( ? & 5 `w D8 Q% R M) ) n ? h%? R P Y 0 * H + P = M 8 U % P< | 8 pT% 5 :% n F 1 $ \m J + 4 0` r kq $ k o J ' a 0R# ^ * { U c @+ # d ( n , t$ N m! PL V RN ( kw ~ @ N u V m \ X* 4 %N !? K! J s p ? y q ? p PP %p XP S > S " u {1 pi >; 9 " " Hp d @ UM Р( c- 0$ . z B D PI' % O " F "[ 7* ~ : % Z J 9 T : `% y _ * ! wd w" E P' S `" + Q ! C 6_ * 2 }# j Z8 R% i 4 e M Z `= ^? F 6 /D >' O P" / I 7! 9 `% E p } ;q [ f * - 0$ D . $ Q ! d s v# # ^ S F, P + ^$ ، 0i# ~7 K% g % k= M \ M 6 =% : % ? H ' mg ,< X5 0-% ~ a U+ M s < {U ~) < B G_ < W i ? H Ji c $ G ! ! @ N . Z @ ;h = 84 0d 3 p" c J `' ) ! o QZ * A f{ K P P) / $( `.$ 5 cD @' |i h " 5 8 p { 6 q $ J @j! ={ <> ? p& w# X `D" 6 = p%? D ? " {; ~, 2 Ђ" C ^ 0* !l ) E Q' 5 7% S v { EK ' 5 0 j " % Z| Px" <> 0% }% `F n/ | o > 8F 1h = @v 2 f R M %k u , z a$ / 2< %? Q )) 9 Pa 9 M ! " Z * 7n - 4# `# , P" km @x" Qe } F H lX * OD ?' hf w: K @! 8 `# a2 $ # > & z ` * x r + u P % Q . W R ,) S r Y y g! G G P' z # ! * p= O ) M oa PN+ K l 4G ' O jE PO' ( 1$ } N W @) j 4\ @U* 0V# : Fk @+ M ` " , \U {) u { M A ? h= %? A #n ( " F PM# n @ > )y ) f8 R : 0X U ) A 0 W O @M w & f Z 4 `*% 9 z I$ T ^ / k V ) !> = N A @n& M ny X #* X$ T Y: T @# # ? M ! qj 'Q ! L W " U e % 7 J/ u A} v } F: G M = M ,- @M 0 [ P ` y | Wr q = % %? ^ * * m& 0 $ t Y + i$ % < % P N pN# ? j PK# a M L { z M S 0" p 3 R g < A% B s ~ , w g _< Z PK" ! U M s? pH f R J) ^ W p) % o L % 0$? + s$ P R " s " ( C 9' IU {) ' E `Y' L ( n Cw X 0 @ 0O e_ = 3 < % B B o y $ 1H ! u ( ؇ 7 L# t _ * 8 c% ru y H# n 5 D =' ^ jV ) ] X `#N ) E$ t ` N kV p* BA `' Z* 0 L * XX * V g D< z" M P x 0 p m z " o @# H h < `" $ t N Q " 8 V ) 6 @$? >^ 0* S K X C" 7 F Iu ? - X 0 .N ! *o F ^ * $? x e N #3 % @ p" r p e N ( ~ M Fd )0 $ t S @" P #\ PN* ? J ' *Y ? nl !, " 0 ai & pi &: % R kx | o ? 0 & 5 5 :% a / $ k I[ pR" Z `h f ; %? 2Z * z # R c `+ l `%? i /A 7Q ) 8 . _ h @5N y ' C Ml o " E 0R' q K P( % E S' K v 3N !b PZ+ 8 PQ P! > 5 3% z `M g ; g w< ZB ,' P " rW 0A" Y [ 9* : : S : a } n 6 ? :y . K1 $ B q ; k :o ϔ W b) P 8 _ w =N Vq | q X * 6 b" # E @" D ʨ M 6 0E% 2 @ % vt v v G ! `wM 4S O) { |9 ' "$ ( d# # " V ) m v 6 p@% 8 N j f ` ` * CP ! D 0 M I# K 8 p% B z L @( R 0+) " + @e 0" W N " Ȋ ] z p I ' )K p' a V `) M ! { U } * P2 @ i $ M ?u H 1 ` B P H p' D d `+ | q | lM `! & k Tk ߋ ; % pK# ( 0 Q 4s r E k L ) k p ` Z 2 < % {h d@ X " 3 + e$ Q *) ` M T / Є $ ` 0 @$ xF ? , Is ($? g < b + c ` ` %? > & M TK ' a ? " e $ I ) lR `5) d< @% DW (e + S T 0f) D PJ' 1 Z 7 W ) P L@ @&& j A ' > M d + @ O ) r M G" @ f U y) N ( U Q ! 0 . b + 5 f P; O > DV ) " " q 2 ? k # ) ` eD eY * G J ' 7 B @ @ & Q ! ` G , " _ " f# " X * ˃ ; q S# @ 8 U% rW H C 9' ; ! m S ( 1$ M / a " Ȥ R - $ j f $| e { ^ " B Y * t . o ` _[ U" d 4 { ] ' o # F n' 4 M w \ d ]! @K (v ( sp ( i 7A C ? ' @&$ M? 0 - M ; P% ( p ? 5 @y b p+ Y * `@ \ PX* , n -B A X E" E p) ' Y& pc C 9' u ( ] `u* h P- $ I `?N 5 F# - } r \/ w n r # # # e 8 = t P " u <` uD |X 0* - $ N gJ ' & r ( L ? ]u 7 c > w u 2 K `' t X 6 * WH P' r @j# ] * k P < ? 8 C 0" e V^ * / # ! `# L O7 P + a ج !? ! f g# p 9 }% 9 C P k u " @ `b R z `K# Nc h @ 0 S Y ? Gx {} x k8 ; d 5 |] * - . $ w O ( b 2 - ? D. @Y %? U# x 0 $ K Є! N9 x% 4 r h @ 0. p$ S ? yP 0) C P Gj F A @' V ) 9 W # 1 / w - l ۏ @ pW ; 0 N m b B > I F k ) }0 $ I H! ) 6$ S @T) X g < : " 6 W ) % T L B 8' p . - P$ 8 H v WW ) D ` ]D `M / o p } ~ ]s / ҆ 9 # : p% ( K 0! @ I D! G ! -w ' P B) P i 4 e n8 ? { U G 0 $ P y8 ' M ! " j FJ ' ) [ :* ; @(N l f ; x c 3 ek _ * H 0! A K / ~= M 4J 1 8N j H< `% bb `]+ V h @ Q 1 0$ F " o q " # P Ո F 0 < % B y M @" c p+ e M ( T P 9 #P ) * z -$ no ޜ [ p " Yd + ^ l3 PN / u 5 t + [ & me + , R' | _ * R" MS @I ' D I' \ 1 V Db CN 62 p yQ $) % ] * # y G AN s ^ ( D a Z+ M ( # 0! Q X # @D ʑ 9 P% Z 0* [ " # B G# F 7 N Z $* * g < g ; c, 0w$ ? T# i wH ! ) K ( <# ! ] * ph P 9 pv% q t Y * 4 @%% 9 4k % P ) 4 +^ * ' ^P ! ( XJ ' > o% = Z "* Q U[ h > @M = N 2 $ K 8P w 6 = 0K# m> % t P z ! ^ c p+ # # ' A " I ߃ < L ! E Av U `~) A 2 $ 0 1 %> n E C ;' G ! e S "G P pv u 0P j [ 3 pS N : % W H < 0% O @( , T V) | ne 7X 9u 2 H ! . p$ 4 Wa N pX 1 o ` p N # % \ H* ; y Y H2 $ P ) % l Ï L 7 H% @N )+ p @ N d + 6! I <* X$ | o \ n ē % ; 0% q 0 + Z6 Ѐ v $ ɞ ( 0f y `! u 9 F N M 2 p$ t6 =% , p7 Jy y O J# 49 P ` h x J ' I z 6 < BM ! Z 'h < DG ' v f ( % p~$ 0 ? S pP) :E N' y@ )& 9 " 3 7 @ @N J i! F e + = M C 2 V g i ? ` x \ @n* 5 ) X$ < ] w , @: ы ' " 3 E pL' < @ j} jw @ y !N i J $ @M g 6 R ! y 7K `' . @K# f9 M ' ($ O * " _ u' F @" q t P \A P' i _ `* ? 56 <% } f P+ & Y 5 4% ( 4$ / ss 3z " U A ' # w s = 1 $ " ^ z Y1 6N 2 @7 b s - @ s " c { " 1 q Y * 5M ! ! r &+ 2 O} v @ %? 0 | o . 0 PM F= <N @ j# + ># ! J( Ї " g k< 4 '% " o $ %? 3 % 3 aS gI 3 dc E * ]$ ^ .| e c C p<' " qA ' ( D p ? : p% 1, 9| e . `" _ 0i !D =' uk { 1 @z D P%? r l ߏ S -N 9I и' % &N + P . 0Y v# , $ # J @' 4 !% O @ .& c] * D `M X( /$ l: G m = 1 # # X3 @ , p" > }y * < % < % C p9' p > ) r W < # V ) x Y ?N 2 `% O _$ M Z ? &` mD ~ ؘ / P" G Q `~# r ػ v ( 9 % J A E3 @M !? N ( . +N ^ * @ 0Y f k. $ T ߊ 7 E q( p1$ \ U i : ` 0 g < `M j - ) b 0v" K ( 4 /> M B e i p X !% > ^ u k \ u ! 9 l ' pG+ ` ~! @] w Z% 0C :/ pt .; % + ` N 8 0 FY @#* ` * Q ) ; `% e C @<' 0 6X P) v % F n' . f `+ DL ]( $ n M `9 y ' "$ ' ( 2$ | r [ PB* #a $? 2 pV# e W ) ) c~ ( ? ? M [. `Y > h @ % U ,P o X ;O X ? @& P ) a k 2 07 % U 3P `) > $/ o M S i \L % O ) AH ' ] `M `M 4 r [L pv( u ( > 2 % Q z* @n v ( 8 d4 ` a Q+ f H ! ; T _) D x %x 4 kG 0' . M# q g ># ! 3 PP X M q ¹ * > ? N ( M OE P `> # w x%? P `) ` ; % ' e' } p ̩ , h0 0 1 f h9 ) f5 @~ w ] }f ; 5 ?R .) b M e; * !? _I ' : x @M <r ' r 1 E] p* L{ H ` x ? p* M * 1} 1u < [ J# 9 g ; [V ) N ! = qD A' ) i iz " ! m b [ 0D* k >$ . B `8' 8 V F Zv M ( < % Z n " > j 9 K ( ` -= % ? %? +R ,) V }G p' `" 0h# /d + B ? g < " P 61 < 8 3 O B5 0{ * f' @ B p $ n7 H% $ M ? & > )N W ) Q 63 = l r ? l @AN @M _ ID " #F Z' y b ( o V & i I M P( b [= `M [ @M" " , 8 4 ' j# / VR x5 _ @M M I 7! " ր b ${ 57 H ' A , 0= o 3 N %? M U D G e . И$ F~ Wt S> 3? . @ "X ) - } | n ܓ ? `M Hg ; h z@ PJ# ? R C) ] * ( GX * * ) F$ - / a a r "? D A E# W @) , " F 0' E 0 1 0$ s ! pb = V ) L Ї( - $ 0 [ `H* 8 [ $? c + I /c Z i o > ` ~{ L & M b Z+ 8 H P! a / ;7 J ' 9 Xw = M M# B ' l k| n MO P! eh G@ v -V Ћ) $ +l R M) Y ( ($ 4 `q D <& c Z Z 2N rS M p" ;- 3 aK p( " , 3 % ! _y O C - : % @f + I Ս V R0 $ _ * F ( `3$ 9 P F R D =a i Wz a" J ǵ e \o Ԝ ?0 $ L rE \ Z* t f 9 x? ~ N 9 % . O ( & pZ `"* P Z+ x> * PX$ ' o T ; 'T @" 5W ) 5 c + , p$ 2 { I H1 | P n M a U+ & 0f O `y ` > 0 & ` * 5 Wj u J -L `]( % ֎ X%? C X } r qO M L :( ! ' p hn @ j ~ R # # j V W i Sf Q: & wb 0+ ? U m^ г* ! I R! I 7: p , { d Ǡ y 0f 9 x+ = U o g " G 0' v " * ) F$ " 2 l Ϗ " " w 4 3 !% - G ' N J `" , , Q J > Y, ' |c p+ e P ! 08 -] * "6 ;% +$ 8$? 7 mr A w ) P . P` D h u ( Y * T P^) ! n E l# %? ؏? 5' @$ ; p Y P; N 0 $ ) & W 1 uI P#! w 2 @$ t J# H [ p Q H| 'f \ Fh &= ! X * F q' :N q ; o , ] 5g ; ;= 2 u $ Q () 4 Pq Kr + Vp HP EB ` N ae / P ` e @[ } |[ 9* : ] * 3 K X ~ ZO @( 1 $ L ( k g " 0 Џ? " h@ @)& 6 h q E * ) T @^) +j > P> "? v D U P) o . D p bT \) ,5 y k ## # 3 1 $ % 6 " pZ ' g+ + 1 - 1 X * , 5i EA F p T _ ? B _ G ! w ! M 4 0o# S ȏ? 6 i $ M [ pC* K T x p" > j E & N & g ? , z$ " & " # ] T w 3 1 M " 8t h1 G p y " 3 8 3 # # F l# U e 5 .% = ) !? 7 ` l " ) 9( 0/$ 3 U ~) 8 @h# , e - - Y I @"! ' $ { 3 p9 % %) P pU 4 J ^! ( 1$ \g < * zq í = m N P( ' H M c J " a N+ 0 К" v\ V* 9 (P 0 P$ qN 0( 3 %? 7m W( /$ ^ * QT [) T k) / $P *r t sL ( 6U z) F 0z' ^ P* 3 i Ef 9 h Ȍ U# " /u p $ A E U' p= /8 q 5 P x J# F @ 1 $ < ( Z ? v5 $? P" V . E X' } }_ * "G ' c N S Q) H Z - # t B 2' ; 7@ ` a lB @-' X b + . @; n $ % > P5 No & __gmon_start__ _ITM_deregisterTMCloneTable _ITM_registerTMCloneTable __cxa_finalize PyFile_SetOpenCodeHook _PyRuntime PyExc_SystemError Py_FrozenMain Py_VerboseFlag stderr stdin fileno isatty PyImport_AppendInittab Py_SetStandardStreamEncoding _PyConfig_InitCompatConfig PyConfig_InitPythonConfig PyConfig_InitIsolatedConfig Py_SetProgramName _PyPreConfig_InitCompatConfig PyPreConfig_InitPythonConfig PyPreConfig_InitIsolatedConfig PySys_AddAuditHook PyExc_RuntimeError PySys_AddWarnOption PySys_AddXOption wcschr _Py_TrueStruct PyThread_allocate_lock sem_init perror Py_DecodeLocale Py_BytesMain _PyMem_SetDefaultAllocator PyMem_RawMalloc PyImport_ExtendInittab PyImport_Inittab PyConfig_SetString _PyRuntime_Initialize Py_IsInitialized Py_PreInitialize PyThread_init_thread pthread_condattr_init pthread_condattr_setclock _Py_DecodeLocaleEx Py_UTF8Mode strlen _Py_PreInitializeFromPyArgv setlocale Py_IsolatedFlag Py_IgnoreEnvironmentFlag strcmp wcscmp Py_PreInitializeFromArgs _Py_PreInitializeFromConfig _PyRuntimeState_Init memcpy nl_langinfo PyMem_GetAllocator _Py_ctype_table _Py_ctype_tolower PyConfig_SetArgv Py_Main PyMem_SetAllocator PyConfig_SetBytesArgv mbstowcs PyMem_RawFree mbrtowc PyMem_RawRealloc Py_InitializeFromConfig _PyMem_RawWcsdup wcslen Py_SetPath Py_SetPythonHome Py_Initialize Py_InitializeEx PyThread_get_thread_ident pthread_self PyStatus_Exception PyMem_RawCalloc calloc _Py_HashSecret _PyMem_RawStrdup PySys_ResetWarnOptions _Py_SetLocaleFromEnv _PyArgv_AsWstrList _Py_ResetForceASCII _PyWideStringList_Copy _Py_get_xoption wcsncmp _PyWideStringList_Clear _Py_GetEnv getenv fwrite _Py_LegacyLocaleDetected _PyMem_GetAllocatorName _PyMem_SetupAllocators PyWideStringList_Append PyWideStringList_Insert memmove PyConfig_Clear PyConfig_SetWideStringList _Py_CoerceLegacyLocale PyConfig_SetBytesString wcstok Py_BytesWarningFlag Py_InspectFlag Py_InteractiveFlag Py_OptimizeFlag Py_DebugFlag Py_QuietFlag Py_FrozenFlag Py_UnbufferedStdioFlag Py_NoSiteFlag Py_DontWriteBytecodeFlag Py_NoUserSiteDirectory strchr stdout __errno_location _Py_DecodeUTF8Ex Py_GETENV _PyWideStringList_Extend PyConfig_Read PyCode_Type _Py_NoneStruct _Py_get_env_flag _Py_wgetcwd wcsncpy _Py_GetForceASCII _Py_str_to_int _Py_GetLocaleEncoding _Py_IsLocaleCoercionTarget Py_HashRandomizationFlag setvbuf getrandom PyExc_ValueError fstat64 PyExc_NotImplementedError PyExc_OSError _PyInterpreterState_Enable PyThread_tss_create pthread_key_create PyInterpreterState_New PyThread_acquire_lock PyThread_acquire_lock_timed sem_wait sem_clockwait sem_trywait _PyTime_FromNanoseconds _PyTime_GetMonotonicClock clock_gettime PyExc_OverflowError _PyTime_Add _PyTime_AsTimespec_clamp PyThread_release_lock sem_post PyThreadState_New PyThread_get_thread_native_id syscall _PyThreadState_Swap pthread_cond_destroy pthread_mutex_destroy PyThread_tss_get pthread_getspecific PyThread_tss_set pthread_setspecific pthread_mutex_init pthread_cond_init pthread_mutex_lock pthread_cond_signal pthread_mutex_unlock pthread_cond_timedwait gettimeofday PyBytes_Type PyBytesIter_Type PyLong_Type PyFloat_Type PyTuple_Type PyTupleIter_Type PyExc_MemoryError PyExc_BlockingIOError PyExc_BrokenPipeError PyExc_ChildProcessError PyExc_ConnectionAbortedError PyExc_ConnectionRefusedError PyExc_ConnectionResetError PyExc_FileExistsError PyExc_FileNotFoundError PyExc_IsADirectoryError PyExc_NotADirectoryError PyExc_InterruptedError PyExc_PermissionError PyExc_ProcessLookupError PyExc_TimeoutError PyContextToken_Type PyExc_DeprecationWarning PyExc_PendingDeprecationWarning PyExc_ImportWarning PyExc_ResourceWarning PyFrozenSet_Type _Py_EllipsisObject _Py_NotImplementedStruct _Py_FalseStruct PyBool_Type PyMemoryView_Type PyByteArray_Type PyClassMethod_Type PyComplex_Type PyDict_Type PyEnum_Type PyFilter_Type PyProperty_Type PyList_Type PyMap_Type PyBaseObject_Type PyRange_Type PyReversed_Type PySet_Type PySlice_Type PyStaticMethod_Type PyUnicode_Type PySuper_Type PyType_Type PyZip_Type PyExc_Exception PyExc_BaseExceptionGroup PyExc_EnvironmentError PyExc_IOError PyList_New _Py_tracemalloc_config _PyObject_GC_New PyObject_Malloc mmap64 _Py_NewReference PyUnicode_InternFromString PyUnicode_FromString PyUnicode_InternInPlace PyDict_New PyUnicode_New PyGILState_Check PyDict_SetDefault PyThread_tss_is_created PyObject_Hash _Py_HashBytes PyObject_IS_GC PyObject_Free _Py_Dealloc PyType_Ready PyObject_HashNotImplemented PyWrapperDescr_Type PyExc_BaseException PyObject_GC_Del PyExc_TypeError PyTuple_New memset PyMem_Malloc PyMem_Calloc PyMem_Free PySequence_Tuple PyList_AsTuple _PyObject_GC_NewVar PyObject_GC_UnTrack _PyTrash_cond PyThreadState_Get _PyTrash_begin _PyTrash_end PyType_IsSubtype PyType_Modified PyDict_Contains PyCMethod_New PyCFunction_Type PyCMethod_Type PyDict_SetItem PyDescr_NewWrapper PyType_GenericAlloc PyDescr_NewMethod PyMethodDescr_Type PyDescr_NewClassMethod PyClassMethodDescr_Type PyDescr_NewGetSet PyGetSetDescr_Type strrchr strncmp PyTuple_Pack PyDescr_NewMember PyMemberDescr_Type PyLong_FromVoidPtr PyLong_FromUnsignedLong _PyLong_New PyWeakref_NewRef _PyWeakref_RefType _PyWeakref_ProxyType _PyWeakref_CallableProxyType PyObject_GC_Track PyStaticMethod_New _PyTuple_MaybeUntrack PyStructSequence_InitType2 _PyStructSequence_InitType PyLong_FromSsize_t PyDict_SetItemString _PyTuple_Resize PyLong_FromLong _PyObject_New _PyModule_CreateInitialized PyModuleDef_Type _Py_PackageContext PyExc_RuntimeWarning PyModule_New PyModule_NewObject PyModule_Type PyModule_AddFunctions PyModule_GetNameObject PyObject_SetAttrString PyObject_SetAttr PyObject_GenericSetAttr _PyObject_GenericSetAttrWithDict PyExc_KeyError PyExc_AttributeError _PyType_Lookup _PyDict_GetItem_KnownHash PyErr_Occurred PyModule_SetDocString PyModule_GetDict PyFile_NewStdPrinter PyStdPrinter_Type PyMapping_GetItemString PyObject_GetItem PyExc_IndexError Py_GetVersion Py_GetCompiler Py_GetBuildInfo PyOS_snprintf PyOS_vsnprintf _Py_gitversion _Py_gitidentifier Py_BuildValue PyUnicode_FromStringAndSize Py_GetCopyright Py_GetPlatform PyFloat_GetInfo PyStructSequence_New PyLong_AsSsize_t PyFloat_FromDouble PyLong_GetInfo PyHash_GetFuncDef PyList_Append PyMem_Realloc PyList_Sort PyObject_CallFunction _Py_VaBuildStack PyExc_StopIteration PyObject_GetIter _PyObject_NextNotImplemented PyIter_Next _Py_CheckFunctionResult _PyNamespace_New _PyNamespace_Type PyDict_Update _PyInterpreterState_GetConfig PyBool_FromLong PyThread_GetInfo confstr PyUnicode_DecodeFSDefaultAndSize PyExc_UnicodeDecodeError PyUnicode_FromWideChar _PyImport_FixupBuiltin _PyImport_FixupExtensionObject PyModule_GetDef PyObject_SetItem _PyState_AddModule PyList_SetItem PyDict_Copy PyDict_GetItem _PyErr_Fetch _PyErr_Restore PyTraceBack_Type PyErr_NewException _PyObject_MakeTpCall PyMethod_Type PyCell_Type PyFunction_Type PyObject_GenericGetAttr PyArg_ParseTuple _PyByteArray_empty_string _PyType_CalculateMetaclass PyUnicode_AsUTF8AndSize _PyDict_Next _PyObject_LookupSpecial _PyObject_FastCall PyObject_GetAttr PyObject_VectorcallDict _PyObject_FastCallDictTstate _PyDict_GetItemStringWithError PySys_FormatStderr _Py_fstat_noraise PyImport_ImportFrozenModule fputs PyImport_ImportFrozenModuleObject Py_CompileStringExFlags _PySys_GetAttr _PyDict_GetItemWithError PyUnicode_DecodeFSDefault _PyImport_FrozenBootstrap PyImport_FrozenModules _PyImport_FrozenStdlib _PyImport_FrozenTest PyUnicode_FromFormatV sprintf PyUnicode_AsUTF8 Py_CompileStringObject PyExc_RecursionError _PyUnicodeWriter_WriteASCIIString _PyArena_New _PyUnicode_FromASCII _PyUnicodeWriter_Finish PySys_Audit PyObject_VectorcallMethod _PyObject_GetMethod PyEval_GetBuiltins PyExc_ImportError PyEval_EvalCode _PyFunction_Vectorcall __ctype_tolower_loc PyExc_SyntaxError _PyArg_ParseTuple_SizeT PyMarshal_ReadObjectFromString _Py_write PyExc_IndentationError PyEval_SaveThread pthread_cond_wait PyExc_EOFError PyEval_RestoreThread fread PyBytes_FromStringAndSize _PyEval_EvalFrameDefault PyGen_Type PyCoro_Type PyObject_Str PyAsyncGen_Type PyObject_ASCII PyObject_Repr PyExc_AssertionError PyExc_StopAsyncIteration PyExc_UnboundLocalError PyExc_NameError _PyAsyncGenWrappedValue_Type strncpy PyExc_TabError PyExc_KeyboardInterrupt PyFunction_New PyFunction_NewWithQualName PyUnicode_FromKindAndData __ctype_b_loc PyTuple_Size memchr strcpy PyTuple_GetItem _PyCode_Validate _PyCode_New PyObject_Vectorcall _Py_GetConfig _PyObject_NewVar _PyArena_AddPyObject _PyObject_LookupAttr PyDescr_IsData PyMapping_Check PyBytes_AsString PyDict_DelItem _PyDict_DelItem_KnownHash PyUnicode_DecodeUTF8 PyType_GenericNew _PyArena_Malloc PyToken_TwoChars _PyObject_GenericGetAttrWithDict _PyUnicode_IsPrintable PyToken_OneChar PyMember_GetOne PyObject_Type PyUnicode_DecodeUTF8Stateful PyObject_CallFunctionObjArgs PyArg_UnpackTuple _PyArg_CheckPositional PyCell_New PyMember_SetOne PyObject_GenericGetDict PyUnicode_CompareWithASCIIString PyNumber_Add PyUnicode_Concat PyImport_AddModule PyImport_AddModuleObject PyWeakref_GetObject _PyUnicode_EqualToASCIIString PyInit__imp PyModuleDef_Init PyModule_FromDefAndSpec2 PyObject_GetAttrString PyModule_GetState PyToken_ThreeChars PyModule_ExecDef PyModule_GetName PyModule_AddObjectRef _PyImport_SetModuleString PyMapping_SetItemString PyCallable_Check _PyUnicode_DecodeUnicodeEscapeInternal PyExc_UnicodeError _PyUnicodeWriter_PrepareInternal PyDictItems_Type _PyDictView_New PyDictIterItem_Type PyDictRevIterItem_Type PyDictRevIterKey_Type PyDictRevIterValue_Type PyExc_SyntaxWarning PyObject_IsInstance PyOS_strtol PySequence_Contains PyOS_strtoul _PyLong_DigitValue PyObject_RichCompareBool PyObject_RichCompare _Py_SwappedOp PyUnicode_RichCompare PyObject_Realloc _PyUnicodeWriter_WriteStr _PyErr_SetObject PyErr_GivenExceptionMatches _PyErr_NormalizeException PyObject_CallOneArg _PyArg_ParseTupleAndKeywords_SizeT _PyModuleSpec_IsInitializing PyObject_IsSubclass _PyBytes_DecodeEscape PyFrame_Type _PyBytesWriter_Prepare _PyBytesWriter_Finish PyTraceBack_Here _PyTraceBack_FromFrame PyException_SetTraceback PyObject_IsTrue _PyStack_AsDict _PyObject_Call_Prepend PyUnicode_RPartition memrchr PyNumber_AsSsize_t _PyNumber_Index PyMethod_New _PyDict_Pop PyArg_ValidateKeywordArguments _PyDict_HasOnlyStringKeys _PyDict_MergeEx _PyObject_Call PyInit__thread floor PyType_FromSpec PyType_FromModuleAndSpec PyDict_DelItemString PyModule_AddType _PyType_Name _PyStructSequence_NewType PyType_FromSpecWithBases PyUnicode_AppendAndDel _PyTime_AsSecondsDouble PyUnicode_Append _PyModule_Add _PyWarnings_Init PyInit__weakref _PyAST_Compile PyModule_AddObject getauxval Py_FileSystemDefaultEncoding Py_HasFileSystemDefaultEncoding Py_FileSystemDefaultEncodeErrors _Py_HasFileSystemDefaultEncodeErrors _PyThreadState_UncheckedGet Py_GetRecursionLimit _PyConfig_AsDict _PyInterpreterState_GetConfigCopy PyInterpreterState_Get _PyWideStringList_AsList _PyInterpreterState_SetConfig _PyUnicode_FormatAdvancedWriter _PyLong_FormatAdvancedWriter _PyFloat_FormatAdvancedWriter _PyUnicodeWriter_WriteSubstring _PyUnicode_FindMaxChar PyRun_SimpleStringFlags PyRun_StringFlags PySequence_GetItem _Py_VaBuildValue_SizeT _PyErr_CheckSignalsTstate Py_hexdigits _PyUnicode_Equal PyLong_AsLong PyUnicode_FromFormat unsetenv PyLong_AsLongAndOverflow _PyArg_UnpackKeywordsWithVararg PyObject_Format _PyUnicode_EQ PyFile_WriteObject PyFile_WriteString PyList_SetSlice _PyUnicode_JoinArray PyUnicode_Contains PySet_New PyUnicode_AsWideCharString PySet_Add _Py_normpath PySet_Discard PySet_Contains PyUnicode_FindChar PyUnicode_Substring PyNumber_InPlaceOr wcscpy wcsrchr fclose _Py_wfopen wcstombs fopen64 _Py_wreadlink PySetIter_Type _Py_ascii_whitespace PyErr_SetFromErrno PyErr_SetFromErrnoWithFilenameObjects strerror PyUnicode_DecodeLocale PyListIter_Type _Py_GetErrorHandler PyObject_Calloc PySymtable_Lookup PyException_GetTraceback PyException_GetContext _Py_EncodeUTF8Ex PyUnicode_Partition PyException_SetContext _PyBytes_Resize _PyLong_NumBits fcntl64 ioctl PyList_Size PyLong_AsSize_t _Py_DecodeUTF8_surrogateescape _PyConfig_FromDict PyNumber_Lshift PyDict_Keys _PyLong_AsInt _PyList_Extend PyNumber_InPlaceAdd PyLong_AsUnsignedLong PySequence_Fast PyNumber_Subtract PyObject_SelfIter PyImport_ImportModuleLevelObject PySys_GetObject PyObject_CallMethodObjArgs PyObject_CallFinalizerFromDealloc PyObject_CallFinalizer PyNumber_Negative _PyGen_Finalize PyExc_GeneratorExit _PyImport_AcquireLock _PyErr_SetKeyError _PyErr_ChainStackItem PyUnicode_FromObject PyFrozenSet_New _PyImport_ReleaseLock _PyTime_FromSeconds PyArg_ParseTupleAndKeywords _PyCode_ConstantKey _PyTime_AsMicroseconds PyNumber_Invert PyObject_DelItem PyObject_ClearWeakRefs PyObject_CheckBuffer PyCapsule_New PyCapsule_Type _Py_InitializeMain _Py_HashPointer PyInit__io _PyBytesIOBuffer_Type PyModule_Create2 _PyImport_IsInitialized PyModule_AddIntConstant _PyObject_CallFunction_SizeT PyCapsule_GetPointer _Py_VaBuildStack_SizeT PyEval_GetGlobals PyNumber_InPlaceSubtract PyThread_free_lock sem_destroy PyMarshal_Init PyInit_posix PyDict_Clear qsort _PyObject_GC_Resize PyUnicode_DecodeASCII _PyTime_GetPerfCounter PyObject_LengthHint _PyObject_HasLen PyObject_Size PySequence_DelItem PyUnicode_Join PyUnicodeIter_Type _PyLong_AsByteArray PyObject_GetBuffer PyExc_BufferError PyBuffer_FillInfo PyBuffer_Release PyObject_Bytes _PyLong_FromByteArray PyExc_BytesWarning PyCell_Set PyImport_ImportModule PyImport_Import PyImport_ImportModuleLevel _PyArena_Free PyMarshal_WriteObjectToString _Py_hashtable_compare_direct _Py_hashtable_hash_ptr _Py_hashtable_new_full PyInit_time _Py_HashPointerRaw _Py_hashtable_set _PyTime_localtime localtime_r PySlice_New PySlice_Unpack _PyEval_SliceIndex PySlice_AdjustIndices _Py_hashtable_destroy PyList_Insert _PyCodec_Lookup PyExc_LookupError Py_Finalize Py_FinalizeEx fflush PyCodec_RegisterError PyIndex_Check PyUnicode_FSConverter PyOS_FSPath PyUnicode_EncodeFSDefault PyExc_UnicodeEncodeError _Py_EncodeLocaleEx PyBytes_FromString lstat64 fstatat64 PyUnicode_Compare wmemcmp PyErr_SetFromErrnoWithFilenameObject PyInit_faulthandler sigemptyset sigaction PyTuple_GetSlice PyThreadState_GetInterpreter sigaltstack PySys_WriteStderr _PyLong_FromUid PyLong_FromUnsignedLongLong PyLong_FromLongLong _Py_UnhandledKeyboardInterrupt _PyLong_FromGid _PyLong_FromTime_t PyNumber_Multiply PyNumber_And frexp modf _PyLong_Sign readdir64 closedir rewinddir fdopendir _PyUnicode_XStrip PyUnicode_AsEncodedString _PyBytesWriter_Init _PyBytesWriter_Alloc _PyBytesWriter_Resize _PySet_NextEntry PyNumber_Long PyLong_FromDouble ldexp PyFile_OpenCodeObject _PyObject_CallMethod PyNumber_Check _Py_set_inheritable lseek64 _Py_read _PyUnicode_IsAlpha _PyUnicode_IsDecimalDigit _PyErr_ChainExceptions _PyUnicode_ToDecimalDigit PyMemoryView_FromObject _PyManagedBuffer_Type _PyArg_UnpackKeywords PyUnicode_FSDecoder _Py_SourceAsString PyBuffer_IsContiguous PyInit__codecs PyMapping_Keys _PyErr_ExceptionMatches _PyErr_Clear PyCodec_LookupError PyCodec_Register PyList_GetItem _PyUnicode_IsDigit _PyUnicode_ToDigit _PyUnicode_IsNumeric PyOS_setsig PyInit__signal __libc_current_sigrtmin __libc_current_sigrtmax PyOS_getsig PyInit__abc PySequence_List PyDictProxy_New PyDictProxy_Type _PyUnicode_AsASCIIString PyMapping_Items PyLong_FromSize_t _PyObject_IsAbstract PyType_GetModuleState PyType_GetModule _PyType_GetDocFromInternalDoc PySet_Clear PySet_Size PyImport_GetModule PyModule_GetFilenameObject _PyErr_SetString PyErr_SetImportError PyErr_SetImportErrorSubclass PyExc_EncodingWarning _PyCodec_LookupTextEncoding _PyCodecInfo_GetIncrementalDecoder PySys_SetObject _PyCodecInfo_GetIncrementalEncoder _Py_ClearStandardStreamEncoding PyNumber_Or PyInit__stat Py_GenericAlias Py_GenericAliasType PyVectorcall_Function Py_RunMain getpid ungetc PyByteArrayIter_Type PyDictKeys_Type PyDictIterKey_Type PyDictValues_Type PyDictIterValue_Type PyListRevIter_Type PyRangeIter_Type PyLongRangeIter_Type PyNumber_FloorDivide PyExc_ZeroDivisionError _PyMethodWrapper_Type PyWrapper_New _PyNone_Type PyUnicode_IsIdentifier _PyUnicode_ScanIdentifier _PyUnicode_IsXidStart _PyUnicode_IsXidContinue PyObject_Dir PyInit__operator _PyWeakref_ClearRef PyDict_Size PyException_SetCause geteuid PyUnicode_FromEncodedObject getuid PyUnicode_Decode getegid PyNumber_Remainder getgid PyUnicode_Format _PyLong_FormatWriter _PyArg_UnpackStack _Py_GetLocaleEncodingObject PyFrame_GetCode PyInit_itertools PyInit__collections PyODict_Type PyInit__functools PyByteArray_Resize PyBuffer_ToContiguous PyMemoryView_FromBuffer _Py_BuildValue_SizeT _PyThreadState_DeleteExcept PyEval_GetLocals PyEval_MergeCompilerFlags PyGC_Collect _PyDict_MaybeUntrack openat64 rename renameat _PyModule_Clear _PyModule_ClearDict PyExc_Warning PyThreadState_Clear munmap PyThread_tss_delete pthread_key_delete PyInterpreterState_Delete _PyRuntimeState_Fini PyUnicode_GetLength dlopen dlsym dlerror PyImport_GetModuleDict PyUnicode_CopyCharacters mkdir mkdirat PyGILState_GetThisThreadState _Py_hashtable_get _Py_hashtable_steal PyCode_Addr2Line _PyCode_CheckLineNumber PyDict_MergeFromSeq2 PyGILState_Ensure PyGILState_Release PyImport_GetImporter PyMapping_Size _Py_convert_optional_to_ssize_t _PyObject_RealIsSubclass PyEval_ReleaseThread PyThread_start_new_thread pthread_attr_init pthread_attr_setscope pthread_create pthread_attr_destroy pthread_detach pthread_attr_setstacksize PyFile_OpenCode PyEval_GetFrame PyInit__sre _Py_NewInterpreter PyInterpreterState_GetID PyLong_AsVoidPtr PyModule_AddStringConstant _PyThreadState_DeleteCurrent _Py_wrealpath PyCapsule_Import Py_GetArgcArgv PyNumber_InPlaceAnd _Py_fopen_obj Py_MakePendingCalls PyExc_SystemExit Py_ReprEnter PyErr_PrintEx _PyRun_AnyFileObject _Py_FdIsInteractive _PyThreadState_GetDict PyInit_atexit _PyUnicodeWriter_Init _PyRun_SimpleFileObject ftell rewind _Py_HandleSystemExit _PyUnicodeWriter_WriteChar Py_Exit PyUnicode_FromOrdinal PyUnicode_Tailmatch Py_ReprLeave PyImport_GetMagicNumber PyCapsule_IsValid _PySlice_GetLongIndices Py_EndInterpreter _PyBytesWriter_Dealloc _PyErr_Display _Py_GetConfigsAsDict _Py_UniversalNewlineFgetsWithSize flockfile funlockfile __uflow PyException_GetCause _Py_WriteIndentedMargin _Py_WriteIndent PyType_GetQualName PyType_GetModuleByDef _PyObject_RealIsInstance uname PyBytes_AsStringAndSize PyBytes_Repr _PyUnicode_FromId PyFloat_Unpack8 _PyPathConfig_ClearGlobal PyNumber_Xor _Py_ClearArgcArgv _PyRuntime_Finalize _Py_dg_infinity PyNumber_InPlaceXor _Py_dg_stdnan PyIter_Send _PyGen_FetchStopIterationValue PyNumber_Absolute PyNumber_Divmod PyType_GetSlot PySequence_Concat PyLong_AsDouble PyErr_WriteUnraisable _PyErr_WriteUnraisableMsg round PySequence_Check PyFloat_AsDouble PySeqIter_New PySeqIter_Type PySequence_Size PyTraceBack_Print _PyTraceBack_Print_Indented PyFloat_FromString _PyUnicode_TransformDecimalAndSpaceToASCII fdopen _Py_string_to_number_with_underscores PyOS_string_to_double _Py_dg_strtod _Py_parse_inf_or_nan PyLong_FromUnicodeObject PyLong_FromString log PyByteArray_FromStringAndSize _PyLong_FromBytes _PyLong_Format localeconv _PyUnicode_InsertThousandsGrouping _Py_ctype_toupper PyNumber_Positive PyNumber_Power PyCFunction_GetFunction _PyAccu_Init _PyAccu_Accumulate PyDict_Items _PyAccu_FinishAsList PyOS_mystrnicmp _PyDict_SetItem_KnownHash PyObject_CallObject _Py_HashDouble PyInit__ast PyFile_GetLine PyFloat_Pack8 _PyBytes_Join PyInit__locale PyInit_errno PyLong_AsUnsignedLongLongMask PyBytes_Concat PyBytes_FromObject PyNumber_Rshift PyNumber_InPlaceLshift _PyBytes_Repeat _PySet_Update _PyDict_Contains_KnownHash PyErr_NewExceptionWithDoc PyClassMethod_New _PyUnicode_ToLowercase _PyUnicode_ToUppercase _PyUnicode_AsUTF8String _PyUnicode_IsLowercase _PyUnicode_IsTitlecase _PyUnicode_IsUppercase PyNumber_TrueDivide fmod _PyOS_URandomNonblock _PyTime_GetMonotonicClockWithInfo clock_getres _PyTime_GetPerfCounterWithInfo PyIter_Check PyState_FindModule PyUnicode_EncodeLocale PyOS_double_to_string _Py_dg_dtoa _Py_dg_freedtoa Py_NewRef wcsftime _Py_hashtable_clear PySequence_GetSlice _PySlice_FromIndices _PyObject_DebugMallocStats fputc PyCallIter_Type PyCallIter_New PyUnicode_Splitlines PyInit__string _PyTime_GetSystemClockWithInfo PyBytes_ConcatAndDel _PyErr_GetTopmostException PyUnicodeDecodeError_Create PyCodec_StrictErrors PyList_Reverse PyExc_UserWarning PyThreadState_GetFrame PyFrame_GetBack PyFrame_GetLineNumber PyInit_pwd PyUnicode_Replace _PyLong_Copy PyODict_SetItem system PyODictValues_Type PyODictIter_Type unlink unlinkat _PyAccu_Destroy PyUnicode_AsUCS4 PyInit_gc fchdir _PyThreadState_Prealloc _PyThreadState_SetCurrent PyEval_AcquireThread fork PyOS_BeforeFork PyList_GetSlice PyThreadState_EnterTracing PyThreadState_LeaveTracing _Py_IsFinalizing PyOS_AfterFork_Parent waitpid _PyArg_ParseStack_SizeT getloadavg PyLong_AsUnsignedLongMask _PyTime_FromSecondsObject PyLong_AsLongLong _PyUnicode_FormatLong PyNumber_ToBase _PyUnicode_FastFill ceil _PyMem_Strdup sigfillset pthread_sigmask _PyObject_CallMethod_SizeT PyComplex_FromCComplex _PyErr_Format _PyEval_GetBuiltin _PyArg_Parse_SizeT PyObject_CallNoArgs PyLong_AsUnsignedLongLong PyFloat_Pack4 PyFloat_Unpack4 _PyCodec_EncodeText _PyUnicode_EncodeUTF16 PyUnicode_DecodeUTF16 PyUnicode_DecodeUTF16Stateful _PyUnicode_EncodeUTF32 PyCode_NewWithPosOnlyArgs PyUnicode_DecodeUTF32 PyUnicode_DecodeUTF32Stateful PyErr_WarnEx PyErr_BadArgument _PyCrossInterpreterData_RegisterClass PyNumber_InPlaceMultiply _PyImport_SetModule PyContextVar_New PyContextVar_Type _PyObject_FunctionStr Py_GetProgramName _PyArg_NoKeywords fchmod fchmodat _PyEval_SliceIndexNotNone _PyLong_Frexp PyUnicode_Split PyUnicode_DecodeRawUnicodeEscape _PyUnicode_DecodeRawUnicodeEscapeStateful _PySys_GetSizeOf PyWeakref_NewProxy PyExc_ReferenceError _PyErr_NoMemory PyUnicode_AsWideChar PyInterpreterState_ThreadHead PyThreadState_Next _Py_strhex_bytes_with_sep PyByteArray_Concat pipe2 pipe _PySequence_BytesToCharpArray _Py_RestoreSignals _Py_FreeCharPArray _PyErr_StackItemToExcInfoTuple _PyLong_FileDescriptor_Converter PyObject_AsFileDescriptor _PyLong_UnsignedShort_Converter _PyUnicode_ToTitleFull _PyUnicode_ToLowerFull _Py_strhex_with_sep PyComplex_AsCComplex PyComplex_RealAsDouble PyComplex_ImagAsDouble PyNumber_Float _PyUnicode_AsLatin1String _PyObject_GetState _PyBytes_FromHex PyUnicode_DecodeLatin1 _PyArg_BadArgument PyUnicode_GetDefaultEncoding PyNumber_InPlaceRemainder _PyBytes_FormatEx _PyLong_FormatBytesWriter PyCodec_Encode PySequence_SetItem PyUnicode_BuildEncodingMap _PyUnicode_EncodeCharmap _PyObject_LookupAttrId _PyDict_GetItemIdWithError _PyDict_ContainsId PyBytes_FromFormat PyBytes_FromFormatV _PyBytesWriter_WriteBytes faccessat access _PyArg_NoPositional _PyEval_SetTrace _PyDeadline_Init _PyCodec_DecodeText _Py_c_abs hypot _Py_c_quot _Py_c_neg _Py_c_diff PyContextVar_Get PyContextVar_Set PyContext_Type PyComplex_FromDoubles PyNumber_InPlaceFloorDivide _PyLong_GCD PyCodec_BackslashReplaceErrors PyExc_UnicodeTranslateError PyUnicodeEncodeError_GetObject PyUnicodeDecodeError_GetStart PyUnicodeDecodeError_GetEnd PyUnicodeDecodeError_GetObject PyUnicodeEncodeError_SetStart PyUnicodeDecodeError_SetStart PyUnicodeEncodeError_SetEnd PyUnicodeDecodeError_SetEnd PyUnicodeEncodeError_SetReason PyUnicodeDecodeError_SetReason PyUnicodeEncodeError_GetStart PyUnicodeEncodeError_GetEnd PyImport_ImportModuleNoBlock PyUnicode_DecodeCharmap PyUnicode_AsRawUnicodeEscapeString PyUnicode_AsUnicodeEscapeString _PyUnicode_DecodeUnicodeEscapeStateful _PyUnicode_EncodeUTF7 PyUnicode_DecodeUTF7Stateful PyCodec_IncrementalEncoder PyCodec_IncrementalDecoder PyBytes_Size PyCodec_ReplaceErrors PyCodec_IgnoreErrors PyCodec_Unregister PyCodec_Decode _PyErr_TrySetFromCause PyErr_WarnFormat PyUnicodeEncodeError_GetEncoding PyUnicodeDecodeError_GetEncoding _PyUnicode_IsLinebreak _PyAccu_Finish PyCodec_NameReplaceErrors PyCodec_XMLCharRefReplaceErrors _PyGen_SetStopIterationValue PyODictKeys_Type PyODictItems_Type _Py_c_pow atan2 sincos _PyUnicode_IsWhitespace _PyUnicode_FastCopyCharacters _PyUnicodeWriter_Dealloc PyNumber_InPlaceTrueDivide _PyType_GetTextSignatureFromInternalDoc tzset _PyTime_ObjectToTime_t _PyTime_gmtime gmtime_r mktime _PyLong_AsTime_t PyUnicode_Fill clock_nanosleep _PyTime_AsTimespec _PyTime_ObjectToTimeval _PyObject_CallMethodId _PyObject_GetAttrId _PyLong_DivmodNear _PyTime_GetSystemClock _PyTime_AsTimevalTime_t _PyObject_CallMethodIdObjArgs _PyUnicode_Copy PyUnicode_WriteChar PyUnicode_AsUnicodeAndSize PyUnicode_FromUnicode _PyUnicode_Ready _PyImport_GetModuleAttrString _PyImport_GetModuleAttr _Py_GetLocaleconvNumeric _PyObject_LookupSpecialId PyNumber_InPlaceRshift _PyTime_FromMillisecondsObject _PyTime_AsMilliseconds Py_GetPath Py_GetPrefix Py_GetExecPrefix Py_GetProgramFullPath Py_GetPythonHome sendfile64 utimensat futimens flistxattr llistxattr fgetxattr lgetxattr fsetxattr lsetxattr _Py_dup rmdir dup3 _PyArg_NoKwnames PyFloat_Pack2 PyFloat_Unpack2 PyErr_WarnExplicitObject strcspn _PyErr_FormatFromCause _PyEval_GetSwitchInterval _PyEval_SetSwitchInterval PyObject_GenericSetDict _PyObject_GetDictPtr PyDict_Merge _Py_CheckRecursiveCall _PyEval_SignalReceived PyErr_ProgramTextObject _PyErr_ProgramDecodedTextObject _Py_strhex _PyLong_UnsignedLong_Converter _PyLong_UnsignedLongLong_Converter PyErr_FormatV getrusage times _PyTime_FromTimespec _PyImport_GetModuleId Py_SetRecursionLimit _PyLong_Lshift PyLong_AsLongLongAndOverflow _PyLong_Rshift _PySequence_IterSearch PySequence_Count PySequence_InPlaceConcat PySequence_Index PyNumber_InPlaceMatrixMultiply PyNumber_InPlacePower PyNumber_MatrixMultiply PyObject_Not PyODict_DelItem _PyDict_SizeOf PyFrame_LocalsToFast PyPickleBuffer_GetBuffer PyPickleBuffer_Type fstatvfs64 PyMemoryView_FromMemory _PyOS_URandom __ctype_toupper_loc _PyUnicode_ToUpperFull PyUnicode_ReadChar _PyTime_FromNanosecondsObject _PyTime_AsNanosecondsObject _PyTime_AsTimeval _PyTime_AsTimeval_clamp _PyTime_ObjectToTimespec clock_settime pthread_getcpuclockid _PyUnicode_IsCaseIgnorable _PyUnicode_IsCased _PyUnicode_ToFoldedFull _PyTraceback_Add PyCode_NewEmpty PyFrame_New _PyObject_SetAttrId _Py_add_one_to_index_F _Py_add_one_to_index_C wcstol __sysconf getrlimit64 setrlimit64 abort PyBuffer_GetPointer PyBuffer_FillContiguousStrides PyAIter_Check PyByteArray_Size PyByteArray_AsString _PyBytes_Find _PyBytes_ReverseFind PyCode_Addr2Location _Py_c_sum _Py_c_prod PyExceptionClass_Name PyUnicodeTranslateError_SetStart PyUnicodeTranslateError_SetEnd Py_UniversalNewlineFgets PyFloat_GetMax PyFloat_GetMin _PyFrame_IsEntryFrame PyFrame_GetGlobals PyFrame_GetBuiltins PyFrame_GetLasti PyFrame_GetGenerator PyODict_New PyInit_xxsubtype PyInit__symtable PyInit__tokenize _Py_IncRef _Py_DecRef _Py_BreakPoint _PyObject_IsFreed PyObject_GET_WEAKREFS_LISTPTR Py_XNewRef Py_Is Py_IsNone Py_IsTrue Py_IsFalse _PyMem_GetCurrentAllocatorName PyMem_SetupDebugHooks PyObject_GetArenaAllocator PyObject_SetArenaAllocator _Py_GetAllocatedBlocks PyStructSequence_SetItem PyStructSequence_GetItem PyType_ClearCache PyType_GetFlags PyType_SUPPORTS_WEAKREFS _PyUnicode_ToNumeric _PyUnicode_ToTitlecase _PyWeakref_GetWeakrefCount PyEval_ThreadsInitialized PyEval_InitThreads _PyEval_SignalAsyncExc PyEval_GetFuncDesc _PyEval_RequestCodeExtraIndex Py_LeaveRecursiveCall PyCompile_OpcodeStackEffectWithJump PyCompile_OpcodeStackEffect PyCode_Optimize PyObject_CheckReadBuffer _PyErr_GetExcInfo _PyErr_GetHandledException _PyErr_SetHandledException PyErr_SetExcInfo _Py_hashtable_size _Py_hashtable_foreach _Py_hashtable_new PyImport_GetMagicTag PyStatus_Ok PyStatus_Error PyStatus_NoMemory PyStatus_Exit PyStatus_IsError PyStatus_IsExit _PyDebugAllocatorStats _PyTuple_DebugMallocStats _PyDict_DebugMallocStats _PyList_DebugMallocStats _PyFloat_DebugMallocStats _PyObject_DebugTypeStats _Py_IsCoreInitialized Py_AtExit _PyInterpreterState_RequiresIDRef _PyInterpreterState_RequireIDRef PyThreadState_GetID PyInterpreterState_Head PyInterpreterState_Main PyInterpreterState_Next _PyGILState_GetInterpreterStateUnsafe _PyCrossInterpreterData_NewObject _PyInterpreterState_GetEvalFrameFunc _PyInterpreterState_SetEvalFrameFunc _PyTime_MulDiv _PyTime_AsNanoseconds _PyDeadline_Get PyThread_exit_thread pthread_exit _PyThread_at_fork_reinit PyThreadState_SetAsyncExc _PyEval_AddPendingCall Py_AddPendingCall PyThread_create_key PyThread_delete_key PyThread_delete_key_value PyThread_set_key_value PyThread_get_key_value PyThread_ReInitTLS PyThread_get_stacksize PyThread_set_stacksize PyThread_tss_alloc PyThread_tss_free PyOS_mystricmp Py_EncodeLocale _Py_EncodeLocaleRaw _Py_write_noraise _Py_DumpDecimal _Py_DumpHexadecimal _Py_DumpASCII _Py_DumpTraceback _Py_DumpTracebackThreads _Py_closerange close_range PyGC_Enable PyGC_Disable PyGC_IsEnabled PyObject_GC_IsTracked PyObject_GC_IsFinalized _PyOS_InterruptOccurred _PyOS_ReadlineTState PyOS_InputHook clearerr fgets feof PyOS_Readline PyOS_ReadlineFunctionPointer Py_FatalError _Py_FatalErrorFunc Py_PreInitializeFromBytesArgs _PyThreadState_Init PyEval_ReleaseLock _Py_FatalError_TstateNULL PyEval_AcquireLock _Py_SetProgramFullPath _Py_FatalErrorFormat vfprintf _Py_FatalRefcountErrorFunc PyThreadState_Delete _PyObject_Dump _PyObject_AssertFailed _PyUnicode_CheckConsistency _PyDict_CheckConsistency PyEval_EvalFrameEx PyEval_EvalFrame _PyUnicodeTranslateError_Create PyEval_CallFunction PyArg_Parse _PyArg_ParseStack PyType_GetName PyUnicodeTranslateError_SetReason _PyInterpreterState_IDInitref _PyInterpreterState_IDIncref PyArg_VaParse PyCapsule_GetName PyCapsule_GetDestructor PyCapsule_GetContext PyCapsule_SetName PyCapsule_SetDestructor PyCapsule_SetContext PyCapsule_SetPointer _PyTime_FromTimeval PyErr_ResourceWarning _PyInterpreterState_LookUpID _PyCrossInterpreterData_Release PyContext_Exit PyPickleBuffer_Release PyUnicodeTranslateError_GetObject PyUnicodeTranslateError_GetStart PyUnicodeTranslateError_GetEnd PyUnicodeEncodeError_GetReason PyUnicodeDecodeError_GetReason PyUnicodeTranslateError_GetReason PyPickleBuffer_FromObject PyObject_GetAIter PyEval_GetFuncName _Py_UTF8_Edit_Cost PyObject_HasAttr _PyErr_FormatFromCauseTstate _PyErr_BadInternalCall PyTuple_SetItem PySet_Pop PyCFunction_GetSelf PyCFunction_GetFlags PySlice_GetIndices _PyLong_UnsignedInt_Converter _PyLong_Size_t_Converter PyFunction_GetCode PyFunction_GetGlobals PyFunction_GetModule PyFunction_GetDefaults PyFunction_SetDefaults PyFunction_GetKwDefaults PyFunction_SetKwDefaults PyFunction_GetClosure PyFunction_SetClosure PyFunction_SetAnnotations _PyCode_GetExtra _PyCode_SetExtra PyInstanceMethod_Type PyMethod_Function PyMethod_Self PyInstanceMethod_Function PyCell_Get PyContext_Enter Py_EnterRecursiveCall PyErr_SetInterruptEx PyErr_SetInterrupt _PyType_CheckConsistency _PyObject_CheckConsistency PyDict_GetItemString PySys_HasWarnOptions PyModule_GetFilename PyState_RemoveModule _PyEval_SetProfile _PyCrossInterpreterData_Lookup _PyObject_GetCrossInterpreterData _PyObject_CheckCrossInterpreterData PyObject_AsWriteBuffer PyObject_AsReadBuffer PyObject_AsCharBuffer _Py_Uid_Converter _Py_Gid_Converter _PyInterpreterID_Type _PyInterpreterID_LookUp PySequence_Length PyObject_DelItemString PyMapping_Length PyObject_Length PySlice_GetIndicesEx _PyErr_SetNone PyUnicode_Find PyUnicode_Count _Py_device_encoding PyUnicode_AsUCS4Copy PyUnicode_DecodeLocaleAndSize dcgettext bind_textdomain_codeset _PyUnicode_AsUnicode _PyUnicode_WideCharString_Opt_Converter _PyUnicode_WideCharString_Converter PyUnicode_GetSize _PyUnicodeWriter_PrepareKindInternal _PyUnicodeWriter_WriteLatin1String _PyType_LookupId PyUnicode_Resize PyObject_InitVar PyObject_Init _PyDict_SetItemId alarm getppid PySequence_Repeat PySequence_InPlaceRepeat PyCode_GetCode PyMarshal_WriteLongToFile PyBuffer_FromContiguous PyObject_CopyData PyCode_GetVarnames PyCode_GetCellvars PyCode_GetFreevars _PyDict_DelItemIf _PyDict_DelItemId strsignal strstr Py_VaBuildValue PyGen_NewWithQualName PyGen_New PyCoro_New PyAsyncGen_New PyVectorcall_Call PyCFunction_Call _PyContext_NewHamtForTests PyContext_Copy PyContext_CopyCurrent PyContextVar_Reset PyContext_New PySequence_SetSlice PySequence_DelSlice PyCFunction_NewEx PyCFunction_New PyMemoryView_GetContiguous PySys_SetArgvEx PySys_SetArgv PySys_AddWarnOptionUnicode PyUnicode_RSplit PyDict_Values getgrouplist PySys_SetPath PySequence_In _PyArg_ParseTupleAndKeywordsFast _PyArg_ParseTupleAndKeywordsFast_SizeT _PyArg_VaParseTupleAndKeywordsFast _PyArg_VaParseTupleAndKeywordsFast_SizeT _PyArg_ParseStackAndKeywords _PyArg_ParseStackAndKeywords_SizeT sigismember PyEval_EvalCodeEx _PyCoroWrapper_Type _PyAsyncGenASend_Type PyInstanceMethod_New _PyDict_NewPresized PySys_GetXOptions PyInterpreterState_GetDict PyFunction_GetAnnotations PyFrame_FastToLocalsWithError PyFrame_GetLocals PyFrame_FastToLocals PyEval_CallObjectWithKeywords PyCodec_Decoder PyCodec_Encoder PyCodec_KnownEncoding PyCodec_StreamWriter PyCodec_StreamReader _PyAsyncGenAThrow_Type PyByteArray_FromObject setpwent getpwent endpwent getpwuid_r PyUnicode_AsDecodedObject PyUnicode_AsDecodedUnicode PyUnicode_AsEncodedObject PyUnicode_AsEncodedUnicode PyObject_HasAttrString PyUnicode_DecodeUnicodeEscape PyBuffer_SizeFromFormat PySys_WriteStdout PySys_FormatStdout PyMapping_Values _PyDictView_Intersect PyMapping_HasKeyString _PyInterpreterState_GetMainModule PyMapping_HasKey PyImport_ExecCodeModuleObject PyImport_ExecCodeModuleWithPathnames PyImport_ExecCodeModuleEx PyImport_ExecCodeModule _PyEval_GetBuiltinId PyUnicode_AsUTF32String PyUnicode_AsUTF16String _Py_DumpExtensionModules PyImport_ReloadModule PyArg_VaParseTupleAndKeywords _PyArg_VaParseTupleAndKeywords_SizeT _PyUnicode_EqualToASCIIId wcscoll _Py_strhex_bytes ftruncate64 PyInit__tracemalloc getitimer setitimer fdatasync fsync wait4 wait3 sched_setscheduler sched_setparam sched_getparam waitid setgroups _Py_Sigset_Converter sigaddset sigtimedwait sigwaitinfo _Py_get_inheritable _Py_set_inheritable_async_safe _Py_open_noraise _Py_fstat _Py_get_blocking _Py_set_blocking wcsxfrm sigpending sigwait getgroups getresgid getresuid ttyname_r ctermid nice getpriority setpriority umask sched_get_priority_max sched_get_priority_min sched_getscheduler sched_rr_get_interval sched_yield __sched_cpualloc __sched_cpufree sched_setaffinity sched_getaffinity __sched_cpucount openpty login_tty getlogin setuid seteuid setreuid setgid setegid setregid getpgid getsid setsid setpgid tcgetpgrp tcsetpgrp fpathconf setresuid setresgid eventfd eventfd_read eventfd_write PyErr_SetFromErrnoWithFilename readlinkat pause copy_file_range splice readv pread64 preadv64v2 writev pwrite64 pwritev64v2 posix_fallocate64 posix_fadvise64 _PyErr_CheckSignals PyUnicode_AsCharmapString bindtextdomain memfd_create chroot mknodat mknod mkfifoat mkfifo initgroups getpwnam_r _Py_stat PyUnicode_DecodeUTF7 PyUnicode_Translate _PyArg_VaParse_SizeT PyObject_Print ferror _PyObject_CallMethodId_SizeT PyMarshal_ReadLongFromFile PyMarshal_ReadShortFromFile PyFile_FromFd PyEval_CallMethod _Py_DisplaySourceLine PyUnicode_InternImmortal PyErr_WarnExplicit PyErr_WarnExplicitFormat _PyThread_CurrentExceptions _PyThread_CurrentFrames _PyInterpreterState_IDDecref _PyInterpreterID_New _PyInterpreterState_GetIDObject PyInterpreterState_Clear _PyErr_Print posix_spawn_file_actions_init posix_spawn_file_actions_addopen posix_spawn_file_actions_addclose posix_spawn_file_actions_adddup2 posix_spawn_file_actions_destroy posix_spawnattr_init posix_spawnattr_setpgroup posix_spawnattr_setsigmask posix_spawnattr_setsigdefault posix_spawnattr_setschedpolicy posix_spawnattr_setschedparam posix_spawnattr_setflags posix_spawnattr_destroy posix_spawnp posix_spawn _Py_open PyErr_ProgramText PyErr_SyntaxLocationEx PyErr_SyntaxLocation PyErr_RangedSyntaxLocationObject PyErr_SyntaxLocationObject PyRun_SimpleString PyRun_String Py_CompileString Py_CompileStringFlags PyMarshal_ReadObjectFromFile PyMarshal_ReadLastObjectFromFile PyMarshal_WriteObjectToFile PyRun_InteractiveOneObject PyRun_InteractiveOneFlags PyRun_InteractiveOne _PyRun_InteractiveLoopObject PyRun_InteractiveLoopFlags PyRun_InteractiveLoop PyRun_SimpleFileExFlags PyRun_SimpleFile PyRun_SimpleFileEx PyRun_AnyFileExFlags PyRun_AnyFile PyRun_AnyFileEx PyRun_AnyFileFlags PyRun_FileExFlags PyRun_File PyRun_FileEx PyRun_FileFlags pthread_kill fchown lchown fchownat fremovexattr lremovexattr symlinkat symlink execv fexecve killpg lockf64 Py_ExitStatusException PyOS_AfterFork_Child PyOS_AfterFork forkpty _PyOS_IsMainThread PyTraceMalloc_Track PyTraceMalloc_Untrack _PyTraceMalloc_GetTraceback _Py_Get_Getpath_CodeObject Py_Version PyStructSequence_UnnamedField PyEllipsis_Type _PySet_Dummy _PyNotImplemented_Type PyExc_ModuleNotFoundError PyExc_ConnectionError PyExc_ArithmeticError PyExc_FloatingPointError PyExc_FutureWarning PyExc_UnicodeWarning _PyParser_TokenNames __environ libm.so.6 libc.so.6 libpython3.11.so.1.0 GLIBC_2.29 GLIBC_2.2.5 GLIBC_2.14 GLIBC_2.6 GLIBC_2.28 GLIBC_2.3.4 GLIBC_2.25 GLIBC_2.15 GLIBC_2.26 GLIBC_2.27 GLIBC_2.4 GLIBC_2.7 GLIBC_2.33 GLIBC_2.3 GLIBC_2.5 GLIBC_2.17 GLIBC_2.32 GLIBC_2.16 GLIBC_2.34 GLIBC_2.3.2 GLIBC_2.9 /opt/alt/python311/lib64:/opt/alt/sqlite/usr/lib64 M 0 v ui W ii ti ď Ϗ ڏ ii ii ii ii # . 9 ri D ii P ui P: " X: " `: `: : ,, : q# : J, : P$ : +, : p&% : r, : % : , 8: @% @: tA, X: % `: e, x: % : v, : & : , : & : , : P( : , : p & : , : p & : , 8: `% @: , X: P% `: ȝ, x: p% : , : @' : , : ?' : P, : % : ̚, : v1 : ֚, 8: v1 @: , X: v1 `: , x: v1 : , : 1 : , : 1 : , : 1 : !, : 1 : 9, : 1 : M, 8: 1 @: ], X: 1 : ,, : l, : J, : , : , : , : ֚, : ̚, : , : ̚, : , : ̚, : , : , : !, : , : ], : _, 0: g, @: o, P: w, `: , p: , : , : ], : e, : m, : u, : }, : , : , : , : , : , 0: , @: , P: , `: Ǟ, p: Ϟ, : מ, : ߞ, : , : , : , : , : , : , : , : , : Ş, 0: ͞, @: ՞, P: ݞ, `: , p: , : , : , : , : F, : <, : R, : , : , : !, : ), : 4, 0: 8, @: B, P: N, `: X, p: c, : k, : r, : , : U, : U, : q4, : Ǥ, : Ĥ, : q4, : Ǥ, : Ĥ, : q4, (: &, @: q4, H: Ǥ, P: Ĥ, `: /, h: q4, p: O, : /, : q4, : O, : q4, : Ǥ, : Ĥ, : q4, : Ǥ, : Ĥ, : q4, : Ǥ, : Ĥ, : , : )C, : Z, : Ò, : ^, (: 4, @: D, P: P, `: ^, p: h, : u, : , : , : , : , : o : ` : D : Y : : : : : (: 0: x 8: @: H: P: p X: p `: 0 h: P p: x: : : s : : : : : : | : : : : : : W : : O : } : : u : : N (: 0: } @: bf H: CB( P: r X: D( `: J( h: g p: >( x: A( : Qn : pf : f : a : 0g : GA( : wB( : wB( : >@( : h@( : 1C( : ] : q : }f : {f : )E( : @( : yf : D( : Y : s (: r 0: &b 8: m @: d H: \d P: f X: m `: d h: p p: b x: B( : B( : ` : pf : w : :L( : : : : : T( : R( : 2 : f : f : : : N( : R( : R( : M( (: K( 0: xN( 8: { @: z H: o P: q X: R( `: L( h: s p: eT( x: : : y : : " : : r : P : S : : 0 : : : e : : u : X3, : I, : X3, (: i^, @: ?, H: D, `: >, h: , : X3, : i^, : X3, : i^, : X3, : n, : , : , : , : M, : ^, : , : , (: , @: #, H: -l, P: , X: , `: , h: 7, : -l, : , : , : , : 7, : , : p' : h, : + : , : Pv( : k, : + : l, : P* : l, : + : m, (: 0: m, 8: `+ @: m, H: 0+ `: , h: , : , : , : , : , : K, : 1, : , : , : 9B, : , : 1, (: , 0: ħ, 8: -l, @: , H: , P: , X: 9B, : , : -l, : , : , : -l, : , : 6n, : 6n, : 6n, : , : ҫ, : , : ^, 0: , @: , H: )C, `: 0, h: )C, : A, : )C, : , : , : , : 6n, : , : t, : 6n, : , : t, : ^, : )C, : 6n, @: , H: t, P: 6n, `: , p: , x: 0, : , : ҫ, : ҫ, : ҫ, : ҫ, : ҫ, : ҫ, : ҫ, : , : , 0: , @: , H: , `: , h: , p: , x: IJ, : , : , : IJ, : , : , : , : W?, : O, : , (: , 0: , @: , P: , `: , h: )C, p: , x: IJ, : , : )C, : , : ., : ., : , : , : , : *\, (: 1\, 0: @\, @: , H: ʏ, P: ., `: ҫ, : , : /, : X, : IJ, : 6n, : , : IJ, : , : IJ, : P, : ݲ, : , : , : IJ, 0: , 8: IJ, `: ݲ, h: , p: , x: ˲, : ݲ, : , : , : ˲, : ݲ, : , : O, : ֲ, : , : )C, : ݲ, (: , 0: O, 8: ֲ, @: , P: , X: IJ, : h], : h], : h], : , : , : , : , : , : , : , : h], : h], : h], : , : , : , : , : , : , (: , @: !, H: ', P: %, `: !, h: ', : , : , : IJ, : , : IJ, : , : ݲ, : , : , : ˲, : 6n, : , : , (: ˫, 0: , @: , H: ˫, P: , `: , h: ˫, p: , x: IJ, : 6n, : , : , : , : , : IJ, : 6n, : , : , : , : IJ, : +, : 6n, @: , H: IJ, P: 6n, `: 9, p: F, x: p% : U, : a, : m, : % : {, : , : % : , : , : % : , : , : `% : ͳ, : ۳, 0: , 8: % @: , P: , `: , h: % p: , : ,, : 7, : D, : V, : @% : c, : P% : q, : `% : ~, : p% : , : % : , : % : , : % : , (: % 0: Ŵ, 8: % P: ^k, `: ^k, : 8. : F, : K, : O, : S, : , : G], : K], : m, : @. : . : . : . @: , H: , P: , X: , p: j, : t, : HW, : D*, : q, : , : /, : , : , : , : , : , : , : , : , : , : , : , : , : u, (: e, 0: , 8: *, @: 7, H: D, P: K, X: P, `: X, h: `, p: n, x: x, : }, : , : ,, : J, : Y, : , : , : , : U, : sA, : , : Y, : , : , : , : , : , : , : , : , : , (: , 0: , 8: ", @: , H: !, P: 2, X: :, `: E, h: K, p: R, x: Z, : c, : i, : q, : w, : [, : v, : , : , : ?, : , : ǝ, : , : >, : , : , : Q, : , : , : , : 4, : m, (: , 0: , 8: #0, @: , H: , P: , X: , `: r, h: , p: , x: , : Wq, : 0, : , : , : , : , : , : #, : *, : ., : , : 8, : , : 7, : @, : I, : M, : S, : Y, : _, : Z, (: , 0: c, 8: v, @: j, H: s, P: ~, X: , `: , h: 8, p: %, x: , : E, : L, : Q, : Y, : , : o, : y, : ~, : , : , : , : , : , : ?, : , : , : , : +, : , : , : , (: , 0: , 8: , @: Z, H: /S, P: , X: , `: , h: f, p: (, x: -, : , : 6, : , : , : ;, : @, : E, : J, : R, : Z, : V, : /, : :/, : tA, : a, : , : , : H, : k, : s, : , (: }, 0: , 8: , @: , H: ', P: Z, X: , `: , h: , p: , x: , : , : , : , : , : G, : , : , : , : ", : <v, : , : , : , : , : , : #, : , : , : , : , : , (: (, 0: , 8: , @: /, H: , P: 6, X: , `: , h: =, p: H, x: O, : U, : `, : L, : h, : S, : &, : , : o, : h, : O, : P, : w, : }, : , : , : , : , : , : L, : , : , (: , 0: , 8: , @: , H: , P: , X: , `: , h: , p: , x: ȝ, : , : q4, : , : , : , : , : ;*, : o, : , : , : , : , : , : (, : 1, : 9, : B, : G, : ?, : Q, : , (: ", 0: 5, 8: X, @: , H: |, P: -, X: , `: `, h: g, p: , x: , : $, : r, : {, : , : , : , : , : , : R, : , : , : , : , : , : , : , : , : , : +, : , : , @: ], H: -, P: ], X: -, `: , h: (, : , : ʏ, : , : , : , : , : , : +, : U, : |, : V, : I, : j, : h], : , : (: 6 0: 1 8: W @: j H: G P: f X: `: < h: M p: Z x: { : `~ : U : ] : L : !N : ]< : `^ : : K : m : "2 : `9 : H : 'q : <O : m : 6 : V : 2 : ~ : (: Ə 0: W 8: w @: Pt H: P: 1 X: ; `: : h: Q p: DF x: Gl : E : J; : X- : ~ : / : : 6 : 8 : : y : T : 3 : A : ) : w : 5 : : X} : Z : = : 5 (: ? 0: X 8: g @: O H: u P: Ɗ X: `: \ h: Y@ p: x: .x : 7 : F : Q : a : C : T : ˆ : 0. : : g : N : : I : xr : q : : : 1 : n : =t : n (: 4 0: 8: _S @: - H: y P: S X: _ `: 9 h: J[ p: 4l x: R : b : : aH : d : t : c : 4 : f6 : e : IK : PP : : R : \o : /? : ` ; , ; 0 ; D ; ; %M ( ; M 0 ; 8 ; U @ ; e H ; _ P ; Sb X ; c ` ; p h ; 4/ p ; z x ; ; ; C ; u ; 8 ; U ; B ; b ; ; ; \> ; - ; } ; R ; 6j ; wL ; :q ; ; r ; "Z ; 2| ; #j (; . 0; 8; = @; nu H; P; ` X; 6E `; up h; Y p; "` x; 3 ; S ; ; ; k ; { ; ; ; ; #i ; J ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 (; 8 0; 8 8; 8 @; 8 H; 8 P; 8 X; 8 `; 8 h; 8 p; 8 x; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 (; 8 0; 8 8; 8 @; 8 H; 8 P; 8 X; 8 `; 8 h; 8 p; 8 x; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; 8 ; } ; h], (; ?, @; Ǔ, H; (, `; \, h; O, p; 1, x; Q, ; , ; , ; 2n, ; h], ; h], ; h], ; 0, ; j, ; g, ; , ; )C, ; 8, (; , 0; E, @; 0, H; &4, P; , X; V, `; M{, ; y, ; , ; , ; j, ; , ; <, ; D, ; , ; 0, ; 0, ; C, ; D, ; D, ; D, ; , (; D, 0; D, 8; D, @; ^, H; ^, `; , h; 6D, p; AD, x; 2D, ; , ; fD, ; UD, ; C, ; D, ; , ; 6D, ; AD, ; 2D, ; 0, ; C, ; , ; 6D, ; AD, ; 2D, ; !, (; ^, @; , H; 6D, P; AD, X; 2D, `; !, h; p$, p; E, ; D, ; D, ; &E, ; D, ; D, ; D, ; D, ; V, ; 0, ; UD, ; , ; 6D, ; AD, ; 2D, ; d, ; , ; lD, ; pD, ; , (; , 0; D, @; -D, H; D, P; -D, X; D, `; , h; D, p; ^, x; D, ; ^, ; L, ; D, ; ^, ; U, ; D, ; ^, ; ", ; , ; ^, ; D, ; ZD, ; n, ; D, ; yD, ; , ( ; D, 0 ; {, 8 ; ^, @ ; ^, H ; ^, P ; )D, X ; ]*, ` ; I, h ; ^, p ; ]*, ; )D, ; ]*, ; )D, ; ]*, ; -D, ; , ; , ; , ; UD, ; D, ; D, ; UD, ; g, ; D, ; , ; g, ; , ; d, ( ; ^, 0 ; g, 8 ; , @ ; , H ; 6D, P ; AD, X ; 2D, ` ; ^, h ; , p ; , ; 0+, ; , ; M{, ; , ; , ; , ; UD, ; ^., ; D, ; PD, ; UD, ; ^., ; D, ; PD, ; LD, ; , ; D, ; C, ; , ( ; UD, 0 ; E, @ ; , H ; UD, P ; E, ` ; , h ; UD, p ; D, ; , ; UD, ; D, ; d, ; , ; UD, ; D, ; E, ; d, ; , ; UD, ; D, ; E, ; d, ( ; p$, 0 ; ^, 8 ; D, @ ; d, H ; g, P ; ^, ` ; E, h ; ^, p ; E, x ; E, ; ^, ; 0, ; C, ; yD, ; UD, ; D, ; 0, ; D, ; UD, ; D, ; D, ; E, ; 0, ( ; D, 0 ; UD, 8 ; D, @ ; D, H ; E, ` ; , h ; 6D, p ; AD, x ; 2D, ; C, ; D, ; UD, ; UD, ; UD, ; E, ; , ; , ; , ; j, ; x1, ; n, ; -l, ; , ; ,, 0; 5, @; \, H; &, `; \, h; &, ; -l, ; , ; , ; 1, ; @4, ; 3, ; &d, ; , ; +%, ; i1, ; x, ; 0, ; Q, ; n, ; Q, (; , @; \, H; R, `; , p; I, x; , ; , ; I, ; U, ; I, ; U, ; X3, ; ^, ; h], ; , ; g, (; , 0; 1, @; , H; , P; 1, `; I, h; Q, ; Z, ; &4, ; 0, ; , ; 0, ; &, ; , ; , ; #, ; , ; . ; 0, ; Wp, ; ͝, ; , ; ˟, ; @N (; , 0; ? 8; , @; `? H; , P; ? X; , `; ? h; Z, p; ? x; O, ; ? ; ?, ; @? ; , ; ? ; (, ; ? ; , ; `? ; , ; }? ; @, ; |? ; , ; z? ; , ; x? ; k, ; @w? ; 2, ; u? (; l, 0; t? 8; C, @; `r? H; 0, P; p? X; ", `; o? h; , p; m? x; , ; k? ; , ; @j? ; , ; h? ; :, ; g? ; , ; `e? ; , ; c? ; , ; b? ; , ; `? ; I, ; ^? ; x, ; @]? ; j, ; [? (; \, 0; Z? 8; B, @; `X? H; 2, P; V? X; #, `; U? h; , p; S? x; , ; Q? ; , ; @P? ; y6, ; N? ; , ; M? ; , ; `K? ; q, ; I? ; O, ; H? ; ', ; F? ; , ; D? ; , ; @C? ; , ; A? (; , 0; @? 8; , @; `>? H; o, P; <? X; G, `; ;? h; ', p; 9? x; , ; 7? ; , ; @6? ; , ; 4? ; , ; 3? ; , ; `1? ; q, ; /? ; F, ; .? ; , ; ,? ; , ; *? ; , ; @)? ; , ; '? (; , 0; &? 8; d, @; X3, H; ?, `; R, ; , ; , ; , ; Q, ; c, ; , ; !, ; , ; , ; , ; , ; , ; , ; , ; , ; , (; , 0; n, 8; , @; z, H; J, P; , X; , `; ", h; /, ; j, ; -l, ; , ; h], ; , ; ,, ; \, ; &, ; \, ; &, ; \, ; R, 0; 5, @; -l, H; , `; j, h; -l, p; , ; h], ; , ; ,, ; \, ; &, ; \, ; &, ; \, ; R, ; 5, ; -l, (; , @; , H; %, P; W, X; *, `; 1, h; 9, p; @, x; G, ; L, ; Q, ; V, ; [, ; a, ; g, ; l, ; q, ; , ; x, ; w, ; |, ; , ; , ; , ; `, ; , ; , ; , ; , ; , (; , 0; , 8; , @; , H; , P; , X; , `; , h; , p; h, x; , ; , ; , ; ), ; 3, ; C, ; R, ; b, ; r, ; ~, ; x, ; , ; , ; , ; , ; `, ; 2^, ; 8, ; , ; , ; , ; , (; , 0; , 8; , @; , H; 1 P; 1 X; 01 `; !y, h; 1 ; hM ; \M ; > ; -> ; @ > ; dM ; @cM ; `M ; `^M ; aM ; fM ; > ; [M = @ = 9 P= y* = yM = `M 0= M @= `N H= @|M P= M X= }M `= M h= `M p= M x= zM = M = M = M `= : h= : p= : = , = + = , = = , = v$ = Û, = R = ̛, = @}$ = ԛ, (= ̙ @= ޛ, H= o `= , h= = , = P$ = , = Yt = , = ~$ = f, = $ = , = $ @= , H= ' X= `. = , = = , = , = ܚ = , = /, = S = 9, = P, = S = [, @= , `= `. = , = = , = , = x = , = = s, (= @ = y, = W/ = = = = = , = = = @= = 01 = , h= = p= @= = S1 = , (= , 0= , 8= Ŝ, @= Μ, H= ՜, P= ݜ, X= , `= , h= , p= , x= , = , = , = -, = k = \/ = , = # = \/ = 6, = = [/ (= h= , p= Y/ = = = = = 0( = Y = ;Z = ?, = X/ = = = ̻ = )) = ;*, (= 8= `]/ = Q, = = = = = % = [, = ` & = a/ = c, (= 8= a/ @= k, H= X= a/ `= s, h= & x= `/ = {, = }D = ``/ = , = @|' = `/ = , = t = _/ = , = r = _/ = , = p = _/ = , (= I 8= ^/ @= , H= &G X= ^/ `= , h= $ x= ^/ = , = = ]/ = ǝ, = b/ = = = = @= ), = ͝, = + = {/ = ), @= ͝, H= + X= {/ = ͝, = + = {/ = & = ؝, = , = @x/ = , = B = w/ = , (= + 8= w/ @= , H= + X= @w/ `= p, h= + x= w/ = Z, = = v/ = , = ! = v/ = , = S+ = @v/ = H, = c* = v/ = n, = g+ = u/ = ,, (= 8= u/ @= , H= 5 X= @u/ `= M, h= 5 x= u/ = 2n, = * = t/ = ޝ, = = t/ = Ǥ, = = @t/ = , = v" = t/ = , = = s/ = , (= } 8= s/ @= , H= X= @s/ `= @, h= x= s/ = , = = r/ = t, = > = r/ = V, = v = @r/ = t, = = r/ = , = Y = q/ = G, (= 8= q/ @= n, H= pO) X= @q/ `= +, h= % x= q/ = , = = p/ = L, = = p/ = &, = = @p/ = , = . = p/ = ?, = C = o/ = , (= 8= o/ @= U, H= E X= @o/ `= 6, h= x= o/ = , = `+ = n/ = , = j = @n/ = , = 2 = n/ = n, = P) = m/ = n, = @P) = m/ = ;, (= * 8= @m/ @= :, H= X= m/ `= , h= P) x= l/ = , = 0) = l/ = *D, = b* = @l/ = m, = p) = l/ = t, = b* = k/ = 2i, = b* = k/ = , (= w 8= i/ @= }, H= ]+ X= `h/ `= |, h= x= h/ = , = |/ = = = = = & = @' = @' = , 8= 1M @= , X= 0M `= &, x= 0M = ' = ik, = &) = / = :, = 0* = @/ = !, = $ = / = <, = G? = `/ = E, (= 8= / @= f, H= - X= / `= [, h= x= / = d, = = / = K, = @ = / = G, = = ~/ = n, = 1 = ~/ = Q, = @ = }/ h= Y, p= / = = = = = `' = ( = `( = n, = . = D, = . = yD, 0= . 8= ), `= ), = ), = , = (. H= ' `= ), = ), = , = M+ = , = #) = ͝, (= @N+ @= , H= M+ `= ˟, h= M+ = ' = ' = / = p' = @' = = = `= = 4M (= o" 8= 0s' `= -|, h= R+ x= / = ie, = Н( = / = P& = ؟, = @= = , = 4M = , 8= = @= #, X= 3M `= 5, h= , p= C, x= I, = Y, = / = `= = = = `$' = P' = ' = , = d, H= / X= % h= @>& x= = p>& = % = j, = S+ = / = z, = `% = @/ = , = = / = , (= 8= / @= , H= + X= / `= L, h= P% x= `/ = n, = " = / = L, = 0% = / = q, = / = = (= = 0= % 8= 0=& @= P=& `= 6, h= ( = , = @= = 4$ = , = 1 = / = Վ, = ] = / = ˠ, = t = / = ], (= [) 8= / = , = P. = = = = = נ, = ߠ, = , = , = , = #, = ?, = G, = \, (= c, 0= z, 8= , @= , H= p. P= , X= , `= š, h= . p= Ρ, x= ֡, = , = , = '% = ?, = P( = / = r, = = @/ = , = P+ = / = , (= l 8= / @= *, H= p X= / `= *, h= x= / = , = = @/ = , = A = / = ;, = * = @/ = hw, = * = / = rw, = @* = / = , (= @+ 8= / @= w, H= * X= / `= A, h= * x= / = f, = ( = / = , = p+ = / = H, = * = / = I, = ) = / = N, = = / = `, (= \+ 8= / @= [, H= X= @/ `= m, h= x= / = k, = C = `/ = S, = ( = / = z, = = / = :, = + = `/ H= ?, P= @/ `= = h= = p= % x= E& = E& = , = ؑ. = = = ), = , (= $ 8= / @= 5, H= $ X= / `= , h= p$ x= / = ʮ, = p$ = / = , = P' = @/ = , = P' = @/ = , = $ = / = ˢ, = p$ = / = Ԣ, (= 7 h= $ x= t = / = = = $ = = = ), @= 5, H= М' X= / `= ʮ, h= Н' x= / = , = ) = / = j, = ) = / = , = `) = / = , = $ = `/ = , = М' = / = ˢ, (= Н' 8= / @= Ԣ, H= = ), = ^ = , = = = ), = ] = = W = , = `*) = ] = 9. = = = 2, (= ;, 0= J, 8= T, @= d, H= r, P= 6, X= , = i, = ) = / = , = ) = / = , = $ = / = , = $ = / = , = = `/ = 3, (= 8= `/ @= , H= X= / `= , h= $ x= / = ʣ, = p' = `/ = , = \+ = / = ˕, = 9 = / = أ, = `' = / = , = N7 = / H= &$ `= , h= =& = , = / = = = @= = $ = ?& = @& = , = / = = = , 8= = @= /, X= = `= C, x= 4M = Q, = `= = ^, = @`( = . = , = . (= )C, H= i, P= Ò, p= . x= ), = m' = + = ^( = / (= `}' 8= `5M H= = X= = h= Pi! x= 0n' = , = + = (. = , = = `. = , = [ @= q4, `= . h= &, = . = Ǥ, = . = Ĥ, = 0. (= 8= `+ H= / X= 7M h= @= x= = = * = @ = P+ = , = , (= + 8= @/ @= g, H= ! X= / = 0! = = = = = * = 6 = , = c' = / = դ, = ' = P/ = , (= ( 8= / @= , H= Y( X= / `= , h= ( x= / = , = ^( = `/ = ;' = ?, = = (= = 0= I' 8= ' @= P' h= : p= , = : = , = : = g, (= @: 0= , h= : p= , = : = H, = `: = , (= : 0= , h= : p= , = : = ˤ, = : = Ò, (= : 0= , h= : p= o, = , = = = , = = = , = = = ͝, = t+ = / = |, (= u+ 8= / `= ͝, h= t+ x= / = ͝, = P~+ = / = , = Ц* = / = ͝, = 0~+ = / = |, (= `+ 8= / `= ͝, h= r+ x= / = |, = s+ = / = ͝, = t+ = / = |, = @t+ = / = ͝, (= t+ 8= / @= |, H= Pt+ X= / = ͝, = v+ = / = |, = v+ = / = ͝, = }+ = / = ͝, (= p|+ 8= / @= |, H= {+ X= / `= ڥ, h= x= / = ͝, = l+ = / = |, = 0m+ = / = ڥ, = = / > ͝, ( > l+ 8 > / @ > |, H > o+ X > / ` > ڥ, h > x > / > ͝, > y+ > / > |, > z+ > / > ڥ, > > / > ͝, (> h+ 8> / @> |, H> j+ X> / > ͝, > q+ > / > ͝, > q+ > / > ͝, > r+ > / @> , H> ]+ X> / `> ͝, h> }+ x> / > ͝, > + > / > |, > `+ > / > & > Z, (> * 8> @/ > , > / > > > > > : > , (> : 0> , h> @: p> O, > : > , > n, > /, > : > {, H> : P> , > `: > , > , > _* > , > > , > r `> , h> `* x> / > Χ, > _* > / > b, > 0) > `/ > , > > / > ק, > U1 > / > , > n* > / > +, (> W* 8> / @> o, H> x) X> / `> ܧ, h> x> / > R, > > / > V, > > / > , > > |, > 8> , P> p) > @/ > K* > C > > `> > > H > p( X > ( > : > , > -l, > + > / ( > , 0 > + @ > / P > , X > + h > @/ > ȋ, > > / > b, > + > / > , > > / > o, > > / X > , > `/ ( > > 8 > > @ > hM > , > b @ > r, H > X > / ` > , h > ( x > `/ > , > > @/ > %, > > / > 0, > ̴ > , > K 0> , 8> X> , `> ?' > +, > 1 > > -l, > #, 0> , X> 7, > , > ȋ, > + > 0 > E, > < > / > o, (> ` 8> / @> b, H> p ( X> p/ `> , h> `' x> @/ > Q, > @+& > / > , > *& > / > q, > ' > / > ܧ, > > / > R, > 0 > / > V, (> 8> p/ @> W, H> H X> P/ `> +, h> x> / > ק, > N > / > , > > / > : > r, (> @: 0> d}, h> : p> E, > : > v, > ȋ, > > 0 > b, > R) > 0 > Q, (> 8> 0 @> <R, H> d X> 0 `> A, h> x> 0 > o, > > 0 > , p> 0 > > > hM `> , h> P > 0, > `' > , > 8 > , (> , > ȋ, > > Q, > s% > , > q% > ܧ, > % > R, > % > q, (> ' @> W, H> `> , h> >& > b, > k% > 0 > q, > `* > 0 > Q, > & > 0 > <R, > ) > 0 > A, > I( > 0 > , (> ' 8> @0 @> +, H> `3' X> `0 `> ק, h> % > , > & > 0 > ڥ, > 1 > , > P > 0, > `' 0> , 8> 8 > , > , > , > q% > ȋ, (> @> ܧ, H> % `> V, h> % > q, > ' > W, > > , > >& > o, > E' > 0 > , > & > 0 > Q, (> ,& @> +, H> `3' X> `0 `> ק, h> % > ڥ, > 1 > , > > b, ( > @ > q, H > ` > Q, h > h > <R, > N > A, > 4 > o, > > Q, > > R, > > V, ( > @ > , H > < ` > W, h > > , > P > 0, > `' > , > 8 @ > , h > , > , > q% > ȋ, > > ܧ, > % > R, ( > % @ > V, H > % ` > q, h > ' > W, > > , > >& > Q, > ,& > +, > `3' > `0 > ק, > % > , ( > & 8 > 0 @ > b, H > k% X > 0 ` > Q, h > & x > 0 > <R, > ) > 0 > A, > I( > 0 > , > ' > @0 > q, > `* > 0 !> o, !> E' !> 0 !> ڥ, (!> 1 h!> : p!> ٨, !> : !> , !> `: !> , "> , ("> * 8"> , "> R, "> p+ "> ` 0 "> ܧ, "> * "> 0 "> V, "> + "> 0 "> , "> * "> ` 0 #> Q, #> + #> 0 #> W, (#> 8#> 0 @#> ק, H#> v" X#> ` 0 `#> o, h#> ` " x#> 0 #> *, #> % #> 0 #> Q, #> = #> `0 #> <R, #> + #> 0 #> , #> " #> 0 $> f, $> } $> 0 $> b, ($> $" 8$> 0 @$> 5, H$> 0[+ X$> `0 `$> Χ, h$> Px) x$> 0 $> +, $> `* $> 0 $> , $> + $> 0 $> , $> ) $> |, $> %> ڥ, %> @%> [+ H%> \+ h%> : p%> C, %> Y, %> \+ @&> @%> X&> 0 @'> b, H'> X'> @*0 `'> w, h'> o% x'> `)0 '> <R, '> & '> )0 '> o, '> P9& '> (0 '> +, '> 6' '> &0 '> ק, '> g% '> %0 (> , (> ) (> $0 (> , ((> u% 8(> $0 @(> ܧ, H(> 0% X(> #0 `(> R, h(> f% x(> #0 (> V, (> % (> @#0 (> q, (> @' (> "0 (> W, (> c% (> "0 (> , (> p?& )> , ()> 0 8)> , H)> , P)> 9 `)> . p)> , x)> )> , )> ŭ, )> , H*> : P*> p, *> +, *> *> 20 *> ק, *> *> 20 *> , *> *> 20 *> Q, *> s% *> 10 +> , +> u% +> 10 +> ܧ, (+> 8+> @00 @+> R, H+> % X+> /0 `+> V, h+> % x+> @/0 +> , +> % +> ˩, +> 5' +> ک, +> e% +> , +> % ,> q, ,> ,> .0 ,> W, (,> 8,> .0 @,> , H,> i% `,> ˢ, h,> q% ,> , ,> ; ,> -0 ,> f, ,> ( ,> ,0 ,> *, ,> ! ,> @+0 -> b, -> J -> P:0 -> w, (-> : 8-> :0 @-> <R, H-> ; `-> o, h-> -> , P.> p:0 .> -> .> hM @/> -, H/> U% X/> =0 `/> d, h/> _( x/> ;0 /> iA, /> T% /> :0 /> tA, /> U0 0> @/> 0> $ 0> B& 0> E& H0> : P0> -, 0> : 0> iA, 0> ' 1> , 1> `[0 1> P (1> 0> `1> [, h1> " x1> ؕ. 1> p ! 1> 1> ` 1> ) 1> 1> 2> Υ 2> 2> , (2> 2 82> b0 @2> ͝, H2> _ X2> b0 2> e, 2> . X3> q 4> C, `4> ͝, h4> m* 4> & 4> s, 4> D* 4> e0 (5> u, 05> f0 @5> 4> H5> 4> 5> , 5> ' 5> 86> @6> m* h6> `4> p6> 4> 6> ( 6> E 6> p"' 7> Dj, (7> `% 87> v0 @7> , H7> D* X7> u0 `7> fr, h7> #* x7> `u0 7> t, 7> ) 7> s0 7> r, 7> G* 7> q0 7> r, 7> `O* 7> q0 7> r, 7> M* 7> `q0 8> s, 8> /* 8> q0 8> pR, (8> "& 88> p0 @8> s, H8> /* X8> p0 `8> r, h8> ** x8> `p0 8> r, 8> .* 8> p0 8> k, 8> .) 8> o0 8> Ol, 8> >) 8> o0 8> r, 8> ; 8> `o0 9> r, 9> * 9> o0 9> r, (9> )* 89> n0 @9> >s, H9> 8* X9> @n0 `9> s, h9> ;* x9> n0 9> `l, 9> >) 9> m0 9> m, 9> I) 9> m0 9> vt, 9> W 9> @m0 9> s, 9> `?* 9> l0 :> s, :> @* :> l0 :> s, (:> =* 8:> l0 @:> r, H:> `-* X:> k0 `:> r, h:> '* x:> k0 :> r, :> ,* :> @k0 :> r, :> @&* :> j0 :> q, :> p) :> j0 :> |r, :> @%* :> `j0 ;> r, ;> +* ;> j0 ;> `R, (;> & 8;> i0 @;> {q, H;> ) X;> i0 `;> mr, h;> $* x;> @i0 ;> mq, ;> `) ;> i0 ;> It, ;> ;> h0 ;> <, ;> @ ;> g0 ;> "J, ;> % ;> f0 H<> , `<> 7> h<> P <> : <> t, <> : <> r, => , (=> 9 8=> ~0 @=> , H=> F X=> ~0 `=> , h=> `z x=> }0 => , => \ => {0 => ?, => * => @{0 => *, => Ð => z0 => %, => ' => y0 >> 9, >> #& >> @y0 >> P, (>> ia 8>> x0 @>> b, H>> X>> w0 >> m, >> 0 >> => ?> z, ?> , ?> , ?> , ?> , (?> h. 0?> , 8?> , @?> ȫ, H?> . P?> ϫ, X?> ٫, `?> , h?> , ?> % ?> L, ?> ?> @0 ?> , ?> ' ?> 0 ?> ^, ?> !, ?> 0 @> , @> + @> @0 @> L, (@> 9o 8@> 0 @@> , H@> \ X@> `0 `@> *, h@> a x@> @0 @> 4, @> @> 0 @> !, @> m= @> 0 @> D, @> sA @> 0 @> >, @> t\ @> 0 A> Q, A> B A> 0 A> , (A> { 8A> 0 @A> N, HA> ] XA> @0 `A> D, hA> C xA> 0 A> O, A> C A> 0 A> W, A> >; A> 0 A> , A> 9 A> 0 A> c, A> uD A> `0 HB> [, PB> 0 `B> ?> hB> ?> pB> % xB> <& B> =& B> h], B> q, B> , B> `0 B> ?> B> =, B> , B> , B> , C> , C> , C> Ƭ, C> Ϭ, C> , (C> , 0C> , 8C> , @C> , HC> , XC> 2, hC> . xC> N, C> j, C> :, C> s, C> |, C> , C> V, C> , C> ؖ. C> , C> . C> , C> 0. C> í, C> έ, C> , C> , D> , D> , D> 6, 0D> >, @D> G, PD> P, `D> X, pD> a, D> i, D> q, D> z, D> , D> , D> , D> ȫ, E> z, E> ϫ, E> , @E> , HE> , PE> , XE> X. `E> ʮ, hE> , pE> , xE> Ү, E> , E> , E> , E> , E> M, E> ., E> h, E> 8, E> D, E> R, E> h, E> x, F> , F> . F> , (F> ȗ. 0F> I, 8F> . `F> 0, F> (. F> , F> p. F> ( F> G> tM G> `F> @G> , HG> ( `G> ˢ, hG> p( G> , G> + G> p$ G> ȝ, G> @8% G> 91 H> G, H> H> 41 H> ů, (H> F 8H> 41 @H> i, HH> ) XH> 31 `H> 0n, hH> =L xH> /1 H> ͯ, H> H> .1 H> &, H> Z H> @)1 H> ԯ, H> H> (1 H> @, H> , H> '1 I> V, I> \ I> '1 I> ۯ, (I> .G 8I> '1 @I> , HI> P & XI> &1 `I> , hI> 5 xI> `&1 I> J, I> I> #1 I> @, I> K% I> !1 I> Q, I> & I> 1 I> U, I> ' I> ` 1 J> , J> dG J> 1 J> , (J> G 8J> 1 @J> , HJ> H XJ> 1 `J> L, hJ> xJ> 1 J> !, J> J> 1 J> j, J> J> @1 J> , J> ] J> 1 J> , J> _ J> 1 K> S, K> 'R K> @1 K> , (K> :& 8K> @ 1 @K> `y, HK> * XK> 1 `K> R, hK> ` xK> @1 K> h, K> I K> 1 K> &, K> ~I K> 1 K> ,, K> p|' K> 1 K> h, K> ( K> @1 L> h, L> ) L> 1 L> x, (L> OG 8L> 0 @L> /, HL> 4 XL> 0 `L> 2, hL> Ӎ xL> @0 L> Z, L> L> 0 L> h, L> c L> 0 L> j, L> 0) L> 0 L> 8, L> ' L> 0 M> I, M> I M> `0 M> `, (M> PJ 8M> 0 @M> , HM> "4 XM> 0 `M> z, hM> J xM> `0 M> , M> 1K M> 0 M> , M> 3 M> 0 M> y, M> 3 M> 0 M> w, M> K M> 0 N> , N> K N> 0 N> , (N> ZN 8N> @0 @N> , HN> O XN> 0 `N> , hN> P xN> 0 N> , N> 6 N> 0 N> , N> & N> 0 N> , N> & N> 0 N> , N> & N> 0 O> , O> 6| O> 0 O> , (O> D 8O> `0 @O> , HO> ( XO> 0 `O> , hO> ( xO> 0 O> , O> ( O> 0 O> Ű, O> & O> 0 O> ̰, O> P O> 0 O> z, O> q O> @0 P> , P> P> 0 P> հ, (P> (Q 8P> 0 @P> ܰ, HP> pQ XP> @0 `P> , hP> Q xP> 0 P> , P> AR P> 0 P> , P> R P> @0 P> , P> R P> 0 P> , P> +7 P> 0 Q> y, Q> { Q> 0 Q> , (Q> ZS 8Q> 0 @Q> ", HQ> S XQ> 0 `Q> OG, hQ> /b xQ> 0 Q> , Q> 2 Q> 0 Q> *, Q> N1 Q> 0 Q> , Q> 5 Q> 0 Q> j, Q> ) Q> 0 R> 5, R> |X R> `0 R> , (R> S 8R> 0 @R> , HR> T XR> 0 `R> , hR> FT xR> `0 R> , R> T R> 0 R> , R> T R> `0 R> -, R> 6& R> 0 R> , R> 0{) R> 0 S> , S> t S> 0 S> , (S> ` 8S> 0 @S> $, HS> |W XS> 0 `S> (, hS> W xS> `0 S> , S> | S> @0 S> *, S> ;U S> 0 S> b, S> |) S> 0 S> e, S> b S> 0 T> ^, T> d T> 0 T> d, (T> e 8T> @0 @T> o, HT> ) XT> 0 `T> s, hT> Og xT> 0 T> k, T> h T> 0 T> r, T> i T> 0 T> -, T> *E T> `0 T> 6, T> * T> 0 U> W, U> $W U> 0 U> <, (U> @y) 8U> 0 @U> A, HU> &V XU> 0 `U> c, hU> A xU> 0 U> ], U> ] U> 0 U> G, U> % U> 0 U> M, U> $ U> @0 U> H, U> / U> 0 V> , V> V> @0 V> , (V> ) 8V> @0 @V> z, HV> k XV> 0 `V> , hV> l xV> 0 V> h, V> ( V> 0 V> w, V> * V> 0 V> C, V> r V> 0 V> S, V> w V> 0 W> Z, W> - W> @0 W> tD, (W> 8W> 0 @W> `, HW> Q- XW> 0 `W> j, hW> K xW> 0 W> t, W> W> @0 W> , W> P}) W> 0 W> , W> a W> `0 W> , W> W> 0 X> , X> l X> 0 X> , (X> 8X> 0 @X> , HX> } XX> 0 `X> , hX> =. xX> 0 X> , X> + X> 0 X> ɱ, X> X> 0 X> ѱ, X> X> 0 X> 0, X> V X> 0 Y> 1, Y> Y> `0 Y> ٱ, (Y> / 8Y> 0 @Y> ߱, HY> & XY> @0 `Y> , hY> ) xY> @0 Y> ?, Y> Y> 0 Y> :, Y> >W Y> @0 Y> D, Y> W Y> 0 Y> , Y> #F Y> @0 Z> , Z> E Z> 0 Z> x, (Z> mO 8Z> @0 @Z> !y, HZ> R XZ> 0 `Z> /, hZ> xZ> 0 Z> x, Z> L Z> `0 Z> jd, Z> ( Z> @0 Z> , Z> i Z> 0 Z> , Z> ; Z> 0 [> , [> 9< [> @0 [> ', ([> N> 8[> 0 @[> /, H[> > X[> 0 `[> #f, h[> p( x[> 0 [> 4, [> PQ% [> 0 [> ;, [> m [> 0 [> E, [> [> 0 [> R, [> X [> `0 \> Z, \> Y \> 0 \> g, (\> Z 8\> 0 @\> u, H\> 0( X\> 0 \> , \> `<1 \> G> \> G> \> @ % \> B& \> D& ]> : ]> 4, H]> : P]> L, ]> : ]> !, ]> `: ]> &, ^> @: ^> ԯ, H^> : P^> @, ^> @: ^> ȝ, ^> : ^> Q, _> : _> 6, H_> : P_> , _> : _> , _> : _> ȝ, `> : `> 8, @`> Դ, H`> `0 P`> @E> ``> =, h`> 0 p`> E> `> , `> F> `> , `> uM `> , `> 0 `> F> `> o=, `> `0 `> E> a> Z=, a> `0 a> D> a> K=, (a> 0 0a> B> @a> :=, Ha> 0 Pa> D> ha> : pa> G, a> : a> 0n, a> : a> J, (b> : 0b> U, hb> : pb> S, b> `: b> , b> 0: b> `y, (c> : 0c> h, hc> : pc> h, c> : c> x, c> P: c> j, (d> : 0d> R, hd> `: pd> -, d> : d> c, d> `: d> ], (e> @: 0e> x, he> : pe> !y, e> : e> /, e> : e> x, (f> : 0f> i, hf> : pf> ͯ, f> : f> V, f> `: f> , (g> @: 0g> , hg> : pg> , g> : g> , g> : g> h, (h> `: 0h> 2, hh> @: ph> h, h> : h> I, h> : h> `, i> , (i> : hi> : pi> , i> ', i> : i> 0, i> : (j> @: 0j> , hj> : pj> (, j> : j> -, j> @: j> , (k> : 0k> , hk> p: pk> 1, k> `: k> ߱, k> : k> @, (l> P: 0l> , hl> : pl> #f, l> 0: l> S, l> : l> ;, (m> : 0m> Z, hm> : pm> `, m> `: m> E, m> @: m> R, (n> 0: 0n> Z, hn> : pn> g, n> : n> t, n> : n> , (o> : 0o> , ho> : po> , o> : o> , o> : o> , (p> : 0p> , hp> : pp> u, p> @, p> O, p> [, p> f, p> u, p> , q> , q> , q> , 0q> , @q> µ, Pq> Ե, `q> ߵ, pq> , q> , q> , q> !, q> 1, q> @, q> N, q> ^, q> o, r> , r> , r> , 0r> , @r> , Pr> , `r> ն, pr> , r> , r> , r> , r> (, r> <, r> G, r> R, r> ], s> l, s> x, s> , 0s> , @s> , Ps> , `s> , ps> з, s> , s> , s> , s> , s> %, s> 2, s> @, s> M, t> X, t> e, t> s, 0t> , @t> , Pt> , `t> , pt> , t> ɸ, t> ո, t> , t> , t> , t> , t> ', t> 2, u> B, u> R, u> _, 0u> m, @u> x, Pu> , `u> , pu> , u> , u> ˹, u> ع, u> , u> , u> , u> , u> , v> (, v> 9, v> R, 0v> ^, @v> j, Pv> z, `v> , pv> , v> , v> , v> ̺, v> Ș. v> , v> , v> , v> -, w> D, w> ], w> v, 0w> , @w> , Pw> , `w> , pw> ǻ, w> ջ, w> , w> , w> , w> , w> , w> #, w> ., x> :, x> N, x> c, 0x> v, @x> , Px> , `x> , px> , x> μ, x> , x> , x> , x> , x> ), x> 7, x> E, y> S, y> b, 0y> v, @y> , Py> , `y> , py> , y> ҽ, y> , y> , y> , y> , y> , y> /, y> K, z> d, z> , z> , 0z> , @z> . Pz> վ, `z> , pz> , z> ", z> ?, z> [, z> x, z> . z> , z> , {> , {> ¿, {> ο, 0{> ۿ, @{> , P{> , `{> , p{> , {> , {> #, {> 2, {> =, {> I, {> [, {> q, {> , |> , |> , (|> : 0|> o=, h|> =% |> &@, |> =% |> (. |> , |> 5 |> p. |> , |> 9 |> . |> O, |> ( |> Й. }> %k, }> P ) }> h. }> , (}> f) 8}> H. @}> Dj, H}> s X}> . `}> , h}> x}> p. }> , }> b( }> М. }> , }> E }> 0. }> , }> { }> h. }> , }> / }> . ~> , ~> $( ~> Н. ~> , (~> Z 8~> . ~> +, ~> =1 ~> |> ~> `|> ~> ` ~> 1, ~> -, ~> 1, ~> -, > 5, (> , 0> 1, 8> 3, `> , h> 1, p> -, x> ), > 9, X> C, > W, > p, h> x, > Dj, (> 8> `@1 @> , H> 5 X> @1 `> , h> x> `?1 > , > t > >1 > , > 4 > `>1 > , > A1 > > h> > &@, > q > M1 > , > > M1 > , Ȅ> џ > @M1 > , > > K1 > , > q( > J1 > , (> fb 8> `J1 @> Z|, H> 0 X> I1 `> , h> x> `I1 > , > $) > H1 > , > > F1 > , ȅ> } > F1 > , > o+ > E1 > , > 4 > `E1 > l, (> 8> E1 @> [, H> @ X> D1 `> , h> f2 x> `C1 > , > 2 > B1 > , > 4 > `B1 > /S, > N1 > > (> `> h> `: p> , > P: > , > P > . > , > p! > + (> , 0> ( > , > , > W, > _ H> @: P> B, > 0, > `. > B, > . > , > . > _, ȉ> @U1 Љ> > > o, > О. > y, > . > , (> . 0> , 8> H. @> G], H> . P> K], X> ȟ. `> , h> . p> , x> 0. > , > p. > , > , > , > . > r, Ȋ> , Њ> :/, ؊> , > B/, > , > , > , > 3, > , > , > , > , (> , 0> , 8> , @> n/, H> , P> ,/, X> , `> v/, h> , p> , x> 0, > -., > 3, > F., > 6, > Y, > =, > H, > E, > k0, ȋ> ^, Ћ> d, ؋> a, > G, > w, > M, > , > , (> , 0> , 8> . @> , H> , `> O, h> 6# x> t1 > , > p( > s1 > ڗ, > P > @s1 > , Ȍ> A ،> r1 > , > > r1 > ܖ, > > `q1 > !, (> @o* 8> p1 @> , H> M X> p1 `> , h> {) x> o1 > 4W, > D > n1 > 3, > D' > @m1 > , ȍ> , ؍> l1 > , > K. > l1 > ), > `5 > k1 > <, (> @& 8> @k1 @> R, H> p& X> j1 `> l, h> 95 x> j1 > , > ( > i1 > , > ( > h1 > n, Ȏ> Z) ؎> h1 > [U, > `#' > f1 > ER, > p & > `e1 > , (> 8> e1 @> , H> X> c1 `> , h> x> c1 > , > A > a1 > , > > ``1 > , ȏ> 2 ؏> _1 > , > + > ^1 > q, > ) > ^1 > , (> p%) 8> ]1 @> \, H> f X> \1 `> , h> ώ x> [1 > . > j > Z1 > . > ( > Z1 > , Ȑ> Q ؐ> Y1 > ), > > Y1 > \, > > W1 > <, (> @* 8> W1 @> S, H> `* X> V1 > o, > u1 > `> > n, > U, (> : 0> O, `> -, h> U1 p> > > |3, > `t1 > > > z, > t1 > > > , Ȓ> V1 В> > > : > . > o, (> y, H> p: P> S, > , > 0, Г> , > q, > , H> , p> V, > , > , > , > , > З (> *, H> $ `> , h> x> 1 > [ , > B > 1 > >, > 0 & > 1 > M , ȕ> % ؕ> 1 (> ', 0> `1 @> `> H> @> > # > 4, > P % > 1 > G, Ȗ> 9 ؖ> @1 > , > `$ > @1 > , > 0$ > 1 > 5, (> P$ 8> 1 @> 6, H> `$ X> 1 `> {), h> @ $ x> @1 > Q, > %$ > 1 > ŗ, > > 1 > ), ȗ> @#$ ؗ> 1 > q), > @$ > 1 > `, > > `1 > @. (> ) 8> 1 @> xT, H> @' X> 1 `> u, h> ' x> 1 > , > &$ > 1 > J, > % > 1 > wU, Ș> &' ؘ> 1 (> U, 0> `1 @> > H> > > : > 5, ș> : Й> wU, > `uM > + @> br, H> n `> , h> I > , > o > , > i > , Ț> h > , > h > + (> V x> 4 > 2, > ;, > J, > T, > d, ț> r, Л> , ؛> , > n, > , > , > 1 > > > , (> f 8> 1 @> , H> Di X> 1 `> , h> 8i x> 1 > , > [i > 1 > %, > o > 1 > , Ȝ> @ > 3 > X> > 0, > #, > ) > ', > # `> h], h> U, x> , > , > , > ( > h. > I, > , > `C* Ȟ> . О> , ؞> , > @B* > . > 2, > , > i > . > , (> , 0> * @> . H> , P> , X> @X* h> . p> *!, x> *!, > Q* > k2, > k2, > > ͝, ȟ> t+ ؟> @1 > ͝, > w+ > @1 @> ͝, H> }+ X> @1 `> |, h> < x> 1 > , > `# > 2 > !, Ƞ> b ؠ> `1 > , > ! > 1 > G, > 9 > `1 > , (> v 8> 1 @> , H> G+ X> `1 `> , h> u" x> 1 > , > > 1 > i, > t' > `1 > , ȡ> ء> 1 > , > x% > 1 > U, > -' > 1 > s3, (> & 8> 1 @> w\, H> p! X> 1 `> /C, h> '& x> 1 > c, > `$ > 1 > Q, > ) > 1 > J%, Ȣ> آ> 1 > &4, > & > 1 > B%, > > 1 > 7, (> ! 8> @1 @> p, H> + X> 1 `> , h> @m x> 1 > , > > 1 > R(, > # > `1 > O, ȣ> أ> @1 > , > `% > @1 > , > > 1 > [, (> % 8> 1 @> , H> p.' X> `1 `> g@, h> x> 1 > ^@, > > 1 > , > ! > 1 > v, Ȥ> ؤ> 1 > , > + > 1 > ʜ, > p > @1 > ;, (> W) 8> @1 @> 0, H> g$ X> 1 `> o, h> p! x> 1 > , > ! > 1 > R%, > # > `1 > Q, ȥ> 0G إ> @1 > $, > p( > 1 > D, > $ > 1 h> 8, p> `2 > > Ȧ> @; Ц> , > @; > !, H> ; P> , > ; > c, > I, ȧ> U, > ; > ;, (> `; 0> 0, h> ; p> $, > , Ȩ> W > 4, > @P (> > 0> R 8> z @> h> ; p> ȑ, > _, > @M > ͝, ȩ> > ), h> p' > /, Ȫ> `> > w, > M (> 2$ @> , H> ( X> `2 `> 9, h> x> 2 > , > % > #0, > 2 > @> > > H> ; P> , > , > , > g, > , > 0+, > , > , > j, > , @> , H> `> D, h> > ]) > > v > ]) > > ! (> i 0> 8> @> H> P> V' X> `> & h> p> o x> . > b > N > > N > > > } > Ȯ> E Ю> خ> > > v > > > : > > > > b (> & 0> 8> @> , H> U X> . > , > > % @> A, H> i. X> 3 > t, > # > 3 > , > ` > `3 > , ȱ> @@ ر> 3 > 4, > ( > 3 > ;, > < > 3 > @, (> ) 8> 3 @> K, H> ) X> 3 `> , h> p+ x> 3 > o, > + > 3 > O, > " > @3 > T, Ȳ> z( ز> 3 > &V, > $ > 3 > q, > $ > 3 > , (> p( 8> 3 @> *p, H> 0+ X> 3 `> , h> $ x> 3 > C, > > 3 > %V, > > 3 > Jp, ȳ> + س> 3 > Qp, > + > 3 > @, > > `3 > q, (> 0$ 8> 3 @> _, H> ! X> 3 `> C, h> x> 3 > j, > p+ > 3 > ^, > t' > 3 > , ȴ> ' ش> 3 > P_, > Њ > `3 > A, > > @3 > 0p, (> * 8> `3 @> =p, H> P+ X> `3 `> s, h> % x> 3 > {, > Y+ > 3 > , > ( > 3 > , ȵ> P+ ص> 3 > , > * > 3 > , > ( > 3 > , (> ( 8> @3 @> , H> `+ X> `3 `> , h> Z+ x> 3 > , > s% > 3 > , > $& > 3 > , ȶ> + ض> 3 > , > + > `3 > Q, > P > 3 > , (> R+ 8> 3 @> 3[, H> * X> 3 `> ], h> ( x> 3 > ڥ, > v > 3 > , > + > l > t > . > , (> ( 8> 3 @> ͝, H> k+ X> 3 `> |, h> 0l+ x> `3 > , > > `. > , ȹ> ع> . (> >, 0> =, @> > > ; > 4, Ⱥ> ; к> _, > ; > t, H> 0; P> T, > `; > , Ȼ> @; л> 4, > , > @> > f, > > ( Ƚ> h, н> ؽ> ( > , > % > + > x1, > ` (> % @> , H> % P> 0% h> {, p> % > C, > % > P ( > , > * > -, > % > ^ @> , h> , > , > , > , > ), 0> , > , > % > 3 > M, > % > 3 > , > # > . > a(, > z' > `3 > (, > 7' > 3 > W, (> ( 8> 3 @> ڥ, H> 5 X> @3 > % > &, > > | > !, > Wp, > " > 3 > ͝, (> + 8> 3 @> , H> P) X> `3 `> 4, h> % x> 3 > E, > @g# > 3 > 3[, > p' > @3 > ڥ, > + > 3 > W, > ( > 3 > W, @> e, H> , h> . p> , > 0. > wm, > > h. > , > h], 8> $, X> h], p> L, > h], > Bd, > h], > , > i( > :( > إ. > , (> ! 0> * 8> . P> , `> `{' h> p> 8. > , > ( > :( > . > , > > > . > $, > > h], 0> L, @> H> P> . h> Bd, x> > .' > @. > , > 0! > b* > . > , > 0! > b* > . > , > 0! (> ( 0> . H> , X> 0! `> f) h> . > , > 0! > b* > @. > , > 0! > c* > p. > , > 7' > :( > . (> , 8> ) @> 0) H> Ш. `> , p> `' x> ( > . > , > > > h. > , > > t > . > , > l > $' (> . @> wm, P> ` `> h. x> #, > P' > C > h], > +, > > :( > ت. > 5, > > :( > (. > ?, 0> 9 8> :( @> . X> I, h> X) p> ,' x> ȫ. > Q, > X) > ) > . > Z, > W) > ,' > 0. > b, > W) > ) > `. 8> k, H> ) P> ,' X> . p> s, > ) > ) > Ȭ. > |, > * > ,' > . > , > * > ) > 0. > , (> * 0> ,' 8> h. P> , `> * h> ) p> . > , > * > > . > , > * > X< > 0. > , > ' > :( > , 0> , @> l* H> :( P> , h> , x> * > :( > x. > , > [" > q > . > , > > :( > Ȯ. > , > * (> ,' 0> . H> $, X> * `> ) h> . > 0, > [, > ,' > X. > ;, > [, > ) > . > G, > @z' > ,' > ȯ. (> O, 8> @z' @> ) H> . `> X, p> x> ,' > 0. > `, > > ) > `. > i, > `' > ,' > . > p, > `' > ) (> Ȱ. @> x, P> ( X> :( `> . x> , > ) > :( > . > , > c* > > @. > , > > > x. > , 0> 8> @> . X> , h> p> x> . > , > > > . > , > f > > X. > , > { > > . 8> , H> P> X> Ȳ. p> , > 3 > > . > , > a* > > 8. > , > Б) > ,' > p. > , (> Б) 0> ) 8> . P> , `> ) h> ,' p> . > , > ) > ) > . > , > > > P. > +, > > > . 0> 8, @> `W) H> :( P> . h> B, x> V > ,' > 8. > M, > V > ) > p. > Y, > p > > . > e, > Q' (> * 0> . H> m, X> ! `> h> . > y, > p > > @. > , > p > `R) > . > e, > Q' > * > . (> I, @> H> ȫ. `> k, x> S) > . > s, > S) > Ȭ. > m, > @! > = > . > y, > > (> @. @> , P> X> `> . x> , > p' > + > . > , > > . > , > S) > (. `> {, h> P( p> R+ x> `. > , > p > . > {, (> P( 0> R+ 8> `. H> , P> p `> . > o > z > o > 0% > ( > } > B > , (> ( 8> 3 @> ͝, H> j+ X> 3 `> |, h> j+ x> 3 > ͝, > + > ; > , > ͝, (> + `> ?, > *, > D, > , > ` > 3 > ͝, (> _ 8> 3 `> , h> `{+ x> 3 > ͝, > 0+ > 3 > n) (> (' 0> pd* 8> ?' `> + > + > + > ? > 9 > H> n) > (' > pd* > ?' `> p> x> M > ?, > *, > D, > D, (> P) 8> 3 @> ͝, H> i+ `> O, h> x> `3 > , > > 3 > " > > " > @) > > < `> , h> ) x> 3 > ͝, > i+ > 3 > |, > i+ > 3 > , > > 3 > ͝, > > 3 > |, (> 8> 3 `> , h> + x> 3 > ʮ, > :9 > `3 > 0+ > > {, > p+ > > > . > > P9 > `> > + > p> > p> > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > (> > 0> > 8> > @> 0> H> 0> P> @> X> @> `> P> h> P> p> `> x> `> > p> > p> > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > > (> > 0> > 8> > @> 0> H> 0> P> @> X> @> `> P> h> P> p> `> x> `> > " > ' > X > [ > Z > Z > q > > `^ > 0> X 8> [ @> Z H> Z `> q h> p> `^ x> > q > > `^ > > q > > `^ > H> + > ͝, (> + > > {, > ͝, > <X > 3 > -, (> 0> > {, > W, > p& > . (> ; 0> 0+, `> C, h> P' > f, > p' > h, > ' > , > ' > , > xB `> x1, > ͝, > V) > , > + > `3 (> , 0> й @> 3 P> I, X> + h> 3 x> , > u( > 3 > Q, > p' > 3 > , > ' > 3 > , > + > `3 > , > 0+ 0> 3 @> , H> p+ X> 3 h> &, p> > `3 > 3, > r > 3 > (, > 0+ > 3 > ʮ, (> + 8> 3 @> m, H> N) X> 3 `> p, h> x> 3 > @, > u( > `3 > e, > @l( > 3 > G, > + > 3 > , > ) > ˢ, > @* @> % H> % P> u( X> % `> ) > u( > + > `; > m, (> @; 0> p, h> ; p> , > ; > e, > n\, > p+ > @3 > ڥ, > p+ > &3 > ͝, (> + 8> 3 @> U, H> + X> @3 `> H, h> + x> `3 > ~, > + > 3 > , > n* > 3 > , > ( > 3 > , > n* > 3 > t , > ( > 3 > , (> 8> `3 @> %, H> 0+ X> 3 `> D, h> # x> 3 > , > + > @3 > 0( X> `+ > @+ > ͝, > P+ > 3 @> D, H> - > D, > i > D, > K > ; > U, H> ; P> n\, > ; > H, > ; > ~, > p; > , @> H> 0L P> > P( @> > , > % > 3 > ͝, > > 3 > , > 8 > 3 > D, > t > 3 @> ' x> ) > , > 8 > 3 > D, > t > @3 > ' 8> 0a* `> R, h> x> . > D, > mt > 3 > ' `> c, h> * x> @. > , > > h. > h, > * > . > r, > * > ȸ. @> ~, H> * X> . `> , h> x> 4 > , > P+ > @ 4 > >, > % > 4 > \>, > P > 4 > , > Pu" > 4 ? , ? * ? 0. ? , ( ? * 8 ? X. @ ? , H ? * X ? . ` ? \, h ? + x ? 4 ? , ? P+ ? 4 ? 3[, ? P! ? 4 ? ڥ, ? 0 ? @ 4 ? ` ? u ? ? p " ? 0! (? в 0? Џ 8? ! @? `! H? P? $ X? ` `? p! h? p? ! x? ? ! ? i! ? ? p(" ? ! ? , (? , 0? , 8? . @? , H? . P? , X? . ? 8, ? 4 ? ? ? ; ? !, ? @; ? >, (? ; 0? \>, `? Z h? 4 p? ? Z ? ^ ? ? 07 ? @< ? } ? е' ? g< ? , ? @) ? @4 ? ͝, ? 0q+ ? 4 ? |, (? q+ 8? 4 `? , h? 0* x? @4 ? ͝, ? ? 4 ? |, ? ? 4 ? `; ? [ , ? , (? ' 8? 4 @? ͝, H? X? 4 `? |, h? x? 4 ? ͝, ? ? 4 ? , ? ? 4 ? , ? ? 4 ? , (? 8? @4 ? / h? / ? , ? , ? , ? C, ? , ? x1, @? , ? , ? , ? , H ? , ? ; ? 4, ? , ? T) ? , ? # 0 ? , 8 ? T) @ ? A> X ? , ` ? h ? 4 ? $, ? T+ ? ,, ? @$' ? 6, ? ? Fn, ? T) ` ? A, ? O, ? , ? ! ? 4 ? ڥ, ? 6 ? ` 4 @ ? g@, H ? @. P ? _, X ? p. ` ? g, h ? . p ? ^@, x ? . ? r, ? 0. ? z, ? . ? , ? Ȼ. ? , ? (. ? , ? H. ? , ? . ? , ? . ? c, ? * ? @. ( ? , 0 ? * @ ? h. ? ~, ? 0+ ? &4 ? , ? ' ? @&4 ? , ? `* ? &4 ? , ? @* ? %4 ? \, ? ! ? %4 ? , (? c" 8? #4 @? p, H? h" X? "4 `? p, h? * x? "4 ? , ? aZ ? !4 ? , ? + ? !4 ? e, ? Т( ? 4 ? 3[, ? ) ? 4 ? ! (? ( 0? ! 8? q* @? * H? ! P? ' X? * `? @! h? ! ? ? * ? Pp* ? 0! @? , H? 4 P? @ ? `? , h? + x? , ? -l, ? + ? , ? , ? F ? , ? , ? 0g# ? h], ? Q, (? 0g# 8? h], @? q, H? @@% X? h], `? W, h? V x? h], ? o, ? }# ? h], ? f, ? ? ? , ? h, ? ? ? . ? , ? pT+ (? . 8? , @? PT+ `? F|, h? ? , ? V ? , @? , H? @m* X? *4 `? , h? ) x? *4 ? , ? $ ? )4 ? ڥ, ? !6 ? (4 ? p%( ? f, ? ? ? #, (? h, 0? 8? @? @. P? 9, X? p+ h? `. x? B, ? s ? =|, ? ? M, ? W ? Z, H? b, ? , ? @m* ? (4 ? , ? ) ? (4 ? , ? $ ? '4 ? ڥ, ? !6 ? (4 @? X? p%( `? , h? Y. x? (4 ? , ? / ? (4 ? , ? f. ? '4 ? f, ? ? ? l, ? h, ? ? ? . 0? , 8? p+ H? `. X? 4|, `? ? , ? , @? , H? - X? *4 `? , h? </ x? *4 ? , ? ? )4 ? , ? / ? *4 ? , ? o. ? *4 ? , ? 3 ? )4 @? ͝, H? ? , ? 7 ? . ? . ? 1 ? , (? , P? #, ? 0, ? _ ? a(, ? ? (, ? ? ͝, ? W ? W, (? h? ? % ? , ? ͝, ? + ? |, ( ? @ ? , H ? ( X ? +4 ` ? , h ? jy x ? +4 ? @N ? `r? ? ^, ? , ? p? ? ? ? Z, @ ? *, p ? ? ? , ? , ? , ? , ? ? ? , ? , ( ? 0, H ? 3, P ? , p ? , ? ͝, ? ? }? ? 9? ? c, ? :6 ? ` ? , ? $, ? C, ? 9, ? g, ? ], ? L, ? V, @!? ͝, H!? H\ !? M? !? `? !? t? !? @6? !? 7? !? 0, !? 0, "? x? "? 4? "? 0, @"? p, H"? , h"? n, "? , "? , "? g, "? ], "? , #? , #? W?, 8#? , @#? , `#? , h#? AD, #? , #? , #? , #? , #? , $? o? $? `>? $? *? $? |? ($? <? 0$? ;? 8$? 3? @$? '? `$? -l, $? , $? n, $? $, $? ?, $? 5, $? O, $? E, %? ], %? S, P%? @? X%? ? `%? g? h%? `e? p%? c? x%? m? %? u? %? ? %? h? %? Q? %? `? %? Z? %? U? %? V? %? @]? %? [? %? S? %? b? %? ^? %? `X? &? d, 0&? 0( &? ku &? z, &? &? P( &? `$? '? 3? ('? 8'? ; '? , '? 0( ((? P(? , X(? `(? P( (? `$? (? 3? (? v) (? ; X)? , p)? 0( )? I+ )? , )? *? P( 0*? `$? @*? 3? h*? P( x*? ; *? , +? p' +? 0. +? Э' +? ' +? `>? ,? ' ,? , ,? $ 0-? , 8-? @-? $ -? M? -? $ 8.? , P.? $ .? 2, .? .? $ /? M? H/? $ /? F, /? $ p0? ], x0? 0? $ 0? M? 0? $ x1? q, 1? $ 2? , 2? 2? $ `2? M? 2? $ 3? , 03? > 3? , 3? $& 3? < 4? @j? (4? = 84? ; 4? , 4? ' P5? X. X5? , `5? ! 5? x? 5? )) X6? , p6? > 6? , 6? $& 7? < @7? t? h7? = x7? ; 7? , 8? > 8? . 8? $& 8? < 8? t? 9? = 9? ; 9? , 9? D% 0:? , 8:? @:? D% :? }? :? A% 8;? ', P;? > ;? v ;? 0, ;? $& ;? < <? |? H<? = <? G, <? > p=? R, x=? $& =? < =? |? =? = =? ; x>? o, >? p' ?? , ?? Э' ?? ' `?? o? ?? ' @? , 0@? $ @? , @? @? $ A? @w? (A? $ A? , A? $ PB? , XB? `B? $ B? @w? B? $ XC? , pC? $ C? , C? D? $ @D? @w? hD? $ D? , E? $ E? . E? E? $ E? @w? F? $ F? , F? $ 0G? . 8G? @G? $ G? @w? G? $ 8H? ', PH? $ H? 8, H? H? $ I? @w? HI? $ I? O, I? $ pJ? a, xJ? J? $ J? @w? J? $ xK? q, K? $ L? , L? L? $ `L? @w? L? $ M? , 0M? $ M? , M? M? $ N? @w? (N? $ N? , N? $ PO? , XO? `O? $ O? @w? O? $ XP? y6, pP? $ P? , P? Q? $ @Q? @w? hQ? $ Q? , R? > R? . R? $& R? < R? h? S? = S? ; S? , S? > 0T? 8. 8T? $& @T? < T? h? T? = T? ; 8U? , PU? > U? . U? $& U? < V? h? HV? = XV? ; V? #, V? > pW? ȿ. xW? $& W? < W? h? W? = W? ; xX? 2, X? > Y? . Y? $& Y? < `Y? h? Y? = Y? ; Z? B, 0Z? > Z? 0. Z? $& Z? < [? h? ([? = 8[? ; [? \, [? > P\? . X\? $& `\? < \? h? \? = \? ; X]? j, p]? > ]? . ]? $& ^? < @^? h? h^? = x^? ; ^? x, _? > _? . _? $& _? < _? h? `? = `? ; `? I, `? > 0a? P. 8a? $& @a? < a? h? a? = a? ; 8b? , Pb? > b? . b? $& b? < c? h? Hc? = Xc? ; c? , c? > pd? . xd? $& d? < d? ? d? = d? ; xe? , e? > f? H. f? $& f? < `f? ? f? = f? ; g? , 0g? > g? p. g? $& g? < h? ? (h? = 8h? ; h? :, h? > Pi? . Xi? $& `i? < i? `? i? = i? ; Xj? , pj? > j? . j? $& k? < @k? `? hk? = xk? ; k? , l? > l? , l? $& l? < l? `? m? = m? ; m? , m? > 0n? . 8n? $& @n? < n? `? n? = n? ; 8o? , Po? p' o? ( o? , o? Э' o? ' p? "? p? `? Hp? ' p? ", p? P! pq? . xq? g q? К! q? ? q? `? q? ! xr? 0, r? > s? . s? $& s? < `s? `? s? = s? ; t? C, 0t? > t? P, t? $& t? < u? `? (u? = 8u? ; u? l, u? > Pv? . Xv? $& `v? < v? `? v? = v? ; Xw? 2, pw? $ w? w? 0. w? x? $ (x? @!? 0x? ` ? 8x? ? @x? `? hx? $ xx? $ x? k, y? ' hy? q' y? {, y? , y? ! y? T y? !? y? `? z? )) z? , z? D# 0{? , 8{? $& @{? < {? `? {? = {? D# 8|? , P|? > |? , |? $& |? < }? `? H}? = X}? ; }? @, }? D% H~? 1v p~? X. x~? ~? D% ~? ? ~? ? ~? `? ~? A% x? , ? > ? , ? $& ? < `? `? ? = ? ; ? , 0? > ? , ? $& ? < ? `? (? = 8? ; ? (, Ђ? @b (? q' P? , X? !C `? b ? T ? "? ? `? ȃ? @X X? , p? > ? -, ? $& ? < @? `? h? = x? ; ? ?, ? > ? . ? $& ? < ? `? ? = ? ; ? O, ? ' 0? . 8? @? Ј' p? ? ? @N ? P' 8? Z, P? > Љ? l, ؉? $& ? < ? @N H? = X? ; ؊? , ? > p? . x? $& ? < ? @N ? = ? ; x? , ? > ? . ? $& ? < `? @N ? = ? ; ? , 0? O8 ? ? 0. ? ? x" ? N ? ? ? @N (? 8? ? @? ? A? ? @C? ? H? ? D? ? F? ȏ? I? Џ? `K? ؏? ,? ? .? ? /? ? N? ? `1? ? &? ? @)? ? @w? ? @P? ? ? 0? 0, 8? , P? 0, `? 0, h? , x? `? ? @j? ? ? ? z? ? k? ? , ? R) ? @.4 ? ͝, Ȑ? Z) ؐ? .4 ? |, ? 0Z) ? -4 (? @; 0? , `? C, h? `* ? h, ? ) ? , ? @* ? C, ? o (? h, 0? ) ? C, ? R ? h, ? ) ? C, ? p`* (? h, 0? ) P? , X? ? , ȓ? f, ? ͝, (? + `? , h? ? f, ? M) ? h, ? m ؔ? C, ? { ? , ? `? , ? ͝, ȕ? + ? :( ? X? `% ? `? ? , ? & ? , (? , P? , x? C, ? Z), ? ? /4 ? C), ? `# ? /4 ? +), (? 8? /4 @? , H? # X? .4 ? `; ? *, ș? ; Й? , ? c, ? @. (? , H? h. ? ~, ? ? `44 ? F, ? P* ? 44 ? , Ț? Ў* ؚ? 34 ? 3[, ? * ? 34 ? Ж) (? p* 0? @* H? r* P? * X? `* `? `* h? * ? q* H? ; P? , ? R, ? 9I ? \, ? @' М? n, ? p( ? z, ? U ? , (? U H? , P? 7> ? , ȝ? , ? , ? , @? , h? , ? , ? , ? J, ? , 0? , X? , ? ", ? /, ? ڥ, ? d6 ? A, (? e @? J, H? * `? , h? ?) x? `64 ? W, ? ! ? 54 Ƞ? ; Р? , ? ; ? W, @? C, H? ( ? , ? . ȡ? , ? . ? ͝, (? + 8? 84 `? C, h? x ? , ? . ? , (? v 0? 4 ? , ? ) ? , ? @! ? T4 ? @, ȣ? أ? 4 ? o, ? ) ? `S4 ? O, ? P@" ? @4 ? r, (? ( 8? `Q4 @? A, H? `k) X? @4 `? T, h? 0) x? P4 ? &V, ? `@" ? 4 ? p, ? ) ? O4 ? p, Ȥ? ) ؤ? M4 ? , ? @) ? 4 ? , ? P) ? y4 ? , (? `) 8? y4 @? s, H? p) X? `z4 `? , h? У x? z4 ? {, ? ) ? `{4 ? , ? ) ? x4 ? , ȥ? ) إ? |4 ? , ? ) ? |4 ? ;, ? P' ? L4 ? *p, (? ) 8? @L4 @? , H? X? }4 `? C, h? ) x? K4 ? ], ? `' ? J4 ? q, ? ? H4 ? , Ȧ? p| ئ? G4 ? 0p, ? `) ? F4 ? =p, ? 0) ? E4 ? %V, (? 8? 4 @? Jp, H? ) X? 4 `? Qp, h? ) x? E4 ? q, ? # ? @C4 ? 4, ? Т) ? `A4 ? @, ȧ? o) ا? @4 ? , ? ) ? ?4 ? _, ? ~) ? @>4 ? P_, (? ' 8? 4 @? C, H? ) X? =4 `? j, h? x? 4 ? , ? 7 ? `~4 ? ^, ? r) ? <4 ? , Ȩ? 0k) ب? ~4 ? , ? 0) ? ;4 ? O 0? p 8? `? p h? F p? `( x? pe) ? " ة? ) ? , ? ) ? V4 ? ͝, ? ) ? `V4 ? |, (? `) 8? V4 h? ; p? g, ? ; ? ^, ? ; ? , (? ; 0? 4, h? ; p? _, ? 0; ? T, ? @; ? r, (? ; 0? p, `? , h? ) x? @u4 ? ͝, ? o ? x4 ? Wp, ? ) ? t4 ? ڥ, ȭ? 6 ح? t4 ? , ? ) ? t4 ? @, ? ~ ? 4 ? o, (? ) 8? `s4 @? , H? X? s4 `? %, h? ) x? r4 ? O, ? `3" ? @4 ? r, ? ' ? p4 ? A, Ȯ? 0) خ? @4 ? T, ? ) ? p4 ? *, ? 0& ? @o4 ? &V, (? ! 8? 4 @? p, H? ) X? `n4 `? p, h? ) x? `l4 ? , ? ) ? 4 ? , ? ˛ ? k4 ? , ȯ? ) د? y4 ? , ? ) ? y4 ? s, ? `) ? `z4 ? , (? 8? z4 @? {, H? ) X? `{4 `? , h? P) x? x4 ? , ? ) ? |4 ? , ? P) ? |4 ? ;, Ȱ? ) ذ? j4 ? *p, ? ) ? j4 ? , ? G ? }4 ? C, (? ) 8? i4 @? ], H? 0' X? `h4 `? q, h? ) x? f4 ? H, ? ) ? e4 ? h, ? ) ? e4 ? , ȱ? ) ر? c4 ? 0p, ? `) ? b4 ? =p, ? ) ? a4 ? Q, (? U 8? `a4 @? %V, H? 8" X? 4 `? Jp, h? ) x? 4 ? Qp, ? P) ? `4 ? q, ? `) ? ^4 ? 4, Ȳ? ) ز? \4 ? @, ? pq) ? @\4 ? , ? ) ? Z4 ? _, (? ) 8? Y4 @? P_, H? ) X? 4 `? C, h? ) x? Y4 ? j, ? l ? 4 ? , ? ? `~4 ? ^, ȳ? ' س? W4 ? , ? ha ? ~4 ? , ? ) ? W4 @? r H? s P? Z X? E! `? ! ? ) ? , ? `) ? @x4 ? ͝, ȵ? ) ص? x4 ? |, ? `) ? w4 (? `; 0? Sq, h? ; p? ^, ? ; ? , ? ; ? 4, (? ; 0? _, h? ; p? T, ? ; ? r, ? ; ? p, ? ? + ? v" @? , P? , ? , ? , ? %/, ? , й? , ? , ? u, ? , 0? }, @? , P? , `? `, p? , ? 4, ? 3!, ? A, к? , ? D, ? y, ? , ? , 0? , @? , P? , `? , p? ], ? , ? g, ? ,, л? E, ? !, ? , ? H, ? , ? @= (? 0= 0? ? 8? ? @? ? H? ? P? ? X? ? `? @? p? `L x? L (? L 0? 0@ ? L ? L ? @L ? L ? L ? L ? @L п? L ؿ? L ? L ? L ? L ? L ? @L ? L (? L 0? L 8? L @? L H? L ? L ? L ? L ? L ? L ? L ? `L ? @L ? @L ? L ? L ? L (? L P? L ? L ? L (? L 0? L 8? L @? L H? L P? L X? L `? @L h? L ? L p? L p? `L x? L ? L ? L ? @L ? `L ? L ? @L ? L ? L ? L ? L ? L ? L 8? L ? `L ? L 0? @L ? L ? L h? @L p? L x? `L ? L ? L ? L ? L ? L ? @L ? L ? L ? L H? L P? L X? L ? L ? L H? `L P? L X? L `? L H? @L ? L ? L ? `L ? L P? L X? L ? L ? L ? `L ? @L ? L ? @L ? L ? L (? @L 0? L h? L x? L 0? L ? @L ? L ? L ? @L ? L ? @L ? L ? L ? L ? L ? L ? L ? L ? L ? L ? L ? L ? L (? `L 0? `L h? `L p? ? x? L ? 0~D H? L P? L X? L `? `L ? `L ? P%D H? `L P? `L ? L ? L H? L P? L X? `L ? L ? L ? L ? `L ? L ? P%D ? `L ? `L ? L ? `L ? L ? L ? L ? `L ? L H? L P? @L X? L `? L h? L x? @L ? L ? `L ? L h? L p? `L x? `L 0? L 8? L @? L H? L X? `L h? `L ? L ? L ? L ? L ? L ? L ? L ? `L ? @L ? L ? L ? `L ? @L ? L (? `L 8? L @? L h? `L x? `L ? @L ? `L ? L ? L ? L ? L ? L (? L 0? L 8? L ? `L ? `L ? @L ? L ? L ? `L ? `L ? L ? @L ? L ? `L ? L ? L H? L P? L ? L (? `L 8? L h? L ? L ? }L ? L ? @L ? L ? L `? |L h? L p? {L ? L ? L ? L ? ? ? @L ? L ? L ? L ? L ? L ? }L ? @|L ? `L ? @L ? L ? xL ? xL P? L X? `L `? L h? xL p? L x? L ? L ? yL ? yL ? @yL ? >D ? PA ? L ? O@ ? L ? `L ? @L ? `L 0? `uL 8? L @? `L ? `L 8? @vL @? vL P? L X? L `? L h? `L ? yL ? Г@ ? `L ? L ? rL ? `L ? @rL ? `L ? `L ? `L ? `L ? L ? @rL ? rL 0? L 8? @L @? L H? @vL ? @vL ? L ? `L ? lL ? L ? L ? qL ? mL ? lL ? lL (? lL (? `L p? @L x? `L ? `L ? L ? iL ? L ? L ? L ? L ? @iL (? `L 0? L ? `L ? L ? `L ? L ? `L (? `L 0? qL 8? L @? L H? L P? @L X? eL `? @eL h? lL p? eL ? fL ? fL ? P%D ? @fL ? PO@ ? lL ? eL @ `L @ L @ `L @ @eL @ L @ eL @ `L @ L @ L H@ `L X@ L @ `L @ L @ L @ L (@ @L 0@ eL 8@ ``L @@ kL P@ L h@ `L p@ L x@ lL @ @L @ eL @ L @ lL @ eL @ @fL @ P%D @ `\L H@ `L X@ \L @ WL H @ L P @ @L X @ L h @ VL p @ yL @ @TL @ SL @ `SL @ SL @ RL h @ PL p @ L @ OL @ L @ QL @ L @ yL @ ML @ @ML h @ `L @ L @ L @ L @ `L @ L @ L @ JL ( @ KL 0 @ `L 8 @ P%D @ L @ L @ @HL @ HL (@ `FL h@ DL @ BL @ yL @ AL @ L @ @AL @ PL @ ML @ lL @ lL @ L @ FL @ L @ L @ @eL H@ VL P@ @UL X@ UL `@ @QL p@ NL x@ `KL @ HL @ FL @ EL @ `CL @ AL @ }D @ D h@ <L @ L @ @L @ L @ `L @ ?L @ yL @ @TL @ =L @ @iL H@ PL P@ L X@ `L `@ @8L h@ :L p@ 8L @ 7L @ L @ `:L @ eL (@ L 0@ L 8@ :L H@ 9L X@ L `@ L h@ `9L p@ `L x@ 9L @ `L @ 8L @ :L @ L @ @;L @ :L @ @ (@ :L @ PL @ L @ -L @ 8L @ -L @ @-L @ 7L @ L @ .L @ `L @ `.L @ L @ 0L @ 0L @ }D @ `0L ( @ 0L 0 @ /L 8 @ /L H @ `/L ` @ /L h @ .L @ :L @ PL @ L @ OL @ *L @ 8L @ :L @ `L @ 7L H @ L P @ L X @ *L ` @ L h @ yL p @ 9L x @ L @ L @ `9L @ L @ `L @ 9L @ O@ @ @ @ PL @ L @ L @ @L @ L @ L ( @ L h @ `'L p @ &L (!@ `L 0!@ L !@ L !@ L !@ `L "@ $L "@ L "@ `L #@ L #@ L (#@ "L 0#@ "L ($@ PL 0$@ L 8$@ L @$@ *L P$@ 8L X$@ :L $@ L $@ L $@ *L $@ @;L $@ `:L $@ eL %@ @ L H%@ L P%@ "L %@ L &@ L &@ PL &@ L &@ L &@ :L '@ `L ()@ yL 0)@ AL 8)@ L @)@ @AL P)@ 9L X)@ PL `)@ ML h)@ lL p)@ lL x)@ @eL )@ L )@ FL )@ L )@ ?L )@ `>L )@ >L )@ ;L )@ 0L *@ *L *@ (L *@ %L *@ #L *@ L (*@ L 0*@ ` L 8*@ L @*@ L H*@ _B P*@ }D X*@ D *@ L *@ L *@ L H+@ L P+@ `L X+@ L `+@ L +@ L +@ L +@ L ,@ L ,@ @L ,@ L -@ L -@ L -@ L .@ L .@ @L H.@ L X.@ L `.@ `L .@ L .@ L .@ L /@ L /@ `L 0@ L 0@ L 0@ @L 0@ eL (0@ ML 00@ L p0@ @ L 2@ OL 2@ L 2@ L 2@ L 2@ PL 2@ `L 2@ L 3@ L 3@ L 3@ L 3@ L 3@ @L 3@ eL 3@ L 3@ PL 3@ `L 3@ L H4@ L X4@ @ L `4@ L 5@ L 5@ `L 5@ `L 5@ L 5@ L 5@ L 6@ L 6@ L 6@ L (6@ L 06@ @L 86@ L 8@ K 8@ K 8@ @K 9@ K 9@ `L 9@ L 9@ L 9@ L 9@ L 9@ `L 9@ K 9@ `L 9@ `K 9@ `L :@ \L :@ eL :@ L (:@ L 0:@ @L 8:@ eL :@ K :@ P%D :@ `K :@ K p<@ K x<@ L <@ L =@ L =@ K 0=@ `L 8=@ K H=@ `L P=@ `K =@ K =@ K =@ P%D p>@ L x>@ L >@ L >@ @L >@ K ?@ @K @@ L @@ K @@ K @@ K @@ K @@ @K @@ K A@ K A@ L A@ `L A@ L A@ L A@ `L A@ L A@ `K A@ L B@ K HB@ `K PB@ K XB@ K `B@ K hB@ @K pB@ K B@ O@ B@ L C@ K C@ L C@ `L 8D@ L @D@ @L HD@ eL PD@ L D@ K D@ K D@ `K D@ K D@ 05D D@ @K pF@ K xF@ K F@ K F@ L F@ L F@ K F@ L F@ @K F@ K F@ K F@ K G@ L G@ L hG@ @K 0H@ `L hH@ VL pH@ PL xH@ L H@ \L H@ K I@ L I@ L I@ L J@ K J@ `K J@ K J@ L J@ `L J@ `L J@ K J@ K J@ `K (K@ L 0K@ L 8K@ L XK@ L `K@ VL hK@ L pK@ ?L xK@ uL K@ qL K@ K K@ L K@ K K@ H@ L@ K L@ `K L@ K L@ L L@ L M@ VL M@ ?L HM@ K M@ @K (N@ @K 0N@ `L 8N@ K @N@ L N@ K (O@ K hO@ rL O@ @L O@ L PT@ L XT@ L `T@ L hT@ L pT@ `L xT@ L T@ L T@ `L T@ L T@ L T@ @L T@ L T@ @L T@ `L T@ @L T@ L T@ L T@ L T@ L T@ L T@ L U@ L U@ L U@ uL U@ qL U@ kL (U@ L 0U@ @L 8U@ ``L @U@ \L HU@ L PU@ VL XU@ ?L `U@ L hU@ @L pU@ L xU@ `L U@ L U@ K U@ K U@ K U@ @K U@ K U@ K U@ K U@ K U@ K U@ K U@ K (V@ L 0V@ `L @V@ L HV@ L PV@ `L XV@ @L `V@ L hV@ L pV@ L xV@ @L V@ L V@ `L V@ L V@ @L V@ L V@ eA V@ @L V@ L V@ L V@ `L V@ L V@ @zL V@ L V@ O@ V@ vL W@ rL W@ PO@ W@ mL W@ jL (W@ `gL 0W@ `L 8W@ \L @W@ XL HW@ `VL PW@ `?L XW@ VL `W@ L hW@ ?L pW@ L xW@ L W@ L W@ L W@ @L W@ K W@ `K W@ K W@ K W@ K W@ K W@ O@ W@ K W@ `K W@ `K W@ `K X@ `K X@ K X@ K X@ }D X@ D (X@ \D 0X@ N@ X@ K X@ -L Y@ K Y@ K Y@ K HZ@ L PZ@ L XZ@ K `Z@ `K hZ@ K Z@ K ([@ K \@ K \@ @K \@ L \@ `.L \@ L \@ K \@ @K 0]@ K 8]@ @[@ @]@ @K H]@ K ]@ K (^@ K 0^@ K h^@ K p^@ @ ^@ K h_@ K _@ K _@ K _@ K `@ K `@ K hb@ K pb@ `K b@ K b@ K b@ `K b@ `K b@ K b@ L b@ K b@ K c@ K c@ @K c@ `K c@ K hc@ K c@ K c@ K (d@ K 0d@ K hd@ K pd@ @K e@ K He@ `K e@ K e@ K (f@ K 0f@ K hf@ `K 0g@ @K hg@ K pg@ @K g@ K g@ K Hh@ `K Ph@ K h@ @K Xi@ K i@ K i@ K i@ K j@ @K j@ @ D j@ `K j@ K j@ D hk@ `K pk@ K xk@ `K k@ K k@ D l@ `K l@ `K l@ K l@ L l@ K (m@ K @m@ /L Hm@ 0L Xm@ K m@ L m@ @K n@ K o@ K o@ K o@ K o@ `L p@ `L p@ L p@ `K p@ K p@ `K p@ K p@ K p@ K p@ K p@ `K (q@ K 0q@ L 8q@ A @q@ K s@ K s@ K s@ L s@ @K s@ K s@ @L s@ -L s@ K s@ K s@ K Ht@ L Pt@ @L Xt@ L `t@ `L ht@ `K pt@ @K xt@ K t@ L t@ L t@ `9L t@ K t@ L t@ L t@ K t@ L t@ K t@ L t@ `L t@ @K t@ K t@ K t@ K u@ K u@ K u@ @K u@ `K u@ K hu@ K xu@ K u@ K u@ K u@ K u@ K u@ K x@ @K x@ K x@ K x@ K x@ @K x@ K x@ K x@ K x@ K y@ L y@ `9L y@ K y@ L (y@ `K 0y@ @K 8y@ K @y@ K Hy@ K Py@ @K Xy@ L `y@ `K py@ K xy@ L y@ L y@ L y@ @K y@ K y@ K y@ K y@ K y@ K y@ K z@ K z@ u@ (z@ `K Hz@ K Pz@ K Xz@ K {@ @K {@ K {@ K {@ K 0|@ L 8|@ K @|@ K H|@ L P|@ L X|@ `K |@ K |@ K }@ K }@ ~K }@ K }@ K }@ L }@ K (@ K 0@ K 8@ K h@ `|K p@ A H@ L X@ L `@ L h@ @xK @ L @ yK @ @yK @ P%D H@ L P@ L @ L @ L @ @L @ 0@ @ @xK @ xK @ L 0@ L h@ yK x@ wK @ uK @ D h@ L p@ L x@ `L @ qK ȅ@ L Ѕ@ @L @ L @ qK @ `L @ eL (@ rK 0@ @rK @@ qK @ K @ iK @ iK ȇ@ L Ї@ L @ jK @ L @ L 0@ `jK 8@ @K h@ lK @ @lK @ lK @ kK @ `kK @ kK @ jK @ K @ dK @ cK (@ iK 0@ L h@ @K x@ L @ L Ȋ@ eK @ @ @ dK @ kK ȋ@ K Ћ@ ^K @ iK (@ L h@ _K @ _K @ K @ @K @ K @ \K @ @\K @ \K @ L @ L @ [K (@ L 0@ `L h@ ]K p@ ]K @ \K @ XA p@ XK x@ cK @ K ȏ@ XK Џ@ jK @ @K @ \K @ XK (@ YK 0@ ^K 8@ UK @@ K H@ L @ XK @ jK @ @K @ \K @ XK @ UK Ȓ@ PK В@ RK ؒ@ `PK @ PK (@ RK 0@ K 8@ QK H@ QK P@ @QK @ `RK @ @L p@ `uL x@ `L @ `L @ `L @ LK @ KK @ L @ KK H@ L P@ @yL X@ L `@ `K h@ @K p@ K x@ K @ K @ K @ L @ L @ LK @ K @ ~K @ `L ȗ@ @LK З@ L ؗ@ `L @ K (@ LK @@ @yL H@ Г@ X@ L (@ @K @ EK @ DK @ DK @ K ș@ DK @ L @ AK h@ PL p@ L x@ @?K @ @K @ ?K @ >K (@ `AK 0@ AK 8@ @K @@ `L H@ L P@ @K X@ CK `@ EK h@ @@K p@ K @ AK @ @ @ PL @ L @ OL (@ >K 0@ `L 8@ KK @@ `L Ȟ@ ?K О@ K ؞@ K @ LK @ K @ ~K @ L P@ Г@ @ 9K @ 9K H@ @K P@ AK X@ 7K `@ 6K h@ `AK p@ AL x@ CK @ @AL @ ?K @ PL @ ML ȡ@ GK С@ FK ء@ FK @ EK @ `EK @ BK @ <K @ `:K @ `7K @ }D @ D @ L @ L @ @3K (@ 3K h@ K p@ @yL x@ L @ L ȣ@ 3K Ȥ@ L Ф@ L @ FL @ L @ `L 0@ L 8@ "L @ /K @ /K @ L H@ ,K H@ L P@ lL X@ lL `@ @eL @ @5K @ 4K @ `1K @ /K ȧ@ -K Ч@ @+K H@ K @ )K @ L H@ (K @ %K @ XK @ L @ K @ !K @ K h@ "K @ #K @ L @ K (@ K @ L @ L @ PK (@ K @ @yL @ K @ K @ L Ȭ@ QK @ ` K @ K @ P%D h@ K p@ K @ L @ K @ K p@ L x@ `K @ K @ "L @ P@ @ @K @ K Ȳ@ L в@ L ز@ K @ dK @ PK @ ^K @ @K @ K @ @K @ K @ K @ iK (@ L 0@ K 8@ @K @ @yL @ K @ %K @ K @ K @ jK @ K @ L (@ K 0@ ^K 8@ @K @@ _K H@ `dK X@ L `@ @[K h@ L p@ `jK x@ K @ L @ K @ L @ K @ @UK @ @XK @ "K @ K @ XK @ XA 8@ `K @@ K H@ K P@ K X@ @ `@ @K @ K @ (K ȶ@ %K ж@ "K ض@ "K @ K @ FL (@ *K 0@ 'K 8@ $K @@ K H@ K P@ K `@ @ h@ K p@ K @ @ K @ L @ L ȸ@ K и@ ` K ظ@ @eL @ @K @ L @ `L 0@ *K 8@ K @@ K H@ K P@ L `@ K @ `K @ K @ J @ L @ L @ J ȼ@ `J м@ J @ л@ @ tK @ @eL @ @yL @ K @ J @ ` K @ K @ K @ K @ K @ K @ K @ J (@ J h@ XK p@ K @ L @ K H@ K P@ J X@ J @ @J @ P@ (@ L 0@ K 8@ @K @@ K @ |K @ "K @ @ @ L @ K @ J @ K @ K (@ K @ K @ K @ K @ `K @ `J @ J @ K @ L @ K h@ @J p@ J @ J @ J @ %K @ "K @ "K @ J @ J @ `J @ J @ A @ @ @ J p@ @K H@ L P@ L `@ K h@ iK @ @yL @ K @ jK @ @[K @ K @ XA @ P@ h@ `J (@ FL h@ J p@ J x@ J @ @J @ L (@ `K @ L @ `L @ L 0@ L 8@ L @@ J H@ L @ @J @ J P@ L X@ L `@ J h@ L @ J @ J h@ K p@ J x@ J @ L @ L @ J @ K @ `J @ 6K H@ J X@ J @ @J @ J @ K @ lL @ lL @ L @ FL @ tK @ @yL H@ K P@ J X@ J `@ J h@ J p@ J x@ J @ J @ J @ J @ @J h@ L p@ rL x@ ~K @ J @ J @ J @ @J @ J @ L @ L @ J @ L @ L @ L (@ J @@ @ @ L @ J @ `J (@ J 8@ L H@ L P@ @J X@ `L @ ~K @ J @ J @ J @ @J @ J @ L @ `L @ `L @ rL P@ J @ L @ `J H@ rL @ J H@ `L P@ rL @ `J @ J @ L @ `J @ rL (@ J 8@ J @@ J H@ J @ J @ J @ J @ `J @ J @ `J @ J @ `J @ J @ J @ J (@ `J 0@ J @ L @ `J @ J @ rL @ L @ @L @ L @ `L @ @TL @ J @ J @ `K `@ "L p@ ^A @ 1K (@ L 0@ L @ L @ rL @ L (@ J 0@ J h@ @J @ L @ L @ @J H@ `J P@ @J X@ rL @ P@ @ AL @ L @ L @ FL @ lL @ lL @ @eL @ J H@ @rL P@ J X@ J `@ J h@ J p@ `J x@ @J @ J @ J @ J @ L @ J @ vL @ L @ J @ K @ L @ J @ J (@ J 0@ J 8@ J h@ @J x@ J @ p@ p@ `J @ L @ @J @ L @ @L @ eL @ L H@ J X@ J H@ PL X@ L @ `K @ K @ `J @ L @ J @ @L @ J (@ J @ PL @ L @ L @ `L @ qK @ `L @ L @ L @ L @ @L @ eL @ qK @ ML (@ L 0@ L 8@ `L p@ qK x@ `J @ @ L @ PL @ L @ OL @ @J @ J @ L @ `L (@ qK p@ L x@ J @ L @ PL @ J @ `L @ `L @ L @ L @ J @ PL @ J @ PL @ L @ OL (@ `L 0@ @J h@ L x@ J @ `L @ `L @ @L @ J @ J @ PL @ L @ `L @ L @ @L @ L @ PL @ `L H@ J P@ J @ J (@ L 0@ L 8@ J h@ J p@ J x@ J @ J @ p@ H@ AL P@ J X@ J `@ @AL h@ J p@ J x@ J @ PL @ ML @ J @ J @ J @ @J @ J @ J @ J @ J @ J @ J @ J @ D (@ }D @ K @ J @ `L H@ L X@ `J `@ J h@ KK p@ `L @ J @ `K @ K @ K @ K @ J @ L @ `J @ J (@ `J 0@ J @ J @ J @ L @ L @ `L @ L @ @L @ L @ PL (@ `L 0@ `L h@ @J p@ J A L A LK A L ( A L 0 A OL 8 A `L p A PA (A L 0A L 8A OL @A `J HA J PA XK XA J `A J hA `J pA J xA LK A J A ~J A `L (A L 0A K @A `K HA K PA J XA K `A J hA J pA K xA J A K A `J A K A J A `K A J A K A L A L A L A `L A J @A J HA eA PA @J A K A yJ (A K A L A vJ A vJ A `J A J A J (A uJ A `K A wJ A K A `J A wJ A wJ A L A `.L A L A L A `J A K A `L A K ( A K 0 A J h A yJ p A `K A L A xJ P A PL X A `J A K A L A qJ A pJ A PD A PL A `J A @pJ A `qJ A nJ h A `L A lJ A J A @qK A ML A qK A J A PL A J (A @AL 0A `nJ hA J pA @J xA J A @J A J A J A zJ A rJ A mJ A `kJ A D A jJ A iJ A iJ (A `L 0A `L A `L A J A J A xL A L A >D 0A @vL A @fJ A fJ A eJ A K A L A fJ A J (A K 0A J 8A K hA fJ A cJ A cJ A bJ (A dJ 0A LK 8A L @A @J PA J XA `nJ `A L pA J A bJ (A A hA `L pA `L A K (A K 0A K hA `K 8 A L @ A K H A L P A L X A \K ` A `.L h A 7K p A @`J x A `K A EK A `J A @K A _J A `K A ~K A K A `_J A @K A _J A K A K A K A @K A @K A @K A K A K A K A `K ( A `K 0 A K 8 A K @ A K H A L P A ^J X A \K ` A K h A jK p A K x A K A @K A K A @K A K A fJ A 6K A K A `^J A ^J A K A K A L A |K A tK A @qK A jK A `dK A _K A @[K ( A @XK 0 A @UK 8 A QK @ A @K H A @LK P A xL X A GK ` A @5K h A *K p A ` K x A J A J A K A J A @rL A ]J A J A J A LK A dJ A K A K A `0L ( A 0L 0 A /L 8 A K H A K P A PA X A A ` A `K h A K p A K x A K A `K A K A K A K A K A K A K A K A K A A A K A A A \A A K !A K !A .L !A @K !A K !A A (!A K 0!A K 8!A ~K @!A |K H!A {K P!A sK X!A @oK `!A `gK h!A bK p!A ]K x!A YK !A VK !A SK !A `NK !A PA !A GK !A 5K !A GK !A @*K !A @5K !A K !A *K !A J !A ` K !A J !A J "A `J "A J "A J "A K "A J ("A J 0"A J 8"A @rL @"A `J H"A J P"A @jJ X"A J `"A gJ h"A dJ p"A bJ x"A `J "A A "A D "A A "A 0aA "A }D h#A ZJ %A L %A TJ %A K %A KK %A TJ %A SJ p&A L x&A `L &A L &A ZJ &A VJ &A `K &A `L &A K &A K &A K &A L &A K &A UJ &A @L &A `UJ &A UJ 'A TJ 'A K 'A TJ P'A VJ X'A VJ `'A PD p'A @ D x'A D 'A @VJ (A L (A L (A @KJ (A KJ (A L (A @L (A L )A LJ )A LJ )A KJ )A TJ )A `K h)A MJ p)A LJ *A L *A L H*A L P*A @L X*A L `*A qK *A `GJ *A FJ *A `L *A L (+A L H,A L P,A L X,A OL `,A CJ h,A KJ x,A `L ,A LJ ,A L ,A LJ ,A KJ ,A TJ ,A `K ,A L ,A `L (-A DJ 8-A +A H-A *A -A AJ .A L .A iJ .A @K /A `=J /A VJ /A `K /A L /A TJ /A UJ /A @L /A K /A >J 0A @>J 0A L 0A L 0A @J 0A KJ 1A @J H1A `:J h2A L p2A L x2A @KJ 2A 6J 2A `=J 3A LJ 3A ZJ 3A LJ 3A `L (3A K 03A UJ 83A @L @3A >J H3A TJ 3A 7J 3A `7J 3A P%D 3A /L 3A .L H4A L P4A L X4A @KJ 4A LJ 4A ZJ 4A 3J 4A `7J 4A P%D 6A L 6A L 6A @J 6A KJ 6A @.J 7A 6J 7A L 7A @L 7A L 7A @J 7A L 7A .J 7A LJ 7A `L 7A K 7A TJ 8A L 8A "L (8A @L 08A L @8A L 8A 0J 8A 0J 8A /J 8A /J 8A /J 8A `)J 9A L 9A L 9A `)J H:A L P:A ZJ X:A `J `:A `)J :A )J :A 8A ;A `UJ ;A TJ ;A UJ <A UJ <A ZJ <A eL H<A `'J <A TJ <A `K <A TJ 0=A %J 8=A $J >A qK >A ML >A PL >A FL >A K >A @yL >A L >A @eL >A J ?A J P?A @WJ X?A OJ h?A `IJ p?A EJ x?A BJ ?A ?J ?A @;J ?A 9J ?A 4J ?A `2J ?A *J ?A 'J ?A `%J ?A `#J ?A D h@A L p@A L @A TJ @A L hAA L xAA J AA `K AA UJ hBA L pBA L BA J BA @ J BA @J BA 6J BA LJ BA J BA UJ KA TJ KA J KA J KA J KA @J KA J LA K LA J LA `J LA J LA J (LA SJ 0LA L 8LA L @LA J HLA `J PLA J XLA J `LA J hLA `J pLA J xLA J LA J LA `J MA K MA K MA K NA ZJ NA J 0NA `J 8NA K @NA J HNA `K PNA @K XNA `jK `NA @K pNA J xNA J NA @J NA `K NA `L NA K NA L NA J NA PD OA ` J OA J (OA J HOA @ J POA J XOA J pOA J xOA BA OA J OA D OA J OA /L OA J (QA `J QA J QA L QA ZJ QA J QA `J QA L RA J RA J 0RA QA @RA J UA TJ UA `=J UA I UA J UA J UA @J UA J UA `J UA J UA J UA J UA `J UA J UA `J VA I VA `J VA ZJ VA K VA K VA K WA `jK WA @K WA J WA L XWA I `WA ` J hWA PD xWA J WA RA WA I WA I WA J WA `RA (XA I 0XA @I hXA I ZA L ZA iJ ZA 6J ZA L ZA K ZA iK ZA L ZA @K ZA K ZA PK ZA ^K [A dK [A cK H[A `L P[A jK X[A L `[A K h[A @I p[A ^K x[A @K [A _K [A I [A I [A @K [A L [A \K [A @\K [A \K [A `L \A XA 0\A `K 8\A K X\A dK `\A I h\A I H]A fJ ]A \A (^A K ^A iJ ^A fJ _A I _A `K P_A "L `_A ^A H`A I P`A `J `A `J `A @I `A _A HbA L XbA `=J `bA `J hbA J pbA `I bA UJ bA I bA @L cA I cA `L XcA cA xcA 0aA cA @I cA I dA L dA `=J eA UJ eA >J eA TJ eA @L xeA cA eA L gA L gA L gA I gA J gA @ J gA @J gA 6J gA `=J gA KJ gA K gA K hA LJ hA J hA L hA TJ hA `K hA UJ hA >J hA I hA L hA I hA @L hA ZJ 0iA I @iA eA PiA I XiA P%D `iA `7J iA .L iA K jA @K jA @K pmA @K xmA `L mA @K mA @K mA `I mA L mA K mA \K mA L mA `J mA L mA `K mA @K mA VJ mA L mA ZJ nA UJ nA L nA .J nA J nA `J (nA J 0nA @5K @nA J HnA LJ PnA KJ XnA LJ `nA `UJ hnA @J pnA J xnA J nA >J nA I nA I nA ^J nA \K nA I nA I nA I nA I nA @I nA @J oA [J oA pjA (oA ZJ @oA YJ PoA jA XoA jA `oA @"J hoA "J xoA /L oA iA oA iA oA !J oA J oA J oA J oA `J oA @I oA @I oA @I oA @I oA I oA I oA I oA I pA `I pA I pA I qA `I HqA `I PqA I `qA `I rA L rA I PrA K hsA I psA I sA `I tA I tA I HuA I XuA I `uA I huA L puA PL uA K uA I (vA @I hvA I vA PL vA I vA I (wA I wA I wA I HyA PL PyA `L XyA I `yA @I hyA I pyA I yA `L yA I yA @I zA I zA I zA 0~D (zA I 0zA `I 8zA I @zA I HzA `I zA I {A I {A PL {A I |A I P}A I h}A I p}A I x}A I }A I }A I }A I }A I }A I }A I ~A `I ~A `I ~A `I ~A D hA PL pA `I xA I A @}L A L A L A I HA @I A I A I HA I PA I A I A I A @I A I A I A @I A I A I 0A I 8A @AL @A `I HA AL PA I XA |L `A I hA I pA I xA I A @I A I A I A @I A I A I A L A I A L ȄA I A I A I (A I 0A I 8A I @A `I HA I PA I XA I `A I pA pA xA `I A I A 0A A I A I A I A I A B A PL A I A I A `I A I ІA L A ~K 0A `I 8A I @A I HA I A L PA I A I A I ȉA pA ЉA `I ؉A I A }D hA I A I A I A I A @I (A I 8A ?C A I (A I hA I A @I (A I A `I A I A `I A `I A I A I ȏA `I ؏A ?C A A A `I АA @I hA `I PA @I A I A I A I ȓA I ؓA I A I A @I A ~I A ?C A A ȔA zI HA L PA I XA @I A xI ȕA wI A sI A A ȖA qI (A I 0A {I @A `yI PA wI XA vI `A rI hA pI xA ?C A A (A L hA I A L A I A @I A L A I A @I A K A `I A I A lI A I HA L PA @8L A lI HA oI PA @nI `A lI hA @kI xA iI A @hI A gI A eI A ?C A A (A `I hA aI A L A @K A K A I xA `I ȠA _I A \I (A YI A \I hA I xA _I A `]I A [I A `XI A VI A TI A SI A RI A PI ФA ?C ؤA A A L A `I ȥA `I إA KI A KI A @KI A KI A JI (A LI A L A I A L A K A `AI A AI A @I A K A @I A `@I (A K 0A @I 8A `I A JI A @KI A KI ЩA `I A KI A J A @BI A BI HA BI hA A ȪA K ЪA `AI A AI A L A K A BI (A :I 0A K 8A @I @A 9I HA 9I A JI A KI A BI A @KI A L ȮA K ЮA :I A ;I 0A A HA A PA :I `A A pA A A L A 1I A BI A K pA BI A 2I HA KI PA @KI XA KI `A JI A /I HA `I A `-I (A L pA +I @A L HA KI pA `2I A I A II A GI A <I 0A @4I 8A 0I @A .I PA +I XA )I `A (I hA `'I pA @&I xA $I A #I A ?C A A A pA A A HA L PA `I XA I `A I A `I A I A I A I A I A L A K HA I ȹA L йA 1I A I A `2I A I A L A K HA I ȻA L лA vL A I A \I A `I A I A I ȾA `2I A \I hA I pA !I xA I A I A @I A I A I A I A I ȿA I пA @I ؿA I A I A I A ` I A I A I A ?C A ЁB A D (A A A L A `I A I A I HA `I `A I hA I A I HA I (A L 0A K 8A K @A I A I A BI A L A 1I A K A I A I (A BI xA A A L A K A I PA I A `+I HA L PA K XA @H A I hA L pA vL xA K A @H A I A I A I hA L xA WI A I A I (A L hA `I A VI (A L 0A L 8A @}L @A SI A `I A L A QI HA `L A QI A H A `H A `2I A \I HA I PA I XA I hA I xA @ I A `H A H A H A H A H A @H A H A H A H A H A @H A H A ?C A ЁB A D A A (A H 0A `L 8A *L @A H A I A I A I A I HA @H XA H (A `L 0A H 8A `H HA `H PA H XA H A I A I A I A I A H A `H A H HA I A H A I HA H A H A I A `I A H A `H A @H A I A I A H (A H hA I pA I A H (A I 0A I hA H hA H A L A H A I A H A I A H (A H @A L HA @H PA I XA H A I A H hA K pA @K A H (A H 0A H A H A <L A H A @H A `H A K A I A I A I A I A @I A I A I A I A @I A I A I A I A @I A I A I (A I 0A @I 8A I @A I HA `I PA I XA I `A I hA I pA I xA I A `I A I A I A `I A I A I A I A `I A I A I A I A I A I A I A @I A L A H A L A `H A H A I A I A @I A @I A I A I A @I A H (A I 0A I 8A I @A I HA I PA I XA @I `A ~K hA I pA I xA @K A `I A I A I A oI A I A I A I A I A I A I A `I A I A I A `I A I A I A I A @H A H A @I (A `I 0A I 8A I @A I HA I PA I XA H `A H hA `H A I A D A @I A A A @A A A A A A A A @A (A I 0A I 8A I @A I HA `I PA `I XA }I `A I hA oI pA I xA dI A oI A NI A I A @"I A I A ` I A I A H A I A K A H A `H A H A H A H A H A H A H A H (A H 0A H 8A H PA H XA `H `A H pA H A A A A A ?C A @L A L A H A `L A H A `H 0A 05D 8A H @A H A K A H (A H A K A H A H A K A `H A H A K A @H A H A H HA @H PA H XA `H hA K pA K xA QK A @H A H A H A @H A H A @QK A H A H A K A H A H A K A QK A @H (A H 0A H 8A H @A @H HA H PA H `A `H hA H pA H xA H A @H A H A @QK A H A K (A I 0A @H 8A H @A `H PA K XA K `A QK hA @H pA H xA H A @H A H A @QK A H A H A H A H A H A I A H A H A H A `H A H A @H A H A I A H (A H 0A L hA `H pA @H xA A A 0A A H A H A H A H A B A H A H A H A H A `H A H A A A H A H A @xK A H HA H XA `L A H A `H A `L hA I xA @AL A H A @H A H A @H A `H A `L A I A @AL A H HA @H XA H `A @H A @H A H ( B H 0 B H B H B `H B `L (B I HB @AL B H B H B `H B H B H B }D HB H B H B `H B `L B I B @AL (B H hB H xB H B H B H B H B `H B `L B I B @AL (B H 8B H @B `H HB H B H ( B @H B H B H B H B H B `H B L B H B H B }H B @H B `H B `L B H B H B }H 0B I 8B H @B H HB }H PB @AL B @H B H B H B ~H B {H B @zH B }D B H B `H B `L (B I 8B @AL HB H B H B wH B vH (B tH B H B `H B `L (B I @B @AL B H B sH B rH B qH B H B `H B `L B I B @AL B H B nH B mH B kH hB +I B iH HB L PB H XB H `B SI B @H B hH B `H B L B +I HB `fH PB fH B @H B `H B `L p B I B @AL B @H B jH B hH B fH B dH B cH B }D B H B `H B `L B I B @AL h B H x B `H B _H B L B K h B H p B `H x B `L !B I !B @AL !B H !B H !B `]H "B \H "B H "B `H "B `L #B @AL $B H $B YH h%B PL p%B @L x%B L %B UH %B TH %B ~K %B `L %B vL %B UH %B K X&B VH `&B VH &B K &B `QH ('B RH H(B L (B UH (B K (B RH )B `RH )B `PH )B PH ()B OH )B UH *B vL *B @XH *B @H +B L +B `J +B KH ,B TH ,B UH P,B ~K h,B UH p,B K ,B vL ,B @XH ,B @H .B @XH .B WH .B RH .B MH .B KH .B `HH h/B K /B `FH /B FH 0B CH 1B DH 1B vL 1B L 01B `J h1B FH x1B /B 1B EH 1B `DH 2B H 2B AH 2B L 2B DH 3B @H H3B AH `3B @AH 3B L 3B L 3B L 4B PL 4B H 4B @H 4B `H 4B `L 5B I 5B @AL 6B @XH H6B @H X6B =H `6B `<H 7B H 7B `L 8B L 8B L 8B 9H 9B H 9B `L 0:B H 8:B `L :B @0H ;B @-H <B L <B L <B @}L <B @+H h=B K p=B K x=B @)H (>B L 0>B L 8>B 'H p>B H x>B `L >B 0H >B `(H h?B K p?B @}L x?B L P@B `%H @B K @B @}L @B L AB @"H BB H BB H BB `L BB 0H DB L DB `H DB H DB H DB H DB K DB `H EB L EB H EB `K hEB ` H EB `CB EB @CB EB CB EB CB EB BB EB BB GB @AL GB 0H GB +H GB H (HB H 0HB 9H @HB 7H HHB 6H PHB 4H XHB 2H `HB @1H hHB .H pHB +H xHB )H HB &H HB #H HB ` H HB H HB H HB @H (IB H IB @L IB `H JB H KB +I KB @L (KB `H hKB `H (LB eL 0LB @L hLB @ H MB `H NB H NB 0H NB `H OB L OB `/H OB @}L OB `H 0QB I @QB `H HQB `H PQB eL QB H QB H QB H QB H QB H QB H QB H QB ` H QB H QB H RB @H RB @H TB H HTB G TB @H UB G UB H UB G VB @H VB `L VB G WB I hXB @H pXB H XB H XB H XB G XB G XB `G XB G XB G XB D HYB L PYB G YB `G HZB `L ZB G [B @AL [B H [B H [B bB [B G [B G [B G H]B H X]B G `]B @G h]B G ]B PL ]B `/H (^B L ^B L ^B `J ^B @K _B @}L _B @H _B `G _B @L aB @AL aB 0H haB @H xaB G aB @G aB G HbB L PbB @}L XbB @K `bB @H cB `G dB H dB `G dB G dB L dB @K heB L peB @K eB @}L fB @L fB @G HfB G XgB +I `gB @L gB G hhB G phB @L hB G iB L iB L iB L jB @K jB @}L PjB @H XjB L jB G HkB L PkB @K kB @L lB G mB I mB @K mB @G mB eL mB G mB @L mB G (nB H 0nB G @nB G HnB G PnB G XnB G `nB @G hnB G xnB `G nB 0lB nB D HoB L PoB @K XoB @H pB L pB @}L pB @H HqB L PqB @K qB G rB L rB @}L rB @BI rB G rB @K rB @H hsB K xsB I sB L sB @G tB K tB @H tB @}L uB G uB `G uB G XwB I wB `J wB L wB H wB `G wB G wB G wB @G xB `G xB G xB G (xB vB yB @H yB G yB L yB `J (zB L 0zB `J 8zB @}L hzB I zB G H{B 9L {B `G |B eL |B I |B G }B L }B H }B @K }B G ~B G ~B L ~B @H (B vL hB G B L B `J B @H (B G B `J B G hB L pB I B 9L B `G B eL B `H B H B G B G (B G 0B G 8B G @B G HB G PB G `B G hB `G pB G B ЁB (B @H 0B H 8B H @B H HB @H PB H XB H `B H hB @H pB H xB H B H B @H B H B H B H B @H B H B H B H ȅB @H ЅB H B H B H B @H (B I 0B I АB I ؐB I B I B L B L B vL B K B H B G B @H B @H @B @G HB XK PB G `B G pB G B G B G B G B G B G B G B L B @G ȑB G БB G ؑB G B @G B G B G B G B @G B G B H B G 0B H 8B G @B `H HB H PB @H XB H `B I hB H pB H xB @H B H B H B H B @H B H B H B H B @XH B UH ȒB RH ВB @H ؒB H B I B H B @H B H B H B @H B H B H B G (B H 0B ~K 8B L @B K HB @H PB :I XB H B H B B B H B B B H ؓB B B H B H B H B `H B H B H B B (B H 0B @H 8B `H @B H HB H PB H XB H `B H hB yH pB @H xB `uH B H B pH B H B lH B H B aH B @H B ^H B H ȔB ZH ДB H ؔB XH B H B `GH B @XH B `BH B >H B @;H B @H B @H B H (B H 0B H 8B G @B @H HB G PB H XB G `B H hB G pB @H xB G B H B G B H B `G B H B G B @H B G B H HB L XB G ЖB G B G B `G B G ȗB L HB L `B G B G B G B G B G B D B K B G B SJ ȚB `G B L B K B SJ (B G 0B `G hB `G pB G xB G B G B G B @G (B L 0B K @B J B G B G B K B G B G (B G xB PC B G HB @G XB G `B G pB G B G B G B `G HB L PB G `B @K hB @K B @G B G B G B `L B G B I B I PB G hB B pB `G B G B @G B G B @G (B `G 0B G 8B G @B G PB B ХB G hB L pB L xB L B @G ȦB @G ЦB G ȧB G ЧB G اB G B G B L B @K B G (B G 0B G hB G B G B G B G B G B G B G hB `G pB K xB K B L ȪB G B `G B K B K B L B G B K B G B K B K B `G B K B K B L B G B K HB G ȭB `G ЭB K حB J B ~G HB `G PB K XB J B }G ȮB `G ЮB K خB `{G B {G ȯB `G ЯB K دB yG B yG B <L B `wG B wG B @K (B @I pB vL xB ~K B `K B `G B @K B wG B K B wG B xG B `wG B wG B `tG B tG (B tG ȳB qG гB qG سB `wG B wG (B `G 0B K 8B @G hB rG B @oG B oG B `wG B wG hB `G pB oG xB @G B oG B K B -L B `lG B lG B kG B kG B `kG B kG hB `K pB K B lG B gG B L B `gG B gG (B K pB L xB :I B `L B hG B @hG (B G 0B G 8B @G @B G HB G PB G XB @G `B G hB G pB G xB @G B `G B K B G B G B @G B G (B G 0B @G 8B G @B G HB @G PB G XB G `B lG hB gG B G B B ȼB @G мB @G ؼB G B }G B |G B `zG B xG B uG B sG B @pG B mG B iG (B eG B B B @^G ȾB K B `G B @K B :I (B L 0B ZG HB `ZG PB ZG XB YG B @[G B [G B /L B 0L B `G B @K B :I B WG B VG B K (B @[G 0B /L 8B 0L hB K pB -L xB `lG B SG B `G B @K B :I B L (B `TG @B @B HB 0L PB /L XB TG B `QG B -L B QG (B PG 0B PG 8B `PG @B K HB PG PB OG B `G B @K B :I B bG B `K B K B `L B `L B QG B QG B gG xB B B 0L B @^G B K B K B -L B `lG B PG B HG B @HG B @BI B `J B HG B `G B @K (B :I 8B IG @B HG B IG B B B 0L B /L B K B @IG B K B QG B I B @K (B @K 0B K hB `G pB @K xB ]G B bG B K B DG B 0L B /L B @@G hB >G (B @=G B QG B `K B K B K B 8G HB `G PB @K XB ]G `B `G hB bG pB `9G xB K B K B 8G 0B 4G 8B @K @B H HB 3G PB 3G XB `3G `B 3G B `G B @K B :I B L B ]G B K (B @L 8B VG HB TJ PB KK XB WG B 5G B `5G B 5G B 4G B 4G B `4G B ,G B ,G B +G B +G B `+G B +G B *G B K B *G B `J B `*G B @I B *G B @}L B `G B @K B :I B ,G B ,G B `,G (B K 8B `J @B L HB WG PB VG XB @L B .G B -G B J B -G B `-G B -G 0B -L 8B `lG @B `G HB ``G PB TJ XB G `B @K B `G B @K B :I B bG B L B `K B G B K HB G hB 3C pB 0L xB /L B `dG hB G hB G pB aG xB K B L B G B G B B B B B B PB G XB @L `B G hB G B L B `cG B G (B cG 0B `bG 8B aG HB KK PB K XB G `B L B PB B B B B PB G XB K `B G hB G (B G 8B K @B G HB G PB G B B xB TJ B HG B ` G B G B G B G B G B G hB aG xB :I B `G B @G B `cG B WG B _G B K B L B cG B G B L B K B L B G B G 0B `B 8B B @B B HB B PB G XB @IG `B K hB G pB @BI xB -L B `G B ``G B @G B G B G B G B @G B G B G B G B @K B @G B G B G hB `G pB @K B :I B L B `G B aG B bG B `cG B G B G B `L B `L B QG B L B QG B gG (B G @B 3C HB 0L XB `dG hB `G pB G xB G B `G B G B ^G HB K PB K XB `lG `B -L B bG B K B K B I B K B -L hB K pB I xB K B F (B `QG 0B `F 8B F @B cG HB 3G XB F `B `wG hB wG pB @K xB @I B TJ B `lG B `G B -L (B L 0B ~K 8B `K @B `G HB @K XB :I `B L pB bG B G B wG B K B wG B `L B `L B QG B gG B F B `F 8B 0L @B /L PB F XB F `B `F hB F xB F B F B F B F B ^G B F ( C G 0 C @G h C G C `9G C \G C \G C [G (C `cG 0C cG @C bG HC G PC bG XC TJ `C KK hC G pC G xC G C @G C G C `bG C G C bG C @G C G C aG C aG C `aG C aG C `G C `G C ``G C -L C `G C _G C `lG C lG C _G C `_G (C _G 0C ^G 8C G @C G HC @G PC ^G pC `G xC ``G C lG C -L C `G C `lG C _G C _G C `G C L C K C QG C ]G C F C \G C `ZG C \G C ZG C [G C YG C `cG C L (C cG 8C bG @C G HC bG PC lG XC TJ `C KK hC `bG pC bG xC @`J C `9G C aG C aG C `aG C `!G C aG C G C G C `G C G C @G C G C G C G C `_G C L C G C _G C ^G C ^G C F ( C @G h C dG x C `dG C 0L C dG C /L C cG C cG C D C C C \G C C C @WG C TG C RG C LG C DG C BG C @G C @?G C =G C `;G ( C 9G 0 C C 8 C 6G @ C .G H C !G P C ?C X C @ G ` C `G h C G p C P C x C G C C C G C G C ?C C G C G C @F C F C B C D p C :I C /L ( C K h C F C K C -L H C `G P C @K X C `F ` C L C `TG C `QH C K C -L (C H C `G C @K C `F C `K C L C K C `L C `L C QG C QG C gG (C F HC K PC -L XC @K `C @K hC K C F hC K pC -L xC lG C `G C @K C :I C QG C lG C /L C K C `G C @K HC F C K C -L C @K (C `G 0C @K 8C `F @C `K C @@G hC K pC -L xC @K C @K C `G C @K C `F C `K C K (C >G C K hC `G pC =G xC K C L C `L C K C <G C K C `F C `G C =G C K C L HC :G C `wG C wG C @F C F C F C F C `G C =G C K C <G C K C K C L C @K C :I C `_G ( C tG 0 C `tG h C F x C 3C C `dG 0 C 4G 8 C -L @ C @K H C @F P C 3G ` C F h C `K (!C `G 0!C @K @!C :I H!C L P!C `F X!C HG h!C K p!C @F x!C L !C F !C F !C F !C @L !C L !C @F !C L !C `.L !C WG !C K "C @F "C `5G 0"C F @"C F H"C F X"C /L 0%C F 8%C xL @%C @BI H%C F P%C K X%C @K `%C <L h%C F x%C @}L %C K &C `G &C @K &C :I (&C @F 0&C F 8&C `K @&C F H&C xL X&C F `&C K h&C F p&C @F x&C L &C K &C WG &C VG &C @L &C F 'C `"C 'C -G ('C `-G 0'C F (C `G (C @K (C :I ((C WG 0(C `!G 8(C VG h(C G P*C -L X*C F `*C J h*C `F p*C F x*C G *C F *C F *C `G *C @K *C :I *C L *C G +C eL H+C G h+C 3C p+C /L +C `dG ,C G ,C `G ,C @K ,C cG ,C :I ,C @G ,C K -C aG H-C @F .C `F H.C `G P.C @K X.C F `.C `G .C F 1C K 1C @L (1C -L 01C `G 81C ``G P1C F X1C K `1C F h1C `F 1C :I 1C cG 2C K 2C G 2C `G 2C =G (2C K 02C <G 82C K @2C K H2C F P2C @G 2C 3C 2C /L 2C `dG 3C K 3C K 5C @BI 5C `G 5C -L 5C ``G 5C G 5C G 5C @K 5C G H6C L P6C `G X6C @K h6C :I p6C `G x6C G 6C G 6C `L 6C `L 6C QG 6C L 6C QG 6C gG 7C G 7C `G (7C 3C 87C /L @7C `dG P7C F X7C F `7C ^G 8C K 8C -L H8C G 8C K 8C K 8C -L 9C K 9C @I 9C `G :C K :C K :C `G :C F h=C `QG p=C F x=C cG =C `wG =C wG =C F =C @K =C @I =C TJ =C `G =C -L H>C L P>C ~K X>C `K `>C `G h>C @K x>C :I >C L >C wG >C K >C wG >C `L >C `L >C QG >C gG ?C F ?C `F 0?C /L @?C F H?C F P?C F `?C F h?C ^G ?C `!G (@C `cG 0@C cG @@C bG H@C G P@C bG X@C TJ `@C KK h@C G p@C G x@C G @C @G @C G @C `bG @C G @C bG @C @G @C G @C aG @C aG @C `aG @C aG @C `G @C G @C G @C @G @C `G AC ``G AC -L AC `G AC _G AC `lG (AC lG 0AC _G 8AC `_G @AC _G HAC ^G PAC ^G PDC `G XDC ``G `DC lG hDC -L pDC `G xDC _G DC `lG DC _G DC `G DC L DC K DC QG DC `F DC `cG DC cG DC G DC bG DC lG DC bG DC TJ EC KK EC `bG EC bG EC aG EC aG (EC F 0EC @F 8EC `aG @EC `J HEC `!G PEC aG XEC L `EC `G hEC `_G pEC F xEC `.L EC _G EC ^G EC ^G EC F EC `dG EC /L EC K EC @F FC F FC D FC @C FC `F (FC F 0FC F 8FC @F @FC F HFC `F PFC F XFC F `FC F hFC F pFC F xFC F FC F FC F FC ?C FC F FC F FC F FC ?C FC F FC F FC K FC F FC F FC D hGC K HC K HC H IC L IC vL IC `L IC G IC F JC L JC yJ JC `F JC F JC F (KC `F LC `F LC @K LC K LC F MC G MC G MC F MC J MC `G MC :I MC `J MC K MC @G NC F NC KC NC F pOC @K xOC K OC F OC G PC K HPC F hQC L pQC L xQC @K QC K RC G RC G RC F (RC F 0RC @F 8RC K hRC F SC vF SC uF SC uF hSC L pSC vF xSC vF SC @K SC `wF SC wF WC vF WC uF XC uF XC G XC sF XC `sF XC sF (XC rF 0XC J 8XC tF @XC rF HXC sF PXC `bG `XC KK hXC G YC F YC K YC +I YC tF YC sF YC `bG YC vF p[C vF x[C uF [C mF [C mF [C fF [C fF \C L \C vF \C @K \C K 0\C gF 8\C gF @\C K H\C G P\C K `\C @G h\C `gF x\C :I \C `hF \C hF \C pC \C ]C (]C mF h]C mF ]C mF ]C mF (aC fF 0aC cF 8aC cF @aC vF HaC uF PaC mF XaC sF `aC G haC sF paC @cF xaC J aC fF aC cF aC bF aC J hbC F xbC WG bC tF bC K bC sF bC G bC K bC gF bC gF bC @G bC `gF 8cC ]C @cC P]C HcC ]C cC ]F dC @]F dC `F dC [F heC XF eC XF HfC VF fC `VF gC `L gC L HgC SF gC `L gC L gC ZF hC SF HhC QF iC `L iC L iC ZF jC PF jC @PF jC PF jC G jC G (jC L 0jC @)H 8jC OF jC `F jC ]F jC K jC KK jC F kC WG kC `K kC `J kC wJ (kC K pkC @`J mC ZF mC G mC @JF pnC K xnC KF nC JF nC QG nC `L nC JF nC L nC @L nC :I nC VG nC _G nC G nC `G (oC LF HoC KF PoC kC XoC `KF oC L oC K oC GF pC FF pC FF pC @FF HpC GF PpC FF XpC FF `pC @FF hpC FF qC FF qC GF qC @L qC @FF hrC GF prC FF xrC `BF rC FF HsC L PsC @K XsC ?F sC GF sC `@F sC FF sC @L tC L tC @K tC vL tC FF tC FF puC FF HvC K PvC @K XvC @}L `vC L vC FF vC @FF vC lK wC L wC 8F wC FF 8xC 9F @xC 9F HxC @9F xC G HyC L PyC @K XyC @}L yC L yC L zC @L {C L {C L {C L P{C @H X{C `L `{C G h{C @L }C G H}C @GF P}C DF X}C BF `}C @F h}C `>F p}C <F x}C `;F }C `7F }C @6F }C 5F }C 3F }C 2F }C 0F P~C L X~C `L `~C L ~C /F (C @K hC IG 0C L 8C `L @C L C /F C [G HC @}L ЁC [G hC .F xC GF C K C @K C @}L C L C K C L C ZG C @GF PC @`J XC -F `C +F hC *F pC (F C K (C %F ȅC @}L C :I C `L C L pC $F C @K (C -G hC !F C @K C L hC F C @K C :I C F C WG C VG hC L pC ZG xC F C @ F C @F C `L C L C ZF (C F 0C F 8C F @C @F ЍC ~K ؍C vL C `L C L C F C F C `F C F C F C F PC F `C `F C @F C ]F (C F C @F C `F C F hC @F pC XF C @ F (C @F 0C VF hC `F C F (C F ȒC F C F C `L C L ȓC F C @ F C `L C L C ZF C F HC E C E C E C E C E HC K PC E C E C H C @E ȗC E C L C `L C L (C L 0C @E 8C E @C E HC E C E C 0C C `E C E C K ȘC ЕC ИC pC HC L PC `I XC E C E C E HC L PC E C E C E C `E C @`J C L ЛC E PC E C E C E C `E C @E ȝC E НC E ؝C E ȞC K ؞C H C L C L C H 0C K 8C `L @C L HC H PC H C E C H C E C E C L C :I C L C `L C L C `L СC `L C E C E C E C L C @E C PL C I ȣC @E УC `H أC `L C I C I C @AL 0C H hC @E pC E xC E C E C L C E C E pC E xC E C E C E pC `L C @E C E C E C E C E C E C E C E C @`J C E C @`J C E C E C E HC E C K ȫC K C C ȬC F ЬC F جC F C F (C F 0C `F 8C F hC -G pC @!F C `%F C JF C H C @H (C \F 0C ZF 8C @XF @C UF HC XF PC VF C mF C mF ȮC F ЮC @F خC F (C `G 0C ``G 8C -L @C `G HC _G PC lG XC `lG `C _G C F C F (C `lG 0C `G 8C ``G @C -L HC `G PC F XC _G pC _G xC H C H C H C WG C VG C F C `F C lG C `H C I C L C K ȽC K нC E ؽC `H C L C vL C K C H C L C E C F C @F 0C F 8C `J @C F PC L XC @E hC F xC @`J C E C F C `G C ``G C -L C `G C _G C lG ȾC `lG оC _G ؾC K C `F C F C L C F C E C `E C E C E (C H 0C H 8C H @C F HC @F PC F XC `vF `C vF pC F xC gF C `gF C \F C ZF C @XF C UF C XF C VF C SF C F ȿC H пC @H ؿC @GF C `(F C K C `%F C JF C #F C FF C :I C -G C @!F (C F 0C WG 8C VG @C F HC `F PC F XC @F `C F hC F pC F xC F C F C F C F C @E C `.L C @E C E C `F C `E C @K C I C @E C E C @E (C F @C аC HC C PC F XC F `C `J hC G pC D xC ЯC C F C C C @`J C @F C F C F C C C F C F C `F C F C F C F C `F C F C F C K C F C `F C F C F (C F 0C `J 8C `F @C F HC F PC F XC `F hC F pC @G xC F C F C `F C F C F C `K C F C `F C F C F C F C `F C F C wJ C F C F C `F C F C F C F C `F (C F 0C F 8C F @C `F HC F PC F XC F `C `F hC F pC F xC F C `F C C C `F C `F C F C C C `tF C nF C `vF C pC C dF C ^F C gF C [F C YF C `WF (C TF 0C RF 8C PF @C C HC @MF PC GF XC ЭC `C `/F hC @GF pC &F xC `$F C C C "F C @ F C PC C `F C F C F C ]F C C C F C F C F C F C F C C C F C F C F C F C F C E (C @E 0C F 8C @E @C F HC K XC `E `C E hC E pC @E xC E C E C @K C E C @E C E C E C E C pC C 0C C C C D C C C pC C L C L C L C L C `L 0C 0~D C `QG C G C `G C `G C K C `cG C `I C @K C <L C @E HC L PC L xC `L C `L C `G C `G C K C `L C @vL C E C C C `E C E C G C E HC L PC L `C E C E C I C `J C @E (C L 0C L @C `G HC G PC E `C `L C E C L C E C E C E C L C K C @L C H C G C E C E C @E C E C `G C =G C K C K C E C E C @E C H 0C K 8C wG @C L HC E PC "L XC K `C E hC G pC L C L C `L C `L C E C @E C E C BI C `E (C E 8C E @C `E HC E XC PC `C L pC C xC `E C 0~D C E C E HC K C K C L C E HC E PC E `C E hC CH C @E C E C E C L C `G (C wJ 0C K 8C 8L @C E C `E C E C @E C L C L C E C L C `G C E C F C @E C E (C E 8C F @C E PC E XC @E C L HC `G XC aG C E C F C E C E C `E C @L (C `G 0C K @C L HC `.L XC E `C @K C E C C C E C @`J C E C `5G C `E C K C E C AK C E C E C `E HC L PC @K XC `G hC E xC `.L C E C @`J C E C @E C K C E C E C `E C `E C `E C E C E C E C E C E C E (C @E C E C `E (C @E 0C @E 8C E @C `G PC @G XC E C `E C E (C E 0C @E 8C @L @C TJ HC E PC E C L C @E C `G C -L C L C E C @K C E C /L C @E (C E 8C E @C E C E C E C E HC @E PC E XC `G hC @G pC E C `E C E hC G C `G C -L C E C G C E C @E C E C 0L C E C E (C E 0C @E C SJ C G C zE C E C G C L C }E 0C `.L 8C }E HC L PC `G `C KK C ``G C `G C {E C }E C }E C `}E C }E C |E C {E C 0L C {E C @{E (C {E 0C zE C E C G C G C @qE HC @rE PC K C oE C oE C `mE C rE C @qE HC oE XC oE `C L pC `oE xC oE C K C nE C `G C aG C `nE C I C sE C sE C rE C `5G (C rE 0C pE C nE C L C iE HC sE PC @jE C K C `gE (C `G 8C G HC E PC ZF XC dE `C cE pC @cE xC cE C bE C bE C @bE C @L C @K C @}L (C `G 0C K 8C L @C `.L HC dE PC dE `C G hC `G pC KK xC @dE C K C E C K C TJ C dE C E C @E C 9L C E C K C @hE C hE (C @fE 8C fE HC PC PC eE XC `eE `C eE C \E C K C bF C \E C L C L C L C L C L (C E C \E C \E C \E C lK C G (C XE 0C K 8C bF C XE C L C L C L C L C L C E hC YE C XE C `XE C lK C G D TE D E D L D E D E (D cE 0D E 8D E @D E HD E PD E XD `zE `D `vE hD L pD TE xD iE D [E D XE D TE D `G D @G D G D NE D G D L D `JE D `E D G D G D KE (D L 0D `KE 8D E @D @E HD `L XD E `D @E pD `E xD E D `G D `G D KE D JE D OE D @OE D OE D NE D OH D ME (D LE 0D SL 8D K @D LE HD LE XD KE `D KE 0 D L 8 D `G H D E P D H X D K ` D TJ h D dE p D @E x D E D E D `E D @E D E D E D E D E D E D E D E D `E D E D E D @E D E D E D E D E D `zE D `vE D iE ( D cE 0 D [E 8 D XE @ D `TE H D L P D EE X D JE D E D E D @E D `E D @E D E D E D `E D `E D E D E D E D E D E ( D E 0 D `E 8 D @~E @ D vE H D `uE P D hE X D ]E ` D YE h D UE p D QE x D `EE D D ( D DE 0 D D D BE D @ D D AE D `@E HD @E D AE D >E D >E D AE D <E HD <E D AE D :E D ;E D AE D 9E HD @9E D AE D 7E D `7E D AE D 5E D 5E D 3E HD 2E D 1E 0D -E 8D -E @D `-E HD -E D `.E D .E D /E D K 0D `+E 8D +E @D *E HD *E PD `*E XD *E `D )E hD )E pD `)E xD )E D CE D AE D `@E D >E D <E D :E D 9E D 7E D 5E D (E D (E D `(E D G D `>E D `<E D G D 8E D <G D @5E D 3E D @2E ( D 0E 0 D (E 8 D 'E @ D 'E H D `'E P D 'E X D &E ` D &E h D `&E p D &E x D %E D %E D `%E D %E D $E D $E D `$E D $E D #E D #E D `#E D #E D "E D "E D `"E D "E D E D !E D !E D `!E D !E D E ( D `.E 0 D .E 8 D E @ D E H D E P D ` E X D E ` D E h D E p D @ E x D E D E D E D E D ` E D E D E D @E D E D E D L D DE ` D BE h D AE p D D x D D D D D D D D D `D D @D D `?E D `=E D `;E D 9E D 7E D 6E D @4E D 2E D 1E D 0E D D D D D D ( D D H D D P D D X D `D ` D @D h D D p D /E x D K D /E D H D I D @I D K D K D E D `/E D K D `J D /E D +E D D h D PK D L D ^K D @K D @E "D L "D L "D E h"D L p"D L x"D AH "D @L "D L "D E "D E $D L $D `L $D L $D `L $D L $D `L $D `L %D @E %D E %D E %D K 'D L 'D L 'D ` E 'D @J 'D @)H 'D L 'D `L h(D L p(D E x(D L (D L (D `L (D `K (D `L (D L (D `L )D ` E ()D %D 0)D E 8)D E @)D P%D P)D E X)D E *D L *D L h+D L +D L +D E +D L +D @L -D L -D L -D L -D `L p-D @L x-D L -D L -D L -D E .D 05D .D `L .D E /D E /D E (0D L 00D L 80D L @0D L H0D `L 0D @L 0D L 0D E 1D 05D 1D `L 1D `D 1D E 1D E (2D D 02D D 3D L 3D L 3D L 4D L 4D L 4D L 4D `L 4D E 4D L 4D L 4D L 4D `L H5D K h6D `L p6D D 6D @L 6D L 6D E 6D E 7D D 7D E 7D 05D (7D @D :D L :D @D :D L 0:D D 8:D D @:D D H:D @D P:D @K X:D @}L :D @K :D L :D `D :D L ;D `L ;D lL ;D L ;D L (;D @L 0;D D 8;D D ;D `D ;D L ;D D ;D D ;D `D h<D L p<D @D <D `D <D D =D `D =D D =D D >D D >D `L >D L >D `L 0?D lL 8?D D @D L @D L @D PL @D `L AD PL AD `L HAD D AD D AD `D (BD L 0BD `L hBD D pBD `L BD L BD `L (CD `L 0CD lL HDD L PDD L XDD L DD `L DD D DD L DD `D ED @D ED L 0ED D HFD AL PFD D XFD @AL `FD D pFD lL xFD lL FD D FD @D FD D FD `D FD D FD D FD D (GD E hGD xL GD K GD QK (HD K hHD @K HD jK HD `L (ID L hID @L ID kL ID E pLD I xLD E LD kL LD @L LD L LD `L LD `L LD jK LD @K LD K LD QK LD K LD xL LD D LD E LD L LD E MD L MD D MD ^K (MD E 0MD E 8MD PL @MD E HMD @E PMD D XMD D `MD D hMD `D pMD D MD @E MD ID MD ID MD PID MD ID MD HD MD HD MD PHD MD HD MD GD ND GD ND PGD ND GD (ND E 0ND E 8ND @E @ND `E HND E PND @ E XND D `ND D hND D pND `D xND D ND D ND D OD K OD K OD 6K HOD D OD @rL OD K PD J HPD J PD J PD J QD GK HQD K PQD `^J XQD ^J `QD K hQD 6K QD ?L QD VL (RD L SD L SD VL SD ?L SD `L SD K TD `^J TD ^J TD K TD 6K TD GK (TD J 0TD J 8TD J @TD J HTD K PTD @rL XTD D TD D TD RD TD QD TD QD TD 0QD TD PD TD PD TD pPD TD 0PD TD OD TD OD TD pOD TD D UD D UD D UD L UD D VD L VD D WD D WD D WD L 0WD @L 8WD L WD D WD L XD D (YD D 0YD D 8YD D @YD D HYD @D YD L YD @}L (ZD @}L 0ZD @K 8ZD D @ZD D [D L H[D D P[D D X[D L `[D L h[D `KE p[D @}L [D D h\D L p\D L \D D \D @}L \D D \D L \D `KE (^D D 0^D @D 8^D D @^D D ^D @vL `D D `D D `D D (`D D 0`D @D 8`D D @`D `L H`D D P`D L `D @L `D `L `D @L `D L `D "L `D D `D p^D bD D bD D bD D bD @D bD D bD D bD D bD D cD @L cD D cD D cD L cD @D cD D (dD D 0dD @D hdD @L HhD D PhD rF XhD @D hhD @)H phD D xhD @L hD `L hD G hD `D hD `L iD L iD L iD L iD L iD L iD @L iD `L iD D iD @D jD PL jD `L jD `L jD L jD K (jD L 8jD `L @jD D HjD `L PjD FL jD D jD PdD jD D jD dD jD D jD .L jD D jD D jD @D jD D kD D kD @D kD D kD D (kD D 0kD D kD @D kD D (mD D 0mD D 8mD D HmD K XmD D mD D mD @D mD D mD L mD dE mD @E nD @L nD `KE nD @D HnD D XnD lK (oD D 0oD D 8oD D @oD @D HoD D oD D oD @D oD @D oD D HqD rF PqD @D XqD D `qD K rD L rD D rD L (rD L xrD D rD D rD D tD D tD D tD D tD D tD @L huD D puD D xuD `G uD `G uD VG uD H uD K uD `K uD rD vD "L HvD @D PvD D vD D HzD D PzD D XzD D `zD @D hzD D pzD D xzD `D zD D zD D zD D zD D zD D {D L {D D {D D {D L |D D |D @D |D L |D 9L (|D D 0|D D 8|D D @|D L P|D @D `|D `H h|D L |D D |D D |D pvD |D `D |D D |D 0vD H~D `L ЀD L D D D D D H D `G D L D D D @K D D (D D 0D @D 8D @D @D L HD D PD L XD @D `D D hD D pD D xD D D D D `KE D `L D @D D D D D D `D D D D D (D D 0D D 8D D @D D HD D PD @D `D `D pD D xD D D D D D D @D D 0~D D }D D }D D P}D ȂD }D D @D D D D @D D D hD D pD L D `D D @D D @D D D D `TE D D D @D D D D @D D D D D D D pD D D `L ЇD D hD `D pD `TE D D hD `D pD `L D D 8D D @D pD D D D `TE D `TE D D 8D D @D pD D D D `TE D `TE D D D D D pD D D D `TE D `TE (D D ؎D PD D D 0D D 8D D @D D HD D D pD D D pD D xD @D D @D D D D D D D D D D @D D @D (D D D |D D {D ȔD zD D 0zD D yD D @D D D D D (D vD D uD D PuD ȟD tD D tD D @tD D @D D D D D (D rD D PrD D qD (D qD `D 0qD hD pD pD @D xD D D D D oD D oD D poD `D oD hD @tD pD @D xD D D D D nD xD 0nD D mD D `mD D mD ȮD lD ЮD @D خD D D D D kD D kD D D PD @D XD @D `D @D hD @kD D pjD D piD D hD D 0hD D yD D @D D D D D D dD D cD D pcD D cD @D bD HD @bD PD @D XD @D `D @D hD aD 8D `D @D p`D D _D D _D D @D D @D D @D D ^D D ^D D ]D PD @D XD D `D D hD ]D D \D D \D D P\D (D \D 0D @D @D D HD [D 8D [D @D 0[D D ZD D @D D D D `ZD XD D `D ZD D YD D \D D @D D @D D `YD xD YD D XD D @D D D D D D XD XD \D `D WD D P\D D \D D @D D D D @WD D D D VD D VD @D pVD HD \D PD @D `D `D hD UD D D D pUD D pVD (D \D 0D @D @D D HD UD D 0OD D ND PD D XD D `D D hD ND D FD D FD 0D E 8D D @D D HD @ED D DD D pDD @D 0DD HD CD PD E XD lL `D D hD @CD D D D CD D BD D \D D E D lL D D (D BD D D D PBD `D BD hD \D pD E D D D AD xD pAD D 0AD D @D D @D D E D D D `D D @@D xD D D ?D D ?D D E D @D D @?D 8D ?D @D >D D >D D E D D D D D >D D =D D p=D pD E xD `D D `D D =D D <D D <D @D P<D HD \D PD E `D D hD ;D D p;D D :D (D `:D `D 9D hD 9D pD E D D D @7D D 6D D 6D D P6D D 6D D E D D D D (D `5D XD 4D `D 4D hD 4D D 3D D 3D D E D D D @D D @2D D 2D D 1D D 1D D 6D D E D D D D D 1D D 0D D p0D D 0D (D /D 0D E 8D `D @D D HD /D X E .D ` E 1D E .D E 6D E E E @E E @E E @.D E -D E P-D `E ,D hE ,D pE E xE E E E E +D E +D E P+D E *D E *D E CD E E E E E E (E `)D xE (D E P(D E 'D E p'D E @bD E E E PL E PL E %D XE $D `E $D hE @$D E #D E pD E E E E E E E #D E "D E P"D `E !D hE pD pE E xE E E E E !D E D E D @E P D PE E XE ^K `E ^K hE D +E D +E pD ,E D ,E D ,E CE ,E .E ,E .E (,E D 80E D 0E D 0E CE 0E 0E 0E 0E 0E `D 1E 0D 1E D 1E CE 1E @2E 2E @2E 2E `D 2E D @3E D P3E CE X3E 3E `3E 3E h3E `D X4E D `4E pD 4E D 4E CE 4E @5E 4E @5E 4E D 86E D @6E D 6E D 6E CE 6E <G 6E <G 6E `D 7E 0D 7E D 8E D 08E CE 88E 8E @8E 8E H8E `D 9E D 9E pD :E D 0:E CE 8:E G @:E G H:E `D x;E 0D ;E D ;E D ;E CE ;E `<E ;E `<E ;E `D x=E D =E pD =E D =E CE =E `>E =E `>E =E `D x?E 0D ?E D ?E D ?E CE ?E G ?E G ?E `D AE D `AE D pAE CE xAE AE AE AE AE ` D BE D CE D CE CE CE CE CE CE (CE D xEE D EE D EE D EE @D EE E EE JE EE JE EE D ME D ME D `ME PD pME E xME G ME NE ME D QE D QE D QE D QE \D QE E QE `TE RE `TE RE C UE PC VE C VE @C @VE C HVE CD PVE E XVE XE `VE XE hVE C YE pC YE C YE @C YE C YE CD YE E YE [E ZE [E ZE C 8]E C @]E C H]E C ]E 0C ]E C ]E E ]E cE ]E cE ]E C `fE C fE C fE \D fE E fE gE fE `C hE 0C hE C iE C iE E iE iE iE iE (iE @C XjE C `jE 0C hjE C jE pC jE C jE E jE nE jE mE jE `C 8pE D @pE 0C HpE C pE C pE `C pE E pE rE pE qE pE C xuE D uE C uE E uE `vE uE `vE uE @C vE C vE C wE C wE CD wE E wE `zE wE `zE (wE @C X~E C `~E C ~E PC ~E E ~E E ~E E ~E C xE C E 0C E C ȂE CD ЂE E E E E E E `C E C E pC E C (E lD 0E E 8E E @E E HE C E pC E C @E C HE \D PE E XE E `E E hE @C 8E C @E C E pC E E E @E E @E E C 8E C @E C E E E E E E E @C E C E 0C E C E CD E E E E E E (E C ؘE C E C E C (E CD 0E E 8E `E @E `E HE C E D E 0C @E C PE E XE `E `E E hE C xE C E C ПE E ؟E E E E E C xE pC E C E C E 0C ȤE @tD ФE E ؤE E E E E C XE C `E pC E 0C E \D E E E `E ȧE C E C E C (E C `E pC hE yD pE E xE E E E E C E C E C E C E pC E pD E E E E E E E C XE C `E 0C E C E pD E E E E E E ȹE C xE C E 0C E C E pC ȼE \D мE E ؼE E E E E C XE D `E pC hE C E C E \D E E E E E E E @C 8E C @E C E pC E E E @E E @E E C 8E 0C @E ЪC E C E CD E F E @E E @E E C E ЩC E PC E F E E E E E C E C E PC E ZD E F E E E C E D E C E P\D E \D E F E E (E `C E D `E ZD pE F E E E C 8E D @E C E ZD E F E E E C E D E PC E C E pD E F E E E C E PC E ФC E F E @E E @E E C E C E C E pC E \D E F E E (E C E ТC E C `E ZD pE F E E E @C E C E pC E C E C E CD E F E `E E `E E C 8E pC @E C E C E lD E F E `F E `F E C 8E C @E C E F E E E E E `C 8E D @E 0C E ZD E F E E E C E D E C E pC E \D E F E E E C E D E C @E P\D HE \D PE F `E E hE `C XE D E ZD E F E E E C xE КC E pC E 0C E \D E F E E E C E D E pC E 0C E CD E F E E (E C xE pC E C E C E D E F E @E E @E E `C XE 0C `E C E C E pD E F E @E E @E E C 8E C @E C E pC E CD E F E F E F E C F C F C @F C HF pD PF F XF F `F F hF @C F C F БC F pC F CD F F F F F F (F C 8F PC @F C F C F pD F F F F F F F C F C F PC ` F pC h F CD p F F x F F F F F C F ЏC F C F C ( F pD 0 F F 8 F F @ F F H F @C F C F ЎC F pC F CD F F F F F F F C F 0C F C F `C @F C HF @D PF F XF @F `F @F hF C xF C F PC F C F C F F F F F F F C XF ЉC `F pC F 0C F C F F F VG F F F C X F PC ` F C F 0C F C F F F WG F F F C X F PC ` F C F ІC F \D F F F @!F F @!F F C "F PC "F C "F C "F F "F #F #F #F #F @C x$F C $F ЄC $F ІC $F \D $F F $F `%F $F `%F $F C &F 0C &F ЃC &F PC &F C &F F &F `(F 'F `(F 'F C (F C (F pC )F 0C )F C )F F )F )F ()F C *F pC *F C `*F 0C h*F C p*F F *F `+F *F C +F D +F PC ,F C (,F C 0,F F 8,F GF @,F ,F H,F ~C 8-F ~C @-F 0~C -F C -F F -F .F -F `.F -F }C x/F 0}C /F |C /F F /F @GF /F @GF /F {C 0F D 0F 0{C 0F zC 0F CD 0F F 1F 1F 1F zC 82F D @2F 0{C 2F zC 2F CD 2F F 2F `3F 2F zC 3F D 3F yC 4F yC 4F \D 4F F 4F 4F (4F `yC 5F D `5F 0yC h5F CD p5F F x5F G 5F 5F 5F xC X6F D `6F xC 6F ZD 6F F 6F 7F 6F `xC x7F xC 7F wC 7F wC 7F 6D 7F F 7F 8F 7F wC 9F vC 9F vC :F 0vC (:F ,D 0:F F @:F ;F H:F uC x;F D ;F PuC ;F ZD ;F F ;F `<F ;F uC <F D <F tC =F tC (=F CD 0=F F @=F >F H=F tC x>F D >F sC >F `sC >F 0sC >F CD >F F >F @F >F rC @F D @F PrC AF 0yC AF CD AF F AF BF (AF qC BF D BF pqC BF qC CF 0yC CF CD CF F CF DF (CF pC DF D DF 0pC DF oC DF @tD DF F EF EF EF `oC GF oC GF PnC GF mC GF pmC GF pD GF F GF F HF F HF kC XMF PkC `MF jC hMF @jC MF iC MF 9D MF F MF SF MF SF MF `hC PF 0hC PF gC QF gC (QF CD 0QF F 8QF VF @QF VF HQF `gC RF 0gC RF gC SF fC (SF \D 0SF F 8SF XF @SF XF HSF fC TF pfC UF 0fC @UF gC HUF CD PUF F XUF UF `UF UF hUF eC xWF eC WF PeC WF fC WF \D WF F WF @XF WF @XF WF eC YF dC YF dC ZF gC ZF CD ZF F ZF ZF ZF ZF (ZF dC [F cC \F cC @\F fC H\F \D P\F F X\F \F `\F \F h\F `cC ^F cC ^F PbC (^F aC `^F aC h^F `C p^F F x^F `gF ^F `gF ^F ]C dF \C dF [C (dF [C `dF P[C hdF lD pdF F xdF gF dF gF dF ZC 8nF +D @nF pYC HnF XC nF WC nF WC nF F nF vF nF vF nF SC xtF SC tF PSC tF RC tF pD tF F tF `vF tF `vF tF RC F PRC F QC F QC F PQC (F pD 0F F 8F F @F F HF `PC xF 0PC F OC F OC F POC ȇF CD ЇF F ؇F @F F @F F @NC xF MC F pMC F MC F LC ȋF @tD ЋF F ؋F F F F F @KC F D F JC F pJC F \D F F F F F F (F JC F IC F pIC (F IC `F HC pF F xF @F F @F F `HC F 0HC F GC F \D F F F F (F GC F D F PGC `F P%D pF F xF F F F F GC F >C F 0>C ȩF =C F P=C F =C F F F ^G F ^G (F ;C F :C `F :C hF @:C pF F F F F 9C `F 9C hF @:C pF F F F F @9C F 9C @F 8C HF @:C PF F `F `F hF `8C F 08C @F 7C HF @:C PF F `F F hF 7C F 6C F 06C F 5C @F p5C HF @bD PF F XF ^G `F ^G hF 3C F p3C F \D F F F @G F 3C `F p3C hF \D pF F F @G F 2C F p2C F 1C F 1C @F 0C HF yD PF F XF F `F F hF .C 8F .C @F 0.C F -C F pD F F F `_G F `_G F `-C F 0-C F ,C F p,C F \D F F F `G F `G F +C F 0+C F *C F 0*C F @bD F F F aG F aG (F (C F P(C F 'C @F PD PF F XF aG `F aG hF `'C F &C F %C F %C F %C F $C F F F `aG F `aG F "C F !C F !C F C F C F @bD F F F aG F aG F C F P C F C F @ C F C (F @D 0F F 8F aG @F aG HF `C F 0C F C F C @F PD PF F XF bG `F bG hF C F C F PC (F C `F C hF \D pF F xF `bG F `bG F @C F C F C F PC (F pD 0F F 8F KK @F KK HF C F pC F C F C F CD F F F TJ F TJ F `C F 0C F C @F C PF F XF bG `F bG hF @C xF C F C F PC F CD F F F bG F bG F C F C F C F 0C (F D 0F F 8F G @F G HF `C XF C `F C hF @C F C F D F F F C F C F 0 C F C F \D F F F cG F cG (F C F P C F C @F C PF F XF `cG `F `cG hF C xF C F P C F PD F F F `F F `F F C 8F B @F B HF B F B F B F ^G F ^G F ^G F B F B F :C F @:C F ^G F F (F 9C F 9C F @:C F ^G F F (F @9C @F 9C HF @:C PF ^G `F F hF B 8F D F PB F CD F ^G F `F F B xF 9C F B F ,D F ^G F `F F B F 08C F B (F ,D 0F ^G @F F HF B F B F 0B (F ?D 0F ^G @F F HF B XF B `F PB hF B F PB F WC F ^G F ^G F ^G F B G p3C G \D G ^G G @G G B G p3C G \D G ^G G @G G B G B G PB G B G PB G _D G ^G G `_G G `_G G B 8G pB @G B HG B G 0B G @tD G ^G G G G G G B 8G B @G B HG B G 0B G D G ^G G G G G G B G B G PB G B @G PD PG ^G XG `G `G `G hG B G PB G ,C @G p,C HG \D PG ^G XG G `G G hG B xG 0B G B G B G @D G ^G G aG G aG G B X G P(C ` G 'C G PD G ^G G aG G aG G `'C !G pB !G B !G B "G B "G @B "G ^G "G `aG "G `aG ("G B .G pB .G B .G B /G B (/G @D 0/G ^G 8/G aG @/G aG H/G B 86G B @6G 0B 6G B 6G @tD 6G ^G 6G aG 6G aG 6G B 9G 0C 9G C 9G C :G C (:G \D 0:G ^G 8:G bG @:G bG H:G @B x;G B ;G PC ;G C ;G C ;G \D ;G ^G ;G `bG ;G `bG ;G B =G PB >G 08C @>G C P>G ^G X>G KK `>G KK h>G B X?G B `?G 08C ?G C ?G ^G ?G TJ ?G TJ ?G B @G pB @G C AG C AG ^G AG bG AG bG (AG B 8BG B @BG PB BG B BG @tD BG ^G BG G BG G BG B DG pB EG B @EG pB HEG @bD PEG ^G XEG bG `EG bG hEG B LG PB LG B LG `B MG B MG _D MG ^G (MG B 8RG B @RG B RG PB RG pD RG ^G RG cG RG cG RG B TG B TG B UG C 0UG ^G 8UG `cG @UG `cG HUG B XWG B `WG B WG B WG \D WG ^G WG `cG WG `cG WG B \G B \G P C ]G PD 0]G ^G 8]G ]G @]G ]G H]G @B eG B eG PB eG B eG D eG `G eG gG fG gG fG B 8iG B @iG PB iG жB iG @D iG `G iG lG iG lG iG B mG B mG PB nG B (nG pD 0nG `G 8nG G @nG G HnG B XpG PB `pG B pG B pG pD pG `G pG G pG G pG @B 8sG B @sG вB sG B sG \D sG `G sG @G sG @G sG B 8uG бB @uG PB uG B uG D uG `G uG G uG G uG B xG B xG B yG pB yG `G yG G yG G (yG B xzG B zG B zG pB zG `G zG @G zG @G zG B 8|G pB @|G 0B |G pB |G `G |G G |G G |G B }G B }G B ~G pB ~G `G ~G G ~G G (~G `B 8G 0B @G ЬB HG C G B G \D G `G G @G G @G G B XG ЫB `G pB hG C G C G \D G `G G G G G ȁG B XG B `G PB hG C G PD G `G G G G G ȃG B G B G PB PG G XG G `G G hG B ؉G \D G B G PB (G pD 0G G @G G HG B G B G ZD G G G @G G `B G B G pB PG G XG G `G G hG B G 0B G ТB G B @G 0B HG D PG G `G G hG B 8G B @G 0B G ZD G G G G G B G PB G ОB G `B @G B HG pD PG G XG @G `G G hG B xG B G PB G B șG B ЙG G G G G B `G B G B G @B G G G G ȜG B 8G pB @G B G G G G G G G B G D G 0B (G B `G B hG \D pG G G @G G @B G B G B @G ZD PG G `G G hG `B G D G B @G 0B HG CD PG G `G G hG B جG B G 0B 0G H 8G H @G H HG B G D G B `G PB hG \D pG H G G G B xG ЀB G B G YD ȯG \D ЯG H دG `H G `G G @B G B G B G CD G H G eL G `G G B G PB G B G ~B G CD G H G G (G @~B G }B G }B G p}B G CD G H G `G G G (G |B G |B G p|B (G |B `G ZD pG H G G G {B G p{B G 0{B @G YD HG \D PG H `G G hG zB G zB G PzB @G zB HG CD PG H XG 9L `G G hG yB G D G PzB G yB G \D G H G G (G @yB G D G PzB @G zB HG CD PG H `G G hG @yB G xB G xB pG H xG @H G @H G @xB xG wB G wB G H G H G H G @vB G uB G uB G YD G @uB G H G L G G G tB G tB `G ptB hG @:C pG H G G G tB G sB G PsB G sB @G rB HG @tD PG H XG `J `G G hG qB xG D G pqB G 0qB G \D G H G G G pB XG +D G ppB G CD G H G @G G pB G oB G PzB G `oB G 0oB G CD G H G G (G nB 8G D @G PzB G yB G \D G H G G G @yB 8G nB @G pmB G H G H G H G `lB xG kB G kB G `kB G 0kB G CD G H G G G `G G jB G jB G 0jB G iB G D G H G @L G `G G hB XG hB `G PhB hG |B G ZD G H G `G G gB 8G gB @G 0gB HG fB G 0yC G CD G H G G G `G G `fB G 0fB G eB G eB G PeB (G pD 0G H 8G eL @G G HG dB G D G kB G dB G \D G H G `G G @dB G D G kB G 0yC (G CD 0G H @G G HG @dB 8G cB @G cB G H G H G H G cB G D G bB `G dB hG \D pG H G G G bB xG +D G bB G 0bB G pD G H G G G aB G PaB G `B PG H XG @H `G @H hG @`B G D G bB @G dB HG \D PG H `G G hG _B XG _B `G p_B hG _B G ^B G D G H G `G G @^B G D G ^B G ]B (G \D 0G H 8G 0H @G G HG ]B G 0]B G `B pG H xG H G H G \B G D G bB `G ZD pG H G G G @\B XG D `G bB G dB G \D G H G G G \B G D G ^B G ]B G \D G H G 0H G `G G ]B G [B G 0[B 0G H 8G H @G H HG ZB G pZB G 0ZB G ZD 0G H @G G HG YB G D G YB G ZD G H G G G `YB G D G bB @G 0YB HG \D PG H `G G hG XB G PXB G WB G H G @H G @H (G VB G D G pVB G yC (G \D 0G H @G @G HG UB G UB G pUB G ZD 0G H @G G HG UB xG TB G TB G ZD G H G @G G `TB G 0TB G SB `G ZD pG H G G G SB G +D G kB G `SB G dB G \D G H G G (G SB H RB H kB ( H RB ` H 0kB h H CD p H H H H H RB H D H kB H dB (H \D 0H H @H H HH @dB H QB H PB pH H xH H H H H OB XH D `H OB H pOB H CD H H H H H NB H D H NB @H pOB HH CD PH H `H H hH MB H D H MB ` H pOB h H CD p H H H H H MB x H D H LB H pOB H CD H H H ` H H LB H PLB H LB H |B H ZD 0 H H @ H H H H KB H PKB H JB H JB H pOB (H CD 0H H 8H eL @H H HH JB H IB H IB @H YD HH \D PH H XH `H `H H hH @IB 8H IB @H C H YD H \D H H H `H H H H @C 8H HB @H C H YD H \D H H H H H @C XH HB `H 0GB H H H H H H H EB H PEB H DB H DB H lD H H H H H H H CB H D H pBB H yC ( H \D 0 H H @ H H H H AB x H AB H pBB H yC H 6D H H H "H H AB X"H D "H @B "H @:C "H H "H #H "H `@B #H 0@B #H pBB #H yC #H @uB #H H $H %H $H ?B x%H D %H P?B %H @:C %H H %H @&H %H >B &H >B &H P>B 'H >B 'H CD 'H H 'H (H ('H =B x(H D (H P=B (H CD (H H (H )H (H <B )H <B @*H p<B H*H CD P*H H X*H +H `*H *H h*H <B +H ;B +H P>B ,H yC (,H 6D 0,H H @,H -H H,H @;B X-H D -H @B -H @:C -H H -H .H -H :B .H :B .H ]B .H \D .H H .H 0H /H /H /H `:B X1H D `1H :B 1H yC 1H \D 1H H 1H 2H 1H 9B 2H P9B 3H 8B @3H 8B H3H CD P3H H `3H @4H h3H 8B 4H D 4H 7B 4H yC 4H \D 4H H 5H 5H 5H 7B 86H D @6H :B 6H yC 6H \D 6H H 6H 7H 6H 7B 7H P9B 7H 8B 8H 8B (8H CD 08H H @8H `9H H8H 6B X;H 06B `;H 5B ;H H ;H @H ;H @H ;H 5B x<H 4B <H 4B <H p4B <H \D <H H <H `=H <H 4B =H _B >H 3B (>H CD 0>H H @>H >H H>H 3B >H 03B ?H 2B @?H p2B P?H H X?H RH `?H RH h?H 1B xBH P1B BH 0B BH 0B BH 6D BH H BH UH BH UH BH 0B xDH D DH /B DH P/B DH @:C DH H DH `EH DH .B xGH .B GH .B GH -B GH H GH @XH GH @XH GH -B xHH ,B HH 0,B HH +B HH +B HH H HH @KH HH *B KH 0*B KH )B LH P\D LH \D LH H LH MH (LH @)B MH (B MH p(B MH 0(B MH C MH H NH OH NH @'B PH 'B PH &B PH \D PH H PH QH PH &B RH 0&B RH %B SH P%B (SH +B 0SH H @SH `UH HSH @$B XH #B XH #B YH H YH H YH H (YH #B YH "B YH "B YH p4B YH \D YH H ZH ZH ZH "B ZH !B [H P!B P[H H X[H H `[H H h[H B \H B \H P B `\H p4B h\H \D p\H H \H ]H \H B x]H _B ]H B ]H \D ]H H ]H ^H ]H 3B ^H P B ^H B ^H H ^H H _H H _H @ B _H B _H B _H p4B _H \D _H H `H `H `H ` B `H \D @aH ZD PaH H `aH aH haH B aH B bH 0 B PbH H XbH @H `bH @H hbH `B cH B cH B `cH p4B hcH \D pcH H cH dH cH `B dH 0B dH B dH B dH ZD dH H eH eH eH B fH B fH B gH 0B (gH pD 0gH H @gH gH HgH B hH B hH PB iH YD (iH \D 0iH H @iH iH HiH B jH B jH B jH ZD jH H kH kH kH @B lH B lH pB lH H lH H mH H mH B mH B mH pB mH p4B mH \D mH H nH nH nH B nH D @oH ZD PoH H `oH oH hoH B 8pH pB @pH B pH H pH H pH H pH `B 8qH 0B @qH B qH p4B qH \D qH H qH rH qH B rH D rH ZD rH H sH @sH sH @B sH B sH PB tH ZD tH H tH tH (tH B xuH pB uH B uH H uH H uH H uH `B vH 0B vH B vH p4B vH \D vH H wH wH wH 4B wH D @xH ZD PxH H `xH xH hxH B 8yH pB @yH B yH H yH @H yH @H yH B XzH B `zH B zH p4B zH \D zH H zH `{H zH B {H B {H B {H @ B |H ZD 0|H H 8|H }H @|H }H H|H B 8~H p B @~H B ~H 0B ~H pD ~H H ~H H ~H @H ~H B H B H B H YD H \D H H H H H H (H @ B H B H B H ZD H H H H (H `B H B H B pH H xH H H H H B H B H B `H p4B hH \D pH H H H H B xH D H ZD ЇH H H H H @B H B H B H ZD H H H `H H B H PB H B H H H H H H (H @B ؋H B H B H p4B (H \D 0H H @H H HH `B 8H D @H 0B H ZD H H H H H B xH pB H B ЎH H ؎H H H H H @B H B H B H p4B H \D H H H H H @ B H B H B H B @H ZD PH H `H H hH B xH A H B H 0B ȓH pD ГH H H H H B 8H A @H PB H YD H \D H H H H H B H 0A H A PH H XH @H `H @H hH A XH A `H A H p4B H \D H H H @H șH @A H D H ZD H H H H (H A H A H 0A PH H XH H `H H hH @ B H A H A @H p4B HH \D PH H `H H hH 4B XH \D H ZD H H H H ȞH B xH pA H 0A H A ȟH D ПH H ؟H `H H `H H A H D PH H XH H `H H hH A H D pH H xH H H H H A 8H D H H H `A H D H H H @H H @H H A xH A H PA ЮH H خH H H H H A H A H pA H H H H H H H A H A H A H H H H H H (H @A رH A H A 0H H 8H H @H H HH `A 8H A @H A H PA H \D H H H A 8H pA @H 0A H A H pD H @I H H H H H @A 8H A H A H @I H @H H @H H A H PA H \D H @I H H (H A H A H pA H A H lD H @I H I H I (H @A 8H A @H A H PA H lD H @I H I H I H A 8H PA @H A H PC H @I H I H I H A 8H A @H PA H PC H @I H `I H `I H A 8H A @H A H A H \D H @I H I H I H A H A H A H pA (H \D 0H @I 8H I @H I HH A H 0A H A H PC H @I H `I H `I (H A H pA H 0A H PC H @I H I H I H A xH A H pA H A H lD H @I H I H I H `A H 0A H A H `A H A (H @D 0H @I HH A 8H 0A @H PA H @I H I H I H A H pA H 0A @H A HH \D PH @I `H H hH A XH D `H pA H A H pD H @I H @H H A H D H ZD H @I H `H (H @B H A H PA H A (H CD 0H @I @H H HH A H D H A `H PA hH CD pH @I H @H H A H D H A H ZD H @I H H (H @A XH A `H A H PA H pD H @I H \I H H H A H D H pA `H 0A hH CD pH @I H H H A H D @H ZD PH @I `H H hH @B H A H 0A `H A hH CD pH @I H @H H A H PA H A H A H pD H @I H `2I H H (H A xH D H pA H A H pD H @I H H H A X I D ` I 0A I A I pD I @I I I I A 8I A @I 0A I A I lD I @I I `I I @A x I PA I pA I @I I I I I I A I pA I 0A I A I \D I @I I I ( I A I D I pA ` I A h I pD p I @I I I I A x I D I ZD I @I I I I @B I A I PA I A I CD I @I I `I I A I \D I мA I PA (I CD 0I @I @I @I HI A I D I A I ZD I @I I I (I @A XI D `I A I A I \D I @I I \I I @I I `A I D I 0A I A I \D I @I I I (I A I D `I ZD pI @I I I I @B 8I A @I pA I ZD I @I I I I A I D I A I A I \D I @I I `2I I I I `A I D I 0A @I A HI \D PI @I `I I hI A XI D `I pA I A I \D I @I I @ I I A I A I A I 0A I D I @I I @ I ( I A X"I еA `"I A "I @I "I I "I I "I A #I pA #I 0A #I A #I \D #I @I $I $I $I A $I D %I pA @%I A H%I pD P%I @I `%I %I h%I A X&I D &I ZD &I @I &I 'I &I @B x'I A 'I PA 'I A 'I CD 'I @I 'I @(I 'I A (I D )I ZD )I @I )I `)I ()I @B )I A )I PA *I A (*I \D 0*I @I @*I *I H*I A +I pA ,I 0A @,I PA H,I CD P,I @I `,I -I h,I A 8.I A @.I 0A .I ZD .I @I .I /I .I A 0I A 0I PA 1I A 1I pD 1I @I 1I `2I 1I 2I (1I A X4I A `4I pA 4I A 4I @bD 4I @I 4I @:I 4I A 8<I 0A @<I A H<I @A <I ШA <I 9D <I @I <I AI <I A GI D HI C @HI A HHI CD PHI @I `HI HI hHI @A 8II A @II A II pA II CD II @I II `JI II A NI PA OI A POI @I XOI I `OI I hOI A PI pA PI 0A `PI A hPI \D pPI @I PI @QI PI A RI D RI pA `RI A hRI pD pRI @I RI @SI RI A SI D TI ZD TI @I TI `TI (TI @B TI A TI PA UI A (UI CD 0UI @I @UI UI HUI A VI \D VI 0A VI PA VI CD VI @I WI XI WI @A xXI A XI ZD XI @I XI YI XI A [I A [I PA `[I A h[I \D p[I @I x[I \I [I \I [I A x]I A ]I PA ]I A ]I pD ]I @I ]I ^I ]I A _I PA _I A _I pA _I CD _I @I `I ``I `I A dI 0A dI A 0eI @I 8eI oI @eI oI HeI A eI \D eI pA fI 0A (fI \D 0fI @I @fI fI HfI A gI \D gI pA `gI ZD pgI @I gI gI gI A XhI A `hI pA hI ZD hI @I hI @iI hI A iI D iI КA jI pA jI @tD jI @I jI jI (jI A XkI D `kI C kI A kI pD kI @I kI lI kI lI kI @C lI A lI PA mI A (mI \D 0mI @I @mI mI HmI A oI A oI A oI @I oI I pI I pI A pI A pI 0A pI \D pI @I qI @qI qI A rI pA sI ZD sI @I sI `sI (sI A vI A `vI ZD pvI @I vI vI vI A wI pA wI C xI 0A xI CD xI @I xI xI (xI A xyI A yI pA yI A yI \D yI @I yI @zI yI A }I A }I A p}I @I x}I I }I I }I @A ~I A ~I pA `~I 0A h~I \D p~I @I ~I ~I ~I A XI \D `I pA I ZD I @I I I I A I A I PA I ZD I @I I I I A I D I A @I pA HI @tD PI @I `I I hI A I D I C `I A hI pD pI @I xI @I I I I @C I A I pA I A I \D I @I I I I A xI pA I A ЈI @I ؈I `I I `I I @A xI A I 0A ȉI \D ЉI @I I I I A 8I ЍA I ZD I @I I I I A ،I PA I ZD 0I @I @I I HI A xI A I C I 0A ȎI CD ЎI @I I I I A xI ЌA I A I A ȐI \D АI @I I @I I @A I A I A pI @I xI I I I I A I ЊA I C @I A HI CD PI @I `I I hI A XI PA `I C I A I CD I @I I `I șI A I A I 0A I @I I I I I I A I 0A I ЇA I ZD I @I I I I `A xI D I A I pA ȤI _D ФI @I I I I A I ЀA I xB pI I xI I I I I A ضI 0A I A I PA (I D 0I I 8I I @I I HI ~A xI }A I }A I -B нI I ؽI I I I I |A xI {A I {A I p{A оI I ؾI I I @I I {A xI zA I zA I p{A I I I I I @I I `zA xI yA I yA I 0yA I @tD I I I I I I I xA I wA I wA I pC I \D I I I `I I @wA 8I wA @I vA I vA I \D I I I @I I @wA I PvA I vA `I pC hI \D pI I xI I I I I uA I D I uA I 0uA I 3D I I I `I I tA I ptA I tA pI I xI I I I I sA I PsA I rA I -B I I I I I I I `rA xI pA I 0rA I qA I @:C I I I I I qA I 0qA I rA I -B I I I `I I `I I `rA xI pA I 0rA I qA I @:C I I I I I qA I pA I pA I ppA 0I I 8I I @I I HI pA I iA I phA I hA I pgA (I C 0I `ZJ 8I @J @I @J HI eA xI PeA I dA I dA I pdA I CD I `ZJ I @I I @I I cA I 0cA I bA I bA I 0bA (I @tD 0I `ZJ 8I I @I I HI `aA I `A I p`A I 0`A I \D I `ZJ I I I I I _A I 0_A I ^A I ^A I \D I `ZJ I I I I I @^A I ]A I p]A I 0]A 0I `ZJ 8I I @I I HI \A XI [A `I 0[A I ZA I C I `ZJ I I I I I XA XI 9C `I PXA I XA I \D I `ZJ I I I I I WA XI 0WA `I VA hI VA I pUA I WC I `ZJ I >J I >J I RA XI QA `I QA hI @QA I QA I `ZJ I J I J I PA J NA J MA J LA J KA (J `KA 0J `ZJ 8J `UJ @J `UJ HJ CA 8 J D @ J BA J PBA J lD J `ZJ J LJ J LJ J AA J D J AA @ J PAA H J CD P J `ZJ X J KJ ` J KJ h J AA !J @A !J @A `!J P@A h!J \D p!J `ZJ x!J LJ !J LJ !J ?A X"J 0?A `"J p>A "J `ZJ "J @=A x#J =A #J <A #J ZD #J `ZJ #J `$J #J `<A x%J 0<A %J ;A %J ;A %J ZD %J `ZJ %J J %J 'J %J :A 'J :A 'J 0:A 'J 9A (J 9A ((J CD 0(J `ZJ 8(J J @(J )J H(J 9A *J p8A *J p7A *J 7A +J 6A +J @bD +J `ZJ +J @eL +J .J (+J 5A x2J 4A 2J p4A 2J 04A 2J CD 2J `ZJ 2J L 2J 3J 2J 3A 4J p3A 4J 2A 4J 2A 5J P2A (5J @tD 05J `ZJ @5J 7J H5J `1A 9J 01A 9J 0A `9J 0A h9J D p9J `ZJ x9J @yL 9J :J 9J @0A X;J /A `;J p/A h;J /A ;J .A ;J pD ;J `ZJ ;J K ;J =J ;J -A 8?J -A @?J 0A ?J 0A ?J D ?J `ZJ ?J FL ?J `@J ?J `-A BJ -A BJ ,A `BJ 0,A hBJ lD pBJ `ZJ xBJ PL BJ DJ BJ @+A 8EJ *A @EJ 0*A EJ )A EJ CD EJ `ZJ EJ ML EJ `FJ EJ )A xIJ P)A IJ (A IJ p(A IJ D IJ `ZJ IJ qK IJ KJ IJ 'A OJ 0'A PJ P&A PJ %A @PJ %A HPJ lD PPJ `ZJ `PJ @TJ hPJ #A YJ P#A YJ #A YJ `ZJ YJ ZJ ZJ ZJ ZJ "A `J A `J A `J A `J \D `J @K `J K aJ K aJ @A bJ D cJ A @cJ A PcJ @K XcJ dJ `cJ dJ hcJ A dJ PA dJ A dJ A dJ CD dJ @K dJ LK eJ LK eJ @A gJ A gJ A gJ @A gJ A gJ @tD gJ @K hJ A XjJ PA `jJ A jJ @K jJ J jJ J jJ A xkJ A kJ P A kJ ZD kJ @K kJ `lJ kJ A 8mJ A mJ A mJ @ A mJ @K mJ `nJ mJ nJ mJ A nJ A nJ p A oJ 0 A oJ C oJ @K oJ @pJ oJ oJ (oJ A rJ P A rJ A rJ @A sJ A (sJ @bD 0sJ @K 8sJ J @sJ vJ HsJ @A xJ A `xJ A hxJ \D pxJ @K xJ @yJ xJ `A 8zJ A @zJ A HzJ A zJ A zJ C zJ @K zJ PL zJ J zJ A J P A J PGD J @ J lD J @K J J J J J @ J P@ J @ @J @ HJ CD PJ @K XJ qK `J @J hJ @ XJ @ `J @ J ZD J @K J J J J ȇJ `@ J @ J @ @J 0@ HJ @ PJ @K `J J hJ @ 8J D J @ J @:C J @K J J J @@ xJ @ J @ АJ @K ؐJ J J J J @ J @ J P@ @J @ HJ CD PJ @K XJ J `J J hJ @ J 0@ J @ @J p@ HJ pD PJ @K XJ ML `J J hJ @ J @ J P@ `J @ hJ @tD pJ @K xJ PL J J J @@ J @ J P@ J @ J @bD J @K J J J J (J @ J P@ J @ `J p@ hJ lD pJ @K xJ J J J J @@ J @ J @ J `@ @J 0@ HJ CD PJ @K XJ J `J J hJ `@ J 0@ J @ J @ @J P@ HJ \D PJ @K XJ J `J J hJ @ XJ P@ `J @ J @ J CD J @K J J J `J ȪJ @ دJ 0@ J @ 0J @K 8J @rL @J @rL HJ @ J p@ J 0@ @J @ HJ CD PJ @K XJ J `J J hJ @ J @ J @ J P@A J \D J @K J @eL J J J @@ 8J D J @ J \D J @K J lL J J J @ XJ @ J BD J \D J @K J lL J J ȶJ A xJ 0@ J @ J P@A ȷJ \D зJ @K طJ FL J @J J @ J A J P@A J \D J @K J `J (J `@ عJ pA J P@A (J \D 0J @K 8J L @J J HJ @ J @ J @ @J HC PJ @K XJ L `J J hJ @ J D J @ J @ J pD J @K J J J @@ J @ J @ PJ @K XJ J `J J hJ @ J D J @ `J p@ hJ \D pJ @K J J J @ xJ D J @ J p@ J \D J @K J J J @ J p@ J 0@ `J ZD pJ @K J J J @ J D J @ J ZD 0J @K @J J HJ `@ 8J D @J 0@ J @ J CD J @K J J J @ xJ D J @ J yB J \D J @K J J J `@ J D J 0@ `J ZD pJ @K J J J @ xJ D J p@ J 0@ J CD J @K J J J J J `@ 8J D @J @ J @ J CD J @K J J J J J `@ xJ @ J @ J p@ J pD J @K J J J J J @ J D J P@ `J @ hJ pD pJ @K J J J @ 8J 0@ @J @ J @K J K J K J @ XJ p@ `J PD J P@A J \D J @K J @yL J J J @ J @ J P@A J \D J @K J @J J @ 8J p@ J P@A J \D J @K J FL J J J @ J 0@ J @ J @ (J @@ 0J @K 8J L @J J HJ @ J @ J P@ J @:C J @K J J (J @ 8J @ @J 0@ J @ J \D J @K J lL J J J @ J p@ J @ @J @ HJ CD PJ @K XJ lL `J @J hJ @@ J D J @ J ZD J @K J J (J @ 8J D @J @ J yC J \D J @K J J J @ J D J XA J @ J CD J @K J `J J @ xJ P@ J @ J @K J J J J J @ XJ P@ J P@A J \D J @K J J J @ J @ J @ J 0@ (J D 0J @K 8J FL @J `J HJ @ J @ J p@ J @K J J J J J @ J P@ J @ J @@ J @ J @bD J @K J "K J J J @ J @ J p@ J @ J D J @K J "K J J (J @ xJ p@ J 0@ J @ J CD J @K J %K J `J J @ J о@ J 0@ J -B J @K J ` K J ` K J @ J @ J @ J p@ (J CD 0J @K 8J J @J J HJ @ J @ J @ (J @ `J p@ hJ CD pJ @K xJ K J K J @ K p@ K PD K P@A (K \D 0K @K 8K @yL @K K HK @ K @ K @ K p@ K @:C K @K K @eL K K K @ K D K @ @K ZD PK @K `K K hK @ K D K @ K yC K \D K @K K K ( K @ K з@ K XA ` K )A h K CD p K @K K K K @ K @ K @ K @K K *K K *K ( K @ K д@ K г@ K @@ K @ K @B K @K K FL K K (K @ K @ K P@ K @ K pD K @K K K K K (K @ K @ K @ K @@ @ K @ H K D P K @K ` K ` K h K @@ K @ @ K Ъ@ H K CD P K @K X K "K ` K K h K A K @ !K P@ @!K @ H!K pD P!K @K X!K "K `!K "K h!K @ 8$K p@ @$K 0@ $K @ $K \D $K @K $K %K $K %K $K @ 'K p@ 'K 0@ (K @ (K \D (K @K (K (K (K (K ((K @ X*K @ `*K @ *K @K *K @5K *K @5K *K `@ X+K 0@ `+K @ +K P@A +K \D +K @K +K @eL +K @,K +K @ -K p@ -K @ `-K @ h-K CD p-K @K x-K lL -K .K -K @ /K @ @0K BD H0K \D P0K @K X0K lL `0K 0K h0K A x1K @ 1K P@ 1K @ 1K D 1K @K 1K L 1K 3K 1K @@ 5K @ 5K @ 5K @K 5K GK 6K GK 6K @ x7K @ 7K @ 7K p@ 7K pD 7K @K 7K ML 7K 8K 7K `@ x:K 0@ :K @ :K `@ :K @ :K @D :K @K :K PL :K `<K :K @ <K @ <K @ <K @ =K P@ (=K @tD 0=K @K 8=K ?K @=K ?K H=K @ 8BK D @BK @ HBK @@ BK @ BK @K BK CK BK CK BK @ GK @ GK 0@ GK @ GK P@ GK @bD GK @K GK xL HK xL HK @ xNK p@ NK @ NK @ NK D NK @K NK QK NK QK NK @ 8SK Б@ @SK p@ SK @ SK D SK @K SK @UK SK @UK SK @@ VK @ VK @ `VK P@ hVK pD pVK @K xVK @XK VK @XK VK @ YK P@ YK Ѝ@ YK p@ YK D YK @K YK @[K ZK @[K ZK @ ]K P@ ^K @ @^K @ H^K pD P^K @K X^K _K `^K _K h^K @ 8bK @ @bK P@ bK @ bK @tD bK @K bK `dK bK `dK bK @ xgK P@ gK @ gK @ gK @tD gK @K gK jK gK jK gK `@ XoK @ `oK @ oK P@ oK D oK @K oK @qK oK @qK oK @ sK P@ sK @ tK Ѓ@ (tK @ 0tK @K 8tK tK @tK tK HtK @ 8uK Ђ@ @uK p@ uK 0@ uK CD uK @K uK L uK vK uK @ wK Ѐ@ wK @ `wK 0@ hwK /D pwK @K xwK xK wK xK wK @ {K P@ {K @ ({K ~@ `{K ~@ h{K \D p{K @K x{K |K {K |K {K ~@ |K D }K }@ }K `}@ @}K pB P}K @K X}K L `}K L h}K |@ ~K p|@ ~K |@ ~K {@ K p{@ (K D 0K @K HK z@ K y@ K x@ `K px@ hK _D pK @K xK K K K K v@ ؍K Pu@ K 0t@ K s@ (K $C 0K @K 8K K @K K HK `q@ K q@ K pp@ (K o@ `K o@ hK @tD pK @K xK K K K K n@ K m@ K m@ `K PD pK @K xK K K K K `m@ K m@ K l@ `K pl@ hK \D pK @K xK K K K K k@ K k@ K Pk@ K PD K @K K K K K K j@ K j@ K pj@ K PD K @K K `K K `K K j@ K i@ K i@ (K `i@ `K 0i@ hK CD pK @K xK `K K `K K h@ جK ph@ K 0h@ K PD 0K @K 8K K @K K HK g@ K g@ K Pg@ `K g@ hK 6D pK @K xK K K K K f@ K D K Pf@ `K f@ hK @:C pK @K K K K e@ K pe@ K 0e@ `K d@ pK @K xK K K K K d@ @K Pd@ K d@ K \D K @K K K K c@ xK Pc@ K b@ K Pb@ ȵK D еK @K صK K K K K `@ K Pd@ K p`@ K \D K @K K K (K `@ 8K _@ @K _@ K P_@ K @K K @K K @K K ^@ K ^@ K _@ @K P_@ PK @K XK @K `K @K hK ^@ 8K P^@ @K ^@ K ]@ K @K K @K K @K K `]@ xK ]@ K \@ K p\@ K \@ K @K K K K K K [@ K [@ pK @K xK K K K K Z@ XK Z@ `K 0Z@ K @ K @K K K K K K Y@ K Y@ K pY@ K \D K @K (K Y@ K tB K X@ `K X@ hK \D pK @K K @X@ K pN@ K N@ K M@ 0K L 8K K @K K HK `M@ 8K 0M@ @K L@ K L@ K \D K L K K K K K L@ xK K@ K K@ K J@ K _D K L K K K K K I@ xK H@ K PH@ K H@ K \D K L K K K K K G@ xK PG@ K F@ K PF@ K @bD K L K E@ xK pD@ K D@ K C@ K CD K L K K K K K B@ K 0B@ K pA@ K A@ @K @@ HK @D PK L hK ?@ K >@ K >@ K P>@ (K CD 0K L 8K K @K K HK =@ K p=@ K <@ K <@ K P<@ (K pD 0K L HK :@ K P:@ K 9@ K 9@ K 8@ K _D K L K K K K K `6@ K 5@ K 5@ L P>@ ( L CD 0 L L 8 L L @ L L H L 4@ XL 04@ `L 3@ hL 3@ L 2@ L _D L L L `L L `L L 0@ 8 L P0@ @ L /@ L /@ L D L L L L L L L .@ L .@ L 0.@ L -@ ( L D 0 L L 8 L @L @ L @L H L -@ L ,@ L p,@ pL L xL L L L L ,@ L +@ L +@ @L 0+@ HL pD PL L `L L hL *@ L *@ L p*@ L ZD L L L L L *@ L )@ L (@ pL L xL ?L L ?L L '@ L &@ L &@ `L p&@ hL \D pL L xL L L L L &@ L %@ L p&@ (L \D 0L L @L L HL %@ x L p%@ L 0%@ L p&@ L \D L L L FL L ` L L &@ 8 L $@ @ L p$@ L $@ L lD L L L @eL L L L @#@ L D !L "@ @!L "@ H!L pD P!L L X!L lL `!L "L h!L "@ 8#L !@ @#L !@ H#L @!@ #L !@ #L CD #L L #L lL #L `$L #L @ 8%L P @ @%L @ %L @ %L CD %L L %L ML %L `&L %L @ (L @ (L 0 @ `(L @ h(L 9D p(L L x(L PL (L @*L (L @ *L @ +L p@ +L @ @+L @ H+L @D P+L L X+L 9L `+L .L h+L @@ 0L @ 1L @ 1L @ @1L 0@ H1L _D P1L L `1L 8L h1L @ ;L @ ;L @ ;L P@ ;L L ;L L <L =L <L @ x?L 0@ ?L p@ ?L L ?L VL ?L VL ?L @ AL @ BL p&@ (BL \D 0BL L 8BL L @BL BL HBL @ xCL P@ CL p&@ CL \D CL L CL DL CL %@ EL @ `EL p&@ hEL \D pEL L xEL FL EL EL EL %@ FL @ GL @ @GL HC PGL L XGL lL `GL GL hGL @ @ HL @ IL @ @IL P @ PIL L XIL lL `IL `JL hIL @ xKL @ KL @ KL p@ KL pD KL L KL ML KL LL KL @ NL 0@ NL @ OL P @ (OL pD 0OL L 8OL PL @OL `PL HOL @ XQL @ `QL 0 @ QL HC QL L QL L QL RL QL @ xVL p@ VL 0@ VL @ VL P @ VL L VL L VL L VL @ XL @ XL @ XL `@ YL 0@ YL CD YL L YL \L YL \L (YL @ \L 0@ \L @ \L @ ]L @ (]L \D 0]L L 8]L ``L @]L ``L H]L @ `L ? `L ? `L `? aL ? (aL pD 0aL L 8aL @L @aL @L HaL ? xgL ? gL P? gL ? gL \D gL L gL L gL L gL @? jL ? jL ? `jL @ hjL \D pjL L xjL kL jL kL jL ? mL p? mL ? mL ? mL ? mL D mL L mL qL nL qL nL ? rL ? rL ? rL `? sL ? (sL @D 0sL L 8sL uL @sL uL HsL ? vL ? vL 0? vL ? vL ? vL @tD vL L vL L wL L wL @? XzL ? `zL ? zL L zL L zL L zL ? X|L D `|L p? |L YD |L \D |L L |L L |L ~L |L ? }L D }L ? ~L ZD 0~L L 8~L L @~L ~L H~L ? L P? L ? `L ZD pL L L L L ? 8L D @L p? L 0? L \D L L L L L `L L ? L D L ? `L ZD pL L xL L L `L L ? L D L ? L @? L ? (L CD 0L L @L L HL ? 8L ? @L P? L P\D L \D L L L L L `? XL _B `L ? L ? L @tD L L L L ȌL ? L ? L ? L ? @L P? HL D PL L XL L `L L hL ? xL ? L 0? L ? țL D ЛL L ؛L L L L L ? 8L ? @L ? L p? L 6D L L L L L L L ? L ? L p? L 0? L @:C L L L `L L L L ? إL p? L ? L 0? (L 6D 0L L 8L L @L L HL ? 8L ? @L 0? L 0? L @:C L L L `L L L L ? XL P? `L ? L ? L CD L L L L L L ȫL ? 8L ? L p? L CD L L L L L L L ? XL ? `L ? hL @? L ? L \D L L ȳL ? L P? L ? ȵL `? L 0? L CD L L L @L L @L (L ? L D L ? L `? L 0? L \D L L L L L L L ? L 0? L ]D PL L XL `L `L `L hL ? ؽL D L p? L 0? (L CD 0L L @L @L HL ? L D L ? L ZD L L L L (L ? L D L ? L pC L \D L L L L (L ? L P? L ? 0L L 8L @L @L @L HL @? L ? L ? L ZD 0L L @L L HL `? L ? L ? L ZD L L L L L L (L `? 8L 0? @L ? L ZD L L L L L L L ? xL \D L p? L pC L \D L L L @L L ? L ? L 0? L L L L L L (L ? L P? L ? L ZD L L L L (L ? L ? L ? (L ? `L ? hL \D pL L xL L L @L L `? XL ? `L p? hL ? L ? L \D L L L L L @L L `? L +D L ? L ? L D L L L `L L L L ? xL \D L ? L pC L \D L L L L L ? xL о? L #A L L L @L L @L L "A L D L ? L P%D L L L L L L L @? L ? L p@ `L 0@ hL CD pL L xL L L L L ? xL D L P? L ? L p2B L L L L L L L ? XL D `L PD L D L D 8L D @L PD L D L D 8L D L `D L D L D PL D hL D L PD L PD L D (L D L ЅD L pD L D (L D XL ЁD `L D L @D L `~D L pTD L SD L D (L @RD L MD L PLD pL E L JD 8L D @L D HL D L CE L D 8L D @L D L E L D 8L C @L C HL C L F L C M EC M 0DC M CC PM F hM `AC M P C M PC M C P M ^G h M `C M B M лB p M `G M B XM PB `M B M G M B xM pB M B M H M @B 8 M PA @ M A H M A M H M A M A M A ( M A p M @I M A 8$M A @$M A H$M A $M I $M A %M nA &M PmA P&M `ZJ h&M jA X(M A `(M A (M @K (M A x-M V@ -M 0T@ -M L -M O@ (0M x/ 80M h* H0M G X0M h0M 7 x0M = 0M @= 0M g* 0M + 0M y/ 0M @( 1M : 1M ( (1M 6 81M @= H1M = X1M ( x1M + 1M `{/ 1M + 1M + 1M x 1M + 1M = 2M + (2M + @2M {, 2M ͝, 2M N+ 2M |, 2M N+ 2M , 2M , (3M p' 83M `P+ H3M 0' x3M @/ 3M p( 3M ' 3M 2M 3M = 3M @2M 3M ' 4M P( 4M @( 84M *) H4M ( X4M ( h4M = 4M {, 4M ( 4M > 5M @= (5M P' 85M = H5M p' `5M , h5M x5M / 5M , 5M + 5M / 5M g, 5M ( 5M @/ 5M H, 5M ;( 5M / 5M , 5M + 5M / 6M , 6M s( 6M @/ 6M , (6M ( 86M / @6M , H6M p! X6M / `6M , h6M x6M / 6M , 6M + 6M / 6M ˟, 6M + 6M `/ 6M , 6M , 7M c, 7M ! 7M / 7M ?, (7M ( 87M / @7M O, H7M p! X7M `/ `7M c, h7M `( x7M / 7M Ò, 7M ! 7M / 7M ˤ, 7M K* 7M @/ 7M o, 7M 7M / 7M , 7M + 7M p/ 8M ˟, 8M 0+ 8M @/ 8M , 88M , `8M ̥, h8M `( x8M @/ 8M ͝, 8M Pj+ 8M / 8M |, 8M k+ 8M / 8M , 8M , 9M 5, 09M @g" 9M @/ 9M p" 9M g" 9M = 8:M ~+ :M O, :M Щ* P;M / X;M X+ `;M * ;M b" ;M = ;M }+ X<M ^, p<M t" <M d+ =M s" (=M `= x=M u+ =M q, >M d+ >M / >M d+ >M q" >M = ?M ]+ ?M , ?M @) ?M 0}+ 0@M / 8@M 0* `@M `8" h@M @> @M ) 8AM , PAM P' AM / AM p+ BM n! BM = XBM ' BM , BM ' pCM `/ xCM S+ CM ' CM > CM ' xDM , DM x+ EM / EM y+ @EM w+ EM pw+ FM Ц, 0FM * FM @/ FM P* FM `" FM > 8GM * GM , GM ( GM q+ PHM / XHM ' HM ) HM > HM ' XIM , pIM ( IM / IM + JM ( (JM > xJM ( JM , KM e+ KM / KM + KM t" KM > LM e+ LM , LM ( 0MM @/ 8MM P* `MM ! hMM `8M MM ( 8NM /, PNM i* NM / NM + OM Pi* OM = XOM h* OM A, OM * pPM `/ xPM o+ PM _" PM = PM p* xQM R, QM 0c+ RM / RM z @RM Pb+ HRM = RM a+ SM f, 0SM d+ SM `/ SM 7 SM pc+ SM = 8TM b+ TM z, TM P`+ PUM / XUM UM _+ UM `= UM _+ XVM x. pVM l* VM @/ VM p+ WM n+ (WM > xWM `+ WM , XM pl* XM / XM Po+ XM \" XM = YM `k* YM , YM g+ 0ZM / 8ZM `ZM f+ hZM > ZM e+ 8[M `}, P[M .& x[M [M 0 [M 0% [M /& \M `N \M > \M > \M > H\M % \M r, \M 1& p]M / ]M @ > ]M > ]M p & x^M ¨, ^M zt _M @0 _M 0 _M Q6 H_M > X_M > _M k `M ը, 0`M 0w% X`M % `M @0 `M % `M 6 `M > `M > `M > (aM % aM , aM 0w% aM % PbM 0 XbM % `bM 6 bM S) bM > bM @ > bM > bM 0:* XcM , pcM 0w% cM % cM 0 cM % dM 6 dM S) (dM > 0dM > 8dM `> hdM pd% dM ?, eM #" eM 0 eM + eM 26 eM V= eM "> eM "> fM ` " fM 0 " fM l, fM d% fM 0gM 0 8gM @% @gM 6 hgM @'> pgM )> xgM )> gM _% gM ^% hM {, HhM , PhM P) hM , hM ) PiM 50 XiM `iM 5 xiM `& iM p) iM *> iM hM (jM @ @jM , HjM ) XjM a0 `jM , hjM @ xjM a0 jM , jM jM @a0 jM , jM q jM a0 jM %, jM q jM a0 jM O, jM 62 jM `0 kM *, kM + kM ``0 kM 1, (kM 8kM `0 @kM , HkM 2 XkM _0 `kM , hkM ] xkM @_0 kM H, kM }) kM _0 kM <, kM ` ) kM ^0 kM ͝, kM kM b0 kM h, kM ) kM ^0 lM D, lM Jh lM @^0 lM Q, (lM / 8lM ^0 @lM , HlM XlM ]0 `lM ڥ, hlM 2 xlM `]0 lM , lM , lM Y, lM ( lM @c0 lM %, lM 2 lM c0 mM , mM 2 mM c0 mM ͝, (mM + 8mM b0 @mM , XmM , mM @. mM + 8nM 50 `nM , hnM 2> nM ? 8oM , PoM + oM 50 pM 0+ pM 2> XpM Ý pM , pM @( qM ; qM 2> pqM d0 xqM ( qM b qM lM qM 2> qM ( xrM Ѫ, rM ( rM rM 1> sM b0 sM ' sM P ( (sM 8sM + HsM @jM XsM `1> sM p' sM ' tM , tM ( tM @0 tM , (tM \ 8tM 0 @tM , HtM XtM `0 `tM ȝ, htM * xtM 0 tM , tM 0 tM 0 tM , tM / tM @0 tM , tM , uM `( uM ( 8uM ж( HuM @G> `uM , puM +, uM , uM [, uM m, uM , uM u, uM , uM sA, uM , vM ?, vM , vM ?, 0vM , @vM q, PvM Y, `vM Y, pvM , vM ǝ, vM Q, vM , vM y, vM ', vM U, vM /, vM 4, wM 8, wM o, wM /S, 0wM #0, @wM >, xwM |, wM j xM T1 xM P"& xM @* HxM > PxM > XxM > xM B yM , 0yM "% XyM yM > zM , zM * {M @> {M > X{M * `{M e5 h{M x{M "i {M @> {M n X|M , p|M |M > |M + }M 5 }M }M , ~M P~M > ~M + ~M 5 ~M M , M M > 8M + @M 5 `M 8M , PM Q M * M , M ݨ xM O* xM , M 0* M * M , M й* M 1 M br, (M * 8M 1 @M %, HM Oq XM 1 `M , xM , M , M , M 1, 8M M ?, M 0* ؈M p 8M ) @M P* hM M xM > M n 8M R, PM xM q M p* ؊M I) M (5 M M M > XM 8 ؋M j, M gA (M > 0M > xM @* M A M M >i M > M q xM P, M M 1 M `* @M p! HM @> M M , 0M 0 M @1 M P*) M M > 8M M ` M , АM P( PM `1 XM Ѐ+ M ! M > ؑM ˺ 0M М( HM XM 5 M M {, M p! 8M HM + XM > hM > xM M M M , M , 8M , PM ^) xM M > M > M > M g M s M ]) M + ؔM 3 M @p* M ? M M ؕM , M ^) M M > (M > 0M > HM s PM ]) XM + xM 3 M @p* M ? M M M @> xM , M M ؗM M 3 M @p* (M " HM M PM > M $ M @$ M $, 0M ` & XM 0( `M > pM > xM ӕ M p( M (. M ( șM M > M @> M l M 0 M M R, 0M M + M P M d, МM M p+ M `P XM v, pM % M ~+ M ( (M > M , M % M ~+ M > ȠM > M 4, M ءM p M > M M M > M M * 0M 3 XM % hM > M 8M , PM xM M ` УM 3 أM % M > 0M R HM " M ؤM V, M p& M c$ M > @M PM ` XM $ pM `3 xM 4 M & M > M @> M > M Pg# M W# M , PM xM n, M 8 M ' M M 3 (M HM > XM > M @ M M , M p+ M P3 M , (M ( 8M 3 @M O, HM + XM `3 `M , xM , M , ШM p XM % M M > XM i, pM M M > M > M p M 3 M ) M 0? M (M M xM % ЫM % M }, 8M ( ȬM > M M L, M `} حM E 0M @3 8M ' HM kW hM > pM `> M N) @M , HM XM 3 `M , hM ' xM 3 M , M $& M 3 M %, M + M 3 M , ȯM P!) دM 3 M , M c* M 3 M 2, M 0' M 3 M , (M PK* 8M 3 @M , HM + XM 3 `M , hM + xM 3 M , M & M 3 M , M ( M 3 M H, ȰM 1' ذM 3 M ͝, M p+ M 3 M h, M %) M 3 M ڥ, (M 5 8M 3 @M , HM e* XM 3 `M (, hM @e* xM @3 M D, M J* M 3 M t , M X+ M 3 M , رM , M , M $& M 3 M %, (M ? 8M 3 @M , HM c* XM 3 `M , hM PK* xM 3 M , M + M 3 M , M & M 3 M , ȲM ( زM 3 M ͝, M p+ M 3 M ڥ, M 5 M 3 M , (M e* 8M 3 @M D, HM J* XM 3 `M , xM , M J, гM M . XM [, pM $ M Y+ M U (M `> M br, M V 8M ( @M > HM > M @3 M M M & M @$ ȷM @M M * M * pM M , M V ظM ( M @> M > M 0M @3 8M @M HM & XM @$ hM M M + M | 8M h, PM % M c* M > ػM l, M M `> xM Q, M ` M M @> ȽM > нM > ؽM T M 3 (M + 8M @ HM > PM > M . M M , 0M XM : `M `> M > 8M M , M m M ! M > M 9 xM , M # M + M 3 M # M + (M HM > PM > M !$ M @N# M , M 0+, M 8& M @) 0M ! PM `3 XM `M @:& M > M > M > M 0$ M $ XM , M , M 8M P\+ XM & `M { M 0, M p/' M > M `> M `> M `, M 0+ 8M `M + 8M , PM xM * M > M P> M `+ M @> M 3 M @% M M \* M + M > M > XM w% M p, M % xM % M ^9 `M {, M , M * M @> xM , 8M * HM > M , M ( M > M , M `( M + M > M > PM 3 XM * `M + hM 0j* xM a* M > M `M M ( XM , pM ( M + M `( (M > M , M M 3 M m, M 0L M p3 M ڥ, (M Ч+ 8M @3 @M , HM ` XM 3 `M U, hM 0(' xM 3 M H, M $ M 3 M ~, M p* M `3 M , M p% M 3 M , M 1 M 3 M , M % M 3 M t , (M # 8M 3 @M n\, HM @' XM 3 `M , hM ( xM 3 M %, M ( M 3 M D, M t M @3 M , M , hM M y M M , M 4 M + M > 8M p& XM % hM > xM `> 8M , PM M f' M . M > M , M 4 M + M `M (M > xM p& M q M 3 M > M `> xM , M 4 M + M `M M @> M p& (M q 8M % HM > XM `> M , 0M M f' M 0 M > M , M XM f' M P5 M > XM , pM M f' M xX (M > M 2, M M f' M xX M > M K, M 8M f' `M xX hM > 8M @4, PM Е xM ! M `> M M M @> M 3 M `- M `$ M Х( M M M HM $' PM XM M +' M !, M P M ? 8M pM 4 M Ё M @> M `> M p `M m, hM 4 xM E, M D, M 0% M 4 M ڥ, M 5 M @4 M , M p( M 4 M %, M ) M 4 M , M P M `4 M , (M p% 8M 4 @M *, HM `b XM 4 `M H, hM xM 4 M h, M @% M 4 M , M P*( M 4 M O, M Q) M 4 M Q, M ' M `4 M [ , M J M 4 M , 8M , xM d, M M ` M ? M `? M 4 M ( M p& (M 8M @V HM `M M 0) M X M `, 0M p% M n* M /& M `? M u, M `_ XM % M X M ? xM , M w" M @M M + @M : HM ? M , 0M p! M ( M ! M ? M r, M % XM ' M ! M ? XM , pM 9 M q M `? M . M _ M 4 M . xM M =, M % M L) M .d, M ( M ( 0M h, 8M p( @M XM -, `M # hM & M {, M f, M # M p# M h, M # M # M , (M @% HM {, M , M P% M {, 8M , PM & xM M 8h M 4 M 4 M ' M ? M M 0M 0 HM # M , M >& M pM `4 xM M ' M ? M M M ~ M `# x N 4, N = N ' N 4 N N G PN ? XN M pN 0 N N X, 0N `t XN N $& N " N ? N ` ? N ? N , N N ! N ? N ' PN '4 hN @ N ? N ? N * 0N !! XN , N (N ? 8N `? N , N ~ N )4 N , N * N `)4 N , (N 8N )4 @N ڥ, HN !6 XN (4 `N , xN , N N p%( N ~, 0N PN ? XN N `' N w N @? N ? N ? N , N g7 X N `+ X N , p N 7 N N N N R. ( N @? N , N )8 N . N N - N `? N , N -7 N N 8N `N 1 hN ? 8N , PN pN N xN N ) N N N ? N ? N /, N N @? N xN `' N ? N ? N ? xN @, N 8 N P+ N + @N D_ HN @? N W, 0N % XN ( `N ? pN `? xN N N ( N +4 N ( N ( N N ? N ? N ? 8N N {, N D, N ( N N j, N % N i N x, N P* (N 0N , @N , HN pP* PN XN , N , N , N K, N { N , N G N R, N XN , pN > N 3 N q' N `. N $& N < (N ? 0N ? 8N N hN = xN ; N ͝, N 8a N .4 N , N , XN , pN #' N `,4 N .' N L (N N xN N & N , N ( N .4 N p' N ( N ? N , p N 0% N , N 0' N . N , N -' N . N , N ( N . N , N P% N @. N %, N u N . N , 8 N , @ N D, H N f X N . N , N N N f! 8 N @3 h N ? p N ? x N ? N 8 N , P N x N N @3 !N ? !N ? 0!N 8!N # !N , !N "N x"N @3 "N ? "N ? "N ? "N a "N x#N , #N #N #N $N @3 P$N ? X$N `? p$N %N , 0%N X%N %N @3 %N ? %N ? %N `? &N n &N , &N # P'N @04 X'N p `'N ' 'N ? 'N ? 'N ? 'N v 'N $ 'N `# X(N *, p(N % (N (N ? (N ? (N ? (N Pv (N `& )N R )N @K* ()N N x)N I' )N 7, *N P 8*N + X*N C4 `*N *N ' *N k *N ? *N `? *N `? +N , +N P) +N ? +N ) 0,N 44 H,N 0 * h,N ? p,N ? ,N 0 * 8-N Z, P-N 1 x-N D -N p= -N 64 -N ]% .N ? .N ? .N ? X.N # .N k, .N 4 /N V x0N y, 0N 0* @1N * 2N , 02N X2N + x2N 2N P! 2N 84 2N , 2N G 2N ? 2N ? 2N @? 83N \ 3N , 3N 0+ 3N 4N Ah 04N P4N 84 X4N 0+ h4N 4N ? 4N `? 4N 4N X5N ^L, p5N 5N 5N 84 5N p 6N ' 6N 86N ? x6N 6N , 7N % 87N 7N 94 8N , 8N @% 89N ) `9N h9N ? 8:N g, x:N ' :N ? :N `? :N 0? :N 0 :N @) :N ? :N @T4 :N ^ :N % ;N ? P;N X;N ! ;N Z ;N `) ;N P) ;N ;N 08" <N _( <N 8<N , P<N % <N ) =N e) =N ? =N Sq, =N P >N ' >N ? (>N ;N 0>N P? H>N p) `>N @? p>N u4 >N pl) >N P% >N `? >N ?N , ?N ?N p( ?N ? 0@N `4 @N Y AN ; = ; g ; g ; g ; g ; g ` (; g 0; g 8; g ` = g n = g l = g b = g Hp = g f = g pd X= g h? g t ȿ? g P? g X? g @ 8? g H @? g h ? g H ? g h H? g p P? g Po X? g t `? g @b h? g hi ? g u ? g P? g h 0? g H @? g h ? g ? g p ? g Po ? g t ? g @b ? g hi ? g u P? g ? g H? g (? g 8? g ? g p? g ? g ? g x (? g P? g p `? g 0c ? g m ? g H{ ? g ? g 0? g ` p? g ? g x ? g _ ? g p ? g ? g U ? g 0? g x? g V ? g H (? g p 0? g Po 8? g t @? g @b H? g hi P? g u X? g b x? g Ж ? g H? g (? g ? g H{ ? g p ? g m (? g 0c 0? g H? g (s ? g ? g ? g p ? g p ? g 0c ? g m ? g Ж ? g r ? g H{ (? g (s ? g p ? g m ? g r ? g (s ? g 0c ? g 0? g h? g 8? g @? g ? g ? g ? g @ g @ g @ g @ g m @ g p @ g r @ g H{ P@ g m X@ g r `@ g (s h@ g V p@ g H x@ g H{ P@ g H@ g X@ g `@ g P@ g ` @ g p x @ g @ @ g @ g p @ g Po @ g t @ g @b @ g P @ g p x@ g x @ g (s @ g 0c @ g H{ @@ g p P@ g @ g 0c @ g (s @ g @ @ g x @ g (s @ g H @ g 0c @ g x @ g x @ g @ g H @ @ g h X @ g V @ g x @ g @ @ g Y @ g x @ g H @ g @ 8!@ g x !@ g !@ g x !@ g 0c "@ g "@ g #@ g H{ #@ g 8#@ g a H$@ g Y $@ g (s $@ g Ȁ %@ g 0c )@ g p )@ g Po )@ g t )@ g @b H)@ g Ȁ )@ g P ,@ g p ,@ g Po ,@ g t ,@ g @b ,@ g xb ,@ g b -@ g P.@ g .@ g V .@ g h .@ g H /@ g /@ g @ /@ g 2@ g 2@ g @ 2@ g H{ 3@ g 4@ g H{ 5@ g 0 6@ g H 8@ g 8@ g @ 8@ g Ж 8@ g 9@ g 9@ g (s 9@ g H{ :@ g ` :@ g x p:@ g V x:@ g H :@ g h<@ g =@ g =@ g (=@ g @=@ g =@ g H{ =@ g h>@ g >@ g ?@ g H A@ g 0 A@ g p A@ g H A@ g [ A@ g A@ g A@ g xB@ g [ (D@ g 0D@ g Ж D@ g r D@ g H{ D@ g D@ g p D@ g (s D@ g V D@ g H hF@ g G@ g G@ g G@ g p (G@ g H pG@ g H G@ g V G@ g (s (H@ g J@ g @K@ g HK@ g p PK@ g 0 K@ g Ȁ K@ g p M@ g x HN@ g PN@ g p N@ g H N@ g N@ g H HT@ g @b T@ g U@ g U@ g H U@ g h V@ g h W@ g H W@ g Y@ g x^@ g ^@ g h ^@ g ^@ g h _@ g _@ g _@ g h xb@ g @ b@ g c@ g x (c@ g pc@ g W xc@ g h c@ g H Pe@ g 8f@ g @ (g@ g @ g@ g H g@ g W g@ g h Hi@ g @ Pi@ g P l@ g @ l@ g H l@ g 8m@ g H Pm@ g h o@ g @ o@ g P p@ g p@ g p@ g H s@ g @ t@ g x t@ g u@ g W u@ g h u@ g V u@ g H u@ g v@ g v@ g x@ g @ hy@ g z@ g V 0z@ g 8z@ g @z@ g `z@ g H {@ g Y (|@ g |@ g H |@ g V |@ g |@ g ( ~@ g @ ~@ g P x@ g H P@ g @ g H@ g Po P@ g p X@ g t `@ g @b X@ g H @ g @ g a (@ g @ g @ g H@ g H @ g @ g (@ g x@ g @ g H @ g H @ g @ g p@ g Њ@ g H ؊@ g @ g H ؋@ g p@ g H x@ g H @ g @ g @ g 0 @ g h@ g ؏@ g @ 0@ g H (@ g @ g @ @ g @ g h @ g H @ g ȉ @@ g X@ g @ g H h@ g @ g @ g x 8@ g PU `@ g H @ g Ȝ@ g W @ g @ @ g (@ g p 0@ g Po 8@ g t @@ g @b @ g x У@ g h أ@ g V @ g H @ g @ g hi ؤ@ g @ g p (@ g @@ g a @ g (@ g p 0@ g Po 8@ g t @@ g @b @ g @ @ g @ @ g @ @ g @ h@ g @ g P@ g @ g @ g H @ g h (@ g H 0@ g @ g p @ g Po @ g t @ g P X@ g ( @ g _ @ g @ (@ g 0 X@ g @ g H H@ g p P@ g Po X@ g t `@ g @b h@ g hi p@ g b x@ g f @ g _ @ g @ H@ g P @ g @ @ g Ж @ g x @ g x @ g @ g @ g p @ g Po @ g t @ g @b h@ g X@ g @ @ g H @ g p @ g Po @ g t @ g @b 0@ g P @ g @ g @ @ g _ @ g a 0@ g 8@ g @ (@ g P@ g X@ g @ H@ g p@ g x@ g @ @ g hi @ g @ P@ g h @ g p @ g Po @ g t @ g @b @ g hi @ g b @ g f @ g P @ g @ @ g Ж 0@ g V 8@ g W H@ g (s 0@ g @@ g H@ g @ g @ @ g @ g x @ g p @ g Po @ g t @ g @b 0@ g hi P@ g k X@ g e `@ g z h@ g l p@ g u x@ g ` @ g x @ g H @ g @ g @ @ g p P@ g W X@ g U @ g @ g H @ g p @ g Po @ g t @ g hi @ g P @ g @ g p @ g h @ g H h@ g @ P@ g @ 0@ g W @ g @ g @ g @ h@ g 0 @ g @ @ g @ g @ p@ g @ @ g @ @ g H (@ g p 0@ g Po 8@ g t @@ g @b P@ g @ @ g @ @ g @ 8@ g V @@ g ( @ g ( A g @ 8A g @ A g A g V A g (A g ( 0A g hi A g @ A g A g @ A g @ x A g V H A g @ p A g @ A g p A g Po A g t A g @b A g hi 8A g u A g A g A g m A g H{ (A g 0c (A g HA g @ hA g x ( A g @b 0 A g A g A g x A g A g Ȁ A g H @ A g W A g A g h (#A g p 0#A g Po 8#A g t %A g @ h&A g 0 &A g H &A g x 'A g ( (A g @ *A g @ *A g H *A g p,A g @ ,A g ,A g x /A g H /A g 0A g H 0A g W 0A g 2A g @ P3A g 6A g 6A g 7A g @ 7A g 7A g 7A g 0 7A g m 7A g (s 8A g ^ 8A g Ȁ 8A g a 88A g 8A g ^ :A g H >A g p >A g Po >A g t >A g @b >A g hi >A g P ?A g u H?A g ȡ @A g V @A g pAA g @ xBA g @ KA g LA g LA g @ NA g NA g 0 NA g (NA g hNA g NA g H NA g OA g OA g OA g H 0OA g 8OA g H @OA g hOA g OA g H OA g OA g OA g H OA g OA g OA g H OA g OA g OA g H OA g h QA g (RA g H UA g VA g 0 VA g VA g PWA g H pWA g WA g WA g WA g XA g XA g @ [A g [A g [A g 0 \A g h \A g H (\A g @\A g H H\A g P\A g H ]A g H ]A g p% ]A g & `A g h `A g `A g ( `A g ( `A g aA g ( aA g aA g ( HaA g H PaA g H PbA g @ PcA g ( `cA g hcA g pcA g dA g @ peA g ( gA g @ gA g gA g hA g 8iA g HiA g H hmA g @b mA g mA g [ 8nA g ȡ oA g H 0oA g ȡ 8oA g h HoA g pA g hk rA g _ HrA g hk XrA g hi sA g p sA g Po sA g t sA g @b (sA g hk 0sA g hi 8sA g _ (tA g p 0tA g Po 8tA g t @tA g @b HtA g hk PuA g xuA g _ uA g p yA g Po yA g t zA g V (}A g p 0}A g Po 8}A g t @}A g @b H}A g p X}A g i `}A g { }A g _ A g A g H] A g A g @ A g a A g p A g Z PA g Z XA g hA g hk A g (A g @b ЄA g Po hA g H A g A g A g ȆA g Ё A g p A g A g (A g PA g Ё A g _ A g Po A g t A g A g Ё HA g p PA g Po XA g t `A g @b hA g Ё pA g p xA g u A g p A g Po A g t A g @b ȋA g ЋA g A g 8 A g A g A g W A g H A g p A g Po A g t A g @b (A g hi 0A g 8A g @A g ȍ HA g A g 8 A g hi A g ȐA g ؐA g pA g xA g 0A g W (A g p 0A g Po 8A g t @A g @b HA g hi XA g `A g hA g ȍ pA g A g 8 A g A g h# A g H A g p A g Po A g t A g @b ȗA g hi ЗA g ؗA g A g ȍ A g 8A g 8 0A g pA g hi xA g A g A g A g A g A g A g ȝA g p НA g Po ؝A g t A g @b A g hi A g A g A g ȍ A g XA g 8 0A g hA g pA g A g hA g pA g A g W ȣA g p УA g Po أA g t A g hi A g A g A g 0 A g A g d A g xb A g b (A g Xu pA g 8 A g H A g ХA g 0A g h# A g A g ȩA g ةA g A g A g XA g H pA g h A g A g A g A g 0 خA g A g H A g h 8A g H XA g & hA g ( xA g hA g A g h# PA g 0 XA g 0A g hA g A g ( A g ( (A g p 0A g Po 8A g t PA g hi XA g `A g hA g xA g A g 0 A g pq A g k A g A g d A g xb A g b A g Xu A g 8 A g ( HA g H hA g A g A g PA g A g x PA g A g 0 A g A g p A g Po A g t A g @b A g ȉ A g hi A g A g оA g pq ؾA g k A g A g A g 0 A g A g d A g xb A g b A g Xu A g 8 A g ( A g H A g A g A g PA g XA g pA g PA g XA g `A g A g A g A g A g A g A g HA g x XA g `A g A g A g A g A g A g A g A g 0A g h# A g pA g A g 0 0A g 8A g A g PA g _ XA g p A g H hA g p pA g Po xA g t A g @b A g hi A g A g A g pq A g k A g A g A g 0 A g A g d A g xb A g b A g Xu `A g 8 pA g ( A g H A g x A g P A g ȉ A g A g A g A g ȉ A g @A g A g A g PA g A g A g ȉ A g ȉ pA g ȉ xA g A g A g W 0A g ȉ 8A g A g A g h# HA g p A g 8 A g 8 A g ( A g A g A g A g @b A g A g [ A g pA g p xA g A g ȝ A g H A g h A g 8 A g ( @A g HA g H hA g Xn xA g HX hA g pA g Р A g Р A g A g p A g H (A g A g p A g Po A g t A g @b A g p A g Po A g t A g @b A g p A g Po A g t A g @b hA g p pA g Po xA g t A g @b `A g A g X A g XA g X A g @b A g [ HA g A g X A g d A g Po A g H A g h A g A g PA g a A g f HA g p PA g Po XA g t `A g { pA g f A g @| A g A g ] A g p A g Po A g t A g { A g ] A g @| A g H_ PA g B g ] B g B g p (B g B g p B g Po B g t B g { 0B g 8B g p @B g PB g @| B g 0B g [ B g p B g Po B g t B g { B g [ B g @| 0B g H_ pB g B g H\ B g [ B g p B g Po B g t B g { B g H\ B g [ B g @| 0B g B g [ B g H\ B g p B g Po B g t B g { (B g H\ XB g @| B g PB g k B g p B g Po B g t B g { 0B g k @B g @| PB g H_ B g PB g k XB g pq B g p B g Po B g t B g { 0B g pq 8B g k HB g @| B g B g u B g k B g p B g Po B g t B g { B g u B g @| B g B g B g p 0B g k 8B g pq @B g HB g p PB g H B g p P B g Po X B g t ` B g { h B g pq x B g B g p B g B g @| B g 0 B g l B g p B g Po B g t B g { B g l B g @| p B g B g ` h!B g p p!B g Po x!B g t !B g { !B g ` !B g @| !B g H_ !B g "B g l "B g k #B g ` #B g p #B g Po #B g t #B g { #B g @| $B g %B g _ %B g 0 %B g &B g p P&B g P(B g _ (B g (B g \ (B g u (B g (B g (B g H )B g U )B g ( )B g \ )B g P*B g X*B g H `*B g ( ,B g _ H,B g 0 X,B g `,B g r x,B g e ,B g \ ,B g h ,B g H ,B g ( -B g _ (.B g p 0.B g Po 8.B g t @.B g @b H.B g { P.B g p X.B g u `.B g u h.B g e p.B g _ .B g p/B g x/B g /B g p 0B g 1B g 0 (1B g Po 2B g 2B g 0 2B g Po 2B g t 3B g p P3B g X3B g V 5B g ^ 5B g p 5B g Po 5B g t 5B g { 5B g ^ 6B g @| 6B g H_ P6B g 7B g 0 7B g 7B g pd 9B g 0 9B g (:B g 0 @:B g H:B g l h>B g 0 BB g 0 EB g pEB g xEB g h EB g H EB g EB g h EB g ( HGB g p PGB g Po XGB g t `GB g @b hGB g { pGB g l xGB g n GB g f GB g pd GB g b GB g \ GB g t GB g q GB g Xw GB g { GB g x GB g ~ GB g y 8HB g KB g KB g x MB g @ NB g P NB g 0 NB g @ OB g P QB g p QB g Po QB g t QB g @b (QB g { 8QB g @ XQB g P `QB g j hQB g hg pQB g pl xQB g k QB g VB g 0 VB g p WB g p WB g Po WB g t WB g @b WB g { WB g Z XB g e XB g XB g ` XB g XB g p (XB g ` 0XB g b 8XB g u xXB g XB g H YB g H[B g p P[B g Po X[B g t `[B g { h[B g hi p[B g l x[B g u [B g H_ P]B g `B g p `B g Po `B g t aB g { aB g ` aB g k paB g cB g p cB g Po cB g t cB g { cB g ` cB g k dB g xeB g ؇ HgB g x PgB g HjB g 0 `jB g hjB g p jB g XkB g ؇ HlB g mB g p mB g Po mB g t mB g @b mB g { mB g z mB g Ha mB g P 8nB g oB g H oB g h qB g qB g psB g sB g H sB g h tB g h (vB g H (wB g p 0wB g Po 8wB g t @wB g @b HwB g { PwB g Z `wB g e hwB g k pwB g ` xwB g u wB g wB g H xB g H xB g p xB g Po xB g t xB g @b xB g { yB g P{B g }B g ~B g ~B g h ~B g ` 0B g x pB g ` B g @ B g ( HB g p PB g Po XB g t `B g @b hB g { xB g z B g Ha B g x B g P B g @ B g (g B g XB g ( ȄB g ȐB g @b (B g [ 0B g p 8B g XB g hB g ` xB g p B g B g a (B g B g H ȓB g h# ГB g h B g W B g PB g ȖB g ЗB g PB g ȝ XB g (B g p 0B g Po 8B g t @B g hi HB g u PB g ^ B g x B g @ B g B g МB g H 8B g x B g B g B g pB g HX PB g hB g B g B g W XB g XB g H `B g h B g B g B g p B g Po B g t B g @b B g hi B g u ȤB g ^ B g ( B g hB g p pB g Po xB g t B g @b B g u B g ^ B g @b pB g H B g x hB g 0 B g W B g H B g h B g H hB g 0 B g _ B g p B g @b B g [ B g H оB g ȉ B g 0 8B g @B g H `B g B g 0 B g H B g 0 B g H 0B g 4 8B g `, hB g pB g h B g @ B g 0 pB g 4 B g p. B g H B g ( B g B g B g 0 0B g H B g B g 4 B g `, B g p. B g H B g H B g ( B g h B g B g h B g 4 B g `, B g 0, B g V B g h pB g H B g @ B g H (B g @ B g 0 B g 0B g @B g B g 0; B g h B g W B g @ B g 0 B g 0B g B g P* B g * B g H B g * B g : B g ; B g X B g W B g U B g h B g (B g @ B g 0 B g H B g B g x B g PB g 4 XB g `, `B g 0, B g V B g H B g h hB g h pB g xB g B g B g B g H B g B g B g ( HB g @ B g @ @B g (B g h 0B g 8B g @B g HB g PB g H XB g `B g hB g h pB g xB g ( B g B g h HB g @ pB g 0B g B g H hB g @ pB g 8 pB g 0 B g B g pB g H hB g @ xB g 0 B g B g 0B g 4 8B g 0, PB g V B g H B g h B g H PB g @ PB g 0 hB g xB g H B g B g H B g 4 (B g `, 0B g 0, HB g V B g h 8C g hC g @b C g [ 0C g p C g V C g H C g C g h C g 0 C g `, C g @ 8C g H @C g C g h C g 0 C g `, C g 0, (C g V XC g H C g h C g 0C g h C g @ C g @ C g Ж C g 0 C g ( C g @ X C g 8!C g 0 `!C g "C g 0; "C g h ("C g H P"C g `, (%C g @ p%C g &C g 0 P&C g &C g &C g P* &C g H 'C g : 'C g ; 8'C g W @'C g U P'C g h X'C g ( (C g 0 p(C g 0, x(C g V H*C g @ *C g 0 *C g x +C g P+C g `, X+C g h# `+C g 0, x+C g W +C g V +C g +C g +C g ( ,C g @ ,C g 0 -C g -C g x -C g 8 -C g @ .C g H 1C g @ 1C g 8 @1C g H1C g Y 1C g 0 2C g 2C g `, 2C g 0, 2C g V 2C g h 5C g @ `6C g 0 6C g 6C g 7C g 0, 7C g `, 07C g V 8C g @ 09C g h p>C g 0 >C g ?C g H ?C g `, (?C g 0, 8?C g V ?C g 8 8@C g HDC g @b DC g [ DC g EC g V FC g H HHC g H PHC g Y IC g [ JC g @ LC g LC g P MC g @ MC g 0 hOC g OC g @ RC g @ SC g WC g XXC g YC g x YC g x YC g YC g @ YC g h[C g (\C g X\C g @ p\C g 0 \C g aC g pbC g bC g x bC g bC g @ bC g bC g dC g ( fC g ( jC g @ jC g kC g mC g Р hnC g Р nC g nC g 0 0oC g H @oC g tC g huC g wC g wC g p 0xC g U H{C g 0 |C g p |C g Po |C g t |C g hi |C g e |C g z |C g Ha |C g k |C g l |C g u |C g 0 }C g j }C g q }C g Xw H~C g 0 h~C g p 0C g (C g 0 HC g p PC g PC g ȉ C g pC g C g C g ȉ C g C g p C g C g 0 (C g p C g ؇ 0C g C g 0 C g HC g x PC g ȉ XC g C g 0 C g C g ȉ C g C g P ȍC g 0 XC g H hC g ( C g ( C g P C g P PC g ( C g C g ȝ C g C g C g P C g 0 PC g XC g ȝ C g H C g C g C g H C g H C g țC g HC g (C g p 0C g Po 8C g t @C g hi HC g PC g xb XC g b `C g d hC g k ОC g P C g ȉ (C g 0 XC g C g H C g @ C g 0 C g 0d ȡC g p C g 0d C g 0d C g p C g Po C g t C g @b C g 0d (C g @| 8C g H_ C g @ hC g @ C g @ ȧC g hC g @ hC g p pC g Po xC g t C g hi C g C g xb C g b C g u C g @ PC g H C g ( ЫC g ( C g V `C g hC g @ C g @b C g [ (C g HC g x `C g @ pC g @ C g C g @ hC g C g p 0C g H `C g C g C g h C g C g V PC g ( C g C g @ C g XC g `C g ` hC g m pC g Po C g H{ C g @ C g 0c XC g @ hC g x pC g @ C g Y 8C g @ XC g @ C g C g C g C g @ C g C g (C g X xC g x C g @ C g 0C g H PC g hC g W C g h PC g C g V XC g pC g C g @ C g x C g @ PC g @ `C g 8C g PC g C g C g `C g pC g H C g V C g W C g H C g h HC g @ XC g @ C g @ C g x C g @ C g 0C g `C g @ C g (C g @C g XC g @ hC g 0c pC g @ xC g C g C g 0c C g C g C g PC g hC g C g @ C g C g H C g @b C g W 0C g @ hC g ȉ hC g Y C g XC g @ C g C g 0C g H @C g HX C g C g 0C g 8C g @C g _ HC g p C g H C g C g C g C g C g _ (C g p pC g H D g @ hD g @ D g @ D g PD g @ hD g x D g D g h PD g H pD g xD g D g ( D g @b @ D g ` D g p D g H D g Xn D g P (D g P D g x D g D g W (D g @b D g H D g h D g ( D g 0 D g 8 D g @ D g H D g ( P D g H X D g h D g H# D g H D g H 0 D g H 8 D g H @ D g H "D g "D g V "D g H "D g h $D g $D g @ $D g $D g H{ h%D g 'D g 'D g Ж (D g (D g h (D g (s (D g H{ )D g V )D g H )D g (s *D g p+D g x+D g h-D g Р -D g -D g p -D g r -D g .D g r .D g (s .D g V .D g H 0D g Р 0D g 0D g m 0D g 1D g m 4D g m 4D g r 5D g V 5D g H 6D g Р 7D g :D g H{ (:D g a :D g e :D g :D g p ;D g @;D g _ H;D g ;D g H{ ;D g _ ;D g a <D g e =D g p =D g Po =D g t =D g @b =D g e =D g ` DD g H{ DD g m DD g a DD g 0 DD g _ DD g 0 ED g a ED g _ (FD g p 0FD g Po 8FD g t @FD g @b hFD g hi hLD g @b LD g MD g 0 MD g Р MD g h ND g H SD g @b SD g TD g h WD g x (WD g WD g XD g p XD g Po XD g t XD g @b XD g hi XD g xb XD g b [D g H ]D g H ]D g p ]D g Po ]D g t ]D g hi ]D g xb ]D g b ^D g p ^D g 0c ^D g @b ^D g m ^D g r ^D g H{ `D g `D g Ж bD g cD g a cD g 0 `hD g Y hD g hD g iD g h iD g iD g iD g iD g Р iD g @ 0jD g p jD g V jD g (s jD g H jD g kD g Xn @mD g PmD g mD g nD g a PnD g Xn hnD g H PoD g rD g 0rD g @ prD g Xn rD g H tD g uD g @ uD g uD g H zD g {D g Po {D g p {D g 0 |D g @ H|D g a X|D g 0 |D g V |D g H ȀD g @b D g @ D g [ D g p D g D g D g H D g Xn D g D g p D g Po D g t D g @b D g p (D g Xn xD g Xn xD g p D g Xn HD g h# D g D g h# HD g h# D g D g h# ȍD g h# D g D g h# D g h# D g (D g h# (D g h# `D g hD g h# ȑD g h# D g D g h# (D g h# D g h# @D g HD g h# HD g h# D g h# @D g HD g h# D g h# 8D g b HD g h# D g ) D g xb hD g h# D g hi D g h# D g D g h# hD g h# D g b XD g xb D g h# 8D g hi D g h# @D g HD g h# D g h# D g (D g h# D g h# D g h# (D g h# xD g hi D g h# D g D g h# D g T HD g h# D g ) (D g h# `D g hD g h# D g h# XD g ` xD g e D g h# D g h# D g h# h E g h# (E g h# (E g h# E g h# HE g ) +E g h# @0E g H0E g h# 0E g ) 1E g 1E g h# 1E g ) 3E g 3E g h# H3E g ) h4E g h# 4E g ) H6E g h# 6E g ) 7E g h# (8E g ) 9E g h# (:E g ) ;E g h# ;E g ) =E g h# =E g ) ?E g h# ?E g ) AE g (AE g h# hAE g ) BE g BE g h# CE g ) EE g h# (ME g h# hME g ) QE g h# XfE g hfE g h# fE g PT hE g h# iE g ) uE g h# uE g uE g h# vE g h# h~E g h# ~E g ) E g h# E g h# E g h# HE g h# E g ) HE g h# E g E g h# ȔE g h# E g h# E g h# HE g ) E g h# E g ȟE g h# hE g h# E g PT hE g h# HE g h# E g ) HE g h# E g h# E g E g h# E g h# E g ) E g u E g h# E g b E g (E g h# hE g ) xE g xb HE g h# E g ) E g E g h# E g hi E g h# E g E g h# E g h# E g @| (E g h# hE g ) xE g 0d HE g h# HE g h# E g E g h# HE g h# E g ) E g k E g h# E g d E g h# XE g b `E g hE g h# E g ) E g xb E g h# E g E g h# E g hi E g h# hE g h# HE g h# F g h# F g h# HF g h# ( F g h# F g h# F g h# F g h# hF g h# h F g h# h F g h# "F g h# "F g ) $F g h# &F g h# (F g h# )F g (*F g h# x*F g +F g h# H-F g h# -F g ) /F g h# /F g /F g h# 0F g h# 0F g Xw H2F g h# 2F g q 3F g h# 4F g j 5F g (5F g h# h6F g h# 6F g ) 6F g 0 7F g h# 7F g u 9F g h# 8:F g S ;F g h# ;F g ) ;F g l <F g h# 8=F g k >F g Ha @F g h# AF g z CF g e DF g h# DF g hi PF g h# RF g h# UF g h# WF g h# YF g h# \F g h# tF g h# ȜF g h# hF g ) F g ȡF g h# F g PT (F g h# hF g ) F g (F g h# xF g PT F g F g (F g h# xF g PT F g F g h# XF g S F g F g h# XF g PT 8F g @F g HF g h# F g PT F g F g (F g h# xF g PT HF g h# F g h# ȾF g h# F g h# HF g ) HF g ) F g h# F g h# F g h# HF g ) F g h# F g h# F g F g F g h# F g h# HF g ) F g h# F g ) F g F g h# F g PT F g F g F g h# F g PT F g F g F g h# XF g PT @F g HF g h# F g S F g F g h# F g S F g F g h# 8F g PT F g F g h# 8F g PT G g G g G g h# G g PT xG g G g G g h# G g PT HG g ) G g h# G g h# h G g h# G g ) H6G g h# >G g h# H>G g ) h?G g h# ?G g ) @G g h# AG g ) HBG g h# EG g h# MG g MG g HRG g h# TG g h# (UG g ) hWG g h# \G g h# (]G g ) eG g h# HiG g h# mG g h# hpG g h# HsG g h# HuG g h# xG g h# yG g ) zG g h# zG g ) H|G g h# |G g ) }G g h# ~G g ) G g ) G g h# @G g HG g h# G g h# 8G g ^ G g G g h# G g ) G g u G g h# @G g HG g h# XG g ^ HG g h# G g ) G g u G g h# ؙG g hi XG g hG g h# G g PT HG g h# G g G g h# xG g ^ G g h# HG g ) XG g u G g h# XG g hi G g h# G g (G g h# (G g h# xG g (g G g h# G g G g h# ȳG g h# G g @ ȵG g h# hG g ) xG g P G g h# XG g x G g h# ȽG g h# G g Ha G g h# XG g z (G g h# `G g hG g h# G g h# G g G g h# G g h# G g (G g h# xG g S G g h# G g u `G g hG g h# G g ` G g k HG g h# G g e HG g h# G g G g h# G g h# G g ) G g P G g h# G g Ha G g h# 8G g z HG g h# G g G g h# (G g h# xG g k G g h# G g ` G g h# @G g HG g h# G g h# XG g k G g ` G g h# (G g h# `G g hG g h# (G g h# hG g ) xG g k hG g h# G g ` G g h# G g h# G g (G g h# G g h# (G g ) 8G g u G g h# G g ) G g l G g h# XG g hi G g h# G g G g h# G g h# 8G g b G g h# (G g ) 8G g ` G g h# G g ) G g p (G g h# hG g ) xG g G g ` x H g H g h# 8H g e (H g h# `H g hH g h# hH g h# H g k H g h# XH g pl ( H g h# x H g hg H g h# H g j ( H g ) 8 H g P H g h# HH g h# HH g h# H g @ hH g h# H g H g h# H g h# H g h# 8 H g ~ H g h# H g x `"H g h"H g h# "H g S #H g h# #H g { %H g %H g h# %H g S &H g h# 'H g q (H g (H g h# (H g S *H g *H g h# +H g h# 8,H g \ `-H g h-H g h# -H g S .H g .H g h# h1H g h# 1H g b 3H g h# X3H g pd 4H g h# 4H g f H6H g h# 6H g n 7H g h# 88H g l h;H g h# ;H g ;H g h# <H g h# <H g @| =H g =H g h# 8>H g ^ ?H g h# H?H g ) BH g h# DH g h# DH g S GH g h# GH g / HH g h# HH g e KH g h# LH g u MH g h# MH g u xPH g PH g h# PH g PT RH g h# 8SH g p XH g h# YH g YH g h# YH g h# YH g @| [H g h# @[H g H[H g h# (\H g h# x\H g @| ]H g ]H g h# ]H g ` ^H g h# ^H g ^H g h# _H g h# _H g @| aH g aH g h# HaH g ) XaH g l bH g h# @bH g HbH g h# (cH g h# xcH g @| dH g ) dH g fH g h# 8gH g p hH g h# 8iH g jH g h# jH g ) jH g pq lH g h# lH g lH g h# mH g h# mH g @| oH g oH g h# HoH g ) XoH g u HpH g h# pH g pH g h# HqH g h# qH g @| rH g rH g h# rH g ) rH g k sH g h# tH g ) tH g pq uH g h# uH g uH g h# vH g h# vH g @| xH g xH g h# HxH g ) XxH g k HyH g h# yH g yH g h# hzH g h# zH g @| (|H g ) H~H g h# ȀH g h# ȂH g h# H g ) H g H\ (H g h# `H g hH g h# (H g h# xH g @| H g H g h# ȇH g ) ؇H g [ H g h# H g ) H g H\ ȊH g h# H g H g h# H g h# 8H g @| HH g h# H g ) H g [ H g h# H g ȎH g h# H g h# H g @| HH g ) XH g H g h# ؓH g p HH g h# H g H g h# @H g HH g h# hH g h# H g @| H g ȚH g h# H g ) H g ] H g h# @H g HH g h# H g h# XH g @| `H g hH g h# H g ) H g f H g h# H g H g h# @H g HH g h# H g (H g h# `H g hH g h# @H g HH g h# H g H g h# H g T H g T H g H g h# H g H g h# H g h# H g ȮH g h# H g h# H g H g h# ȰH g h# H g H g h# H g h# H g (H g h# HH g h# H g d H g d HH g h# @H g HH g h# H g ) H g H g H g h# H g S H g h# HH g h# HH g h# H g ) HH g h# H g ) HH g h# H g h# H g h# H g ) H g h# H g ) H g h# 8H g @H g HH g h# H g H g h# H g h# XH g Xu hH g h# H g b H g H g h# H g ) H g xb H g h# 8H g d (H g h# xH g 0 H g h# H g ) H g hH g h# (H g h# xH g H g H g h# HH g ) XH g k (H g h# xH g pq H g h# H g h# H g h I g h# I g HI g h# I g hi I g h# I g I g h# I g h# I g Xu ( I g h# x I g b I g I g h# I g ) I g xb I g h# I g d I g h# 8I g 0 I g h# I g ) I g hI g h# I g h# I g I g (I g h# hI g ) xI g k HI g h# I g ) I g pq I g h# I g h# XI g hI g h# I g I g h# I g hi h"I g h# "I g "I g h# #I g h# #I g Xu %I g h# X%I g b `&I g h&I g h# &I g ) &I g xb 'I g h# 'I g d (I g (I g h# )I g ) )I g k )I g h# 8*I g pq ,I g h# X,I g 0 H.I g h# .I g ) .I g 0I g h# h4I g h# 4I g <I g HI g h# XHI g HII g h# II g hi OI g h# @OI g HOI g h# (PI g h# xPI g Xu (RI g h# xRI g b SI g SI g h# TI g ) TI g xb TI g h# 8UI g d VI g h# VI g 0 XI g XI g h# XI g ) XI g ([I g h# ]I g h# ]I g _I g h# _I g hi dI g h# eI g (eI g h# eI g h# 8fI g (gI g h# hgI g ) xgI g ȍ hhI g h# hI g ) hI g iI g h# jI g hkI g h# lI g h# 8mI g hi oI g h# oI g oI g h# pI g pI g h# pI g rI g rI g h# sI g ) sI g ȍ vI g (vI g h# hvI g ) xvI g wI g h# xI g yI g h# yI g hi (}I g h# `}I g h}I g h# (~I g h# x~I g hI g h# I g ) I g ȍ I g h# I g ) I g I g h# XI g (I g h# I g h# I g hi I g h# I g ȈI g h# I g I g h# ؉I g @I g HI g h# I g ) I g ȍ I g I g h# (I g ) 8I g I g h# ؎I g I g h# ؐI g hi (I g h# `I g hI g h# I g h# XI g hI g h# I g I g h# I g I g h# I g h# I g ) I g u I g h# ؤI g p (I g h# `I g hI g h# I g h# I g h# ȽI g / I g h# ȾI g ) I g h# I g ) I g h# I g h# I g { HI g h# I g i (I g h# I g h# I g p (I g h# `I g hI g h# I g h# I g / I g h# I g hi I g h# I g / I g h# I g hi I g h# (I g ) I g h# I g h# I g h# (I g ) hI g h# hI g h# I g ) H J g h# J g h# (!J g h# h"J g h# "J g "J g h# "J g ȡ "J g ȡ #J g h# #J g ) #J g u %J g ) 2J g h# 85J g P (9J g h# H?J g h# (BJ g h# HEJ g h# IJ g h# XPJ g hi YJ g h# YJ g YJ g h# `J g h# cJ g h# HcJ g ) dJ g h# gJ g Ȁ hJ g Ȁ hjJ g h# jJ g jJ g h# kJ g h# kJ g ) kJ g u @mJ g HmJ g h# nJ g h# xJ g (xJ g h# xxJ g T J g h# J g h# hJ g h# J g ) J g h# XJ g hi @J g HJ g h# J g S J g h# J g ȐJ g h# J g h# J g h# (J g h# ȚJ g h# (J g h# hJ g h# J g h# J g (J g h# J g h# J g h# @J g HJ g h# `J g hJ g h# J g h# J g ȸJ g h# J g P J g J g h# J g h# HJ g ) J g h# J g hi J g h# @J g HJ g h# (J g h# xJ g x J g h# J g ` (J g h# hJ g ) xJ g u J g h# (J g ) 8J g l HJ g h# J g z J g h# J g e (J g h# hJ g ) xJ g k J g h# HJ g h# J g h# (J g h# xJ g hi HJ g h# J g J g h# hJ g h# J g J g h# J g P @J g HJ g h# J g h# J g J g h# J g S HJ g h# J g h# J g h# J g ) J g f HJ g h# J g b J g h# J g hi J g h# J g J g h# `J g hJ g h# J g P J g h# J g h# J g J g h# J g h# J g h# J g h# J g / J g h# K g h# K g h# K g h# HK g ) XK g f K g h# K g b ( K g h# x K g hi K g h# K g K g h# K g h# X K g P K g K g h# !K g h# H$K g h# 'K g h# h*K g h# *K g *K g h# h+K g h# (-K g h# 0K g 0K g h# 1K g h# 5K g h# 5K g 5K g h# 7K g h# BK g ) NK g h# HSK g h# (VK g h# YK g h# ^K g h# HbK g h# gK g h# hoK g h# sK g h# HuK g h# (wK g h# H}K g ) 8K g @K g (K g h# K g h# (K g h# hK g ) (K g h# K g h# K g ) K g h# K g ) K g h# (K g ) (K g h# (K g h# xK g S (K g h# hK g ) 8K g HK g h# K g PT K g h# K g ȻK g h# K g PT HK g h# K g ) K g h# HK g ) HK g h# K g ) K g h# K g (K g h# `K g hK g h# hK g h# K g ; K g K g h# K g T K g T (K g h# xK g S K g S K g h# (K g ) HK g h# K g h# K g h# K g h# K g h K g h K g h# XK g H `K g H K g h# 8K g @K g K g h# H L g h# L g h# (L g h# `L g hL g h# L g h# XL g b L g h# L g ) L g xb (L g h# `L g hL g h# (L g h# L g L g h# 8L g P L g h# H L g h# !L g h# H%L g h# ((L g h# X1L g Ȁ ;L g h# ;L g ) ?L g h# ?L g ?L g h# AL g AL g h# CL g CL g h# CL g P EL g (EL g h# GL g h# HGL g ) IL g h# HIL g ) KL g h# NL g h# hQL g h# QL g ) VL g ) gL g h# (jL g h# hzL g h# zL g zL g h# h|L g h# }L g h# (~L g ) (L g h# hL g ) xL g Ж HL g h# (L g h# hL g ) 8L g b HL g h# L g u hL g h# L g hi L g h# HL g h# L g h# L g h# HL g h# hL g h# @L g HL g h# L g L g L g h# @L g HL g h# L g h# 8L g b ȿL g h# L g ) L g xb L g h# L g hi L g h# L g (L g h# L g h# (L g ) 8L g u L g h# L g ) HL g h# L g ) L g h# L g hi L g h# L g L g h# L g h# L g ) L g u L g h# L g h# L g hi L g h# L g L g h# L g h# L g ) (L g h# L g ) hL g h# L g L g h# L g T L g T HL g h# L g L g h# L g T L g T @L g HL g h# L g L g h# L g T L g T L g L g h# @L g HL g h# XL g T `L g T L g h# L g L g h# L g T L g T L g h# L g L g h# L g T L g T hL g h# L g L g h# L g T L g T L g h# L g L g h# L g T L g T (L g h# `L g hL g h# xL g T L g T L g L g h# L g T L g T HL g h# L g L g h# L g T L g T L g L g h# L g T L g T @M g HM g h# XM g T `M g T @ M g H M g h# X M g T ` M g T ( M g h# ` M g h M g h# x M g T M g T hM g h# M g M g h# M g T M g T M g h# M g M g h# M g T M g T M g M g h# M g T M g T ` M g h M g h# x M g T M g T $M g $M g h# $M g T $M g T &M g h# @&M g H&M g h# X&M g T `&M g T h(M g h# (M g (M g h# (M g T (M g T -M g h# -M g -M g h# -M g T -M g T ; ; 0 ; P ; p ; ; ; ; ; ; 0 ; P ; p ; ; ; ; ; ; 0 ; P ; p ; ; ; ; ; !; 0!; P!; p!; !; !; !; !; "; 0"; P"; p"; "; "; "; "; #; 0#; P#; p#; #; #; #; #; $; 0$; P$; p$; $; $; $; $; %; 0%; P%; p%; %; %; %; %; &; 0&; P&; p&; &; &; &; &; '; 0'; P'; p'; '; '; '; '; (; 0(; P(; p(; (; (; (; (; ); 0); P); p); ); ); ); ); *; 0*; P*; p*; *; *; *; *; +; 0+; P+; p+; +; +; +; +; ,; 0,; P,; p,; ,; ,; ,; ,; -; 0-; P-; p-; -; -; -; -; .; 0.; P.; p.; .; .; .; .; /; 0/; P/; p/; /; /; /; /; 0; 00; P0; p0; 0; 0; 0; 0; 1; 01; P1; p1; 1; 1; 1; 1; 2; 02; P2; p2; 2; 2; 2; 2; 3; 03; P3; p3; 3; 3; 3; 3; 4; 04; P4; p4; 4; 4; 4; 4; 5; 05; P5; p5; 5; 5; 5; 5; 6; 06; P6; p6; 6; 6; 6; 6; 7; 07; P7; p7; 7; 7; 7; 7; 8; 08; P8; p8; 8; 8; 8; 8; 9; 09; P9; p9; 9; 9; 9; 9; :; 0:; P:; p:; :; :; :; :; ;; 0;; P;; p;; ;; ;; ;; ;; <; 0<; P<; p<; <; <; <; <; =; 0=; P=; p=; =; =; =; =; >; 0>; P>; p>; >; = = @ A A hRA _A jA A BB BB CB (CB HCB hCB B B B (B B B C D H D (D HD hD D D D D D (D HD hD D D D D D @N CN DN 0DN PDN pDN DN DN DN DN EN 0EN PEN pEN EN EN EN EN FN 0FN PFN pFN FN FN FN FN GN 0GN PGN pGN GN GN GN GN HN 0HN PHN pHN HN HN HN HN IN 0IN PIN pIN IN IN IN IN JN 0JN PJN pJN JN JN JN JN KN 0KN PKN pKN KN KN KN KN LN 0LN PLN pLN LN LN LN LN MN 0MN PMN pMN MN MN MN MN NN 0NN PNN pNN NN NN NN NN ON 0ON PON pON ON ON ON ON PN 0PN PPN pPN PN PN PN PN QN 0QN PQN pQN QN QN QN QN RN 0RN PRN pRN RN RN RN RN SN 0SN PSN pSN SN SN SN SN TN 0TN PTN pTN TN TN TN TN UN 0UN PUN pUN UN UN UN UN VN 0VN PVN pVN VN VN VN VN WN 0WN PWN pWN WN WN WN WN XN 0XN PXN pXN XN XN XN XN YN 0YN PYN pYN YN YN YN YN ZN 0ZN PZN pZN ZN ZN ZN ZN [N 0[N P[N p[N [N [N [N [N \N 0\N P\N p\N \N \N \N \N ]N 0]N P]N p]N ]N ]N ]N ]N ^N 0^N P^N p^N ^N ^N ^N ^N _N 0_N P_N p_N _N _N _N _N `N 0`N P`N p`N `N `N `N `N aN 0aN PaN paN aN aN aN aN bN 0bN PbN pbN bN bN bN bN cN 0cN PcN pcN cN cN cN cN dN 0dN PdN pdN dN >; < >; < ?; < 8?; < h?; < ?; < ?; < ?; < (@; < X@; < @; < @; < @; < A; < HA; < xA; < A; < A; < B; < 8B; < hB; < B; < B; < B; < (C; < XC; < C; < C; < C; < D; < HD; < xD; < D; < D; < E; < 8E; < hE; < E; < E; < E; < (F; < XF; < F; < F; < F; < G; < HG; < xG; < G; < G; < H; < 8H; < hH; < H; < H; < H; < (I; < XI; < I; < I; < I; < J; < HJ; < xJ; < J; < J; < K; < 8K; < hK; < K; < K; < K; < (L; < XL; < L; < L; < L; < M; < HM; < xM; < M; < M; < N; < 8N; < hN; < N; < N; < N; < (O; < XO; < O; < O; < O; < P; < HP; < xP; < P; < P; < Q; < 8Q; < hQ; < Q; < Q; < Q; < (R; < XR; < R; < R; < R; < S; < HS; < xS; < S; < S; < T; < 8T; < hT; < T; < T; < T; < (U; < XU; < U; < U; < U; < V; < HV; < xV; < V; < V; < W; < 8W; < hW; < W; < W; < W; < (X; < XX; < X; < X; < X; < Y; < HY; < xY; < Y; < Y; < Z; < 8Z; < hZ; < Z; < Z; < Z; < ([; < X[; < [; < [; < [; < \; < H\; < x\; < \; < \; < ]; < 8]; < h]; < ]; < ]; < ]; < (^; < X^; < ^; < ^; < ^; < _; < H_; < x_; < _; < _; < `; < 8`; < h`; < `; < `; < `; < (a; < Xa; < a; < a; < a; < b; < Hb; < xb; < b; < b; < c; < 8c; < hc; < c; < c; < c; < (d; < Xd; < d; < d; < d; < e; < He; < xe; < e; < e; < f; < 8f; < hf; < f; < f; < f; < (g; < Xg; < g; < g; < g; < h; < Hh; < xh; < h; < h; < i; < 8i; < hi; < i; < i; < i; < (j; < Xj; < j; < j; < j; < k; < Hk; < xk; < k; < k; < l; < 8l; < hl; < l; < l; < l; < (m; < Xm; < m; < m; < m; < n; < Hn; < xn; < n; < = < (= < ? < ? < ? < H? < ? < ? < h? < ? < h? < ? < ? < ? < (? < ? < h? < h? < H? < ? < (? < ? < ? < ? < h? < ? < h? < ? < H? < (? < (? < ? < ? < ? < ? < (? < ? < ? < ? < h? < (? < H? < ? < ? < ? < ? < (? < ? < H? < ? < (? < h? < ? < ? < ? < H? < ? < h? < @ < @ < @ < h@ < (@ < @ < @ < @ < @ < @ < H @ < @ < @ < @ < (@ < @ < H@ < (@ < @ < ( @ < @ < H!@ < ("@ < H#@ < %@ < (&@ < ('@ < *@ < ,@ < (-@ < .@ < 0@ < 3@ < 4@ < h6@ < (9@ < :@ < <@ < =@ < (?@ < (A@ < B@ < E@ < G@ < (I@ < L@ < hM@ < O@ < HX@ < (Y@ < Y@ < Z@ < H[@ < [@ < (\@ < h]@ < ^@ < `@ < `@ < c@ < d@ < e@ < f@ < g@ < h@ < hi@ < (j@ < j@ < k@ < hm@ < (n@ < o@ < hq@ < (v@ < z@ < {@ < |@ < h}@ < ~@ < ~@ < @ < @ < @ < @ < @ < h@ < @ < (@ < @ < @ < H@ < @ < @ < Ȗ@ < @ < H@ < (@ < @ < @ < h@ < h@ < (@ < H@ < @ < @ < h@ < @ < @ < @ < H@ < H@ < @ < (@ < H@ < ȵ@ < @ < @ < (@ < @ < @ < (@ < @ < @ < @ < H@ < @ < @ < @ < @ < (@ < @ < H@ < @ < @ < @ < H@ < @ < (@ < @ < @ < @ < h@ < h@ < @ < h@ < @ < h@ < @ < @ < (@ < @ < H@ < (@ < (@ < h@ < @ < @ < H@ < @ < @ < @ < @ < @ < h@ < h@ < H@ < @ < H@ < @ < @ < @ < H@ < @ < @ < h@ < (@ < @ < A < A < hA < HA < HA < A < A < H A < A < A < A < HA < HA < A < HA < A < "A < #A < %A < 'A < )A < H+A < h-A < -A < (/A < H0A < h1A < 2A < 3A < 5A < (7A < 9A < 9A < :A < ;A < h<A < H=A < ?A < AA < AA < BA < (CA < hKA < LA < PA < HQA < RA < RA < (VA < WA < XA < \A < \A < H^A < _A < haA < bA < cA < dA < eA < hA < (jA < jA < (pA < qA < hrA < sA < tA < uA < HwA < xA < hzA < ({A < (|A < (~A < A < A < ȃA < ȅA < hA < A < A < A < A < HA < A < HA < A < A < A < ȑA < HA < (A < A < (A < A < A < A < A < A < A < A < ȞA < A < A < ȡA < HA < ȢA < A < HA < ȦA < HA < (A < A < ȰA < ȱA < A < ȳA < ȶA < (A < A < hA < (A < A < hA < (A < (A < HA < A < A < A < A < A < A < HA < A < A < A < A < A < (A < hA < hA < A < (A < A < A < HA < A < A < HA < HA < A < A < A < HA < (A < (A < A < hA < HA < (A < A < A < A < (A < hA < A < A < (A < A < HA < (A < H B < HB < B < hB < HB < B < (B < B < hB < H B < B < B < H B < ( B < ( B < hB < B < HB < B < hB < B < B < B < HB < B < B < B < B < hB < hB < ( B < h B < H B < B < B < ("B < (#B < H$B < &B < H'B < H)B < *B < +B < -B < .B < 0B < 1B < 3B < 4B < (5B < 6B < (7B < 8B < 9B < h:B < :B < H;B < <B < <B < =B < >B < ?B < h@B < AB < AB < CB < EB < HIB < (JB < JB < KB < LB < (MB < MB < NB < OB < (RB < RB < SB < hSB < SB < hTB < (UB < UB < VB < XB < hYB < YB < ZB < \B < H\B < \B < ]B < H^B < (_B < _B < H`B < aB < bB < (cB < HdB < dB < eB < hfB < fB < gB < hB < jB < hkB < hlB < nB < hoB < pB < pB < qB < sB < tB < tB < HuB < HvB < HxB < HyB < yB < zB < {B < (|B < |B < H~B < B < HB < B < B < HB < B < hB < HB < B < B < șB < HB < (B < B < B < hB < B < (B < B < ȣB < hB < B < B < B < ȩB < B < B < hB < (B < (B < (B < HB < B < ȵB < B < B < HB < ȽB < B < HB < B < B < B < hB < B < B < B < B < B < HB < B < B < B < B < HB < (B < (B < B < B < B < B < B < B < B < B < B < (B < hB < B < B < B < B < B < B < B < B < (B < B < B < (B < B < B < hC < C < C < C < C < C < HC < hC < C < HC < hC < C < HC < C < C < C < hC < H C < C < C < h"C < "C < $C < %C < h'C < (C < +C < h-C < .C < 1C < 2C < (3C < 3C < 3C < 5C < 7C < h8C < H9C < 9C < H:C < ;C < =C < =C < hAC < CC < GC < GC < hHC < (IC < JC < HKC < MC < HNC < OC < hPC < QC < RC < SC < WC < XC < ZC < [C < ]C < `C < aC < hcC < (dC < eC < eC < fC < hgC < hhC < HjC < kC < kC < mC < hoC < pC < (qC < qC < rC < hsC < tC < uC < uC < wC < hxC < xC < hyC < (zC < zC < {C < }C < ~C < C < C < C < C < C < C < HC < C < C < C < C < C < C < ȋC < hC < C < HC < C < ȐC < C < HC < (C < (C < hC < C < C < (C < C < hC < C < ȟC < (C < HC < C < (C < C < C < (C < hC < C < ȨC < (C < C < C < C < HC < (C < C < C < (C < C < C < C < C < C < C < C < C < C < C < (C < HC < C < HC < C < hC < C < HC < HC < C < hC < C < hC < (C < C < HC < hC < C < C < C < C < HC < C < D < D < HD < D < D < h D < hD < (D < hD < (D < D < (D < D < D < !D < #D < H$D < %D < 'D < h)D < *D < +D < ,D < H.D < (/D < /D < (1D < H2D < 3D < (4D < h5D < 6D < H7D < 9D < h:D < ;D < =D < (>D < H?D < ?D < H@D < @D < AD < BD < HCD < CD < HED < JD < ND < HRD < UD < UD < VD < HWD < (XD < hYD < hZD < [D < \D < (]D < ^D < _D < aD < HbD < cD < dD < hD < HkD < kD < lD < hmD < nD < oD < pD < qD < rD < HtD < tD < vD < yD < zD < h~D < (D < D < D < D < (D < D < D < dN < dN < eN < 8eN < heN < eN < eN < eN < (fN < XfN < fN < fN < fN < gN < HgN < xgN < gN < gN < hN < 8hN < hhN < hN < hN < hN < (iN < XiN < iN < iN < iN < jN < HjN < xjN < jN < jN < kN < 8kN < hkN < kN < kN < kN < (lN < XlN < lN < lN < lN < mN < HmN < xmN < mN < mN < nN < 8nN < hnN < nN < nN < nN < (oN < XoN < oN < oN < oN < pN < HpN < xpN < pN < pN < qN < 8qN < hqN < qN < qN < qN < (rN < XrN < rN < rN < rN < sN < HsN < xsN < sN < sN < tN < 8tN < htN < tN < tN < tN < (uN < XuN < uN < uN < uN < vN < HvN < xvN < vN < vN < wN < 8wN < hwN < wN < wN < wN < (xN < XxN < xN < xN < xN < yN < HyN < xyN < yN < yN < zN < 8zN < hzN < zN < zN < zN < ({N < X{N < {N < {N < {N < |N < H|N < x|N < |N < |N < }N < 8}N < h}N < }N < }N < }N < (~N < X~N < ~N < ~N < ~N < N < HN < xN < N < N < N < 8N < hN < N < ȀN < N < (N < XN < N < N < N < N < HN < xN < N < N < N < 8N < hN < N < ȃN < N < (N < XN < N < N < N < N < HN < xN < N < N < N < 8N < hN < N < ȆN < N < (N < XN < N < N < N < N < HN < xN < N < ؈N < N < 8N < hN < N < ȉN < N < (N < XN < N < N < N < N < HN < xN < N < ؋N < N < 8N < hN < N < ȌN < N < (N < XN < N < N < N < N < HN < xN < N < ؎N < N < 8N < hN < N < ȏN < N < (N < XN < N < N < N < N < HN < xN < N < ؑN < N < 8N < hN < N < ȒN < N < (N < XN < N < N < N < N < HN < xN < N < n; , o; , Xo; , o; , o; , p; , Xp; , p; , p; , q; , Hq; , q; , q; , q; , (r; , hr; , r; , r; , s; , Xs; , s; , s; , t; , 8t; , xt; , t; , t; , (u; , hu; , u; , u; , (v; , `v; , v; , v; , w; , Xw; , w; , w; , x; , Px; , x; , x; , y; , Py; , y; , y; , z; , Pz; , z; , z; , {; , X{; , {; , {; , |; , P|; , |; , |; , }; , H}; , }; , }; , ~; , 8~; , x~; , ~; , ~; , 8; , x; , ; , ; , (; , h; , ; , ; , 0; , p; , ; , ; , 0; , p; , ; , ; , 0; , p; , ; , ; , 0; , p; , ; , ; , 8; , ; , ; , ; , 0; , p; , ; , ; , 8; , x; , ; , ; , 0; , h; , ; , ; , (; , h; , ; , ; , ; , `; , ; , ؊; , ; , P; , ; , ȋ; , ; , 8; , x; , ; , ; , 8; , p; , ; , ; , 0; , p; , ; , ; , ; , `; , ; , ; , ; , `; , ; , ; , ; , `; , ; , ; , ; , `; , ; , ؒ; , ; , X; , ; , ؓ; , ; , X; , ; , Д; , ; , P; , ; , Е; , ; , P; , ; , Ж; , ; , @; , ; , З; , ; , P; , ; , ; , @; , ; , ؙ; , ; , P; , ; , К; , ; , P; , ; , Л; , ; , P; , ; , ; , ; , `; , ; , ; , (; , h; , ; , ; , H; , ; , ; , ; , 0; , h; , ; , ; , ; , `; , ; , С; , ; , @; , x; , ; , ; , ; , X; , ; , أ; , ; , `; , ; , ؤ; , ; , P; , ; , Х; , ; , H; , ; , ; , ; , 8; , x; , ; , ; , (; , `; , ; , ب; , ; , P; , ; , ȩ; , ; , @; , x; , ; , ; , (; , `; , ; , Ы; , ; , P; , ; , Ȭ; , ; , 8; , p; , ; , ; , ; , X; , ; , Ю; , ; , @; , x; , ; , ; , H; , ; , ; , ; , 0; , h; , ; , ; , ; , P; , ; , ; , ; , 8; , x; , ; , ; , 0; , h; , ; , ش; , ; , P; , ; , е; , ; , X; , ; , ȶ; , ; , 8; , x; , ; , ; , (; , `; , ; , ظ; , ; , H; , ; , ; , ; , @; , x; , ; , ; , (; , h; , ; , ; , ; , X; , ; , ؼ; , ; , P; , ; , ; , ; , 0; , h; , ; , ؾ; , ; , H; , ; , ; , ; , (; , `; , ; , ; , ; , @; , x; , ; , ; , ; , X; , ; , ; , ; , 8; , p; , ; , ; , ; , P; , ; , ; , ; , 0; , h; , ; , ; , ; , H; , ; , ; , ; , (; , `; , ; , ; , ; , @; , x; , ; , ; , ; , X; , ; , ; , ; , 8; , p; , ; , ; , ; , P; , ; , ; , ; , 0; , h; , ; , ; , ; , H; , ; , ; , ; , (; , `; , ; , ; , ; , @; , x; , ; , ; , ; , X; , ; , ; , ; , 8; , p; , ; , ; , ; , P; , ; , ; , ; , 0; , h; , ; , ; , ; , H; , ; , ; , ; , (; , `; , ; , ; , ; , @; , x; , ; , ; , ; , X; , ; , ; , ; , 8; , p; , ; , ; , ; , P; , ; , ; , @; , ; , ; , 0; , ; , ; , ; , p; , ; , ; , `; , ; , ; , P; , ; , ; , @; , ; , ; , 0; , ; , ; , ; , p; , ; , ; , `; , ; , ; , P; , ; , ; , @; , ; , ; , 0; , ; , ; , ; , p; , ; , ; , `; , ; , ; , P; , ; , ; , @; , ; , ; , 0; , ; , ; , ; , p; , ; , ; , `; , ; , ; , P; , ; , ; , @; , ; , ; , 0; , ; , ; , ; , p; , ; , ; , `; , ; , ; , P; , ; , ; , @; , ; , ; , 0; , ; , ; , ; , p; , ; , ; , `; , ; , ; , P; , ; , ; , @; , ; , ; , 0; , ; , ; , ; , p; , ; , ; , `; , ; , ; , P; , ; , ; , @; , ; , ; , 0; , ; , ; , ; , p; , ; , < , ` < , < , < , = , = , ȉD , D , hD , ȋD , D , hD , D , D , D , HD , D , D , HD , D , D , HD , hD , D , D , (D , hD , D , D , (D , D , (D , D , ȢD , D , HD , D , ȥD , HD , D , ȧD , D , D , (D , D , D , ȴD , HD , hD , D , D , HD , D , ȼD , (D , D , D , HD , D , D , HD , D , D , (D , D , D , D , D , HD , D , D , D , HD , D , D , D , HD , D , D , D , D , HD , D , D , (D , D , hD , D , HD , D , D , D , D , D , D , HD , D , (D , D , D , D , D , D , HD , D , D , hD , D , D , HD , D , (D , D , D , HD , D , D , hD , D , HD , D , D , D , HD , D , D , (D , hD , D , (D , hD , D , hD , D , HD , D , (D , D , D , hD , D , HE , E , E , E , (E , E , (E , E , E , h E , E , E , h E , (E , E , E , HE , E , E , (E , E , E , HE , E , E , HE , E , E , HE , E , E , h E , E , ( E , E , E , H E , E , E , h E , E , ( E , E , E , (!E , h!E , !E , !E , ("E , h"E , "E , "E , (#E , h#E , #E , #E , ($E , h$E , $E , $E , (%E , h%E , %E , %E , (&E , h&E , &E , &E , ('E , h'E , 'E , 'E , ((E , h(E , (E , (E , ()E , h)E , )E , )E , (*E , h*E , *E , *E , (+E , h+E , (-E , h-E , -E , -E , (.E , h.E , .E , (/E , h/E , /E , /E , 0E , (1E , H2E , 2E , 3E , 3E , H5E , 5E , 5E , (7E , h7E , 8E , 9E , H9E , :E , ;E , h<E , <E , <E , h>E , >E , >E , h@E , @E , AE , (BE , CE , CE , DE , DE , (EE , hJE , JE , JE , (KE , hKE , KE , KE , (LE , LE , LE , (NE , NE , NE , OE , HOE , OE , (TE , hTE , TE , TE , XE , hXE , XE , (YE , [E , \E , \E , \E , HbE , bE , bE , cE , HcE , cE , cE , dE , HdE , dE , dE , (eE , heE , eE , fE , hgE , gE , hE , HhE , iE , iE , hmE , mE , nE , hnE , nE , (oE , hoE , oE , oE , HqE , qE , rE , HrE , rE , rE , (sE , sE , sE , hvE , (zE , hzE , zE , {E , H{E , {E , {E , |E , (}E , h}E , }E , }E , E , E , HE , E , ȀE , (E , E , ȃE , E , hE , ȇE , E , HE , E , ȈE , E , HE , E , ȉE , E , HE , E , hE , E , E , hE , HE , E , E , HE , (E , hE , E , hE , E , E , (E , hE , E , E , HE , E , (E , hE , E , E , (E , hE , E , E , hE , E , E , (E , E , E , HE , E , ȢE , E , ȦE , E , hE , ȨE , E , hE , HE , E , ȰE , E , HE , E , E , (E , E , ȲE , (E , hE , ȳE , E , hE , ȴE , (E , hE , HE , E , ȸE , E , (E , hE , E , E , HE , E , ȿE , E , HE , E , E , E , (E , hE , E , E , HE , E , E , HE , E , E , E , E , HE , E , E , (E , E , E , (E , E , E , (E , E , E , HE , E , HE , E , (E , hE , E , (E , E , E , (E , E , E , E , E , E , hE , E , E , (E , E , E , HE , E , E , E , HE , E , E , E , hE , E , E , HE , E , F , H F , F , (F , F , F , (F , hF , F , H F , F , F , F , HF , F , F , F , HF , F , F , (F , hF , F , (F , hF , F , F , (F , F , F , F , F , F , F , H!F , !F , #F , $F , h%F , %F , h(F , )F , h+F , ,F , h.F , .F , /F , 1F , h3F , 4F , 5F , (7F , 8F , 8F , H9F , 9F , ;F , h<F , >F , ?F , @F , h@F , BF , hBF , (DF , EF , FF , HFF , FF , FF , GF , HGF , HJF , JF , JF , (KF , hKF , KF , LF , OF , PF , HPF , PF , QF , SF , SF , UF , (VF , hVF , HXF , XF , XF , ZF , ZF , ([F , \F , ]F , H]F , bF , cF , HcF , cF , cF , fF , fF , (gF , hgF , gF , gF , (hF , hhF , mF , mF , rF , rF , (sF , hsF , sF , sF , (tF , uF , uF , (vF , hvF , vF , vF , (wF , hwF , F , F , HF , F , F , (F , hF , F , hF , F , F , (F , hF , F , F , (F , hF , F , F , (F , hF , F , F , (F , hF , F , F , (F , hF , F , F , (F , hF , F , F , (F , hF , F , F , (F , hF , F , F , (F , hF , F , F , (F , hF , F , F , (F , hF , F , F , (F , hF , F , (F , hF , F , F , HF , F , ȟF , HF , F , F , (F , hF , F , F , (F , F , F , hF , F , F , HF , F , F , (F , hF , F , F , F , HF , F , F , F , HF , F , F , F , HF , F , F , F , HF , F , F , F , HF , F , F , F , HF , F , hF , F , F , F , F , hF , F , F , HF , F , F , F , F , (F , hF , F , F , F , hF , F , hF , F , G , G , HG , G , G , G , HG , G , G , G , HG , HG , G , G , hG , G , (G , G , G , ( G , h G , G , G , G , G , G , G , (G , G , G , G , HG , G , (G , G , G , G , HG , G , G , G , h!G , (*G , h*G , *G , *G , (+G , h+G , +G , +G , (,G , h,G , ,G , ,G , (-G , h-G , -G , -G , (.G , (3G , h3G , 3G , 3G , (4G , h4G , 4G , 4G , (5G , h5G , 5G , 8G , 8G , h9G , :G , <G , =G , H=G , >G , H@G , (DG , HG , HHG , HG , HG , IG , HIG , IG , OG , (PG , hPG , PG , PG , (QG , hQG , QG , QG , SG , (TG , hTG , VG , WG , YG , ZG , hZG , ZG , [G , H[G , [G , (\G , \G , ]G , ^G , H^G , ^G , ^G , _G , h_G , _G , _G , (`G , h`G , `G , `G , (aG , haG , aG , aG , (bG , hbG , bG , bG , (cG , hcG , cG , cG , (dG , hdG , dG , (gG , hgG , gG , gG , HhG , hG , (kG , hkG , kG , kG , (lG , hlG , lG , lG , oG , HoG , oG , oG , qG , qG , rG , (tG , htG , tG , (wG , hwG , wG , wG , (xG , yG , yG , h{G , {G , (}G , ~G , G , ȀG , G , G , hG , ȄG , HG , G , ȅG , G , HG , G , ȆG , G , HG , G , ȇG , G , G , G , HG , HG , G , (G , G , ȑG , G , hG , G , G , G , HG , G , G , HG , G , G , (G , G , ȚG , (G , G , țG , G , hG , G , G , HG , G , HG , G , ȢG , (G , hG , G , ȤG , (G , G , ȥG , G , G , ȦG , G , HG , G , ȧG , G , HG , G , ȨG , G , HG , G , G , (G , G , ȪG , (G , G , G , HG , G , G , hG , ȰG , hG , ȲG , ȴG , (G , G , hG , G , (G , G , G , hG , ȼG , (G , G , ȿG , (G , G , G , G , G , hG , G , G , HG , G , G , HG , G , G , hG , hG , G , G , hG , G , hG , G , hG , G , G , G , HG , G , hG , G , G , G , G , G , hG , G , G , (G , hG , G , (G , G , G , G , hG , HG , G , G , G , HG , G , G , (G , G , H , HH , H , H , H , H , H , h H , H , H H , (H , hH , H , hH , H , H , hH , H , H , HH , H , hH , H , H , (H , hH , H , H , ( H , h H , ( H , "H , (#H , (%H , H&H , 'H , ((H , H)H , )H , *H , +H , H+H , -H , (.H , h/H , /H , 0H , H0H , 2H , H4H , 5H , 7H , (9H , h9H , 9H , h=H , >H , @H , AH , HAH , AH , CH , (DH , hEH , EH , FH , hFH , FH , KH , HKH , (MH , OH , OH , (PH , hQH , QH , (RH , hRH , TH , (UH , hUH , UH , VH , VH , WH , HXH , ZH , ]H , (^H , `H , aH , (dH , eH , fH , hfH , gH , (hH , iH , iH , kH , kH , nH , oH , (rH , HsH , tH , tH , wH , xH , h{H , (}H , }H , }H , HH , H , H , H , H , H , H , HH , H , (H , hH , ȉH , (H , ȌH , H , H , (H , hH , H , H , H , ȔH , H , HH , H , H , HH , H , HH , H , H , H , H , H , (H , hH , H , ȢH , H , H , HH , H , ȥH , H , HH , H , ȦH , H , HH , H , ȧH , H , HH , H , ȨH , H , HH , H , ȩH , H , HH , H , ȪH , H , HH , HH , H , H , H , ȭH , H , HH , hH , H , H , H , H , ȴH , (H , hH , ȵH , H , HH , H , H , (H , hH , ȷH , H , HH , H , ȸH , H , HH , H , ȹH , H , HH , hH , hH , H , H , (H , hH , H , H , (H , hH , H , HH , H , H , H , hH , H , HH , H , H , (H , H , H , (H , (H , (H , HH , H , H , (H , hH , H , H , H , (H , hH , H , H , H , H , HH , hH , H , H , HH , hH , H , HH , H , H , HH , H , H , HH , H , H , I , I , hI , I , I , I , I , (I , hI , HI , I , HI , I , I , (I , I , I , H I , I , I , H I , I , I , ( I , I , !I , $I , %I , 'I , H(I , h)I , *I , (+I , h+I , -I , h-I , (/I , /I , 1I , 2I , h2I , 2I , 9I , 9I , :I , H:I , :I , :I , (;I , (@I , h@I , @I , @I , (AI , hAI , AI , BI , HBI , BI , BI , HI , hJI , JI , KI , HKI , KI , KI , (LI , QI , HQI , QI , SI , HSI , hTI , UI , VI , WI , XI , (YI , YI , (\I , \I , \I , ^I , _I , h`I , `I , aI , fI , gI , HiI , jI , (lI , lI , mI , HnI , (oI , HqI , qI , hsI , sI , vI , (wI , xI , xI , HzI , zI , {I , ~I , (I , I , (I , hI , I , I , HI , I , I , I , (I , I , I , HI , I , I , HI , I , I , HI , I , I , ȕI , I , (I , hI , I , I , I , I , I , HI , I , ȦI , I , hI , ȧI , HI , I , ȨI , (I , I , I , (I , hI , I , I , (I , hI , I , I , hI , I , I , (I , I , ȭI , I , hI , ȮI , I , HI , I , ȯI , I , HI , I , ȰI , I , HI , I , ȱI , I , HI , I , ȲI , I , HI , I , I , ȴI , I , I , (I , hI , I , I , HI , (I , HI , I , I , HI , I , I , I , I , HI , I , I , (I , hI , I , (I , hI , I , I , (I , hI , I , I , HI , I , I , (I , I , I , I , I , (I , hI , I , I , I , I , HI , I , I , HI , I , I , I , (I , I , I , (I , I , I , (I , hI , I , I , (I , hI , I , hI , I , I , (I , hI , I , I , HI , I , I , HI , I , I , I , I , HI , I , I , HI , I , I , I , I , I , (I , I , I , (J , J , J , J , hJ , J , J , hJ , hJ , J , J , (J , hJ , J , J , (J , hJ , J , J , (J , hJ , J , J , HJ , J , J , J , HJ , J , J , (J , hJ , J , (J , J , J , (J , J , J , H J , J , J , h J , J , H J , J , J , "J , h$J , $J , %J , 'J , h'J , )J , h)J , )J , H.J , .J , .J , (/J , /J , /J , (0J , 0J , 3J , 3J , 6J , 7J , h7J , 7J , :J , h:J , h=J , =J , >J , H>J , (@J , h@J , @J , (AJ , CJ , (DJ , DJ , hFJ , FJ , hGJ , KJ , HKJ , KJ , KJ , (LJ , LJ , LJ , MJ , SJ , TJ , HTJ , TJ , TJ , (UJ , hUJ , UJ , VJ , HVJ , VJ , VJ , HWJ , hZJ , ZJ , [J , ]J , ^J , h^J , ^J , _J , h_J , _J , `J , H`J , (bJ , bJ , cJ , (dJ , eJ , fJ , HfJ , fJ , fJ , iJ , iJ , jJ , hlJ , lJ , nJ , hnJ , oJ , HpJ , pJ , qJ , hqJ , uJ , (vJ , vJ , vJ , (wJ , wJ , wJ , yJ , HyJ , yJ , ~J , (J , hJ , J , J , (J , hJ , J , J , HJ , J , J , J , HJ , J , HJ , (J , J , (J , hJ , J , J , hJ , J , J , J , hJ , HJ , (J , ȒJ , (J , J , (J , J , (J , J , J , J , HJ , J , J , (J , J , J , J , hJ , J , J , hJ , ȥJ , hJ , J , J , HJ , J , J , hJ , ȬJ , (J , J , J , HJ , J , J , J , HJ , ȳJ , (J , J , J , J , HJ , hJ , J , (J , J , J , J , J , hJ , J , J , hJ , J , J , hJ , J , J , HJ , J , J , hJ , J , J , J , J , (J , J , hJ , J , J , HJ , J , J , (J , J , J , (J , HJ , J , J , HJ , J , hJ , J , J , (J , J , J , J , (J , J , HJ , J , J , HJ , J , (J , hJ , J , J , hJ , hJ , J , (J , J , (J , hJ , J , J , HJ , J , (J , hJ , J , J , HJ , J , (J , J , J , hJ , J , (K , K , K , (K , hK , K , K , K , K , HK , K , hK , K , K , H K , K , h K , HK , K , K , K , HK , K , K , HK , K , K , HK , K , K , (K , hK , K , K , (K , hK , K , K , K , h K , K , K , h K , K , K , !K , ("K , "K , "K , #K , (%K , %K , %K , (K , (K , ()K , *K , H,K , ,K , .K , /K , /K , 0K , 1K , 3K , H3K , 3K , 3K , 4K , H5K , 6K , (7K , 8K , 9K , 9K , h<K , >K , ?K , H?K , ?K , ?K , H@K , @K , @K , AK , hAK , AK , AK , CK , CK , (DK , DK , DK , (EK , hEK , EK , (FK , FK , (GK , KK , KK , LK , HLK , LK , LK , (PK , hPK , PK , QK , HQK , QK , QK , (RK , hRK , UK , HUK , UK , XK , HXK , XK , XK , (YK , H[K , [K , \K , H\K , \K , \K , (]K , ]K , ^K , (_K , _K , _K , cK , (dK , hdK , dK , (eK , iK , iK , (jK , hjK , jK , jK , (kK , hkK , kK , lK , HlK , lK , qK , HqK , qK , qK , HrK , rK , tK , vK , HxK , xK , xK , HyK , yK , yK , (|K , h|K , ~K , ȀK , K , HK , K , ȁK , K , K , ȇK , K , HK , K , ȈK , (K , K , K , (K , K , K , hK , ȋK , (K , K , ȒK , K , HK , K , ȓK , (K , hK , K , K , HK , K , ȕK , K , HK , K , ȖK , (K , K , K , K , țK , K , HK , K , ȜK , K , K , (K , hK , K , K , (K , hK , K , K , (K , K , K , (K , K , K , (K , hK , K , (K , hK , ȫK , K , HK , ȭK , K , HK , HK , K , ȰK , K , hK , K , (K , K , (K , hK , K , K , (K , hK , K , K , (K , hK , K , K , HK , K , ȽK , HK , K , K , HK , K , K , HK , K , K , K , K , HK , K , K , HK , K , K , (K , hK , K , K , K , K , (K , hK , K , K , K , HK , K , HK , K , K , HK , K , K , K , hK , K , K , (K , hK , K , K , (K , K , K , HK , K , K , K , HK , K , K , HK , K , (K , hK , K , K , K , K , HK , K , K , K , HK , K , K , (K , hK , K , K , HK , K , K , (K , K , HK , K , K , K , hK , K , K , hK , K , (K , hK , L , (L , hL , L , L , HL , L , (L , L , L , (L , hL , L , L , H L , L , L , L , H L , HL , L , L , L , HL , L , L , L , L , L , (L , hL , L , L , L , L , HL , L , L , hL , L , L , h L , L , L , H L , ("L , "L , "L , h$L , $L , h&L , &L , h'L , *L , H*L , *L , H-L , -L , -L , .L , h.L , .L , .L , (/L , h/L , /L , /L , (0L , h0L , 0L , 7L , 8L , H8L , 8L , 8L , (9L , h9L , 9L , :L , h:L , :L , :L , H;L , <L , (=L , =L , (>L , h>L , (?L , HAL , AL , BL , BL , (DL , DL , EL , (FL , hFL , GL , HHL , HL , hJL , JL , KL , LL , ML , HML , ML , OL , (PL , hPL , PL , QL , RL , RL , (SL , hSL , SL , HTL , UL , HUL , (VL , WL , (\L , h\L , h`L , eL , HeL , eL , eL , HfL , fL , fL , HiL , iL , kL , (lL , lL , lL , (mL , qL , rL , HrL , rL , huL , uL , vL , HvL , xL , xL , HyL , yL , yL , {L , |L , H}L , }L , ~L , (L , L , ȀL , hL , ȃL , L , hL , L , ȆL , L , hL , L , L , L , L , (L , L , ȋL , L , L , L , (L , hL , ȎL , L , HL , L , L , hL , L , L , (L , L , L , (L , L , ȚL , L , (L , hL , L , L , HL , L , L , HL , L , ȟL , hL , (L , L , hL , ȤL , L , hL , ȦL , hL , L , L , hL , ȩL , L , hL , ȪL , ȬL , L , hL , L , L , (L , hL , L , L , (L , hL , L , L , HL , L , L , L , L , HL , HL , L , L , (L , hL , L , L , (L , ȾL , L , HL , L , HL , L , L , (L , hL , L , HL , L , L , HL , L , HL , L , (L , hL , L , HL , L , L , HL , L , L , (L , L , HL , L , L , L , hL , L , L , (L , L , (L , L , L , L , HL , L , L , L , HL , (L , HL , L , L , L , L , L , HL , L , L , L , L , L , (L , hL , L , L , ؔN , N , XN , N , ؕN , N , XN , N , ؖN , N , HN , N , N , N , (N , hN , N , N , N , XN , N , șN , N , 8N , xN , N , N , (N , hN , N , N , (N , `N , N , N , N , XN , N , НN , N , PN , N , ОN , N , PN , N , ПN , N , PN , N , ؠN , N , XN , N , ءN , N , PN , N , ТN , N , HN , N , N , N , 8N , xN , N , N , 8N , xN , N , N , (N , hN , N , N , 0N , pN , N , N , 0N , pN , N , N , 0N , pN , N , N , 0N , pN , N , N , 8N , N , N , N , 0N , pN , N , N , 8N , xN , N , N , 0N , hN , N , N , (N , hN , N , N , N , `N , N , ذN , N , PN , N , ȱN , N , 8N , xN , N , N , 8N , pN , N , N , 0N , pN , N , N , N , `N , N , N , N , `N , N , N , N , `N , N , N , N , `N , N , ظN , N , XN , N , عN , N , XN , N , кN , N , PN , N , лN , N , PN , N , мN , N , @N , N , нN , N , PN , N , N , @N , N , ؿN , N , PN , N , N , N , PN , N , N , N , PN , N , N , N , `N , N , N , (N , hN , N , N , HN , N , N , N , 0N , hN , N , N , N , `N , N , N , N , @N , xN , N , N , N , XN , N , N , N , `N , N , N , N , PN , N , N , N , HN , N , N , N , 8N , xN , N , N , (N , `N , N , N , N , PN , N , N , N , @N , xN , N , N , (N , `N , N , N , N , PN , N , N , N , 8N , pN , N , N , N , XN , N , N , N , @N , xN , N , N , HN , N , N , N , 0N , hN , N , N , N , PN , N , N , N , 8N , xN , N , N , 0N , hN , N , N , N , PN , N , N , N , XN , N , N , N , 8N , xN , N , N , (N , `N , N , N , N , HN , N , N , N , @N , xN , N , N , (N , hN , N , N , N , XN , N , N , N , PN , N , N , N , 0N , hN , N , N , N , HN , N , N , N , (N , `N , N , N , N , @N , xN , N , N , N , XN , N , N , N , 8N , pN , N , N , N , PN , N , N , N , 0N , hN , N , N , N , HN , N , N , N , (N , `N , N , N , N , @N , xN , N , N , N , XN , N , N , N , 8N , pN , N , N , N , PN , N , N , N , 0N , hN , N , N , N , HN , N , N , N , (N , `N , N , N , N , @N , xN , N , N , N , XN , N , N , N , 8N , pN , N , N , N , PN , N , N , N , 0N , hN , N , N , N , HN , N , N , N , (N , `N , N , N , N , @N , xN , N , N , N , XN , N , N , N , 8N , pN , N , N , N , PN , N , N , @ O , O , O , 0O , O , O , O , pO , O , O , `O , O , O , PO , O , O , @O , O , O , 0O , O , O , O , pO , O , O , `O , O , O , P O , O , O , @ O , O , O , 0 O , O , O , O , p O , O , O , ` O , O , O , PO , O , O , @O , O , O , 0O , O , O , O , pO , O , O , `O , O , O , PO , O , O , @O , O , O , 0O , O , O , O , pO , O , O , `O , O , O , PO , O , O , @O , O , O , 0O , O , O , O , pO , O , O , ` O , O , O , P O , O , O , @ O , O , O , 0 O , O , O , O , p O , O , !O , `!O , !O , "O , P"O , "O , "O , @#O , #O , #O , 0$O , $O , $O , %O , p%O , %O , &O , `&O , &O , 'O , `< = = X? ? ? ؾ? ? ? ? x? ? ? ? ? X? 8? ? x? ? 8? ? ? ? ? ? X? ? ? 8? x? 8? 8? ? 8? ? X? ? ? ? x? ? ? ? ? X? 8? ? 8? x? 8? x? ? x? ? ? ? 8? ? X? ? ? ? ? X? ? ? ? ? 8? x? ? X? ? x? ? ? ? ? 8? ? ? ? ? ? ? x? ? ? ? X? ? ? ? ? @ @ 8@ 8@ @ @ 8@ x@ 8 @ @ X @ @ @ X @ @ @ @ @ @ X@ @ x@ 8@ X@ @ @ 8@ @ @ @ x@ @ @ @ 8 @ @ @ @ X @ !@ !@ !@ "@ "@ $@ x$@ $@ 8%@ x%@ %@ x&@ &@ &@ (@ )@ x*@ *@ 8+@ +@ +@ x,@ ,@ -@ 8.@ .@ /@ /@ X0@ 2@ 3@ 84@ 5@ 5@ 8@ 9@ X:@ X<@ <@ x=@ X>@ >@ >@ @@ xA@ 8B@ C@ D@ xD@ XF@ F@ XG@ H@ XH@ H@ H@ J@ K@ K@ L@ L@ 8M@ M@ N@ xN@ N@ O@ XO@ O@ 8T@ V@ X@ X@ xY@ Y@ 8Z@ Z@ [@ x\@ \@ ]@ ]@ ^@ X^@ ^@ X_@ _@ _@ x`@ Xb@ b@ Xc@ d@ Xd@ d@ 8e@ xe@ f@ Xf@ g@ Xg@ g@ 8h@ xh@ 8i@ i@ i@ xj@ j@ Xk@ k@ xl@ l@ m@ m@ m@ o@ xp@ q@ s@ 8t@ Xu@ u@ xx@ x@ y@ x{@ |@ x|@ }@ ~@ @ X@ 8@ @ @ 8@ 8@ x@ @ @ @ X@ X@ @ @ @ @ X@ @ X@ @ @ @ X@ x@ ؍@ X@ X@ @ @ @ x@ ؑ@ @ @ x@ ؓ@ X@ 8@ @ @ @ @ X@ @ @ @ @ 8@ @ @ @ @ X@ @ @ @ x@ @ 8@ @ @ 8@ x@ @ 8@ x@ @ X@ @ ت@ @ @ @ @ X@ @ X@ @ @ @ س@ ش@ @ @ @ ط@ x@ @ @ x@ @ @ ػ@ x@ @ @ 8@ ؾ@ X@ @ 8@ x@ @ x@ @ @ @ X@ @ x@ @ X@ 8@ @ @ X@ @ X@ @ @ @ @ @ x@ 8@ @ X@ @ @ @ 8@ x@ @ x@ @ 8@ X@ @ x@ @ @ @ @ 8@ x@ 8@ @ 8@ @ 8@ x@ @ x@ @ @ @ @ @ @ @ @ 8@ @ @ @ @ X@ @ 8@ x@ @ 8@ @ @ X@ X@ @ 8@ 8@ @ @ x@ @ X@ @ X@ @ @ X@ @ x@ @ 8@ x@ @ X@ @ @ @ @ 8@ @ @ @ @ @ @ X@ @ X A A A A A A A A X A 8 A x A A A A X A A A XA A A A A A XA A A A A A A A XA A A XA A A #A X#A %A X&A 8'A x(A (A X)A )A 8*A *A *A +A 8,A ,A -A -A .A x/A /A 0A 0A 81A X2A 2A x3A 84A x4A 4A 6A x7A x8A 8A 9A 8:A :A ;A 8<A <A =A x>A 8?A X@A @A @A XAA AA XBA BA KA MA NA QA QA QA xUA VA 8WA XA XXA XA ZA 8[A [A 8]A x]A ]A ^A ^A ^A 8_A 8`A x`A `A 8aA 8bA bA 8cA cA xdA dA XeA eA xgA xhA iA iA iA xjA XmA nA xpA pA pA 8qA qA 8rA rA XsA tA xtA 8uA uA vA XvA vA vA wA wA wA 8yA yA yA zA zA x{A {A {A }A }A XA A 8A A 8A xA A A xA A ؇A 8A xA 8A A XA ؊A A A A ،A A XA ؍A A A xA xA A XA A A A xA A 8A xA A A xA A A A A XA A xA ؚA xA 8A xA A A 8A A XA A XA A XA A A A XA xA A A A بA A 8A A A A xA A A XA A 8A A 8A xA A XA A A صA 8A A A xA A 8A A A xA A 8A A A ؼA xA XA A 8A A 8A A xA A A A XA A 8A A 8A xA XA A A A XA A A XA A A xA A 8A xA A XA 8A A A 8A A xA A 8A xA A 8A xA A A A A A XA A A XA XA A A A xA A XA A A A 8A xA A A A A A XA A A A A A A xA A XA A A 8A A A XA A 8A xA A A 8A A A A A 8A A A B B B B xB 8B B B B XB B B B B B B B B B x B B B B B B xB B 8B B xB B B 8B B xB xB B xB B B B XB B 8B B B B 8B B B 8 B B B B B X B B X B B X!B !B "B "B #B #B X%B %B 8&B &B 'B 8(B x(B (B )B 8*B +B 8,B ,B -B .B .B X/B /B /B 0B 0B X1B x2B 2B 83B 3B x4B 4B 4B 5B 86B 7B 8B 8B X9B :B :B ;B x<B <B X=B >B X>B >B X?B 8@B @B AB xBB DB DB XEB 8GB HB HB IB IB IB JB XKB LB XLB LB MB NB xOB OB PB QB RB SB 8TB TB TB xUB UB xVB WB XXB 8YB YB 8ZB xZB 8[B [B 8]B ]B ^B ^B x_B _B `B XaB 8bB bB cB cB dB XeB eB 8fB 8gB gB XhB hB iB 8jB jB 8kB kB kB 8lB xmB nB 8oB oB xpB 8qB xqB rB XsB sB xtB tB uB uB vB wB wB xB xB yB zB XzB zB 8{B x{B x|B |B x}B }B }B ~B B XB B B B B XB B B 8B B B B B B xB 8B B B B 8B B xB B B B XB B B ؞B XB 8B B B 8B آB 8B B xB B B XB B XB B B XB XB B xB ثB B جB 8B B B 8B xB B B xB B B B XB رB B زB B B B XB B XB B ضB XB B B XB B B ػB B B B B B B B XB B B B B XB xB B xB B XB B xB B XB B B 8B B B B xB B B xB B B 8B XB XB B XB 8B B B B 8B B xB XB XB B XB XB B 8B B B XB B B B B B C X C C C C XC X C X C C C X C C 8 C C C C C 8C C XC C C C C 8C C C xC XC C C C XC C C 8C C C X C C !C !C %C %C &C 'C X(C 8*C *C 8+C x,C ,C 8-C -C 8.C .C 0C 1C x2C x3C x5C 86C 6C 7C 88C 8C 9C 9C :C :C X=C 8>C >C ?C ?C @C 8DC EC XGC GC 8HC HC xIC IC xJC JC KC LC xMC MC XOC OC 8PC XQC QC XRC RC XSC SC WC xYC X[C [C \C ]C X]C ]C aC XbC cC cC cC dC dC XeC eC 8fC xfC fC 8gC gC gC 8hC iC jC XkC xmC XnC oC oC 8pC xqC XrC 8sC sC tC tC XuC 8vC vC vC wC wC xC xC 8yC yC yC zC 8{C |C 8}C 8~C ~C C XC C xC 8C xC C XC C 8C C C C C XC ؆C C XC C XC 8C xC ؉C C XC C C C 8C ؎C C C ؏C XC C C XC ؑC C C C xC C C C C 8C xC ؕC 8C C C xC 8C xC 8C xC ؚC xC C 8C C C C C xC C xC C C آC xC C C ؤC XC C XC C C XC C XC ةC C تC 8C xC C C 8C xC C C XC C حC C xC C C C دC C ذC C C xC C C C xC C xC 8C C C 8C C xC C C C xC C C 8C xC C 8C C xC C C C 8C C C C C C 8C C C C xC C C C C xC C xC C C 8C C XC C C C C C C C 8C xC 8C C C C 8C C C XC 8C C C C C xC C C XC D D D XD D D D D D D D D D D 8D xD D D 8D xD D D 8D D D xD D D 8D D D D xD D D D D X D D D !D X"D "D #D $D $D X%D %D x'D X(D (D *D X+D +D ,D X-D -D .D .D 0D x0D 0D 1D 1D 2D 3D 4D 4D 85D X6D 6D 6D 9D :D x;D X<D <D <D x=D =D >D >D ?D ?D @D 8AD xAD BD XBD BD CD 8DD xDD DD FD FD GD XGD GD GD HD XHD HD HD ID XID ID ID XLD MD ND 8OD xOD OD OD 8PD xPD PD PD 8QD QD QD RD SD xTD xUD xVD VD WD XD YD YD ZD ZD 8[D [D X\D \D \D ]D ^D x^D _D x`D `D bD xcD cD dD XdD 8hD xiD xjD kD mD mD 8nD oD xoD oD 8qD qD XrD rD tD XuD uD 8vD xvD 8zD {D |D }D X}D }D }D 8~D D D D xD D XD xD D XD D xD D XD D XD D `'O `= h= p= x= = y = = = @ = _ = = = p Ȧ= Ц= < ئ= = 2 = = J = d = } = w = = ' (= a H= 1 X= n `= = = ȧ= = hDM hwM yM zM (M ȂM hM M M (M ȋM hM M M (M ȕM hM M M M HM M M (M ȤM hM M HM M M M HM M M (M ȻM hM M M hM M M HM M M (M M M hM M M HM M (M M hM M M HM M M (M M hM M M hM M M HM (M M h N N N HN N N H N N N (N N hN N HN N N ( N !N h#N %N &N H(N )N +N (-N .N h0N 2N 3N H5N 6N 8N (:N (<N =N ?N Ч= H= ا= n X= n = = = = = | h= | = ` = ` @M ` = 0= = ^ ع= ^ = = = ȼ= = { P= { (= = (D (D D ȎD D D D D D D hD D D D (D D D (D HD hD HD D D D D D D D hD hD (D D D D D HD D D H E E E hE HE E E +E (0E 1E 2E H4E (6E 7E 9E h;E h=E h?E AE BE hEE ME QE UE YE (]E HfE hE HjE (pE huE vE H~E hE ȄE E (E (E E ȘE E hE hE HE E E HE hE HE (E (E E E E E (E E E E E E (E (E (E E E HE hE E hE HE (E F F (F F F F F hF HF H F H F "F h$F &F (F *F +F (-F h/F 0F (2F 3F 5F H6F h7F 9F h;F <F h>F @F BF DF GF HMF PF RF TF hWF YF [F ^F dF (nF htF ȂF hF hF F F F F F F F F F F (F F F (F F F F F F F F F F F F hF F HF F F hF (F F F F (F hF F F HF G hG G (G (G G G hG H G !G .G (6G 9G h;G =G H?G @G (BG DG LG (RG TG HWG \G eG (iG mG HpG (sG (uG xG hzG (|G }G (G HG HG G ȉG G G G (G G hG HG (G G G G ȬG G hG G G G G G G G G G hG G G G hG HG G (G (G hG G HG (G G G G (G G hG G G HG G G G HG G G G G G G G G hG G G H H H HH H H h H H H H (H (H HH H H h H H"H #H h%H &H h(H )H +H H-H .H H1H 2H 4H (6H 7H H;H h<H =H >H hBH hDH hGH hHH KH MH hPH RH XH YH ZH \H h]H ^H _H `H aH cH dH fH hH jH lH mH nH (pH (qH rH sH huH vH wH (yH HzH {H (~H H H H H hH H H ȋH (H hH H H hH (H H HH H H H HH hH H H (H H hH H H ȱH (H (H (H H H (H (H (H (H H H H hH H (H H HH H H H H HH H H H H hH H I (I h I I I h I I I I HI I I (I I I HI I H"I #I $I H&I h'I (I )I +I (.I 0I H4I (<I GI (II NI PI RI SI TI VI hXI [I h]I _I dI eI gI HhI iI HkI lI oI pI rI vI wI hyI }I ~I HI I I I I hI hI (I ȌI hI hI I I HI I I hI I ȶI hI hI hI hI I (I I I I I hI I hI I I hI I I I I HI HI HI HI J ( J J !J H"J h#J h%J 'J *J h2J 4J 9J H;J (?J BJ (EJ hIJ OJ YJ `J bJ dJ gJ HjJ hkJ (mJ nJ rJ xJ (zJ J J HJ J (J hJ J J J J J J J HJ ȯJ J J (J HJ hJ J ȹJ J J J J hJ J J (J hJ J hJ (J hJ J (J HJ J (J J J (J J J (J J hJ HJ J J J J hJ J J J K K K K K K K K K K K ($K 'K H*K H+K -K /K h1K 5K h7K h:K <K (BK GK hNK (SK VK YK ]K (bK hgK HoK sK (uK wK {K |K ~K K ȍK K K K K K K ȬK K K K (K hK K (K K (K hK K HK K K K (K hK hK hK hK K K K K K HL ( L L L L L L L L h L ( L L (#L (%L (L *L 0L ;L h?L AL hCL EL FL HL hKL NL HQL hVL XL \L `L hgL jL mL rL vL HzL H|L }L L (L L ȄL (L HL L hL (L L ȥL (L HL (L HL L L L ȽL L L L L L (L hL L L L HL L hL hL L L hL HL (L (L L L L HL L L (L (L (L M M M HM hM ( M M ($M %M H(M h-M 0= = 8= Q ȹ= Q @= = H= (= P= X 8= X X= = `M `= j = j h= = p= 3 x= 3 x= q = q M q = p = p = | = | = ` = ` = D = D = z = z M z = p= M = (M = = = P= Ȩ= y = y Ш= = ب= 0= = = = = = (= = ( = ( = @= = = = W = W = = (= = 0= B = B 8= = @= x= H= x= P= = X= غ= `= o ؾ= o h= X= p= ظ= x= = = м= = = = = = = = = = 8= = = = / = / ȩ= x= Щ= I = I ة= x H= x = 8= = Q = Q = , = , = Ⱦ= = (= = = (= = 8= Ȼ= = 0 8= 0 = I x= I = b = b = = = = HM = XM Ȫ= @= Ъ= D H= D ت= к= = = h?N (AN = h = h = = = = = и= = = = = \ = ; = = = ȸ= . = = U = = ! = @= " H= ~ P= X= `= h= p= = 0 = = ] = = 2 = = = й= 7 = = 3M @:M ;M =M ?M @M `BM DM EM @GM HM JM LM MM `OM QM RM @TM UM WM YM ZM gM rM sM `M M M M `M M @M M M M @M `M M M M M M M `M M `M N @N N N 'N = , = F = = m (= 0= a 8= @= K H= `= x= = = 9 = c = = Ⱥ= = = J = O = i = H= d h3M d (M d M d M d 8M d N d N d 2N d 84N d X= z `= d h= n p= = ~ = = = = F = = = л= ػ= [ = X? ? ? @ @ P @ )@ =@ W@ 0[@ j@ 0m@ z@ @ A 8RA iA iA iA oA pA A ГA HA ȜA pA (A A A p9B <B _B ЪB B PB йB B 0B B C C PC p C 2C FC \C 0cC XC C C C C 0C 8C hC hD D PD D +D (ED |D x}D hD = = = (= 0= 8= @= P= `= P h= p= 0? X? ? @ B@ z@ @ P@ @ @ h@ !A h'A @-A `OA RA X_A iA poA qA XqA xsA tA A `A @A (A pA A A A p1B x9B <B pLB hB oB |B تB عB xB B XC C H'C 2C C C HC C C C `C +D ;D |D }D XD D hD D D = = = = m = ؼ= = 4 = 0M h1M 2M X3M (4M 9M <M p>M @M AM PCM DM FM 0HM IM pKM MM NM PPM QM SM 0UM VM pXM ZM gM nM oM PqM rM wM yM 0{M |M p~M M M PM M pM M M PM M M 0M hM M M 0M ОM pM M M 0M ЪM pM M еM pM M M PM M M pM M M PM M M M PM M M 0M M PM M M 0M M M 0M N 0N N N 0 N N p N N N PN N N p N N N P"N #N %N 0'N (N p*N ,N -N 5N 9N :N <N P>N = = = 0= @= 7 H= P= $ `= h= p= = = Ƚ= m н= rM {M M 8M M M 8M M XM M M ؽ= = j = , B , = v 8? v ? v H? v ? v h? v ? v H? v (? v (? v ? v h? v p? v ? v ? v ? v ? v ? v ? v p? v ? v ? v ? v ? v ? v ? v ? v H@ v @ v @ v @ v @ v 0@ v p@ v h@ v @ v @ v @ v x @ v %@ v &@ v )@ v *@ v +@ v -@ v h0@ v P4@ v @6@ v h:@ v =@ v B@ v D@ v xG@ v H@ v K@ v PM@ v N@ v N@ v N@ v 8V@ v (]@ v g@ v Hq@ v pu@ v y@ v |@ v @ v @ v p@ v 8@ v p@ v @ v @ v x@ v @ v 0@ v @ v H@ v @ v @ v @ v ا@ v 0@ v @ v @ v x@ v @ v @ v @ v @ v x@ v @ v @ v p@ v @ v @ v @ v @ v @ v @ v @ v 8@ v H@ v @ v @ v @ v p@ v P@ v 8@ v h@ v @ v @ v X@ v @ v H@ v @ v x@ v h A v 8A v A v A v A v A v A v A v A v A v A v p#A v H'A v x)A v 0-A v 0A v 3A v 4A v 8A v :A v P<A v (=A v `?A v @A v NA v RA v HWA v \A v ]A v H_A v `A v HcA v heA v (iA v oA v tA v PzA v {A v |A v }A v `A v A v A v HA v A v 0A v A v pA v 0A v ЏA v (A v A v ДA v ЕA v ЖA v pA v A v pA v РA v A v 0A v ȤA v 8A v PA v A v A v A v A v A v A v A v hA v (A v A v A v PA v A v A v A v A v A v A v A v 0A v A v A v A v A v A v A v A v A v hA v 8 B v B v B v (B v B v B v PB v 0 B v B v B v B v HB v B v HB v B v B v (B v B v XB v (B v B v ( B v B v B v "B v "B v $B v H&B v (B v H*B v ,B v 5B v h6B v h9B v ;B v >B v H@B v AB v HB v JB v pKB v xLB v RB v XB v ZB v [B v p]B v _B v aB v (dB v gB v hB v jB v pnB v oB v sB v tB v 0vB v xB v yB v {B v |B v ~B v pB v B v xB v B v B v B v ȜB v hB v B v HB v HB v ȥB v B v xB v B v B v ȹB v B v B v `B v hB v B v B v B v B v B v B v B v (B v `B v pB v C v C v 0C v C v C v PC v C v 8C v 8"C v 'C v .C v 2C v H7C v (9C v X?C v EC v IC v NC v PPC v pRC v \C v (cC v dC v dC v eC v fC v PgC v PhC v hkC v 8oC v vC v (xC v }C v ~C v C v ȁC v HC v hC v C v HC v 0C v C v C v XC v C v C v C v C v C v C v C v C v XC v C v C v PC v 8C v (C v C v C v C v C v HC v C v C v 0C v C v 8C v C v C v XC v C v C v xC v D v D v D v D v D v "D v %D v H)D v +D v -D v 0D v 5D v ;D v <D v >D v (?D v 8ED v FD v ND v TD v PYD v [D v ]D v H^D v `D v cD v jD v kD v `nD v hrD v uD v |D v (}D v 0}D v h}D v p}D v }D v }D v }D v ~D v ~D v D v D v D v xD v 0D v D v D v ȇD v D v D v = 0= @= P= u X= `= h= b p= x= = t = M M M M N ,N 0N 1N `;N ?N = 6 = = о= = = = y = * = = ) = (= { 0= z 8= G P= X= `= h= v p= = p = 5M EM gM qM sM M 0M БM M M 0M PM M M M M M M PM M pN 0N pN N 'N ,N >N = = = - = b ȿ= V п= # ؿ= = b H2M A 4M A (hM A M A hM A M A PM A M A N A P2M 4M M pM M XM M N 2M 6M (8M 8M lM HmM tM hM M M hM ȱM hM M (M hN N N ( N x;M =M >M X@M AM CM 8EM FM xHM JM KM XMM NM PM 8RM SM xUM WM XM XZM eM XnM oM (uM }M ~M XM 8M ؏M xM xM ؛M xM M M xM M M M XM M M M xM M M XM M xM @M 8M M xM N N N N N N XN 8N N N /N 81N X9N <N X\M ]M _M 8aM bM xdM iM M XM M XM M 'N >N huM d xuM uM uM uM h uM uM uM uM uM a vM vM (vM s 8vM HvM XvM hvM xvM vM { vM r vM vM vM vM vM vM . (wM K 8wM HwM M 8 N 8 %N 8 2N 8 M ؚM HM % ئM 8M ; M N N HN ;N 8= @= H= P= X= `= h= p= x= = = = = = = = = = ȭ= Э= ح= = = = = = = = = = (= 0= 8= @= ! H= # P= $ X= % `= & h= ' p= ( x= ) = * = + = , = - = . = / = 0 = 1 = Ȯ= 3 Ю= 4 خ= 5 = 6 = 7 = 8 = 9 = : = ; = < = = = > (= ? 0= @ 8= A @= B H= C P= D X= `= E h= F p= G x= H = I = J = K = L = M = N = O = P = Q ȯ= R Я= S د= T = U = V = W = X = Y = Z = [ = \ = ] (= ^ 0= _ 8= ` @= a H= b P= c X= d `= e h= f p= h x= j = k = l = m = n = o = p = q = r = s Ȱ= t а= u ذ= v = w = = x = y = z = { = | = } = (= 0= 8= @= H= P= X= `= h= p= x= = = = = = = = = = ȱ= б= ر= = = Z = = = = = = = (= 0= 8= @= H= P= X= `= h= p= x= = = = = = = = = = Ȳ= в= ز= = = = = = = = = = (= 0= 8= @= H= P= X= `= h= p= x= = = = = = = = = = ȳ= г= س= = = = = = = = = = (= 0= 8= @= H= P= X= `= h= p= x= = = = = = = = = = ȴ= д= ش= = = = = = = = = = (= 0= 8= @= H= P= X= `= R h= p= x= O = = = = = = = = = ȵ= е= ص= = = = = = = = = = (= 0= 8= @= H= ! P= " X= # `= $ h= % p= & x= ' = ( = ) = + = , = - = . = / = 0 = 1 ȶ= 2 ж= 3 ض= 4 = 5 = 6 = 7 = 8 = : = ; = < = = = > (= ? 0= @ 8= A @= B H= C P= D X= E `= F h= G p= H x= I = J = K = L = M = N = O = P = Q = R ȷ= S з= T ط= U = V = W = X = Y = Z = [ = \ = ] = ^ (= _ 0= ` 8= a @= c H= d P= e X= f `= g h= h p= i x= j = k HH. HtH 5. %. @ %. h %. h %. h %. h %. h %ڼ. h %Ҽ. h %ʼ. h p%¼. h `%. h P%. h @%. h 0%. h %. h %. h %. h %. h %z. h %r. h %j. h %b. h %Z. h %R. h %J. h p%B. h `%:. h P%2. h @%*. h 0%". h %. h %. h % . h %. h %. h! %. h" %. h# %. h$ %ڻ. h% %һ. h& %ʻ. h' p%». h( `%. h) P%. h* @%. h+ 0%. h, %. h- %. h. %. h/ %. h0 %z. h1 %r. h2 %j. h3 %b. h4 %Z. h5 %R. h6 %J. h7 p%B. h8 `%:. h9 P%2. h: @%*. h; 0%". h< %. h= %. h> % . h? %. h@ %. hA %. hB %. hC %. hD %ں. hE %Һ. hF %ʺ. hG p%º. hH `%. hI P%. hJ @%. hK 0%. hL %. hM %. hN %. hO %. hP %z. hQ %r. hR %j. hS %b. hT %Z. hU %R. hV %J. hW p%B. hX `%:. hY P%2. hZ @%*. h[ 0%". h\ %. h] %. h^ % . h_ %. h` %. ha %. hb %. hc %. hd %ڹ. he %ҹ. hf %ʹ. hg p%¹. hh `%. hi P%. hj @%. hk 0%. hl %. hm %. hn %. ho %. hp %z. hq %r. hr %j. hs %b. ht %Z. hu %R. hv %J. hw p%B. hx `%:. hy P%2. hz @%*. h{ 0%". h| %. h} %. h~ % . h %. h %. h %. h %. h %. h %ڸ. h %Ҹ. h %ʸ. h p%¸. h `%. h P%. h @%. h 0%. h %. h %. h %. h %. h %z. h %r. h %j. h %b. h %Z. h %R. h %J. h p%B. h `%:. h P%2. h @%*. h 0%". h %. h %. h % . h %. h %. h %. h %. h %. h %ڷ. h %ҷ. h %ʷ. h p%·. h `%. h P%. h @%. h 0%. h %. h %. h %. h %. h %z. h %r. h %j. h %b. h %Z. h %R. h %J. h p%B. h `%:. h P%2. h @%*. h 0%". h %. h %. h % . h %. h %. h %. h %. h %. h %ڶ. h %Ҷ. h %ʶ. h p%¶. h `%. h P%. h @%. h 0%. h %. h %. h %. h %. h %z. h %r. h %j. h %b. h %Z. h %R. h %J. h p%B. h `%:. h P%2. h @%*. h 0%". h %. h %. h % . h %. h %. h %. h %. h %. h %ڵ. h %ҵ. h %ʵ. h p%µ. h `%. h P%. h @%. h 0%. h %. h %. h %. h %. h %z. h %r. h %j. h %b. h %Z. h %R. h %J. h p%B. h `%:. h P%2. h @%*. h 0%". h %. h %. h % . h %. h %. h %. h %. h %. h %ڴ. h %Ҵ. h %ʴ. h p%´. h `%. h P%. h @%. h 0%. h %. h %. h %. h %. h %z. h %r. h %j. h %b. h %Z. h %R. h %J. h p%B. h `%:. h P%2. h @%*. h 0%". h %. h %. h % . h %. h %. h! %. h" %. h# %. h$ %ڳ. h% %ҳ. h& %ʳ. h' p%³. h( `%. h) P%. h* @%. h+ 0%. h, %. h- %. h. %. h/ %. h0 %z. h1 %r. h2 %j. h3 %b. h4 %Z. h5 %R. h6 %J. h7 p%B. h8 `%:. h9 P%2. h: @%*. h; 0%". h< %. h= %. h> % . h? %. h@ %. hA %. hB %. hC %. hD %ڲ. hE %Ҳ. hF %ʲ. hG p%². hH `%. hI P%. hJ @%. hK 0%. hL %. hM %. hN %. hO %. hP %z. hQ %r. hR %j. hS %b. hT %Z. hU %R. hV %J. hW p%B. hX `%:. hY P%2. hZ @%*. h[ 0%". h\ %. h] %. h^ % . h_ %. h` %. ha %. hb %. hc %. hd %ڱ. he %ұ. hf %ʱ. hg p%±. hh `%. hi PATIUHSH w. { u H u711H= = y { tH. H5 H8 L 1H []A\AUIATUSH Ld$L} |$ t H D$(L$8$L$y* H\$(Hx 1HcLHL牄$( $ Q |$ t$H貞 H T$(\$8$\$ * H=/ 1غ Ht 18 @HL Hg |$ QHu. 8 t'kB H 4" H5 HHö. H81YH= _ uH5 H=C" x y t6H-ʳ. H} tH} 11H5 1 + x HH []A\A]H(HWHH$Ht$)D$z H(AUATUSH8HN. X Ld$IH1Lfz MuHu)aH=A .Q L HA Huٻ:H=A Q H HpA HuH=lA P 1HYA L1߉ H8[]A\A]H1Hy LP 1H1HA 襉 w H5V H=" PIw H~% 1A API@I@ YM@ MM x 11H5 L x H. LH0 tL x MtLS x IH Hu WM IE w SH4 HHtHl H[˩ [AUATUSHVH. L@ MuYHH=A []A\A]z H@ IH = HHHu!HH譎 HHt|H-.. HE /HHH)H膎 HHtUH}Hq HHt8LHHK H߅x ZH[]A\A] H H٨ XL[]A\A]骪 H= HN 1&w HtHH1[w 1Hw sx 1vx fo $foT$M Ux 1H} E H" H fHnfH:"Ex HDL$ HL$HT$H4$yDL$ H4$HHT$HL$AttA A H H9r~H< HL$HT$H4$ K HHt[H4$HT$L@HHL$E txAA@HIE11I@AHHt H)HHH>1H []A\ÃEt HL$H$M H$HL$HtH)H*Ht H H H@[H foD$ foL$0$L$P$ L1̅ x HL L1赅 x y 1q $ D$$ I~ H|$ 1U} HD$fol$Pfot$`(p8} fo$ fo|$p)l$`)|$PHD$D|$PHT$Xfot$PLD$`fo|$`0x| DH|$T D$P H :" H fHnfH:"HD$D$Xfol$Pfot$`(p| $ y H|$t 1A L H" L1HT$L$dLlK H. L$(H߉臎 H|$} HT$L$D|$pHT$xfol$pL$ fo$ )l$P)t$`= HHk DŽ$ Jz Ht$LH x2D$L$ `z $( 衘 u{ 1$$ g{ DH$ A H<" L DŽ$ fHnfI:"$ fo$ L1HT$fo$ L$)|$p)$ $L,J He. L$(H߉G H|$= HT$L$D|$pHT$xfot$pL$ fo$ )t$P)|$`H5v HD$8H|$8uEx z H5 u"$ x1Ez Az x Ex DŽ$ cz DŽ$ HT$1 Hz HHw" H fHnfH:"Az DŽ$ Ax H5u H7H5v L z L H$ 1A HC" DŽ$ H$ L$ -LxH5T L zH5E L z Lw H|$T 1A H~" L+ H|$T 1A H~" LI SWHH H$HHL$D$t H H[Ãt6t$HtZL$L[{ T$`R{ fo $foT$ Sz tL$L){ T$` { { T$`{ { T$`z H L 1H{ H\s" H* fHnfH:"CP| HX | HKHLL $~ H5;/ Hf1HFFH(Hc11H<$HD$HT$Ht$q H(fo$foL$E M HRF L{F HLxH L9 J< C IH 1LHHL$8HHT$8IyLLD$(LL$ HL$Ht$H|$;Ht$HL$HPLL$ LD$(HwRAQLD (A vK CHI)IMuHtHL)HHE M$+ 1 HH|$tHt#Et LIH AA1HLHt$[E Ht Ht$H)Hu H$Ht H H H 11H H r" H fHnfH:"C& foL$foT$ S 1W Hu ATL%B USH1H0Hl$Hm H=A D H=A D H=A D H=A zD H=A nD L LHA H=A HA HuL| HHzA m 1HHqA H1HmA } H=@A tH=>A tH=<A tHuH5 H='{" L H0[]A\ATUSH0HL%'A Hl$HtT? HtL1l LC 1HHA ~ 1HHHA | Hu5H5: H=z" Ӑ 1zl LRC 1H1HA O| H0[]A\H foD$ foL$0$L$ n HD$HD$C 1H@ H H $LpHM HD$`HHHH$a D|$`E H<$I HHm D|$`EuCA` tH<$Hm L$` 1 L11fHnfH:"駀 fot$`fo|$pHD$hHT$p)t$ )|$0fod$`fol$pHD$hHT$p)d$ )l$0DH|$$ A H Hq" DH|$$ A H Hq" ^fo\$`fod$pAHD$hHT$p)\$ )d$06fo|$@fo\$P)|$ )\$0 DH|$D A H0q" H p D|$@fHnHT$Hfol$@fH:"HL$Pfot$P)l$ )t$0z DH|$d A HGm" H D$` fHnfH:"D$hfol$`fot$p)l$@)t$PsDH|$D A Hp" H KH mj" H fHnH|$d fH:"DA D$` D$hfo|$`fo\$p)|$@)\$PD$Hfod$PD|$@fo\$@)d$0)\$ ~ H p" H fHnH|$D fH:"DA H=. D6} HǢ. H@ Hu H=TA AQH O HHt H@ tHW11AX XH|$蹂 H|$Hq H HEH}1 H-v" E HEHUr 1H} E H u" H fHnfH:"E; E oD$D$(EE铀 C( K C, o 1ɉK % H ` Io =. H:. H5 H81zH H-6A Hk/ =[. tWH. H54 H81:L=-. V =$. t Hâ. H= H_ 鯂 A t?Hr+ E1HH;E>HtaH AHF+ IcHH=. t HJ. H=8 HQ8 L=r. =q. iH\. H5 ITH. H81@HӪ { Hj/ t<H . I9~8HPID [ H. HA 麁 L=. h 驁 [ 顁 =. ITHy. H52 H818 1鲁 UHSQHt2? Ht*H57 tH5 Hu H5h Hu E 1QH5R Hu H5q Hw¸ tH5 H]¸ tZ[]H $S E1E1E1H fHnH ? L / fH:"fHnH^ L/ fH:"L )/ / / / / / / X! 11E1 / H / H5/ L/ / / / / / 륃Z111*g 11 g 11 g y fo$I|$ 1A$ AT$适 LHI|H $H)HH $D L: fo $I|$1 A$ A\$. 1H A$ H fH:"AD$ 1< fo,$fot$Am Au 1I} AE H5}" H fHnfH:"AE AUIATMUH1SHH8H|$l |$ t(L$(T$ SWHHL,$Ld${ y31H{ H;}" Hy fHnfH:"C 1HH8H[]A\A]1 Hڝ. LH5Pg" H81f鷇 H. 3 H= H1韇 1#x I 8 u L%~s/ H1SL H H[H < LD8 L$ fo$ fo$ H$ )$ )$ $ $ L$ fo$ H$ fo$ )$ )$ A} tH Ø 雘 L$ 8 L$ H$ fo$ ,$fo$ )$ )$ W1H$ L={" H DŽ$ L$ HH$ $ fo$ fo$ )$ )$ F 1H$ HD$pH2 HD$(H$ L=Y{" HD$ 8 D$ H$ H L=0{" HD$pHD$(H$ HD$ HD$pL$ H$ )$ HD$(H$ $ HD$ )$ 鳈 HD$pL$ fo$ fo$ HD$(H$ HD$ H$ $ )$ )$ ^ H$ HD$p1H HD$(H$ L=}z" HD$ C 鸊 = HjHtSHxL $ $ C$V LHɨ u/$ x$C$ DŽ$ ǃ = Hw 1H$ H5gz" $ H$ fo$ H$ fo$ )$ )$ $ )$ )$ Iߋ H) 1H$ H5'z" H DŽ$ fHnƸ fH:"$ fo$ fo$ )$ )$ $ H$ H$ fo$ $ fo$ )$ )$ CILLGz $ u%M黆 HD$pHD$(H$ HD$ fo$ L$ fo$ H$ $ )$ )$ 鮊 HT$ 1Hz H @w" fHnH fH:"Bӊ H H5 H8 n = HIH HH I}un HCXH H$ H5" fHnH DŽ$ fH:"H $ fo$ fo$ )$ )$ g= H,Ht"HxLN u$ tl= eH6 1H$ H5w" LHq u$$ tH = ~:. H 뢉&. 1 HD$pHD$(H$ HD$ ǃ Ds铄 fo$ H$ fo$ HD$ L$ H$ $ )$ )$ 駃 L1 H$ fo$ fo$ HD$ L$ H$ $ )$ )$ T H$ H L=u" H$0 HD$8 |$ H5 7 H=7 1E1 M1 1H$ HD$pHD$(H$ HD$ ǂ H<$s H$ 1[H ͟ HLHp H$HM蛚 $ H<$s $ fo$ fo$ L$ H$ $ )$ )$ ' fo$ $ fo$ )$ )$ IHt$ Lu $ uMȀ Hfo$ L$ fo$ H$ $ )$ )$ 銁 1H$ 1E1 HD$pHD$(H$ HD$ S fo$ L$ fo$ H$ )$ )$ H$ H$ fo$ fo$ )$ )$ $ $ H$ fo$ H$ fo$ )$ )$ H5 HtH5P H H<$HH HzX $ HD$pL$ fo$ fo$ HD$(H$ HD$ H$ $ )$ )$ fo$ fo$ )$ fH~$ )$ L$ )$ )$ 還 H$. G H=Ӿ E1 H# L 1 1H$ HD$p HD$(H$ HD$ K fo$ L$ fo$ H$ )$ )$ fo$ L$ fo$ H$ )$ )$ HH H ٙ fo$ HD$fo$ h̃ C0 K 1{, C( C` 鯆 fo$ H$0 fo$ HD$8L$ H$ $ )$ )$ $ H$ fo$ H$ fo$ )$ )$ H c LHLU $ Ȁ C4 C@ H5q H݄ L$ E1H4$LD JH$ : ZH9LC DsHC阄 1 $ E1D @ LD$LL)Hݏ Aρ ŏ EHDρ AxAA A I?LD$LD$(I@HD$(D C馎 ݎ HD$H57 H0j foD$foL$ E M H|$H H} LE1E H" HELm鳏 錑 邑 1{ q g ] = g v}r^? HHO麑 Jq?w. w01= @Ґ Ȑ 龐 鴐 1= @颐 阐 1H rDFA?w5 w7= tAHtEB@փS I ? = uɾ . $ 1 foD$foL$ K 1H^ 1H{ H3m" H1 fHnfH:"C( foD$ foL$0K E1- 1Lo 镒 7/ H<$ 1H|$4 H D$0foD$0HT$@foL$@AE AM 1H= rx H誁 1H|$4 H HX 1I} AE Hy IE鳖 LX LH I HA 1Hw 1H|$4Hڹ 8G. L H 1H|$4 H . . H<$Ӏ Hˀ foT$0HT$@)T$D$fo\$)\$0- 1H|$4 H HH j 1$H[ D$ 雗 1I $l H@ []A\A]A^1H $ @ Hb HHtH a I$1H% 1鞘 F > 6 1H{ H i" H fHnfH:"Ci t$ b t$ @H1@H5ɸ v b H5 Hr b H5 Hr H= H\` 1i 1静 Hr 1H{ 1H} E H=h" H fHnfH:"EG H. 1 H8DH . 1 H8)馚 H]. 1 H8 H҉. 1 H8H. 1 H8ӽP Hĸ []A\A]A^A_ T$ LLHD$HH|$HD$ HD$ AE &t 1͉. E =. 1H=p ϻ Aą" =. R DQD%j. HHD9 H<H H)HHj tA2 E! } H. H5 H81x D$D 1H= 9 AąHHD迼H A8tD脺Z =. Ht$ ILA E i. >HH,H. H5 H8̱ Ht$ D ffoD$ D%. . EH. H8qN H݇. H9D$ WHӇ. H9D$(ED%. E>H)HHDf鲘 H". HH5X H81 KI1HLJ I 1LHE I[Z M 1H{ HM" H) fHnfH:"Cf 阘 H} / L3 1l MtL$ H5N H=ON" <n Mu!H} / L {X uH H5. H LH0苰 H} b/ L躰 Au* Af* Im H|$ H<$ H|$ HH[]A\A]A^A_1+ HD\$R HEL|$0Ll$8D\$ * ) HUE1A H訶 D\$* A* H HD$(HtGJ) HA I ' ) 0 H|$(D$y D\$Exb( * * H|$}y H<$oy H|$`y A_p2H8, #- I+ I <, H= D$ D$ 1҃D!l+ Y , IH\$M M Ho tIE1+ H>HD$ HD$* H=V D$ xD$ oH=/ D$ _D$ V1* uHھ H蓿t߃xG cHtMc 7 H;, HH(, N, H?H<, , 1, H+ HyO H?H8' PH . H5 H8 ZHHHH ž H?HH Hփ Hփ H ʚ;H+ H= XH5 H= J" Lj G 鮙 H5 H=I" /j I u@I uCI uFI uIADžx H5i H=" i H5k H=" i H5x H=" i H5 H=֒" i H5 H=" i H5ױ H=" mi H5 H=͒" Zi H5 H=" Gi H56 H=" 4i H5 H=t" !i LDt$<uKEtH Q H H + HC@| @d + Lwt&H5d H=" h H5ɱ H=" h H|$Hu`H 8Q L$ H5}. 1ҋL$H9FP=+ H5. H=" Th 1LXHD$HD$HA@B HHt$Ht$@IHi H+ H5 H=\" h E1A+ H`}. H9BP 1H|$4 HI" H б H$߶ H|$(Ut 1H|$4 HI" H t H$髶 L#t H C H|$t 1 L-PB" D$p Ll$xH$ fo\$pfo$ L,$)\$0)d$@S Ls H Hs Ls Ls Hs Hs Ls Hvs Hls Hbs HXs HNs LDs L-A" H|$t 1fInL,$ H { D$p fH:"D$xfot$pfo$ )t$0)|$@r H|$4 H@" H H$H 1H|$4 H@" H H$ Hr Hr Hrr 1H|$4 D$0 H " fHnHD$ fI:"D$8fod$0fol$@ hִ 1I$ HT$ 1 ~+ Hz Ho fH:"B镴 Lq 1I$ HL-" q fInL,$H H|$T D$P fH:"D$Xfo|$Pfo\$` )|$0)\$@ L-%" H n 1fInH|$TD$P fH:"L,$D$XH)q H L-$ H|$T 1D$P Ll$XH\$`L,$fHp Lp Lp Hp Hp Hp Hp Hp vHp iHp \H}p OHpp BLcp 5LVp (L-$ H|$T 1fInL,$H fI:"D$P D$XH Lo Lo Lo Lo 1H|$4 HIE" H B H$3 H j L-k$ H|$T 1D$P Ll$XH\$`L,$H . H L-+$ H|$T 1D$P Ll$XH\$`L,$H L-$ H 1fInH|$TD$P fH:"L,$D$X_H W L-$ H|$T 1D$P Ll$XH\$`L,$(H H D L-% H|$T 1D$P Ll$XH\$`L,$H L-d$ H V 1fInH|$TD$P fH:"L,$D$XL-V$ H|$t 1fInD$p H fI:"L,$D$xfol$pfo$ )l$P)t$`JHT$ ع ~z+ Hz H fH:"BS 1H|$4 D$0 H " fHnHD$ fI:"D$8fo\$0fod$@` LLm HT$ 1 ~+ Hz H] fH:"Bɯ H m H= 1 鎮 Ll H= 1 2 H=' 1% 1HSHl X[]A\A]Y Ha HHG' ' 1( Hv. H8胇 + 1Ҁ8 o- H=Q/ LS/ HA L%A ID$ E1LA * D$ D9s, 1鏯 L$ HHu 1A1D IHcD$ ɤA I"A IT HJ< L$ d HHtHcD$ A IL Jů Hp. H5T H8 0 Hmp. H56 H8Ơ 1 1 HH1[]A\ H5ͩ H=$ {^ H1t tH=-A H1 2 X[]/ HX 2 Hs. HHkPL 3 K HH)HJ wDODWD^A? g EYA?g: EZA?i H|$ HLD$p8 15 IHqLK< H0HH/< 9 [= IT$HLLF IHLl$M93 2 IT$HՁ tH|$LD$p5 7; H)H|$HD$pb: XS` wLc8 19 ;8 1:5 05 H|$LD$p9 H~DOEQA?wA wD tHcG?S9 L u? HA 7D4 LgV EtEHH) 1= Hm. H5 H8 1? Hm. H5a H8 ^[]A\A]A^A_' /A 1(A A H4Iu<C I~ C B HcL4BH@tJ<C H=B b 1A IH} Lt$tcHU(N4BHDlH͠E JHHEHE HEHD$;A I t=H肖 II@ H tDHo. H9Ct0H) wLh PIExHtHIH{ uLk =H<o. I9FuI~ u$H t YH[] H}h xHExHt^H[]ZH[]o t#C @Hs ]I H{HvI I HI 1H<O Hf Lf N * 1Q @ w AS AS HK V H;T 1H/T K T IuHjZ HHY HHY IuHY K RX K AY HI<[ I<Q[ I<[ I<Z H|$e ] A$ f] H|$e HEHHUHH9\ [ Hn tE @y[ \ I1L9| LH ` H] ^ LM(HIH)HIIHHLRfHnHfK:"MPA@ H<uL a H{a LHHHDH!H<t?a HH HvH 1 L $y$ A H 1Hz ] HS0e 1H=ף "[ e H u8H Hl H uFH H 1u 1u H uH H 1u 1u 1u HxH! HJHt H8HQ HRHa H9V H{0 Lk HE0HTr :k LHu HzH Hj HRHj '} 1IWLOc H m H] H H H usH Hh H H HE H < H H H H H 1t 1jt HuSH H H H H H H HL 1zt H u-H HuIH uDH H 1Ct H uH H 1"t 1t S 1t 酔 H uH H 1s 1s 1s Hx`H HzhH܀ 驚 H Hj H Hm i { H uYH Hr H ugH H1r H uH H1r 1r H uH H1r 1r 1r H H H1nr H< H H H H H_ H[ H H H H H H H H 1_r H u5H H H H H؋ 1r H uH H 1q 1q 1oq M H uH H 1q 1q H H Hh H _ H Hw H n H H 1hq 醐 1Bq 鸑 H u-H HuIH uDH He 1 q H uH HD 1p 1p 養 1p H uH H 1p 1p k 1p H u-H HuIH uDH H 1|p H uH H 1[p 1Tp 1Hp f a H uH Hb 1 p 1p 1 p 1o H H H usH H1 H H H H H H-H H H1o 1n HuSH HH H P H HH Z H H@1n H H HH & H H1un H H H 1o H H H LN`H I9 H HuH H H H H6 Hm HH@Hdc HRHHv Rc HxaH uH H 1`m 1Ym H{0 Sc HE0H[j Ac H{0 6c HE0H>j $c 1m H{0 c HE0Hj c H{0 b HE0Hi b H uH HuI1l 1l 1l H uH Hu 1l 1l 1l H H H H ulH H|H2 H HH w H H H H H 1cl HuSH HH r H H H H Hi 1 l H uXH H H H H* 1k HH 4c HH Hg c H H H 1k H u1H H H uH H 1Ik H uH H 1(k 1!k H uH H^ 1 k 1j 鉋 1j 1j v 1j j 1j H uH H 1j 1j 6 1j HK]. H5ܘ H8 HR H H H usH HgH H HH 3 H HdH = H H 1i 1ii HuSH HH H HH H H/ 1yi H H HH H H 16i H u1H HH unH H 1h H uFH H 1h H uH Ho 1h 1h 1h 1h 1h H uRH H 12i H u8H H H uFH H 1h 1h H uH H^ 1h 1h 1h HM] H H=] H HCPLH2] :] H uH Hk 1g 1g H u1H HkH unH H1Yg H uFH H18g H uH H1g 1g 1 g 1g 1f H uH H 1f 1f H uH H1~f 1wf 1f 1f H uH H1|f 1uf 1nf HT 6 ] H H H H H uqf] HxXH} Hz`H- } H HuFH Hx H H Fq H/q H H \ ] H H q Hp H H \ H{0 O[ HE0HWb =[ I t$L^ HH^ HE l LT IGxHtLHH H H H H H HuH H H uH H H Z HE0H}a cZ H{0 XZ HE0H`a FZ H HH $\ H H_ \ 1d HjH HZ~| Hc H c| Hc HLN`H I9 H Hu H Hu!H ulH HuzHc HLN`H I9 tIH Hu H HuCH u.H H H{c HtHRc HtH]c HLN`H I9 t>H HuH H H u H H H"c HtHc H H Y HHH HJHuo 铅 M H( I9 tH HuH( H^ H0 Y H0 Hv] Y H H( 3] H( H7^ ] H Ht#H( ] H( HzY \ H HuWH( \ H( HKY \ LO H HHra Hja 1Mb H( H w\ H( HX b\ H HH( D\ H( HH] /\ H薟 Ae HY H H !iV 1a HuVH H H H H H H Hu1a 1a H u-H HuFH uAH HT1Ua H x H H/10a x 1$a H{0 V HE0H] U HO H{ dh P HrU HRHv `U HS. H5Ѝ H81> HLN`H I9 tH HU H HT HN`H9 T H H H j Hj H H jV H\M HIHR. H5E HSH81 H-HoLM HH R. HSH5ڍ H81@ 1Hh HdR. HSH5I H81 cHL HLN`H I9 H HuH Hw H ~ H HnH_ HLN`H I9 H HuH HoH H Htw H^ HP. HSH5 H81# LK r1L^ H uYH HC H ugH Hu 1+^ H uH Hu 1 ^ 1^ H uH Hqu 1] 1] 1] 1] H H H 1] H] HitH] H Hxv H Hhv H uH H1t\ 1m\ 1 ] 1_\ H\ H H H$ H H H u H HuHEP1\ St HH\ 1\ H uH H1\ 1\ t 1\ 1Y\ 1R\ H uUH HuxH usH HN1O\ H uH H1[ 1[ H uH H1\ 1[ 1[ as 1[ H5 H=z$ e< H 魅 HH HN. H5 H815 Muh HiN. IVH5f H81 HH HPH?N. H5 H81 LH : HH 10 LpH LHL H蘉 H1NH 1 HM. HRH5 H81q I LA H7 HHtHyM. H8HC t HH5 1 HG oH5 } 1鴅 H1H=|/ %|/ 1HG 3 ' HoG ! 2 H= y P H= y 1Zþ$ H=0 1vy } X[] H=P Xy 1͍ L HH LmMt LL%O. E1 H=$" : HO. H@ HPHc O H@ HZ[]A\A]PH=" : H;L. + LcF v 1H;5L. Ã驔 HJK. IU H5 H81} 1闕 H'K. H5 H8{ HK. H5Ȉ H8h{ H5 H=v$ 59 k H= 'x 阖 HkL!E111HL HD$H 1HCHE 1 []A\A]A^/ LwE HoE e HIR LcL讈E111HLl HD$H 1HCH E 1鳟 HJ. LH5j H81N HM. H H ԡ HD HD A HD 1¥ H1N. H5/ H8z 1陦 F HHJH; >O. t\H; -K. tS: H\$HZ HLUD I$鹧 HI. HRH5I H81 1閧 HT$HGH;N. t H;J. H:PL +! A 1H 4 H% = I<tHHHHDL!I<uI4邫 I ̪ C H[: HJHHH HHJ1HVH<L. H@ HJ k E Z1[]A\A]A^A_7 L7 " H7 , L$ H- L5թ M9I ID$IL$HLHP1 M$$Ht$Hm~ ID$I|$HT$H5 M$$鯭 I@u"M? HgHt$"~ O IGH5 IOH=2 HP1V 뵃|$l tMH|$-D t$hH= 1E1H E1L$ II$1I9teH H1H= 8 麱 Iu uIEHx tHX x Mm H H|$C G d K|= 1AL)H I HIA IcXH H 1H9 H H菅Ht$0H)HO LL H= 驰 HX LD 6 H|$B ' IvH=ç 7 镯 HX H H|$B z ԫ HX L H|$|B IuH=] G7 顯 IuH=H 27 髮 LH= 1L 藄HD$0齩 H{H 1[]A\ H=H pr LQ H @ L? H? l H|$? H? H? 1c E1ML$X? B E1OD? G 1ID$8? 1ID$@}? E1M\$Hk? E1MT$PY? 1IT$H? 1LHu է 1ID$(!? 1ID$ ? 1LHM > H= Aq Ht0L> HUz HHE 1ID$0> H> 1 HH@ [1HK > H{(H H Y[] H{(Hpt 1LIM H?C. HH5 H81s 1 H> H > H= HIHA HJD. VHr H81 HH= 1^ H= 1 s D$ = D$ a 1 HuHiB. H5^ H8r 1H;5C. þ H=g| o 1j HA. H5% H8r H= [H]A\ Ll$I|$H LtU HH HHAT$HLD$ D$ HBB. HRH5߁ H81 HH Hk HDI|$@ t"HA. IT$MH5 H81 I$ uHA. IT$MH5 H81n LD zH;B. O H5 1? A H~ AH HN= HHHHE " IH E1 H5'D. H H(E. H:uHUHH5K 1 IUHH5 1 HPxHHt$H|$HH$}, H$Ha E H HPH@. H5> H81D A| IMt#LHL AL 6 HLT Aރu E1d ulH < yTHL$1 H=y l H'C. H@ Hx` HD$ IHP1 LX Mu IMnHBIM H=)y Il 1 1C H9 + H=* l 1 1h HHH[]p H[]c 9 H"?. HSH5O H81 1 H HPH>. H5 H81 fQ HB. H 1 HH2 PH=. H5C H8Pn HZHHE E / HSHBHCH2M H. 4 /vIHCHPHS8H([]A\A]A^A_P HuHg=. H5 H8m E1 ЃHC붉HSyHHE E& /\ HCH =. H5L H8dm H<. H5s H8Lm H $E} HH# p] IHZHE1 IH( M9 DHH H0 IVJI< H H HHH} G<:~уB<9 H S HcHL @. IHC L v@. IH0 /vRHSHBHCH2M H HE 8]tnL6 H;. H5 H8l KHS<(b H;. H5(~ H8k EL] HH HHE IL$E] L)HH L 6 /v"HCHPHSH8H([]A\A]A^A_ЃHC/v5HCHPHSH HH([]A\A]A^A_o ЃHCH $HE} HHL) Lv5 IH $E} HL)&H $E} HHHL) L35 H|$)5 H5 H:. H5~ H8qj 1 A HMLALL)E9 H4 A E1A AEHLL H9. H5o| H8i 1[H$<. H5| H8p p H^4 1Z HO4 HE4 H;4 H14 H'4 H 4 H4 H 4 H3 H3 1 H Ho9. IL$HH50| H81 ? H==| e } H[]H H3 18 H3 R H=q e m 1Z 1# H=q e ) H H7. H5њ 1H8h H H$ Hr)H<2 1M H|$ W HL$H~VHs HD$0HL$HhLpHHHL$8LhHH Htb1IxJ| Htr2 Hs HD$0HhLp HD$0HL$HhLpHHHL$8LhHH Hu1 E1 E1) H|$ L E1 T HHG HH HvH1% HH[]A\A]5 1Ld$I E1HKA1LL)LL $ L $LK,H9tuH;HD1 E1 E1 A A A H6. H5 L $H8nf L $1IA kA `L9d$tL r L- 1ҹ HLA uD1} L-ޕ HHT$L HT$tHHH?H HH9H H Hu I t"H_ HHi d L1 L IExHtHHƾ H=q <b 1 H8HH[]A\A]A^A_W HL$(LD$LT$H|$ H|$LT$LD$HL$(H/ H5n H=`$ " ! IA HHL$H4$J/ H4$HL$HtKH=4. HHx HH01` u H4. H Ht9HHPx H1 M H3. Hx HH01` - HHGx 1 H= " " H. 1; H. 1h L. PH)Ho IE1IW(IGHUgE HI} HEgE IGO H=bm ` O uE1C H6. H5ە H8sc uL- H- `~0Hu$- ID$L HH 6 5 H- L- H5 L- H- 0 1: H=! ! H6. H HH- 1 H9- H5E H|t_H5@ H|tVH5D Hx|tMH5D He|tDH5E HR|t j ` V L B HT1. H5 H8a 1 t tV LL$t$HIH| H5X IAPH1. H81Z HXZHtH< H, H0. H5 H8pa Hr0 HB0= HBH4 HrH H4. HHkPH | H=Ik ^ n HBH SHHG@Ht0HuHG( vBH|$4 H|$x&HH[[+ H 4. H W H W >+ 15+ x HcH3. Hk8H H묍CH3. HHkPH HGH H 3. H W H9u H W * H W 5 1S H=t \ : LLaJ 뾠 H=t \ 1 8z L HH=p w 8 m HR % H@/. Ht H0 ` []A\HtH* HM1. H5t H8n_ HtH) H=5h -\ AD$LH)k 1 Y[]A\A]b H=h [ H) H tHcX H H HHT$H $* H $HT$xHAxHtHm 1h H7.. H0t LH0^ 1 MtL ) E1 H( MtL( 1 HH=I tHH@H z 1s Hm * E1E1o H( H.. IPH5s H81达 Ht"Hz tH-. H5 H8] ID$HhHE U |$ <$ + tutH A^ <$D$ q t=u_H u~A4 t<uaH D$ DD$$0 <$DD$# <$|$ <$DD$ <$|$ D$ $D$ <$DD$ D$ $D$ H,. H5 H8\ H|$8'' L ' 1_ H,. HRH5^t H81L H& H-. H H0/. H k H+. H5s H8&\ HPHA,. H5r H81 bH$ H\$H57t H$ H@LCHPH.. H81 HR& QIE H H/. H$ Ho } x2H$ H+. H5q H8l[ H$ % 19 Hy+. H5r H8B[ It L>l I_ L'l H`*. LH5r H81Ի H|$@z% DLm% A胺 Hb YH*. HUH5Sq H81艻 |$ <$ 0 $D$ H*. H5sq H8cZ L$ Hr*. H5Sr H81 H). H5r H8 Z 1 R AA H5r H=6" H}). H5r H8Y H|$P A H|$Pe H Mt@H). LH5r H81n H|$P A H5 H=6" K H L A H5 H=5" ( H(. HH5Ҍ H81 H|$PQ A! H H L Mt-H%). LH5t H81ɹ H|$P A H 8 L H|$d 3 H Ht?H(. HH5q H81q H|$ H5 H= 5" O H H-E H5 q H=4" H5 H=4" H H T Ht,H-(. HH5| H81Ѹ H|$ ` H A H- { H) I# IcBPHIARHLxi, LHH= LHX[]A\A]A^A_8 LHH=y Lۋ/, HCHPHSI}H5'. L< % M* / HCHPHSLM AF<s <tL /c HCHPHSH MFHD$HR I}H P IEIE Iu LHD$A~# HLT$8HL$(LD$ Ht$LL$0`dHL$Ht$LD$ LT$8H9HL$(2 H HL$0HLH=q ЃHCЃHCLHH=U LoL y /vTHCHPHSH MFHD$HtTIEH=Z u~LHL LHH=p LЃHC뫉ЃHCLHH= LH5%. HT$P HT$uiH= t1LLLT$ LL$LD$L LD$LL$HLT$ HtH@Hq HD$WLHH=3 LSIEIE HD$HuH5D). L Iu(LE, /< HCHPHSHMFH HD$LhHD$H8 L9+ HD$LHL$ LD$H8%pHD$LD$HL$ HHLD$ LD$ H\$LT$0Ht$(HHL$ HLD$\ HL$LD$HHt$(LT$0HHL$ tIIcBHL$H=ڛ HL$LD$PHIARHHHxH9|oHL$LD$ZH % H #. H5Me H8eS % ЃHC Hz% ! AE t HLL$w HL$HLH= LL$ HL$HLH=v dLHH=jn LOL;-&. tFIE H=p LLL$LD$B& $ LD$LL$ E1 HLL$ HL$HLH=Æ MyCH $ H H!. H H5Wm HT$H8H1 O$ LHL$ LT$0Ht$(LD$Z H|$HL$ HHtLT$0LD$Ht$(IcBPHIARH8H=ҙ HxVLLD$H% # LD$ MmH H !. H5^c H8vQ # H|$HHLL H# HHT$HLLT$LL$HL$ HL$LL$LT$xDIcBMFPHIARHH ) HH HL . H5z H8P # H|$HHLL H" H$. H5gj H8P " H$. H5 j H8P " H$. H5j H8yP " H}$. H5Fj H8^P " HLH=U L Ht" H=К zH . H5F H8P M" Hf . H5+ H8O 2" L;-#. t5IE L;-#. t;IE # 1HA HC . H5a H8O ! 1H H " HLH= L5 H! HT$HHLLL$蘶 LL$H Hg# / HCHPHSL;-.#. Hu Az IELT$LL$ Ht$HL_& LL$LT$HH HL$HE1LHA LT$[ LT$IcBH Н MFPHIARHHH 1H1H3" ЃHCCH|$HHLL H E1A 111HLT$ٳ LT$yHT$HHLϵ LL$LT$WH|$HHLL H* HLH= L H Hf . H5_ H8M LHH= L/vQHCHPHSLLD$H2z LD$HH f Hq!. H5g H8RM ЃHC뮋/ HCHPHSHIE t&LLL$LD$ LD$LL$H I}H5 . t I}_ LHH= L4/vMHCHPHSLLD$H G LD$H ffK ЃHCBЃHCAE LHH= L/vmHCHPHSLLD$Hx LD$HH /vfHCHPHSLLD$Hx LD$HHt|X ЃHCLHH= L R H $ЃHCH;5 . IE( H L H~ qHb. H5f H8+K E1 ! HD. H5ug H8 K E1 H&. HSH5#g H81ɫ H H. H5 H8J H ! Ht$H<$F H<$Ht$t(G @t% >" H " '" e {" v" " L H9\$ # ' I8E9wt# H; C. u Hn0" D$ " HHw* HPH$. H5f H81˪ Hs 1+ IHH^ Lq+ HH= 菺 tH?HO* 1ҹ HH= 1 1* HD$ H{ HD$HC H1+ '+ 1H|$HT$HCH1H{H* E1YH0 . H5~ H8I )1H|$HD$H;-. u!HH, H;-. uoI H, e+ E1l, LD$Mt.I@ tL;CtHL'` <, L' H. H5Ie H8H E1, d+ I|$@ tKH$ HH, HAT$@H, |, HPH_. H5 X H81 s, HJ . IT$HH5 e H81 C, H=Q D - L1l - L_ H(HL[]A\A]A^A_6 HtmHvHV . LJHPM@HtHB HDH. H l H5d H818 ML;g. . . HWM@HtHB HDHI. H H5;d H81 1ZL1AX` HB HDH. H ڷ H5d H81覧 H(1[]A\A]A^A_HSHE1MHM I0 11ЃC 1 I?M1 m1 1 H=V! Hk(H2 1HZ7 2 Hf. H5d H8/F 1Hz H;. H54d H8F Ӿ H=O B 13 H 1 H-. HE HL IHt/H 1HE IHu1L% HtH L H HH5}z H躔 LD$ L D$ AVEAUIATAUHHS HHt"HELDH HH HH[]A\A]A^Z1[]ø * 葼 DAD$ HID$ E11 14 H譨 3 DCH3 sHK@l Hˉ3 H^. H5b H8?D H|$PHt 13 L D$x4 LIQH|$LHPW$ fD$}4 11E1:9 ȿ H0HcH)HHL9|Mk HI9 H < H. H5x H8C DH FH. H5b H81; Ha6 H. H5~x H87C LQH|$PLHH{ L1 T$0/vGHD$8HPHT$8H8W IHH|$PLLH Lt'K d3 ЃHD$@T$0L. Z$ PI S HH IT$Ht$H L7 IH l$H Ix HH HD$IT$H . LHHD$7 IH I HHI Lh IT$Ht$LF. IHtzI HH L+ D$H I HHݗ t_L D$H H. DH5` H81) D$D$H. H56` H8 A D$LD$ ; C9; ; DHHDNDHDNDHDNDHDN(> HoL HHuHoL Y[]״ H;H. HHkPH ;@ HBHHHH? HBH HtH 1 HqHK H3 1 HA. HH5_ H81 H H1 @ LL2 Hi 10 HZ LHH;. H0 u=I|$` u$H H. Ht H0? 1 H L LH IHu@Hn HH] HE 1b H~ HtH Hh 1 Hʼn H L x/H. I9 eB @ HA H臟 {A vA H;. D D I~ u+HsH}7M HHD D H D L HHD HH. H5Qs H81* H D HH 1 H{` uH . HH] HH01| 1 HI W C H1< AF@ H[q 1 HGH ~ HՉ= tHAH A HՉ= u:H Ht'I Hھ H=m M HH []A\HAH AH A1 H H H Hb Hs L5Zm HcLL$ LD, LjRL$ uxH9t2H߉L$ qH HJLHH;M L$ HH I$ L$ ADŽ$ HC LHQ I$ H5q LFL$ hH5q LH-q QL$ FHLQL$ /H5yq LQL$ H5uq L2FL$ H5Eq LFL$ H51q LEL$ ; HLAׅLl H . HH5p H81 HF L$ HPu HF L Hw . HH5p H81軛 HF L$ - udv H. HHQH( [ H|$H5p IHt+{HPHp H$HVOL( 1 Ѓk HIb H( C HGH9B B IEL\$PLP0L\$POG HGP0L H|$01葼 LT$0HI 1H\$0E1LH;Z< HB`LT$8Hc1HT$H\$@LlH1HL$HtI9* LHt$P/ ( HcH9D$Hߋ\$@LT$8HT$HMM(LD$ HLHL JI 1HIIH9 I| H 1HI9 H<H/uHGP0HHJ 1HL9 H| H/uHGP0HH. IM(MLHvY H01$w H\$ J Ll$0H. LLHn H0IM(1v J HGL\$8P0L\$8 K H|$ t-HD$Hl 1L`L9}H| H/uHGP0HN 2H LH|$ t/HD$HHhLI9 J<H/uHGP0IG HD$Hx` u IE IG H H HHHH=X HHEIHE1( HHzm H G I/wG IGLP0hG HEHP0YG H/H\$ I BG H\$0IEu#I/RI IGLT$LP0LT$9I H= m IHtWLH I,$Hu ID$LP0Ht2H. IHLHV H01,u Hm u HEHP0I/uIGLP0H\$ H H\$ H LL uAHt$PL tH. H5N H8&6 1(J @ A K u A H. H8 D;H HCH8A H{A H}A H[]A\A]A^A_ک H . ) H=W HO1 H; t<11H=k 5 HuHj. H5V H835 H{ u HH0 w P 1k H@@Pv 覬 Hek H`. H[]A\H01' H/k Hk HHDHP. H01 & Hx@ ' tjHF <#uFBH < u H. H#V HH01螐 BH A@ H V :H. Hj HH01^ H52V H=" G` {` Dcu+ H" HuU{` Dcu1H" Hu Dk 1 HC@Ht " HtC` ċsH{H HtH P DDLC = HH H{ HH j HLv IH E1HCpLHHHtHL$ HH HCpHL$HS <` H AKDMcM9H{ C` V3 H H C` H C` P =p h {` o HDc H P =p G {` HDk蚂 IH6 H H Hj H H) IH H@ H # H* H H HH LLHC HH0 HH, HH {` Dc1 d 脐 HV C` Q c H 8G` ٤ ! C` 輤 {` Dk HB HH {` Dku~H$ HH {` Dku` H H {` Dku@ H H {` Dku # H Hub{` Dk H HV H~ H@H= HH,HiH! HHtH{ 0 HHX 1HH C` F H H03 H HH IHHIE H1H HHS LH[ H` H C` - Hg HG# HQ H1H HHH IH$ H H# H HH HHH{ L HHC` H HHZH~ HHDkHSIcHDxDp G` 轡 G` 謡 G` 荡 C` | {` Dc H53 H=[" H54 H=H" H53 H=5" H5O H="" H5O H=" LoXLFUA H53 H=" H5_c H=" r ; Ht5LE1 Ll$hQN ILE1 L Ld$h1N Hr- H5;Q H8;, H|$h J H{- H W H W HD$hI 趋 Hu HR- H5O H8+ Lq E1uB 脋 HuH - H5O H8+ 10i HD$hHDžu19E L% L HD$hL % HuH- H5O H8Z+ t Ht!L ]H - L(IE A HK- H5dO H8+ Hc- H5b H8* H a H?Ge H - H5a H;* H;轔 uE1@ H;H5M * LQ HH= 4 HH- H5N H8e* L p$ fH~f.T$zu HNL f.D$f(zuĉ H*fHn. IŅ@ LH I@ H{ HD$hHDžu5Ld$hM1H9 L> HtiIT$HHL HD$hH >i Htr AOQAW > H- AOH5H` H8E) HuHW- H5M H8 ) L 1HD$hLl$h? H - 6HL- H5eN H8( L f.$ zuw HY IŅJ? LH I7? F HD$hHDž Ld$hML= HH L= HH LHHC H߅ H L g IHt Hl IŅ> LL Iz> 艇 HJ v HJ LH IA> L HD$h > HH- H5L H8o' H HtL 1HD$hLl$h= H H|$ Hu- H5fJ H8' E1H HW- H5HL H8& Ls 艆 HE v Hu R IHt1A 1D$HH F A HH- H5J H8r& H~H- H5K H8I& cH=m- 蘴 HD$hHHFueLl$h< L 輅 HHT- H5uI H8% H9- H5H H8% 1Q ItG L HD$hZ HtOE111E1LL$E1LL$LL$LL$(LL$0LL$ Ll$h H_ H|$ A A D$D}? 111E1Ht$E1Ht$111E1H|$E1H|$H|$E111E1LD$E1LD$LD$LD$(t虄 H;LK D$8S? v HD$88? [ HLK D$@> 8 HD$@> 1111E111E1E1111E1HL$E1 HILb9 HHt? 11H)- H5I HT$8H8# HT$8|H/ AG` A J E1H AG` A I 1H 1rI G` 辗 TF $ HuA $G A AG` G AG` | A` F A F uI ł HvI A AG` H H. AG` A ,I 1G 1gG 1G AG` A` u EoE A H H5D H= " _ H tH )b Ht/ BI H??1I H- H5 Y H85" I H>I Hu- H5G H8" H+ AG` K A ] LAL HH[ L A` [ L H[ Lz H[ LI HHz[ AwI` H DH @ Aw D1HHPDD$V HX LHq HXYH A K 1K A ] ILl$Dt$A H\$ X C` L H, AG` A [ L H A A H L xLIWIcA HAW`p@t$D$u:A` T A J A J A AG` I A E PA =p ? m LEo HHt; L Ht) L Ht1 LD A` Eo m L^ Ht8 LL Ht&L Ht1LH5 I_ U A` EoZ m L Htv L HtdL裄 HtWL; HtJz L HHt5 L HHt Lr HtL` A` A` Eo m Ln H LX H L H L8 Htyz L$ HHtdA PA =p A` LAo IHtL A` Hj AoA A` txA A EgrA G AG` A` H6- KHC LH01y HHt^A F L3 HrLcK LcC HC HcSHcKARPH- LH01L4 A[[HHu| H+A AG` Hm- H&C LH011y HHV벾 L HLcM LcE ^AG` Ӑ nA LL1T A PA =p LA_" H L1Q H L H H- H<S LH01Wx HH|{ H& A A EgA` M A A C AG` ]C AG` C AG` A A` Ew/D 1E AG` A C AG` A H AG` A XC A 1҃E A A 3C A A C AG` L L" xFIWIcA HAW`Dh@D$A /A B A A AG` B z Hu<A G LDt$IH& C` t SU A AG` UG A A .B y H] A U A AG` A B AG` A C A A A AG` A U AG` 貍 A` A` A_v L& HH]L2N HL L H6 L H 1 L> H- KH> LH01(u HHMA AG` A T A T AG` A A` A Ew B A 1҃B PA =p 8 LA_ A` A` A_u8 L A` t A A S AG` A` 5IcWA_9K Hc@ 14B S AG` ŋ A` NA S w H A bS d L H&LLk H L HH- H9N LH01Ts HHyv HA AG` A AG` R A A AG` > A AG` R d LL Hv L6 H`Lq HO L A` 7 L H! L H1@ Q AG` A P A P AG` @ P =p H5tt H蛷 HtHL H9 {` D{u$H5Et Hl IHt HL HuS {` k@ LIߋl$Dt$H\$ L C` 3 {` uD{ZH, {` u H Ht H Hw1 H9 `H8- AO H5; HH01p HH @ AG` K s H A A _< Ht {` H HH- H.K HH01Ip HHqs H C` A A ; A A AG` ; AG` a= AG` 谇 #A L IWIcA HDh@D$AG`t L3p HHEgA` A A O r HuA < A < A AG` < AG` F A ? Nr HA AG` AG` 豆 A` AGEoD9< L IWIcA` Hh@D$ IcOA;O< L_ % IWIcOe< q HuA ; A ; A AG` ; A N HS- K H8 LH01m HH3q Hu6A N AG` 袅 A` M A ]N A AG` FN p Hu A .M A M A AG` M A : p HuA : A : A AG` : A : A v: A M G` 跄 A` A 7 1: AG` 莄 A` uIc_A9_C Hc7 A h= AG` U A` Ic_A9_C Hc\9 AG` ' < AG` A EoA L J: H=- HF LH01l H"G LH*` HH)o H A vL A AG`AoL n HA H9 Lh IWHcA HpDhAG`t$t jLp HHAoA` > BA ; Xn Hu<A A 8 A A 8 A A 8 A A AG` h8 L IWHcA HhD`AG`u A` D A A 8 u\Lq HHA_A A 7 AG` C A A AG` 7 A A 7 A 1҃8 AG` 誁 A` u%Ic_A9_@ Hc66 A : A EI A AG` 0J A !J LIߋl$Dt$H\$ l HuNA D l Hu A H A H A AG` H A AG` FD A H A AG` vH AG` 蓀 !< A UH AG` r : k HA AG` k Hu A I A H A AG` H A AG` H HGH Hu-M H~(H H9^0 H} 11H<$1HD$H;$ HHL$8HD$ HD$HL$@HL$HH\$HD$ HT$(HD$0= HHtmHs- H}H IH 1u IHt HG- LH0 LIi I9uvHE(J H|- H5YB H8 1J H HE(HHt5H]0 Hy} HHt HE(HM Hھ I~ j HuI9~#H- LHH5k1 H81k wH- H5@ H8 \C` 1:J H- H5m1 H8 1J Hs LLT$ LT$ IGLT$HLP0LT$H IHGLDP0@{ HOHT$PQ0HT$P HGP0 Hs LLT$& LT$S H- LLT$H0 LT$u>I,$( ID$LT$LP0LT$ HELT$HHP0LT$H酥 ID$HZ3 LHHH - H01jG LT$IGLT$pLP0H|$H LT$p L=G! դ IuXHLLT$^ LT$ߧ H8 骤 Mf HL$0H|$HL+QHcЅLT$PHD$0z W{ A A)HD$Mc@dMI HD$A$Ht$ ff $ HIM~Lc8MT$LIFLT$HLHD$p LT$HxQIG thIoH\$HE1LL9 H- K|H0 x ^ IIH\$HI/uIGLT$LP0LT$Lt$p= H7- LLT$HH0蟀 LT$Hx InE1LLT$HH$ H$ L$ HL$ S I/LT$HAuIGLT$HLP0LT$HEnH$ H]H$ fHnfH:"H@H;5- AF11HLT$H! Hm LT$HuHEHP0LT$HHD$AMHt$ ff $ H+IH\$HH3- H0 LLT$H0d LT$IH\$HIvH/uHGLT$HP0LT$HlMϙ IGHL$pLLT$HP0Hm LT$HHL$pm 0 ID$LT$HLP0LT$H逭 1HGHT$pLT$HP0LT$HHT$pA ` I/I0 IGLT$LP0LT$ I HGHT$HP0HT$HH*R^ HJ I,$ߣ ID$L|$LP0LT$ţ LHT$H HT$HO{ MT$Lc8IVMfM|$LT$pIHHT$HLo HT$HLT$pHH*uHBLT$HHP0LT$HI/uIGLT$HLP0LT$HH5 HD$AIl$MH|$M ff $ HH`- AT$Lc8Ht$H fH IHD$ f $ II HH- MT$Lc8InMfLT$HH0Lm LT$HtpI,$uID$LP0LT$HI~MfH/uHGLT$HP0LT$HHD$AMMHL$ ff $ H Mt$LLT$Ir LLLHI LT$? IHC LLT$Hx` H/ LHHC- H0s@ LT$鐡 ID$LT$HLP0LT$H HELT$HP0LT$] HLT$PLD$`t LT$PHIT I}` . H- HHO: LLT$H0? LT$ H t b LT$HHa Hq- LH0> LT$HȠ L9 LT$H Mѕ I馠 M HWHD$pLT$HR0HHD$pH\$H H- H+ LLT$H0 LT$S HGHL$HDP0HL$HLê MR H& Hm HELT$HP0LT$ H\- Lc8MT$MfH@ LT$HHP8 8 HH¸ H LT$HLeHI$LT$Hɕ InLT$HI,$uID$LP0LT$HHD$AMHL$ ff $ H]HBHP0HD$AT$H|$ ff $ I HH=- | LT$HHH2ݞ I/MО IGLT$LP0LT$鷞 E1MLL$0ʓ E1ML\$0麓 IGLT$pLP0D$HLT$pHLt HD$0HIFc n H- HH7 LLT$H01= LT$1 ML IGLP09 HK H- H9EteH|$H輋 ME1LT$0 Ha ט 1HL- W H|$HLT$pHGP0H|$0 LT$p r} H} LLT$P, LT$P LLT$ H|$pd LT$HHtAIGHH* LL@Hb- H01< Hm LT$uHEHP0LT$I/ IGLT$LP0LT$ HAHP0` M IWLL$0McLLHM4Lg LT$HHAD$HHM4 IGLT$HLP0LT$Hq ]m IwHT$HLV0HT$Hku IGHL$pLLT$HP0HL$pLT$HH, h HLT$ Lt$HLT$ Lc8HBLT$HHP0LT$H鴂 HkHIM9KcC I{HVC InIFHD$pIk锏 D$PIGLLT$pP0T$PLT$p s L;=- tiH- 1H$ H LT$PH )$ I LT$PH$ Ht]I/s IGLT$pLP0LT$prs LLT$P)D$`ҫ LT$PfoD$`rID$L LT$PI}H t$H- LLT$PH0, LT$P_ H$ LT$P- LT$Pu#I/ IGLT$pLP0LT$pq Ht$pHHD$HH H|$pLT$HGP0LT$ Lc8M~MT$H-- LT$HLH[ 4 LT$HHI HX[ LLT$H LT$HH IFI/uIGLT$HLP0LT$HLLT$H I,$LT$HHuID$LP0LT$HH HD$AI.MHL$ ff $ I HqIuXI}HHL LT$PI}` / IGH}% LLT$HHHB- H018 LT$ I}` t%I,$ ID$LT$LP0LT$ј IGHo% LLT$HHH- H01B8 LT$AD$H 9Gȸ AD$Hg IHm uUHELT$HLD$P0Lt$LT$0 IGLT$HLP0M$@ HELT$H # M I}` taHm HELT$HP0LT$˗ I}` IGH$ LLT$HHH- H0117 LT$鎗 IGH$ LLT$HHH- H016 LT$mAD$AD$AD$AD$AD$AD$~AD$sI<I HWIDeR0H{H/>LT HLT$f LT$Ö IGLT$pLP0LT$p銠 V0HD$H|$M>AT$ ff $ I IHH@LT$HLP0LT$H鋜 LT$H LT$H1h V0HD$AT$ H|$ ff $ I HIGLT$HLP0LT$H HBLT$HHP0MLeLT$H 1l IIGHT$pLLT$HP0HT$pLT$HH k { InI/ݲ z HBHP0HD$AT$HL$ ff $ I HEHD$8HcH{Lc8MT$HlLT$HH=D LT$HuAHD$AT$MH|$ ff $ HIHD- LLT$H0 LT$ H - HH- LH0S3 LT$p ID$LT$LP0LT$V LT$H%E DHp0k LT$HHHE@_ HLT$躿 LT$HCHHD$ H@LT$HP0LT$H IuXHLLT$H LT$HT LT$p艆 LT$pHH LHLT$p LT$px0I,$uID$LT$pLP0LT$pI HGP0S Hm uHELT$HP0LT$IvLLLT$ I,$Lt$HLT$- ID$LP0LT$Lt$H ID$LT$pLP0LT$p鯜 H| `8 Hm HEHP0؍ HELT$pHP0I/LT$pz I@LT$pLP0LT$pA H0- Hq LLT$H0 I,$LT$h ID$LP0LT$S I,$H ID$LT$LP0LT$. AD$ IPR0鏍 HcLc8MT$HDHHxHtT1HhH/uHGLT$HP0LT$HHD$AMH|$ ff $ HHs LLT$[ LT$鈑 M逑 H- H[* LH0 HCHLT$HD$ T H- Hw LLT$H0 {ELT$Q 3 ID$LT$HLP0LT$H 1N@ AD$0 AD$% IGLT$pLP0LT$pL H5 H=! 誯 HP/ A $H5)* H- H81A H2- H$* LH0 HCHMHD$ n MT$d HL R Am H H HCHHD$ H- H( LLT$H0 HCHLT$HD$ HGLT$HP0MLT$H@l Mُ Mя HGP0j ID$LT$HLP0LT$H( ID$LT$HLP0LT$H u HLLT$pQ LT$pHl L%- LI4$ LT$pK L輼 H{H@Q LT$pHl I4$LLT$聼 LT$ Hu- HH,( LH0- LT$ H|$`L$ HHL LT$PH&l }AD$ AD$ AD$ AD$ AD$ AD$ AD$ AD$ LLLT$)HI4 I,$LT$1 ID$LP0LT$ P LT$HHH H( H@LT$HP0LT$H ID$LT$HLP0LT$H H- Hz& LLT$H0' I,$LT$ ID$LP0LT$鉍 HGP0V I}` r H- Ha& LLT$H0 LT$J NO LT$HH H- LLT$H0艺 LT$ H}- H& LH0s LT$ I H 鿉 HELT$HHP0LT$H HBHMP0HD$AT$ Ht$ ff $ I HH- LH0ӹ LT$H] Lι LT$HHI? H{HH) I,$LT$HuID$LP0LT$H IGLT$HLP0LT$HE` H$ H5- ql H$ H MH$ Ht H/ H$ HcIH5* Ht$I$HD$@L$hH@ A$HD$ ff $ HhH- HY LLT$H01* LT$$ HGP0kI}` 1+ HGLT$pP0LT$p͏ ~D$HfH:"C)$ H fHnź LT$pH$ fI:"H|$HL$ )$ Rh H|$HLT$pHH/ HGLT$HP0LT$H鑏 H- LLT$HH0辷 LT$H;H- H# LLT$HH0 LT$HH-*- CI}` Hs- HH*# LLT$H0( LT$މ K LT$HH HU- LLT$H0 LT$ H- HH" LH0d( LT$遉 IGLT$HLP0LT$He k IGLT$HLP0LT$H過 H- HH LLT$H01( Hm LT$ HEHP0LT$ M~ IGHT$pLILT$HP0HT$pLT$HHIVɈ ID$LT$HLP0LT$Hڍ IGLT$HLP0I,$LT$H-} AD$ HALT$HHP0LT$HF AS0HD$AT$ HL$ ff $ I H>HkHIM9O/ IWH/ k HC @0 Hm uLT$HR0LT$LT$H- E1LMVH H0* LT$駇 HELT$HHP0LT$HS ID$LMP0HD$AHL$ ff $ HfH- HHm LLT$H0& LT$! H- HH' LLT$H01& LT$ HHLO u HX@ f8 L HT L Hm HEHP0鰁 M{ MT$Lc8MfLT$HLj LT$HHI I,$tfH- I9Gu LLT$H߸ LT$HHHN HD$AM~MH|$ ff $ H$ID$LT$HLP0LT$HID$HPPH H: I,$ 1IF InLc8MT$HEHPPH HRH LT$HHHm LT$HIuHEHP0LT$HM ID$HPPH Hz HD$AMfMHt$ ff $ H'1H LLT$INHHH - H01|$ Hm LT$ӄ HEHP0LT$鿄 I~Lc8MT$HGH;- HPPH HRH LT$HLT$HHI HLT$Hh LT$HHH I,$uID$LT$HLP0LT$HHD$AI.MH|$ ff $ I HH(uH@LT$P0LT$I/uIGLT$LP0LT$Hз- HY LE1LT$H0 M~LT$闃 H@PLT$HPLT$HHHEu HHH- LH LT$H01" LT$G 1Iv< 1HHH`- LIVH" H01LT$" I,$LT$ ID$LP0LT$ t) I,$LT$LP0LT$LT$HHH Hٳ- LH014" I,$LT$ID$ ID$H5 LT$HPH- H81G I,$LT$I ID$LP0LT$4 LT$HHHe pHy- Hh# Hh# x H- H5 1H8 [ H Q HH Z[]A\A] W G` EgV AGd 1 zT A IGpMwxI I?LHHHIWpD*HZHI ~ A96 Ll$ L+l$(I}M HHtMHt$(LH5B+ ID IGxI9 wL4 IpHHT HRV HV I}M HI- H5" H8 1IuC@ A< / x@t6*A HH- IH8B@ w H " HcHL~ P HH5 1HHc HIPI1VIHL; ZYNH - H5 H8 3HBH+H5 HHv- H LH01= HV- H5/ H8HjH,- H5 H8HPHH5/ @ @ HH- H8费 t L HH L1< jR H= DA< Hw 11| C@ < E| HW HO H|$E L= L5 M L$ HGHIHP 9 Z H= G ? HHT$ Hة H|$Ω LƩ L辩 MHT$tLHT$觩 HT$H蚩 1 H= H= H_ HW H|$M LE L= H<- H5z H8 1ZH- H5 H8{ L?{ H5 HH L1[]A\A]A^A_> E11^ <$ G > A 0 A " AGTA9 ILJ E1E E DE; t"HH LH54 1[]A\A]A^A_> HH LH5b 1[]A\A]A^A_= H HcDAt9H5 HH L1[]A\A]A^A_= LH $& H $a Lz H5 Ly H5v DLy H5 ELDDKs Ly . Ly AOPAà H HcDAt#H5 #LH $d H $ LOy H5 MwLG' AŅtJ IG8A H5L LHIGI I A A 1v< < A E11 IGAG@ IGH5 H=$z$ 豙 H5 H=z$ 螙 DD(IGAG@ IGIGAG@ IGoMw A H\$ D 1HH~ L> HL1H5 ; 1I8A#y A I8Iw1H): HH* H IH LsL9) HH账 IUI9i HH\$ 8 H1H = IQ HH5 L1: RIGAG@ IG=IG8A HIGI I A A AtmH5 L1m: AG@ DH5 tLv H^ DL( DLv IG8HE IG H5 L1 : AG@ }H5` ALJ b Mw8HV M;wU A Z 8 IH1I DLu IG8DI HH H H[)]A\1A])A^LA_mR A Z ! 1HD$ d Ht$HHT$Ht$LHHt$H H|$XHD$(H)H H5 ALJ AGTA 8 1H( HIǢ M LF LH諢 H HCIG8IGLDE' HىH5 L1@8 Hc AG@ H- H8A tAG@ H. AG@ vDLI^Mt MoI9r\ H5 7 LuDI9tIFx6HǬ- u)H] IG<$ I$uJ9 AG@ Lu IG: I$ U IA uL ALJ PZ H=[ HZHPHJ HPHS HC H H 1H Ht$H IH Ld$HIt$E tzH{LL!LcLcA$ { tLH9z tHH覠 [ H2 HC HHpH HCz H H^ HCa C@ Y H5 H16 HCHC; HC. <wG< <2ǀ@?wiHuHc HC ǃ <w<t3<to <w%z <u 됀zwH- H H5. D H815 H HCh zv뾃 M H- H0I IH> 1HH/c LHT Hs H Hl } } { H H H fHǹ} H{8 H;Dh L I)HD HLhILjC H{LHH L#LsL {@ H 1H= . HC* Hw HC <NC@ { u H HtH C@ 1HHEw H HtH HHC { uH HH8l HI MtNID$Ml$ Hx HH LHL* { tUHW HC C@ HC H6 C@ D )$ fo$H H#HHCHHC0bH; 1HH HC HkLcN HC Ls C@ HCo e H=_ H- H5 H8 7 H- H5 H8 H=s [ HŠ- H5 H8^ H 1+ H5W H=o$ H5& H=|o$ bE HHt HMHHEPHQAHg + L腛 0E 1 脤 xH} m r HT- H5 H8 D ? xLm@MeLHV D HH{E1NH- H5 H8R ]1 Mh 11ZLL1ЃC f H=- H5 L$H8 L芚 L$MtLy Lq 1^o Mo LHLL$ L$}A L$LL$ ao LL$. L$HTIHHHH4q L L $HtNH- HL$MH5 H81+0 L $LL $˙ L $E1{n H跙 I1eo H - HT$LH5g H81/ L $1D$ uo H - H5^ H8 H- H5 H8 Hמ- H5P H8 1m ?` H1m HC|$ H HHtHUH- H5 H815/ E1m 1m HPHc- H5 H81 / 1I4$u I}@ t'HP HHt#HAU@ 1I $ 1H1e 1I$0 LL* HHa HPHΝ- H5o H81u. F` 1C` o H0< 'E | ` A M AG` ~A A 3 A & AG` WA AG` EA A` A L AG` A A AG` f AG` s G` @ A` A 1P 4, H A AG` P L, AG` @ A D HLHT$(H4 ? HT$(Ht\I L AG` C@ A A A A 1A AG` * L\$0L AG` ? A l L xPIWIcA` HDp@D$X A L) AG` ? A A AG` AG` * H A | * Hu$A * Hu"A j A AG` A AG` @ A 3 L xGIGA` JDhD` A A AG` > f A AG` AG` A A AG` A LA xGIGA` JD`Dh A A AG` = A AG` <) Hu A i A 1d A AG` A A i A \ A .L AG` T= A A AG` += A` A A` Aoc A MHJ4 ; Hua\$(ILc AG` < A A A AG` < i L A H AG` l< Lr x5IGA` JDpDh` A A A AG` ' Hu&A h' Hu@A A AG` AG` 7 A d A AG` M AG` ; L AG` u; A P& H A AG` A A Hً\$(D & Hu!A AE AEA AG` AG` : BA A A AG` : L蜵 xGIGA` JDhDpk A = A 0 AG` F: A AG` A @ A @ AG` 9 o A AG` 9 A 1% H A A Y A J $ H A AG` % A $ HuA A A AG` A AW`EgA PA =p [ Ly H Lhl HH L2 H- A H L螳 x\IWIcA` HDp@D$9 A A A AG` 38 A AG` A AG` 7 A` A A d A A x A i A Z A AG` e A 6 " HyA AG` lAG` G7 A` A P A A A A H1Lg HH A A G A ^ LC H2 Lt H! H0 LcM,LcE(LHcM$HcU PH> PH- H01D AYAZHHl! H A AG` 6 A` A A PA =p t|A` AG D$ HtyEG`E DD$(1ҹ M\$IHHl$HL舡 IHtyL9 AGND ID$AG` W5 rA AG` 85 A A A AG` D$LDD$(MIw HHT$I\$Hl$AGDD$"> HT$DD$HtIcH9~4I<HpAH<L1 AG` 4 A T L A L H. Lq H HQ LcE(LcM,LHcM$HcU VPHu- H01 _AXHH< H A HHLD$H4 2 LD$HtHVH\$MN AG` 3 A q A C Lp H HcU LcM,LLcE(HcM$PH PH- H01G HXZHq HuVA A AG` HuA A AG` A AG` G` 2 A` A 1g Hu A B A 3 A AG` AG` ^2 H A AG` H A AG` A L AG` 1 A I Hu'A F AG` < A , A AG` A L蓬 xFIGA` HD`hs A A AG` >1 A AG` A AG D$ IH AG` 0 A A A | A m A ^ A AG` 0 A` u6AGAo9t9IW5 1 Le x]IW A LA xRIWHcA` HH@L$D$uIL IH A AG` 1 A AG` u A f AG` / A` u EoE9o D 4 A AG` M AG` 1 HA AG` A ` Hu A I A AG` 4 A ' A q AG` . A W A J AG` . AG` . A` e A L胩 !HcD$IWA` HH@L$D$H AG` 3. A A AG` . r Hu A A A AG` y A 8 A , L踨 xMIGA` JH@L$D$ A " AG` g- A` uMcgF A AG` AG` 3- A` A AG` - C A AG` , A RHPH5 H- H81U 1YHWHl$H5A 1H7A H1L # H V H{ HAԅu\HX Hl L M H I9 HLAԅ L Mu L MY e H=j 芴 l G` H=E e HPH- H5 H81? C` 1* C` HɺD Hw(HoHHD HWHH I M 9 M e M IY 1҃ 1҃ C` 1҃ Z Hu1= C` G` * {` 1҃\ Ht C` = / H谀 H言 AD$` 1; S H5T HH- H81 Hp Hf 뼾R H= 訲 H=R u HHt(H5J H~ HID$P! I|$P H `H HSIcă{` HHDxL$ H@ IH O sH{HL$X HL$H DH H{ HD` DL$ H|$h H|$DL$ HHuC` WE1LATL$(} AYAZH c HtpC` 1S C` ( {` & G` ( DkD;k C` Dc뗋 {` 5 냋 C` 1 {` [S HL$)( HL$Hu HU7 HL$t$ ( t$HL$Hu H- H5/ H8菳 1V Hق- H52 H8r H[]' I9 I9t]1MZX IE PX H9tHIE11E1V E1E11E1V H9 IH E11.X MuE11 X E1E1E1V IE E11X M9t E11W E1E11W =} V E1E11E1bV LHH HA} EV V V HE1IE1 V E1 W E1xW HWHV IV H.- xW E1E11E1U | (V | U | U E11 W HE11W E1V HtHE E1E1V I| U E1E1V H xSHc$HS{` Hp@t$D$! e# Hup C` /# $ CC`t uHH H Ht $ HC C` 뇃 r Hu [ C` C` < C` ] $ P =p H# H # H HH$ H~ H H藿 H Hў H H$H LcJ LcB HcJHcRWHPHI- H01 AXAYHHN z C` # {` ! #v! C` # {` O! $ CC`t0u,HF H Ht H ^ C` *# {` у Hc$HS{` Hp@t$D$ NH x7Hc$HS{` Hp@t$D$p g C` MC` " {` HHD$_ H H H HT$HHcJLcJ LcB HcRPH PHO- H01 HXZHuY^ HtA C` O C` ! {` + T IσP C` n! [ HHD$ Hy HT$H HLcB(HcJ$LcJ,HcR VPH`~- H01 _AXHHej Htv C` [ K H g c C` " P =p T {` [ CH߉D$] HHD$t 1 H HL$> D${` C! Hc] Hx H} Hb Hg HHD$G H1z H6 HT$H HIIHcJHcRVPH|- H01` _AXH H=[D / Hљ H H)D H> C` C` A,LcA(HH5 HcQ AQIVHHH{- H01 AZA[H( H h D${` CuH[ Ht4 H HHD$t HH57 LT$ui H1q Ha C` H1q H % H IcRMcJ HMcB IcJARPHz- H01} A[ZH Hu5 a Hu K C` 8 C` % C` # {` M H߉$ Hc$xmHC{` HЋp@4$D$ ` IcJIcRHMcJ McB PH PHy- H01耿 ZYHt! ? C` Hul E1 E1 H8 xEHCLc{` JDhD`ukH IH C` B C` E1t G` {` W E1M E1< IHu C` E1 C` _ IHu C` E1 C` e C` 1 C` {` u%CD$9C 4 H C` ko C` {` k IHu C` E1 C` ' C` C` a C` * b IHu n ~ C` E1f E1U E1D HHD$ t H HT$H HIIHcJHcRVPHv- H019 _AXH H| z C` q Hu C` C` {` } g H C` H~ Hc$HS{` Hp@t$ D$ C` ^ C` U C` {` u C$f > s C` C` H|$ <$ t>Hyw- H8A t+ M HSw- H8 t 1 Lo O HL HHy 1 L5 LLHD$@ HT$IHHt1IL$IE HL. H HPHr- H5N H81T 1( 1U 1_ H;ps- H&! MC` k| G` g {` 1 MLҭ C` 6 B C` {` uk 17 C` LV C` C` 1 C` H9HtAX2 H9XG H;u- HH Hp- H5 H8 H u- HHl H9X_ H^1 9XM 9ZD H9Y: fZAY[ H9ZbHϾ Y HHu 1 k # Hq- H|$HI H $L|$`H01 H $H# Hj # HEt- H5 L|$`H8! y# H= L|$` ^# H|$H}q- L|$`H G` H018 0# H=7 L|$`袜 # H! L|$` # H|$LH$ H $ HL|$` j " L|$`" L|$`" H= L|$`/ " Hfo- HQL|$`H5 H81 |" H= L|$` a" HJHUHtHr HDH o- H5 H81 1# H;o- " W# HT$HHH LD$u!I?I$ # 1ЃC # C$ 1E h E H E MD$(MLD<E Ml$MLDD 鑸 $ $ G` $ G` H|$; H|$` $ ~$ G` $ G` 3$ H{Ht*HC H9u+1HCHkH: H1[]A\HCT 1HCHsHh[]A\A]A^A_陷 ' R H=3 + Hg 12+ )D$) $i fo $foD$HtU+ Hg H5b L Hm* Mf fHnfAnU fnMfA:"U fH:"I\$f:"MHCflHP0H9* * Hl- HRH5 H81m * g F AF` M, H<$3 AF` A + H<$ AF` s A j+ A ]+ AF` L A C+ A 6+ G` & A~` * A E1A + m H* AF` AF` En* AF` , 1t1;- Y[] Hk- H H HH01 Z1[](- Hj- H5 H8: 1E C` E1- IH/ C` E1- C` . E- D m- C` - H HS{` J"DpDxu>C;C H̉ HcKHSHHȃ:- Ar- E1 - E1- G` d {` b, E1, C` E1, HcHC` , Hi- H5 H81 1D h HC2 A AF` / Lb AF` A 3 A 1 AF` A 1 A 1 AF` w Q4 A T/ A / A A 1/ AF` 3 2 AF` A / G` A~` X- A 1o/ Z Hu A . A . A AF` . AF` A~` 2 A 2 H AF` v A 0 H AF` T A q0 Lϣ AF` 2 A #2 A 2 AF` A 1 A 1 AF` 3 J H- A AF` :. A +. H- A AF` . A - HLW8 HHt A R- Hu3A *- AF` A - AF` A AF` , AF` A~` uIE~E9~ , L xaIFMcA~` JD`hu_L H , , A , A 1- AF` t q. A AF` I, A :, Hu A !, A , A AF` + A + A 1j, 1`, L xxIV* 6 Hu A + AF` 1+ A AF` }+ A ;+ H- A AF` + A AF` 1+ L% HL @ D@ l_ Hs+@ Hdd- H5 H8轔 14 Hd- H5@ H8蠔 1E6 D~,Dn(Df$n HvLw EEARHDAVR A[[6 D~,Dn(Df$n HvLw l5 DEHPEAV ZY5 N LPHvw P,LRDH(D@$ə AXAY5 N LPHvw P,LRDH(D@$,7 ^_q5 D~,Dn(Df$n HvLw 2 DEHPEAV ZY45 )$ fo$Hj5 HL> ILDH9HT HDHmc- H5 H81 5 HLE> ILDH9H HEH5p HHH#c- H81 {5 > 15 *? H&b- H5 H8迒 16 H b- H5 H8袒 Ha- H52 H8芒 Ht$)$ fo$Ht$Ht6 H,7 C` 17 G` o {` 6 Hk xHSHcŃ{` HD`DhuC;C6 H: x CHS6 C` 6 H血 HF8 8 8 C` 7 17 G` {` e7 17 IH7 C` 7 H;Nb- B8 8 HULBHUHtHJ HDH4e- H H5 H81 18 A EoH=. H. A 9 e Hu#1H; AG` < A : A AG` 9 H> AG` A \9 AG` H$ H$'; A A AG` $= AG` HT$LD$D LD$HT$< H轛 AG` A 8 A < AG` A_A 1҃-9 A 1҃ 9 AG` A` 7 A w8 AG` H$ A` H$8 A 8 G` r A` =7 A 1҃8 8 AG` A A 7 A AG` 1҃a8 A 1҃P8 E1k HA AG` #8 AG` 9 A 8 G` {` < E1K= H} xaHS{` J"DhDxu:C;C Hr} xKHcKHSHHȃ:< A = E1< C` E1< C` k E1< C` E1< HcH눋 |< D#< , IH< C` E1K< E1= HH> C` = C` s> E1h= kW= C` E1?= G` {` < E1= C` < E1? AE` E}C AE` A}` A A aB LC IHCB 1LH5 @ *B H McN,McF(LIcL$$IcT$ ASPH]- H018 A^IXMtGA \? IHK? A AE` E1> A > a H A A A E1m> Lz IEA AU`HXh? = A AE` A ID$IcL$$LIcT$ McN,McF(ARPPH PH\- H014 H IHSB A S> A AE` E1= A AE` @ A > A = AE` A}` @ A @ E1N= G` A}` 9< A E1%= A AE` E1 = A @ A @ A fnfA:"fAօ ? A E G@ A fnfA:"fAօ d? L~x H> L A HD$(H> LRx H> L; IH> AuI}8, H DH @ Au LPDD$ L$Ht$0H|$8 Y^HH A E m? L<x xjIUIcA}` Hp@t$D$> A fnfA:"fAօ Z> A fnfA:"fAօ 7> A AE` fnfA:"fAօ > AE` N= A fnfA:"fAօ = Hu#A fnfA:"fAօ = A AE` fnfA:"fAօ = 14 A C` C Hl C` @ DcH=2. HI. l@ C` B AA@ Hv p HC{` H(hDhc? E1q@ C` B {` u? ? C` ? HZ@ C` @ C` H$ H$@ r? B C` HT$(LL$ LL$ HT$(|B H C` F? @ *? C` H$K {` H$> > G` # {` = E1+? C` E1? E1 C` E1> 12 A C` G DcH= . H3. 6D HD C` ND C` VF AA9D HWt m HC{` H(hDh C E1C C` {` C C C` C Hc C` jC C` H$ H$D C vF C` HT$(LL$ p LL$ HT$( F H C` M B VD B C` H$ {` H$cB B G` {` KA E1B C` E1B E1 C` E1B L% HL 0 0 M Hs0 AG` ] A` G A PA K EF AG` mH AG` J AG` H AG` *J AG` 럃AG` L$, A` L$, AWA9WM )I $ Ht A AG` A D$ H|$ AGu~H=. L. A PAG` L$,O A` L$, AWA9WM G H A A` AOH hAW`vIw H|$T$3 T$HI HcH9D$J I4IHH4 H6 A A` AO<G HuE[J A I A AG` I H A F AG` G A AG` 1ۃrI x HuFA A` AOH LP Hu2A A` AOE $A AG` A AG` AG` F AG` F LLD$ E AwIAAA " LD$Htffn $fn@ LD$f:"@ I_ fA:"M(foHflL)$Z LD$I1Mt%I9~(IPHHRITHAAH AG` IIw LD$HHL$a HL$LD$I1MtH9~ IPHATHAG` H߾0 r HHt+fo $LhE HhL`X A )H H A G AG` D AG` A hH5߹ L$,^L$,H H#P- H| LH01 L$,. Hu`A C A AG` C A A AG` JG A AG` AG` AG` B A` < A AG` L$, A` L$, AWA;W&I D AG` A` @ A_A9_A Ll IWHcA` HxDh<$ LL HH F A H A A` AOQD Lbl IWA` HhD`tLA 1ۃE G` A` T@ A 1ۃ`E AOA9O H D AGA;G% Lk 3 AG` A Ew1E A AG` 1ۃD AG` fA HJ A A` AOC Hu A A` AO7B A AG` A AG` s Hu5A A` AO4B GA AG` [A AG` HcHʁ:E R? EAD IcOIWHHAG` L$,u A` L$,AWA9WE fB Lۆ AG` > A PA AG` AG` L$, A` L$,AWA9WyE @ AG` L$, A` L$,A u:PA =p ? AG` L$, A` L$,? ? AG` L$,o A` L$,AWA9WC ? AG` L$,< A` L$,*AWA9WD A AG` L$, A` L$,AWA;WD @ AG` A` A n> *A AG` B A wB A hB KI C` t {` H oJ G` R DsD;sG J H {` )J I Hh HSIcă{` HHDxL$ H[G IH3H H C` 1~H C` Dc I C` I {` %I |I C` iI ]I J C` 2 {` J K G` DsD;skI nK h H {` K 6K Hf HSIcă{` HHDxL$ HH IHI J C` 1I C` Dc K C` K {` J J C` J J H{XHP K LsM9K LshMON L% M9:K HLAՅL _L H{XHM K LsMtUL%v L9J HLAՅK K Ls MtYL%G M90K HLAՅK IL LsMPL% L9yJ HLAՅ^K K H{XHJ L% M9O L LsMu Q C` {` P R G` DsD;sTP WR H {` R R Hrd HSIcă{` HHDxL$ HO IHP Q C` 1P C` Dc R C` Q {` |Q Q C` Q Q H[0HWR Ho H96R HLHH[]A\H[HS H? H9S HHHH[]A\ Hu8 {` u6DkU C` Dc yV C` fV aV {` tGV C` 1{U C` Dc V C` {` T U Hu< {` 8U {` U C` U H.b x5HSIcă{` HHDxL$u,HVS IH.T uU C` JU >U G` DsD;sES V \T Hu5 {` Y Y C` Dc Y C` Y {` ~Y Y C` Dc bY } Hu< {` ?Y dY {` KY Y C` Y G` DsD;sHV Y gW C` {` V X Hr` x5HSIcă{` HHDxL$u,HU IHV !W C` fX ZX C` 1V HHH Y E H?HڍHM ]Y Y C` Dc [ C` Dc [ Hu; {` u9Dk[ {` t[ C` [ [ Hu1 {` ta[ C` 1Z C` 7[ {` [[ C` Dc [ Hu< {` Z {` Z C` Z Y C` > {` X yZ G` DsD;sX K] C` Dc CZ H] x5HSIcă{` HpDxt$u,HW IHZX iY C` Y Y C` Dc Y Hu< {` Y {` Y C` sY Hu< {` KY {` o-Y C` Y Hֹ H= t HsH;HT$苏 :] 1M] 1F] C` a Hu`AD_ D] C` E1^ ^ G` * {` 8] E1^ C` ^ C` k E1g^ H[ HS{` J"DhDp' C;C H[ HcKHSHHȃ:\ A2^ C` kE1] C` P {` udD{D9{<] HD[ xHSIcǃ{` HDpDhu{H` IHF] !] C` E1n] !^ HcHBC` k E19] C` ] ] E1] H C` \ \ Hu }] o] C` Z] | H C` v\ h\ HH=֥ tH;HsHY_ _ 1c_ Hֹ H= m 3 O /` G` f {` _ E1` HSY HS{` J"DhDpu7C;C H!Y C` k E1_ E1_ C` E1_ DA_ ( IHN_ C` E1Q_ C` E19_ HcHʃ:7^ A]_ HcKHSHHC` Dc c H {` Dka C` Zc {` tb L Hu1 {` tb C` Dc b C` mb C` Zb Ub H {` A)b {` # b ` H {` a {` a C` Dc a {` ~a C` ka G` DsD;s^ c C` 1` C` "a HPV xWHSIcă{` HpDxt$ uNH] IH^ ^ C` {` }^ ` C` ` ` ` LH \d []A\HW IHtbHx Hxx LI0 I L+d H軗 HHmd H^d H(:- H6H8e Dd H6- H5 H8e y LHM0 Ht8H6- H+ H5Y H8) c : HV* HtH HHc Hc Hp5- H5 H89e GH y HH~c Hoc Hx Ht? HHH9Gc H5- H5 H8] "c n H c H IHHx H LI/ I L+b H^ IHeHx H LI. I D+L9xb H 5- H5 H8 Sb H 8- H5V H8c H! f.$ zt Zb c Htw LH). H H4- H+ H51 H8 a Hg/w LH- HtSH/4- + H5 H8 va H Ha HtHv Ht|H= a H3- H5 H85 ` Hsv Hn HH= ` Hh3- H5 H8 ` HW|H脐 f.L$ ` {` Hl` Hu H fH= K` H2- H5i H8a &` Ht$H*9 H H|$ _ Hsu HtZfH H= _ Hi2- H5 H8 _ H0- HH5 H81 F H8fz_ H d_ H&1- H5g H8` Hf LH []A\HSLBHSHtHJ HDH4- H H5 H81N H0- H5 H8V` Ho0- H5 H88` HY4- H5 H8` 1. H HI H+_ HCHP0_ 1 _ M HH_ HH/- H5x H81 H>* _ H|$?3 H|$t;11H|$ LD$HD$HG HHT$(H|$ HHD$0% _ 1 _ 1 M H[]Ht$HPxHt$HHu HH[HH[ H + P H;.- H5| H8^ 1 LHLcLlLLI9HHIFvc c LHɄuULgH1HLD tuA. 9 HHw(1 t#At99ujHLgH@tLg01A H9C@*c AEc A c A H;k c A.Eb A b 9EAb 9EAb ) x H} } HMc H( H( C` 1c HPH-- H5ݗ H818 C` Hu#H Hb R H=f Z H.- C` HHט H0H01[]A\A]A^Y HJ0- C` H@ H5,- H H9H`UHxh JH|$(HT$Ht$ ! H|$Ht2' H|$((' IcUMcE HH t$ IHPH-- H01s H|$0& XZ)$ fo$Hb C` a {` uk9 P1 G` / Lg C` y q C` W C` L]g C` $ H HH$c H {` L$Ic 1L1H6 HO HH迫 IH, d d 褺 Hu d C` d H$ H$H c H HHD$c H {` LD$Ib H $1LH66 H HH IH Ac C` { {` b c C` W $b c 诹 Ha C` 1a 脹 Hu c C` wc B p H HtZ P =p K {` u3HDs HHM {` DsuHз HD {` Dk Hz Ht HG HD$ H {` Dk HG IH {` DkucH HL {` DkuHH {` u#Hhp Ht HfG H {` Dku H; Hu0 t${` s}` ` H G Ht HF HtLc@ LcH HHcHHcPH VPHw)- H01o _AXIH> ` HF HH McF McN HIcNIcVVPH)- H01n _AXIH f` H4o H H.F HHcPLcH HLc@ HcHPHC PH(- H01Hn IXZMr _ P =p {` HDsE Ht H߃ yn H# HsE H LcH Lc@ HHcHHcPH ARPH'- H01m A[A^IH :_ P =p {` H HD$(H P =p w {` C D$] IH C`D$ HD$ 1H$ HzD HtIH} HHt9H4$H9t$ H$sI Ht$H$C` &D$Hs H<$C HH L` C` X H{ H$ H߃ HHcPLcH$HLc@ HcH PH( PH8&- H01k IXZM C H$ C` C` xI4HQD$ H4HcD$ H9$LH $ ` H$HHt$(| H HB {` HB HLcH Lc@ HHD$ HcHHcPHh ARPHF%- H01j A[A^IH \ Ht$LHL$HHH4 HD$c HL$H9IC` h{` DsuHz Hq C` Y C` H {` Dk^ Z 蒲 Hu; \ z H C` ~ [ C` X\ J\ C` [ 0\ Huz \ G` {` Y CHzA ,HSHcŃ{` HDxD`C;CY HAA xNCHSY C` [ w Hu [ C` j[ C` oY G` "\ V^\ P1N\ L ] H;h"- ^ L5c!- ] AE` q A}` A } A 1҃w A h 袰 H A AE` C 1 Lu H\ - KH LH01 HH A A L HH LL16 v AE` 8 A 1҃ AE` M A 1҃ G` D 誯 H A AE` K AE` A / L? xZIUIcA HAU`HDpL$ A 1 Hu(A A AE` 1҃ A AE` " xYHE Z^ #] H#- H5 H8N V^ H" x!H3"- H W H9] ] )^ $^ g H ` HhZ C` DcE1@_ C` ^ C` ^ G` {` ^ E1_ H߉T$ T$HH$t H< T$H {` SY^ 5` C` {` H DsU HH] _ S_ '^ C` _ C` {` ] _ H HHD$tTH/^ HHtDLC Ht$ H<$b H HH詝 HHt ^ 0_ 萬 Hu _ C` _ S A@utA A DE1Ld$ALl$MDt$ MM9e` Ht$JT- D A9 Ht$|$ J+I蛕 ¸ 렋HHAg HT80H0lg H@HH8_g NL0H0e H@HIe HHe HHe HHg HHf A@Fd Kt L) 0d _ HO0kd HOHbd H@HH ("a H@HL (gd HT0H0b LgHE9_ AAAD a ` Lg0` H@HH@b HT0H0e H@HHe HO0oe HOHfe HOHa HO0a H Ds14 1҃- C` 1҃ HSIcHDhD` 1҃ G` 諾 Ht C` ! Hh H H% IMtHu L g H H h H - H5 H8I h 1H& IHmh HF LHG HQh H H - HHU 舜 HI HI M h Ih IHu HUMH H5W HMH\- H81 L g IH g C` 1 H LcJ LcB HHcJHcRATPHY- H01_ XZLK f H A AE` A 1 G` ¼ A A A AE` 荼 LH$ H$ oHH$ H$n QA A}` WG` ( {` Dg 1g {` P =p x kPA =p P =p P =p H IH H HH LHo Ht# H5 HtH}b H {` Ds HWb H H߃ 5 H H|5 H HcPLcH HLc@ HcHPH8 PH- H01] HXZH ,f 1_f 1Uf C` f {` r Dc<f C` 1f C` * {` u$DsQC` {` U {` kuHX IHtlH(U IHt\ Hc4 HtJ P =p I {` Z HD{e H; {` p {` k H_ IH H3 IH H H HqT H H IcM$IcU HMcN McF ARPH<- H01[ A[A]HHS nd C` ¸ {` " xH=ND t H1L HnJ{` kHd IH HS H ImH Lm I HH@H|s JTHLc@(LcH,H HcJ$HcR VPH9- H01Z _AXHHtU pc H|H? DHH9|Hʁ H HHEH- H01賟 HH H C` {` kHc H H1 HttH IHtdHlR HHtTrr H~r IcM$IcU HLcH,Lc@(PH PH,- H01Y ZYHHE `b kk`VHb IHB H11 H,Hb HIUHtH 1 1C` O {` D{t H HHD$tHjQ Ht$HHunD{L_q Hkq IcM$IcU HLcH,Lc@(H AVPH- H01X A_HXH0 Ka ?a H15 Hd E` d H`c E` D@D 1c E` d G` 1 }` a AE` b H0 xHUIcŃ}` D HD`@D$(u9A@ Ap ~a E` 輴 }` ha xb AF cb HkH4$HJDKDI0c H$LIb G` X k# V P1 C` kRd 艟 HDd C` :d ,d G` {` c 1҃d 2 Hc C` c c 1҃c C` c 1҃c C` 1҃c HPH0- H5 U H81ן ee H- H5Q~ H8> HH~苉 HHtH Ht[C` H- HP{ H0? 1e H胟 Hu H- HH0 tH 1H+oe e H=H #; 1G` n {` e 1҃e 违 HHf C` e e C` 1҃e 1҃e C` he H - H5_} H8= 1M Hu_ C` 萱 {` Hu y C` d C` O P =p HZl HtZ P =p ! {` u3HDk) HH3 {` DkuH; H& {` k Hk Ht H4+ IH] {` k H+ IH {` kuaHA Hu}{` kuKH+ {` u#HT Ht H* H {` kuHa HE P{` Dc 1 H'T Hr HQ* H\LcH Lc@ HHcHHcPHgw AUPH - H01jR A^A_H H) HIcMIcUHMcM McE PHw PHp - H01R ZYH P =p {` $ HDkr) H H߃ S H H<) HLcH Lc@ HHcHHcPHiv ARPH - H01UQ A[]H X 誙 H < 莙 Hu* $ v H C` C` έ G` 轭 H{ 1 Htf H߃ c HLcH$Lc@ HHcH HcPHu ARPH - H01>P A[]H 衘 Hf C` Z C` C` C` ߬ {` DkuHb H HF' H H0' HLc@ LcH HHcHHcPH-u VPH - H01JO _AXH 蹗 HH C` P<H H H& {` { H& HeLc@ LcH Hw HIcMIcUVPH - H01N _AXHf d X C` 萫 {` k\P19 G` h P1 1 H=w 3 1 H - H9- H52w H86 1 1 G` 1f G` Ϊ {` a 1a Hia C` C` DcPa C` DcC` D{14c 1c G` R {` ^b P1c C` , {` b Dc]b H#- H5Dv H85 g H9b C` P1ic P1Yc C` P1Bc H- H5v H8Z5 1 G` 臩 2 Vn P1^ Hu- H5u H85 1 HHz HHt5H HHt%KHsu C$PDK DC H; ZYc 1c b Hu1 1 H( C` 1 C` Dst{` P =p H H H" Hty H" HtgH- Ht HH01F HH E 18 0 C` {` d Ds 1 C` 1 G` 菧 5 1 HSIcHDhD`R 1 轒 Hj C` ^L%- I$g H IHS H J H> AG` A P1k G` ɦ O A AG` 誦 A AG` 萦 A` ? A H > AG` c A { A n AG` < ! H 1J LLH=r 1T 1 LL$ HL HB H} tLLn HHtH^ HHtHu H y 1҃g 1҃W H VV . H{ HL] HH 辐 H C` G` $ 芐 H C` H{H` N tDc A@_ _ P XHH[]A\A]k 1҃ H C` 1҃z G` a C` 1҃R H1; C` / _` 1O` C` 5` 1%` G` ۣ A_ H1\; C` _ H:; C` 螣 P G` 脣 C` E1p P^ E1PM E1P< H: C` , P 艎 HU C` PK 1ɍP; 1ɍP+ F H C` P G` 謢 H1D HI- H HHWH1D HG H, LH5o H81 L 1e Hu HP{ H, LH5io H81ǎ Lo H}8 H}P u~H}X uwH}` upE LH5*p H;, H81y L! H mL `HHHHt& HW LH5Wo LH5o Ht L H, LH5n H81 L H, LH5!n H81Ǎ Lo Lb LU H[]c H^ C` ^^ < HHW_ C` A^ C` D{^ #^ C` 聠 {` N^ ] Hm x<HKIcŃ{` HD`hu;S;S] H= xdSHK] C` 1҃] 1҃] G` {` 8] 1҃f] R] C` @] H;7 C` 蟟 H7 C` } E1 C` E1O k E1Z G` $ 3 1 1ɍP k H C` P 1ɍP 1ɍP P =p n H6 IH {` DcuV H H {` Dcu6 H H4 {` Dcu H HY P{` k 1 P =p tq{` HDss Ht_ HPl IcMMcM HMcE IcUAUPH, H01@ A^A_HHD q C` q 끃{` Ds H IHto P =p u C` * {` u@ HD{ HH {` D{u# H HH GH. HHA H HB IHlH H[Hk McD$ IcL$HMcL$ IcT$VPH, H01D? _AXHH 谇 H C` P荇 H C` P 1ɍP Hv H : H` {` H LHXV IH+ H߃ ? IH' Ha {` H H{ LLK HH= 贆 H- C` P# C` G` P c H C` P : Hh {` I H K LLHCU IH Hu5 ܅ Hu C` C` C` ) {` DcsHQ H H HHcHLcH HLc@ HcPHh ARPH, H01< A[A\HHl H8 H%: H" HH, H#h HH01~ HH : . LH߃ 1 HGG` {` wX 1҃X N H Y C` X X 1҃zX C` GX C` 1҃WX 1҃GX gZ H HZ H IHZ 1HH5 c Z H c McG(McO,HHcM$HcU VPHE, H01: HD$_AXHZ M HZ C` Y Y Y H HY H谑 LcM,LcE(HHcM$HcU PHf PH, H01S: HD$AYAZHZ 輂 HZ C` 4Y H HY 1HH5i b Y H HcM$HcU HLcM,LcE(PHKf PH#, H019 HD$ZYHY , HtY C` X C` 蔖 {` [X X 1W 1W IW C` IDsW G` = {` +W 1W ΅ 1 .u.t6 ø4 Ë P =p # Hz Huf{` Dcu6# H^ Hl {` Dcu# H> H P{` k 1 HGM Ht H HwLcH Lc@ HHcHHcPHd ARPHp, H018 A[A\HA J C` {` ZDc P1$ G` ʔ HL H HG H H HHcHHcPHLcH Lc@ PHJd PH, H01P7 ZYH H!L H H HmHK H\Lc@ LcH$HHcH HcPHc VPH6, H016 _AXHt ; H- C` P!H, LH5c H812 ~ HuH, LH5wc H81 H, LH5c H81 A Iu6 I 1 MH{ 1[H\ H x=HSIcƃ{` HDhD` 1҃ 1҃ C` 1҃m G` 芒 } Hd C` 9 HC, H5c H8 []A\H H5Z HH, H81~ } HuHf, H5b H8 AE` A}` ? A G` ̑ P1B HE) AE` 訑 A g AE` 莑 H) AE` t A 3 AE` Z A A A . 1v 1B 1 E1 1 .G` Dc {` t1퉃 P =p t= HG Ht1 HsA u, Dc C` k {` tH, HY HH01hx Ht HT { Ht C` 06 I HD, HX LH01x H|$8H H , H%a LH01w L5 H HCHH a HHHj, H01Y [1]A\A]A^þ H=$ H m, }S H=$ z Ht&H} U HLH5ca 1{ T 芒 H, LHH5` H81{ T H=[$ { Az HT H, LH5W H81M{ T LW0 LWH H E1 LHu H L AFu005IfBc q u005IfBc AGxI= 1H2, H5` H8 1 P1a G` # HWHHH HD$H5` [ LW J\ L|$@V HD$H5W [ H5W [ H=)W LT$HL$L$Hm L$HL$HH@ LT$Y HK, H5$` H8 [ G` # 14 HH5 X 1 P =p : HN Hu Dc H$ Ht־: H Htľ H Ht H HtH, Hc_ HH01Nt HHt1 7 C` {` IV1 `w H> C` 2} HHtmHH537 H, H81Jx H HI~ uHHO[ H} HHt'HH], HMH5*5 H81 x H 1=[ Hy} HHtHH5K w- 5\ HUH] P1 G` [ H ^ H, 1H@ L LhI9,$~I HtI|HL;" H{H] ] H= - 1_ HHH^, HVH5] H81w H 1a` I|$( t"HH;- , HC L` _ ?` ID$ H@A A A_E1J A E1B G` ܉ A E1 A AG` E1 u HtA AG` A L! AG` f A KE1 AG` A A` A #A AG` A L AG` A AG` ӈ H, H\ LH01p Hj ǃ@= <] H, HER LH01p HDD< A{u<} H, Hr\ LH01Up L L ? Hd, L< HQ LH01#p H?, HQ LH01p ه H <) HDD< A(" WH, H[ LH01o L H, HG\ LH01o y H, HZ H01eo \ ߀] HDD< A[<] 1҃ br H C` C` S P =p HDs' H H6G H H H H, HAI HH01\n HH C` 1҃ 1 C` {` U kj {` Dsu߾ H_ IHtHoF Ht H= Ht H+ Ht1 HW6 tH, ANHZ HH01tm HH G` 0 v HSHcŃ HD`Dh T 1҃ [p H C` 1҃ p H C` H1 H5I H1p P[ H-, H5FZ H8 \ G` E P =p H IHt7 H Ht% H Ht1 H4 uN P{` k 1 P1 C` 蘃 {` hH, AL$HY HH01k Ht M n Hs C` PgH5Z H|$ H|$ubH|$被 H|$L1H5 M o 1H[A\H5Zm H|$o H|$ƃftsuNH|$Q H|$H|$@ H, LH|$HL H01 uH|$ \ H|$PH5 j 1H5' %H5yl HGP0c^ DD$ C ,L1HX tL 0^ H( H&, DHY LH01GL I ^ H , LH3 R^ InH @^ L; 0^ HMH3HW LK ^ IcC ,LD$ LH, HX H01K y] HPHR0DG` M A_1 l HtA AG` A@ A 1Ƀ A AG` AG` A` A s A 1Ƀ A 1Ƀ~ A AG` 1Ƀe Hֹ H=J T 1[Hy, H5W H8 18 Ld$H1L` HH>] ] Ld$H1L` HHxkA-] H ] fk H] 1 ] Qk H] DsH{Et!A\ DwHEu\ \ A-\ H?H9\ H\ G` r P =p v H IHt7 H Ht% H Ht1 H/ uN P{` k& 1< P1, C` ~ {` hH, AL$H.V HH01f Ht i Hs C` PgH[HC ^ J] L o] H}` uHHL[]A\A]A^ MV` MN` ME` M=` M4` M,` AAI` HcH ˲ H5, D x^ 0 H5, A ]^ M_ I8_ 0t-H5}, A@ '^ 0 H5b, A ^ WHO߀BY H5<, W<j HA@ ] WHt8] WHu H5, A ] uSH5, 1Ҹ A ] A H5, 1f] t^h^ t[Z^ A ,^ H5n, A ] ^ H5M, A \ A A@ |WHO߀Xu H5, W<w9HA \ H5, A H\ H5, HA@ \ M^ I] M] I] WHO߀Ou H5, W<w$HA 8\ H5|, HA #\ M] I] L݈ I.Aj_ _ HÈ Hm _ _ I}` t1` H=R H Ht!L=, E1ya H;, Ra a ` Hw, ` H, ` H, H5R H8` 1 H, H5S H8C H, H5R H8+ b HH| 9b u Ht$ Ht$t~ nb c i 1b A J Xe Ha A AG` Eg1 A L xNIWIcA HAW`DhDpuFA` A 1҃ A 1҃ A AG` 1҃ A PA =p LA_ Ht LU HtLi A` H A` A_u5 Lu HHt LT HtLi A` A A Eg1 AG` |x A` NG` cx 9 AG` Qx A c HgA AG` x L HX L HB1 L( +H9, KHP LH01_ HHtSA L8 HH, Hy: LH01_ HHt A b HA AG` AH HLmHE1L)b 1Gc HSHH9pc b H;{Hac Ha H v 1a A0 HS0HS(a HSHHS(b a Ht$X 1Hu8Hu0Ht$a HSHa H, H5uO H85 1k H{ 1HC_d 1xe dg L1H A9h h M) L H Le Hu h t E6h ,h HHL$- HL$t4LkHg I9g C g C Htg g 0h H uh LeMh E Kh 1LRp j HL[]A\A]A^A_ HHL1[]A\A]A^A_ Hm, HLH0N H0H1[]A\A]A^A_@? Hi h H* i H|$. H, H5%N H8u 1 H, H58N H8X 1H; e, 7k H1H9'k H, H5/N H8 1 HLH $ H $l m(Rl L~ Hv $$ thHE`I>fIE HEhIHEpI1HEpE`H <$"k H, I} H0i H5M H= T H3, HM HH0 HE`I>f1IE HEhIHEpIHUpE`H k I> t5 k I> t _I>WH5M H=# м I>j HHH, HH5M H81_ HO 1k C` r F C` r L? C` r P1 G` {r q L C` br t []A\Mr H @r 1 H, H5+M H8 ዃ 1҃w |] Hz C` T G` q 1҃3 H H[]A\ H$HIl H H}HHEHHu 1H l 1\ H C` 1҃ G` Aq H=XL 1l H|$p i n H|$( ME DKH uHG H p HD$(H, HT$(H5 N H81n] H|$ph n $ T$HHt$ H|$XLT$@pT LT$@HHn H, HL$XH5#; H81] H|$pXh 0n H, H5: H8 H|$p3h n H, H5K H8 H|$ph m A9m Ns E1D $GHP, H5L H81\ H|$pg m H|$pg m DME DH n L. H H. HDALEH|$( uBH= F H|$(AVAH5K PHI, HT$8H81[ AYAZH|$p4g m H ; H|$( H , H, HT$(H50K H81[ 붍CE9EH n ENHȥ L- H- AHDA9LMH|$( tUH AVH5J PH, HT$8H81;[ H$ ~f AXAYRl H$E H m HD$(JH= E H|$(H, H58 H8 H|$p/f l H, T$DH5J H81Z H|$pf k H], H5I H8 H|$pe k L 68 o H|$( H э t8H, HT$(H5yK H81OZ H|$pe mk L o H7 H l HD$(HL$(I$HHD$(Ht1Ht$(i Wm 1 k E111j H%, H5 / H8 H|$pe j Hp, H5I H8 H|$pd j H C` l Pg MHHT$J4 pk HT$HIt*Hn E1P) G` l d H C` ul P C` Ml w PE1 C` E1.l P 1҃) G` l jW H E` H} $ H2 HHG HH V H E` w i [ M ? V H& E` nV H E` KV H E` (V H E` V H E` U Hw E` m U HT E` J U H1 E` ' 3U H E` U H E` T H E` x H[o HHH[]A\A]A^ , 1H; , n 1o Lo n I|$` uHHH[]A\A]A^ H , H5F H8 1 H, H5F H8 E H0 E H# SH, ME 1HD$ վ H, HT$H5F H81U MtL衾 MtL蔾 Mp L胾 o HC0CuHHCH[Xf H](o H|$h H|$HHt 1H7H9 1p H, H5|F H8 1P H, H5F H8o H, H5F H8W 1 I|$ urH+ , tp1Ld$HH;_txHL^ u(Ld$p H, H5 H8 E1o L耽 E1o 1H Hk p I+\$(u11H Ld$Huo o 3 H=F HLL mq L D[ A H O 1H> , 3 H=E = 1 Hr, H5E H8; q HT, H5E H8 H<, H5E H8 r H , H5E H8 H6, H5E H8 14 H, H5E H8 H, H5E H8 PH, HE H0 ZHkHu$H{Hr YH[]$ H=D H1ջ H{Hnr ZH[]]$ HH|$ H|$t HGHH 1҃ 1҃ G` e h rP H C` OP H{ C` Pq 1ɍPa G` d P H7 C` P- 1ɍP H AF` Xd A % A P1$ G` .d H AF` d A AF` c A AF` c A A HEH5&D HPH, H81AP H t c H+t HCHP0t H_, Ihi H8萃 t P1 G` ?c HH5*U . IcL$IcT$HMcL$ McD$ PHC PH?, H01 ZYHt@ W C` b {` P 1, N Hu Pv C` Pa C` 1҃ 1҃ umHC HH Ds G` %b E C` ' M H C` 1҃| 1҃l 1҃\ N H{ 1Hu) HH+ M H C` L H HQ, HH8膁 A P1 G` 4a J Ht IVAH4 LA HH Ht$H9t$t>HD$EwHT HHD$ He AG` ` A Ht$HHT$HHH4 HD$F_ HT$HuhH AG` w` A A AG` P` A } A p AG` )` H#` 4r 1҃ H H HT IHw sH{| HH D@ I|$DDDH VLs & _AXHH H{ T' HH; J H+ C` ! J H C` C` V C` l 1҃ H xVHSHcŃ HDhDpC`u{` D 1҃u u0H7@ HHT kɋ C` 1҃A 1҃1 G` Y^ H|$ Z^ [t H Nt H HtzW H H H~HT$Kq HT$HHC0H H ߽, H9HtZHH5> H> HHDH1eJ H HuH{0 H5( H, H8O HtH5t( < H5N( . HtWHHu> HH5> HDH8, H81I tH{0 H5 ( uH, H8H5 ( SH, H8HuH5' 3Hټ, H8H= U E1Ws HC01H9CtE1Cs s H~o HS0IH, H8Ht#Mt6LH5= 1"I Lʲ Ju Mt$LH5= 1H H5`' !u H5O' u H; , Nu u I~ uKIKu H@N HHu HH, IL$H5 H81H H, u HM HHu HH, H5o H81HH H {u Mu}H, H5& H8@ E1 L L趱 HEHHD$ Hg, H W H W INHH W IN HI^(e E1f IHtI HT$Ht$LH<$w HH H $HHT$H HT$Ht$HIFHE LIn H)H IF(F H Lհ H{HH<$ L軰 u HD$Ht$H<$ z HbHW, H W H W INHH W IN HI^(U Iu H, H5; H8 1 LYHDtE1L\$H)O< HQH$ 1I9~7 IIM A8tgHHĘ HHL[]A\A]A^A_$ H ME1H1H1HD$L9,$|,G:4/t8CL/LHuIIHH)HL$E H HT$1K ,I9~8 HHT$t;HTHD$H9~H$L)H= 3CL/LHtHD$IvEu@HI9t?M`L)MAt0I)HHHL# H HT$L Hl$ H HHLA HHL HM, H5: H8 1. 1u H, HRH5: H81D 1`u Hٵ, HѾ H: H81G v H v G` W AG` W A D$AG1 A AG` oW A P1 A H AG` :W A H AG` W A yyB Hu(1Z 1҃S G` V C` - 2B Ht C` Dc랋 1҃ uoP =p tiH Ht:} H Ht(H HHtHH5 ! u6 DcA 1u C` V {` tH1Hq HHt 7 EA Ht C` LFc I/Au v H, H5 9 H8N 1v HH+ H5D H= 1 Ht$蹴 H|$m H, H t HPHqH Hu Hv HHֳ, H58 HD$H: HD$Hþl H=8 1w H{H/Hw `w Hѯ, H58 H8j 1 H, H5 9 H8M H, H58 H85 H, H59 H8 1 Hg, H59 H8 1 H, H59 H8 H$H H ,F HHt#HHү, H5[ H81y@ H! 1w I~ uAE PAU w v LE HHtHHy, H5G H81 @ Hȩ 륹 HH== = P [1]A\H2 HH H AG` $S A A D$1AGU A AG` R A A AG` R R AG` R A` A 뒍P1 G` R H AG` vR A MHH( H5tA H= H01[H蜱 V Hމ耔 = H 1kHD$ d= H C` E1䉃 C` Q {` H x3HSIcƃ{` HDhD` pG` {Q C` SHi aH-, H5^6 H81= 1Z[]G` Q kB V= P1- E H=, 1P H, H5 H8 Hl$H\$ Ht$(E1HHH|$p H|$tHD$ H@ u1 HH& H5? H= H(1[]A\A]A^A_H裯 D{ A@t HSHHT$HT$H9 AM$IcHI,IHP |$ 0 DD$DL{0D$|$ HSHHT$LD$WHT$LD$H9 AIcHI,IHu HЮ A t(H{0Hp8I$J|( H{HR HH uAI$IcHH,IHZ D{ ; |$ u:H{HHLD$LD$tAIcHI,IH L1, HHa, H53 HD$H:E HD$HI~@Ht IF8IvPILA HH tm1[H]A\A]A^HrHHV HHtI~@H IF8IvPILA HH輨 1H+uHCHP0HHLt I~@HHwIF8IvPIHHH A L\ IHm <HEH1P0-HU IMMHL HhHU LIMMHt I~@HHBIF8IvPIHHHtGA Lҧ Hm HEH1P0A L1N A L19 Hէ, H5&2 H8n 1 H, H512 H8Q H, H5A2 H89 1 HsH4փ~ uH6LcJtH 7 H 1Z1 Ht 1: 1 Hr 1H K H? 1 H9, H51 H8 1H q H, L H1 H81; t HPHu, H5v H81 8 Lġ xL跡 kIE t.IE 3 Lj H, H5 H8 0Hx, H5 H8 K 1 G H , H521 H8 1 H, H5e1 H8 Hԥ, H5%1 H8m Z[]J 1 H [5 Hu, H=^ I<$Hhu 1I$Y[]A\A]A^A_鞠 { Yu H, H5 H8 H腩 t{ >t Hn -t n5 Ht A[, H= []A\A]A^A_} @ HE LmHLe(HHHLu8HHH9 HsHIMtM9tL 1Hu8Hu0LL7 HHtQ} HEH@M9d M9uHE8H]0H]1H7 H}( y H H9 H Z[]A\A]A^A_HE@ t@ EHt IHtLEE1HHL9LN11q ZH, HH W H W I$讞 H IHQHx(HE@Hu(H9HNH I<$M,$h [L$ H}(Lu6 H1HE(BL H]@L HE(H]@M9tH]1H " HE81HH]0H] HHC, H54. HD$H:' HD$HH襝 H\$8HB H|$0Ht耝 H|$`v H|$pl HĈ H[]A\A]A^A_þU L G H|$`Ht 1HT$`' 1H$, H5- H81[3 N !2 H@ H, H5 H8R % H՜ 1r H, H5- H8( 1 Hr, H5- H8 DF 1 1 Hw, H5- H8 AW<Aw8L H踙 HL$H1V HH5} ZH+, H:u,H5j AG<Aw8LP^ 뫁 @ ! HH5f- 1?2 AG<Aw8LP- w1H H=p H fHnfH:"C! fo $foT$ S! 1Ð g! 1H{ Hqq H fHnfH:"C=! G` H., G` AHH, H01, E1HEhLupfLMpL}`H=s H v E`H$1+ Le1H=l r+ I$ 辨 1H[+ 1H=W M+ I$ 虨 1H6+ 1H=B (+ I$ t 1H+ A$ 1H=' * A$ 1H=" * A$ 1H= * A$ 1H= * A$p 1H= * A$l 1H= * 1H=! * I$ L% ħ 1Ha* LI LL% IL1L MthLH= 1|L c1H|$t H n H- D$p fHnfH:"HD$D$xfo|$pfo$ 8p' H= 1) 1H L H5 H螙 H5~ LI1K MtLH=U 1K H=H 1t) 1HK H5F HK H57 LI1K MtLH= 1K H= 1!) 1HgK H5 H H5 LI1DK MtLH= 1.K H= 1( 1HK H5p H襘 H5a LI1J MtLH=\ 1J H=O 1{( 1HJ H5W HR H5H LI1J MtLH= 1J H= 1(( 1HnJ H5 H H5 LI1KJ MtLH= 15J H= 1' H1J H= 诗 IHtH@ H$LLH脈 H( 1H|$T H" D$P HD$XHT$`fo|$Pfot$`)|$p)$ HD$xHD$D$p fo|$pH$ fo$ 8p$ H= 11' MeI9~MIEH= H41H5I L< ? H' =H, H5,* H8 H= 1& Hp, H HH0 ɋ H H5 1H|$t HD$Ht$xD$p H$ fo|$pfo$ 8p# Hh H= 1& H=l HHtrIȡ HD$ 谮 H|$ IC Mt4L1L LA& E7H=U 1% H H=* 1% f Hǖ H= 1y% K L̔ LĔ L輔 H i H D$0 fHnfH:"HD$D$8fo|$0fot$@8p" ~50) H|$T H( D$P fH:"t$Xfo|$P)t$fot$`)|$0)t$@fot$1D$0 D$HHD$t$8fo|$0fot$@8p[" H{ 1H|$t Hh D$p HD$xHD$H$ fo|$pfo$ 8p " L蟓 L蒓 A fo|$1D$P t$h|$Xfot$Pfo|$`)t$0)|$@H% LH$H9! HC(@ u! } c! H5' H= 1E I! H\$D ~) H{ H& fH:"C ! HD$fo|$08fo|$@x! H H0& H5g H$ HQ% {Hm% oH% cH$ WH$ K H\$1 ~) H{ H fH:"C[ H\$1 ~) H{ H fH:"C$ H|$P7 |1H|$t H$ HF" H, % H=% HHb w 1H|$t H H D$p fHnfH:"HD$D$xfo|$p8fo$ xr 1G` : P =p u C` : {` H H H1t IHtzD sH{A@ h HA@Ht3B DJ D1I|$s ELP HXYHtr H[]A\A]A^à ! H۴ x*HSHcŃ{` HDhDp 1҃C` $ H C` tH, H5y% H81% 1[]A\A]A^AIcG 1E11? G` (9 L C` 9 a! LE1 H! Lp C` 8 &! E1! C` E18 E1 L%H, I$G- L%7, I$, L%&, I$$ L%, I$Z$ H苎 1k0 L%, I$. ϫ 2 H, HVH5$ H81$ e HPHғ, H5$ H81y$ e H=}` E H5 H=j` W HH[@ HHt+HCK@IS<s8HGDCD Ht HCCg 1[]A\A]A^L讍 E11 2 ;i A M9 K HDLD$ v HT$HD$ v 9$uxLD$IH[Hi HmHh DD$H $< H $DD$t-{ /h HDD$H $ H $DD$ h h h 1h E111.m E111k E111m E111 q E111 m AIc|k AIcm AIcjp H, H52# H8 1j IcI|Hd HHOi tAIc_s AIcqn E111lj AIco HHt i AIc^k AIck AIcZq E111%m E111 i IcI|HtKHHh 8AIcs IcI|Ht+HHh AIcYs AIc}s AIcAs AIch AIck AIc!l AIc r AIco AIcWp AIcRl AIcp E111/m 1E11ym AIcim AIc i AIc#q AIcm E111m E111j AIcj AIco IcI|HtHHjg AIcIU q IcI|Ht+HH2 AIceq AIcr AIcMq E111Dq AIc n AIc q 111Gy Hc8y 111kz 111z Mw8 鷄 魄 s Hcw 111~w 1驁 AIct HcB{ Hcy AIc?u 111z 111.y Hcz Hcy LLL$.u L$ | w AIct Hcv Hcy E111ft L$(L9t$ LL襚 L$(IvAč@Ѓ I~E1Dl$8IH|$(IHDà w^k L$< L9t$tDLLIL AHD$(I9t L$<AD$D$G>H|$HLl$G鷂 L$駀 L$鞀 AHLDl$8x IE1m L$w LLL$( L$z H , H5 H8) 1 q ABH3q R} IwH} IwH} Aj1A: L@l HXHH[]A\A]A^A_ 2 AJ AA I h} H, LHHX HpV _ LH I} L 1} L L$q Hr E111v 1y HT$Ht$H|$ H|$Ht$HT$g 1鐂 H蚏 I,$ Hn K H*, DH8AG߃]w|1H5 I,$ ҉ LE1* HH, H8O L Ln Ht@LHHD$hY H|$hI܅ 1H5^ I,$[ 雄 M ID$LP0H螅 { H衎 HSHs& IH E1' H#, H5T H8輺 ) H? - Hs, LH5Y H81o Hۉ, H5 H8t 1* 1+ 1* Hc+ 1 * 111-* 1* AIc) Hc * AIc* Hd, H5 H8 韎 It$0ő It$H黑 ID$H Ml$0 Ml$0 Ml$H̏ Ml$H HWH H, H5 H8蓹 5 HW0 I HΈ, H5 H8g ID$H ID$HP ID$Hs ID$0l ID$0_ It$0\ It$HR Hm, H5 H8 騍 ID$0 ID$H鐌 HH ID$H鉐 ID$Hӏ H!, H5 H8躸 \ ID$H齏 ID$H ID$HJ 6* HWH0 HH0 HW0 AIcp* 1m* 1* HWH* HW0* 1* Hs H;E1E1LHW O HHL$赋 HL$tH/ H[]A\A]A^à EA HH t Eø ø H4 1S+ E111+ AIc+ HGH HG0 HGH H, H5 H8G 1a HGH+ HGH HGH L鐖 HGH; HG0 HG0) HS, H5D H8 HGHm HGH * HX 16, HHt$Ht$H<$H4 Ht$H<$HHCH H9 ̖ HBpH , HRH9HtHx uH5F 1/ ޖ H5< 1 ˖ H, H5 H8! 1ݖ Hk, H5 H8 HS, H5 H8 HH= []A\A]F HpHH1[H= ]A\A]e1 HHH҅, HHP H01& HN P H$H$H9EP - H ٘ 鰘 P 0 , HA, H5 H8* H@ Hz 1^, H Hc H, DH5 H81 H> H4 ) LI 9 LDH= 10 I龙 L%, H, DH5 H81V L~s Hm0高 Hi, H5 H8J E1S It$Hi Ӈ tE Lm - H~ 1}- L~ HCHpX HXHH[]A\A]A^A_ H&, H5 H8迳 H DHH v H~ 1- H~ 1H IHtHuH= 1 / H- + [H]1H= A\. KHQ- KHQ" KHQ E111ű KHQ KHQ KHQ E111[ KHQӨ KHQȨ KHQ齨 KHQ鲨 KHQ駨 KHQ霨 KHQ鑨 CHP1遨 E111釰 KHQj KHQ_ KHQT KHQI HKH{(H9y߭ H5 H IT$HEH, H81 }<EDM@u8WH;D@螻 CHP1ݧ CHP1Ч KHQŧ KHQ麧 KHQ鯧 KHQ餧 KHQ陧 H5 tIH, LH81N }<EDM@u8WH;D@ CHP1R CHP1E H5r uH5 H HE땋KHQ KHQ KHQ KHQ KHQ KHQ KHQ֦ KHQ˦ KHQ KHQ鵦 KHQ骦 KHQ韦 KHQ锦 KHQ鉦 KHQ~ KHQs KHQh KHQ] KHQR 1HcI;$8 ItH誥 ًKHQ KHQ KHQ KHQ KHQ KHQ KHQܥ KHQѥ KHQƥ KHQ黥 KHQ鰥 KHQ饥 KHQ隥 KHQ鏥 HD~, H5 H8m CHP1l IcHItФ tBAIc IcHIt谤 t-AIc8 KHQ! KHQ KHQ KHQ 11I9$ HcHItV HcKHQǤ CHP1麤 KHQ鯤 KHQ餤 KHQ除 H5. tIH, LH81N }<EDM@u8WH;D@ CHP1R CHP1E H5 uH5$ H HE땋KHQ KHQ KHQ KHQ KHQ KHQ KHQ֣ KHQˣ KHQ KHQ鵣 1( H=V v < Ht1U H, H5 H81H ߃kHCHCH1鋳 CHH |, H5 H84 CHAIcƴ AYHH[]A\A]A^A_ E111 Hu , Hl~, H5 H81 E,U$M(u H;D@x QkHHH+~, LH5! H81o AD$,AT$$AL$(At$ H;D@, kHkHkHAD$,EL$$LHED$ HK PAD$(P AYAZ2 kHtM H}, H5 H81 AD$,AT$$AL$(At$ H;D@艵 kH^AD$,EL$$LHED$ HK PAD$(PF A_Zu kH$AL$$AT$ LHEL$,ED$( u kHAD$,EL$$LLED$ HPAD$(P A\A]鑹 H=ܴ Lu Lu 1鼺 H||, LH5B H81 D$xT$L$pt$D@HD$H8| HBu 릨 H)|, LH5 H81m D$xT$L$pt$D@HD$H8) Z1% } u{ H} x λ HFHǽ Lt E1Z Lt HV0Ž HVH鼽 t _ = IT$H! IT$H f_ tQtV ż tw E@ t 郼 y 9Bj Hc}, H5 H8D HHn 1$ L % H=' ǽ GHٽ HL2 HL$' HH& L-|, S& L-|, MD& IG {& HPHx, H5g H81e 1M' & HPHx, H5k 1H817 1& HO{, H5 1H86 H Hx ) D$X& 11& HD$HH1HD$0_( H=U ͤ E1) H=< 贤 $ D$<' H$HT$ LLT$H|$HHv LT$I:Ht r Im) H|$HLD$L$ L$ LD$HtSM9|=HcI6) HuSM9|Hc1I ( LT$@1I7z( I( AыT$(HL$ LT$@)HLDH$H %; HPHt0Hv, H5 L$H81 L$E1M( H H K| ' H $AH5 HQ H HDL D9$ LNHQH : Ht#UH5 PHcv, H81 AZA[@HH уmH1( H0 ( mHFDH PF@PH<y, DN<DF8HH Y^( mHH8 ;( mHH" .( mHyH t0L HH / HLm /H dy, H_q HExHtLH/ $u%A D9k HEH$HPƀD < 11L HH| AH$HD9 |uAt H>t, H5w H8藤 1Ż H!t, H5/ H8z : L[HCHt/HHC1HCAAE1IkLn 뜾; LHCHtHHCD9 DND9DND{$Ds( ;wHH| H`s, H5 H81 HCs, DH5_ H81u H!s, H5 H8z Hs, H51 H8_ Hr, H $H5/ H81 AuHBEH$z$Hr, H5 H8 d& oH& Kh& 1' H袮 AG` A D$AG1^( A A P1M( G` ]' HJ AG` A AG` A A AG` u N' HT 1) HE HW HPH0r, H5 H81 Hl HPHwq, H5H H81 1 *( HH= []A\A]y2 HAu N & H , HH[]A\A] Hu ֻ HHH~q, HHl H01 H < ;H$H$H9EP 鹺 IEHH)* AEHAEHq+ thIEHH 4) HcLL$ HtHT$C HT$L$ tHc) AmH AmHAmHL k Lf+ 1( AmHAmHIH' 1) Hj q* Hrp, H5 H8; HR n Ht* Ho, H5] H8 H<$j HMHK?H& H<$ij H $A-HHD$HH Hk A LD1A0AT7HuH H<$ j Hn, DH5 H81> _ A D1A0AfATyHuIHp HH0N HHHE HPHH\$1HC LH<I1A H$DTHD$H9 D1A0AATHuI$HH@H\ H $fA- HH2 H|$ J @@HPHfHP0]HMH@lHM0cu HUHJ<IHUH@tHU01H HIHkHD1H0DA wH $HHD$H|$( uH $HH HA- HHg H|$ HEH H= } Hl, H5 H81Y zH<$g lHEH颼 H<$g U8 UHD$XHD$XH9CPk H|$q 1J( P H= ZHD$H@HHD$H c 11E1HD$T H-p, A H H HD$H~% H|$>p HD$ LH@ @ E HD$HHHD$H LLL$ t$T$o T$t$ILL$ tAE I} @ Ho, H50 H8Л H@H MWH/ HPHk, H5 H81x L% HHT$LT HT$u*1 L% 1ҹ HLs= z HHH?H] g 1HxR LT$L\$D HT$8Ht$HH|$@LT$HT$H4$I<蹶HL$H9 $u R w 1HuID)I HQ1HD IHt HLHH Le z H1I)H2I _ A ILHLH I= Hm C U AAAAAAEE9 H[H HmH 1 u A Ak 5 1q H@m HC ` HPHi, H5 H81E V Q mH1$ mHHS% HJ% 1P& HBh, H5 1H8 +& Hܤ H]h, H5" H8 1& * H= 赕 LNc H葬 4 H聬 H@H HHq LHLK H߅ b Hb Lb H= % 1 Hb 1E1|$LLD$(w Hb H|$b ^ Lb H|$ b 11HD$T$L` lb Hdb L\b LTb HGb H6i, HH5l H81z HH Lb H|$ b 1ɉL$L Ha Ha LL4$a La Ha Ha Ha Ha La 7Ha Hwh, HH5 H81 HH+ HLh, H5 H81 HH L+a H|$ !a 1t$L0 H|$ a 1ɉL$L LL4$` L` LL4$` HWHo$ HO0& HOH& I$ t@H艏 HHx - L W & H=; ˒ M La = ID$xHtHH8 u H= 舒 p Hg, H9Cf 2 Ax/tMPI@& 18' ML1& H4' 18' HtH9tHX' ML1~& IIs& E& @/tuA.t.. . H& H9& x/tHH9uHL9tH8/tL9t x/tHL9t-0.tA/ /t+DHH5& x.u x/uH55# HAH1HA/ 1 Hd, HRH5 H81" 1' L讫 t=HkH?f, H9 H t?Ho HH LLb u H=" 貐 H_ HExHtHHDD$ HL$H|$1g H|$HL$DD$ tfHGH9 HH Hø HH HWHHL$ < Hy Hp H HHHV HWH붃f' HGH HPHHHH Hd, H5 H8ʒ 1 Hf, HHkPH s HPHHT$Ht$H|$,f H|$Ht$HT$tHOH9HHNH H9 Hqd, H9Gi H|$e H|$[HH H\ HuH{L[]A\ HGHHx} tH}HH]H Ha, H5 H8豑 1' H1p J| k' H'a, H5 H8耑 Ha, H50 H8h I1L9} H| H 1HT$& H Mt o yH{d, H W H W HH W ' C@ w' HCC@ HCH=, O 1/ LLG H`, H H HO< H( 1( 1( H_, H5k H8s Ht 1' L H At 1HY_, H5* H82 ߃[]A\A]A^ø ( LHϖ( LH迖( L}Z H1sZ * HfZ ") HTZ Ha, H5 H8讏 ( H1Z H詧( H1Z ) HH| HH_, H5 H819 HY T HTE1* ' HPHL_, H5u H81 1 HuH1 HL ܣ * H t@Ht$LD, ' HHtNL9d$s/LHL艖H D$r* 胣 _* H k G* [ 7* Hw* 1}* DD$ HL$HT$H4$4 H4$HT$HL$DD$ dd, * A HDD$ HL$HT$H4$DD$ H4$HT$HL$HHxEtY H4$HT$HL$DD$ HHt+LOE1L9t]B`AAIIE1{H([]A\A]DD$ HL$HT$H4$o DD$ HL$HT$H4$HAA 1H>Et D#AvHL$H$Et/v H$HL$HtL*Ht HE Hj觘 HL$H$HHD$(^ HHtnI EIFJHD$(IH LHL$H L$ugHL$W L$0 HLHD$0 HT$0u!HV MD4$LV E1 HLt$D4$V LT$HV L$LHL$ L$uSHL$xV L$ D4$IL`V H\$LL$H)H<V L$HHc `H)V L$HT$LH)H< HHtH HEH IFHIg E1O HHHD$( HL$(u HU HHl$D4$U LT$;11 HL$U L$LU E1b LL\$L$y^ L$L\$ A@ AS M{AAAE߉\$IXA9 L9 I{HH|$ ILLD$L $] L $LD$ E1 HD$H|$LL$H)H L$HIRH1H$H$m H L $I9INHxH q E1L $I1M L\$(HD4$MM9 HD$HT$ LHH)H<(H|$0c HH H|$0HHD$ HH I IFJ HX, H5 H8+ HwX, H5y H8 E1 HD$ ( IHtL $E1D4$1M1ALL\$M9 I HT$F:,2 IM9uML\$(D4$MuMH Z, I9[{ H|$LL$H)H L$HH IBJ IMj H|$LL$H)Hĕ L$HH I ~LHL$ L$b HL$R L$L\$D4$IHu HY, I9StL9~BIZ= HEI LLH<H)4 HHtKH YHEH pH|$LL$H)H L$HHt H IBH,HD4$ILQ -HHHD$( HL$(u.HQ IFHI6IBIA LHHl$D4$uQ LT$LHL$ L$uHL$KQ L$[H:Q L$WH)Q L$L Q xMD4$HLHD$0/ HT$0uHP HD$IHHLt$D4$P LT$ q HL9d D MsH L $I9INHx H1Ld$1IIHD$H9 M9 C< HZ, <8 IHL$A$P L$LP sLL$$P L$LO " If LHL$ L$uVHL$O L$p MM9~0LMA< HZ, <8 HI9uMIZd HiO L$]t&Il$I9~0A<wtHY, <8 u9HMN MuI9uH$HV, H9P HK<L) IHteH IGL$ t 9LI<L$$H) L$HHtH !IBH,HML~N LHL$ L$uHL$VN L$HHN L$H IIGMHLHLM uLN HILL<$M L$j@MsHDMs0;Ms uoMkH L $I9INHx H1Ld$1IIHD$H9t}M9 CDe f H W, < IЀ@MkHtMk0HL$GM L$ IxHH|$ HQ, H5 H8节 uMM9~+LMADm fwpHlW, < toHI9uMIZ tGIl$I9 ADm f H *W, < H *M uHLL$$HH)I| 5 L$HHteH IBH,H\MuI9uH$HS, H9PtNK$HL)I| IHtH rIGL$MLK /H IIGMHLLHL$ L$u8HL$K L$HHL u%LxK HIHdK L$gLL<$OK L$R^ I F I LH,$Dt$0K L$uMkH MkHuMkH L $I9INHx H1Ld$1IIHD$H9+ M9e CD% H U, < H IL\$D4$IHtNI9|@H|$LL$H)HH L$HH H IBH,HIZ HQ, I9SuHEI LHN, H5¾ H8Y E1 1 HT$LH)HH< HHN H HEH IFHI MM9}1LMAD- X HS, < W HL9uMIZ1 LHL$_ L$u^HL$I L$ HLHD$02 HT$0u HH HLt$D4$H LT$LH HH L$H|$LL$H)HHq L$HH HHHD$( HL$(u!HnH D4$ILZH lHHl$D4$DH LT$t+Il$L9};AD- H R, < u?HM uMuL9uH$HqO, H9P HK|% L)NJ IHtfH IFL$ LHL$ L$uHL$G L$QHtG L$ EMLNG uH IIFMHLHLT u[LG HIS$ LI|- L$$H) L$HHtH &IBH,H~LL4$F L$ZLHL$ L$uHL$F L$HF L$ HD$ Hu}H1IL94$ A |$ H|$ubj HD$ HtL0HD$(Ht H H 111H<$ L$<Ht$ E1x E HHy H7N, H5 H8 { HC3 H=V H ^ W ME1LHH=S 1a Hx H= w 1m H= b9 H{H) H|$t# H H98 H|$HtD 1 Hu H98 o H|$HCH HtD HD r H 1 H H H LsD H H HPD LHD E1HLK0 L/D H ILK` LLL$L$US L$LL$HkM, HH, LH0[ HChH H C 1H 3 H98 . HHtHxH tYH|$HL$HT$ Ht$(LD$H| u)LL$LD$Ht$HHL$ HT$( H|$%C 8 H H I, H5, H8ix IO B H HD$HtH L x HD$HtH L EtD#Aw H HD$HtH0HD$Ht H=. H8Lt3 脃 L:B E1! E1! L"B HuHHt$~ HCHHD$ LA HF, H5 H8Tw LA HJ, HE Il$H W H W IL$ HH W IL$( HA H 1Hd LIE xA I} L> 1LIE IA 4 H=M s 1HC`+A $ HJ, H5h H8v HE$ H=$ =L, t @ 1 |$載|$$ tHME, H8 ($ _$ |$|$ tt u19L, 1 |$U|$$ 뛸PT h$ 1 |$-|$# l=$ UH1H5H SH HT$5 u1YH|$H HHtHt$H / u!D$( u It H G, H "G, H HHĨ H[]P H=} q HZH#E, H5# H8t ($ H= q $ HtHH1[$ HD, H5 H8t ]. HC, LH5x H81j =. HC, LH5X H81J . HC, LH58 H81* - HC, LH5 H81 - HvC, LH5 H81 - HVC, LH5ؼ H81 - H6C, LH5 H81 }- HC, LH5 H81 ]- HB, LH5x H81j =- HB, LH5X H81J - HB, LH58 H81* , HB, LH5 H81 , HvB, LH5 H81 , HVB, LH5ػ H81 , H6B, LH5 H81 }, HB, LH5 H81 ], HA, LH5x H81j =, HA, LH5X H81J , HA, LH58 H81* + HA, LH5 H81 + HvA, LH5 H81 + HVA, LH5غ H81 + H6A, LH5 H81 }+ HA, LH5 H81 ]+ H@, LH5x H81j =+ H@, LH5X H81J + H@, LH58 H81* * H@, LH5 H81 * Hv@, LH5 H81 * HV@, LH5ع H81 * H6@, LH5 H81 }* H@, LH5 H81 ]* H?, LH5x H81j =* H?, LH5X H81J * H?, LH58 H81* ) H?, LH5 H81 ) Hv?, LH5 H81 ) HCHN?, LH5и H81 ) HtH ?, H; uwHC, H8 a) H>, LH5| H81n A) H>, LH5\ H81N !) H>, LH5< H81. ) H;LH59 1 ( H>, LH5 H81 ( Ha>, LH5 H81 ( HA>, LH5÷ H81 ( H!>, LH5 H81 h( 蛃 ( H=Qx qk 1 H=9x Yk 1 L8 H|$8 1HL$! H=x #k 1i L8 L8 H|$8 L8 HB, H8 \( HK=, HH5Ͷ H81 <( 1 H=w E1j HI8 _ H-( H<, HH5 H81k ( HCH5M H8# ( IEHMLH5 L@Hv=, H81$ Z1[]A\A]HS=, H Y T$ HuH{HV []A\ L7 B L7 5 * + Hc7 HHL0HHT0ozyozy$ 1A LIx LIl I# E1 I I I I0 1 v H=G i ( H><, H5> H8l 1 S H>' ( ) H) H+;, LH5 H81 W+ M+ C+ HT$0Ht$(S 0 L6 L6 6 H|$5 HT$0Ht$(NS I}` uHU>, H LH0k H IHtHHH5ԯ v LA5 E- fH>, H5Z HG . CH+>, HOH@ H@H HGHrfHnH HfH:"GHJH=hg? H / HPg? H1 Ht$1 1I} H! AE fHnH fH:"AE2 H 9, H8 t } L4 1M 9 + H<, H5 H8i Ѐ{K I U HGH;:, t-H;=, H5 H[ HEH9, H8i v H5 H HGH;:, tpH;=, H5 H HEH8, H8Ai ' H=<, H H59 H81# H{0H CKLđ 1I} H5 H{0H CKL藑 Me H<, IE H w 1 2 12 W HE I. IFLP0 I}` u.IFI B Hy8, H LH0h L2 HS8, HR LH0h H 8, H5 H8 Hp8, H LH0Fh @ I}` 5 H;, HHH{ @ H] H$H9twH:, HHЖ xK IH H@ U H7, H LH0g H:, HHH{ Ǽ HuI}` H 7, H5t H8 s HU:, HHp ~ IH H H@ H :, HH(s W p A~ IN1A. L致 HH;H 1L覶 HHLI0 4 I}` I}` H6, H0 LH0f { H-6, H\ LH0cf L 1H LT$ L LT$ \ I.% IFLP0 I. Hm HEHP0 H44, Hm LH0e &7 LT$HO:, H=x H`1LT$=;, A9e 1LHS LH/ Hn H{ g H=e 1HH HIe/ MG LLa HH5 H$) H3, Hp LH0e )8 B E H3, Hk LH0d IF1LL)H膴 HHtIHLӊ HH$. H$Hk I}` u H4, HH LH01腢 1? H?3, H LH0Ed ? Lh7 "|A1Ҿ. L許 HH\HtdI H H,2, H- LH0c H~3, H3 LH0c H[3, Hټ H5 H81 H #- 1- H-4, - ( EHEH1- 1 L| x 1HC0A- H[ؕ 1HHS@*- H{HX a 1CKH{PH 2 * xS H5, HKHH@ H@H HCHrfHnH HfH:"CHJ [1Hs@, I L{H HSHA 5 t C Hk@j Z1[]A\A]A^A_HH|$E5 tH|$G @t H- 1HH5 H. H H+\ L t]" A H O 1H $ HUE1A Hdh LII~ HUHH>h HULH*h , L- 1 H{H- H{H- HoHQ- HoHH- H/ - U LS 1. - H0, HRH5~ H81L 1 z HSHHg {K H3, H@ H Hz T IH HH LH* H H|* 藿 HtH 腿 Hm H ` I HT$Ht$H|$ LHV HHte* HT$Ht$H|$H []A\ H-Y0, HtHd LC(Hu 1 H n H= TGH1 H-0, H} 貾 HuI|$. uDI|$. b. b. X. N. D. :. 0. &. . . . - I|$- u]I|$ u- - - I|$Y- . Mt$Mt2E11I9~(IcIDHx/- u_AIcݸ - I|$- u*I|$ - u&I|$, Q- Q- G- =- 3- HUH;., t:H;1, H H HEH( Hu0, HH8b] 1y. H HF HuWHxLL[]A\A]A^A_@ HxLH5 1[]A\A]A^A_ Hx@ HH I8 H8 t IH4 I8 HH I8 HH I8 IH HL7 IG8MF Hپ LHPpLj1҉ LLhp7P IFHt H8 IVH L4$1ME1IHHH9 IcLHtQ tVAIcIcLHt4 t9AIc0 H|$@Z& B HsL Q L跆 1 H(& H & HxL1[H5= ]A\A]A^A_ h H~31H5 Ll H@H H8 | IvLA H% `IG8H5 L 1k 1 IG8H5 L 1C 1 HH*, H5 H81 H+*, HE H5 H81[ I~ 1 HxLH5 1[]A\A]A^A_ HvL ) H$ sHxLH5 1[]A\A]A^A_{ H$ G1 LL O 5 1LL6 5 ( L;$ LL L IG8IV hxHtHL4$1ME1IHHH;}!IcLHt AIcHLML4$HL?> pIG8E1fvLHPpHZLHXpD 24 3# LK E11Hھ LL Mn Mt<11I9E ~2HcLIt HcHLML4$IG81Ҿw Lhx IG8E1LHPpLbL`pD 2 sIG8E1HPpHjHhpD l H=U? H Hj~ ) T? * HJ), HHH5 H81苸 }$E,M(u WH;D@Pa 1* L H5 HHP1h Lc IT$HRH " LLh蕁 H5f HHPL1^h tDLc! H}8 IHt*HCI- 1* M. N/ Le! 1 ~tVH(H5 1[]A\A]A^A_, L4! H,! H+&, H5 H81b 1% Lc H(H5 1[]A\A]A^A_ H(HH5 1[]A\A]A^A_ E1 HM* L DH%, DH5 H81 $E1;" HcHIta Hc / H(H5 1[]A\A]A^A_2 H(HH5 1[]A\A]A^A_ H(HH5t 1[]A\A]A^A_ y& ]& LLHHH)b uE* H g* MH* @H$, H H5 H81ֵ LI H5 HHP1f t 1" 1" 1" X[]SH1H5O HHT$ 1t:H|$A1Ҿ/ H_Ho H|$HyHH HpH葤 H[HL#, H8- y' 1' HH;.(, ' H' HkxA H{x' Hkx' HE8AoGHH5 I 1V q- 1( Du]H5 H:%, D}m H8S I<$SDEDDM] L 1&) H Hw&, H5 H8`S 1) t H HPHd#, H5M H81 1HH|$& H|$tHHZ- 1S* 1H $) H#, HRH5` H81足 1%* HH=l4 P * * H5 L1 1. H=L\ lO . Ae . Lx01IG - H=\ 0O V/ L H H5o L1裼 E1X. H%, H5 H8R 1E* H57 H1k D* H57 H1P Z1Z1ZLI IH1 H=d[ N Q1 H$, H5 H8Q 1Z1* LJ fv1 H=[ :N 2 H+u HCHP0H1[]A\A]A^A_H+uHCHP0L H+uHCHP0HT , H5= H8P * H6 , H5O H8P H$, H5| H8P Ⱦ H=iZ M 3 H+u HCHP0H1[]A\A]A^H+uHCHP0L H+uHCHP0H* m H= M 13 L E1n4 L E1^4 L L * H* V LH)* E1* HZ 15 .{ HHt1HHڿ 1x HHD$' HD$5 H 15 HsH c!, H1H8 []A\A]A^A_&u + 1+ u HH+ HH+ tHWH@tHW0HWHI}8 IH I}8 IH Hs1HL+ tnHsLL+ tYLL3 tJIE81HsHPpLzL≸ LLxpE+ t IE81HPpLrLpp , 1!, Im+ W t@HGHt HG0HGHph PHO , H5 HRH81 1ZAH H|$H5 HDH1[]A\A]A^A_ _ H , H5 H8M 1W/ h [HVhHt?HGHH`Ht+H t!H` , H0 HHt H[y Hz( uH= HtHH={^ H\$ HT$= : HHH[]A\A]A^A_ HT$HH} : HT$= H= HHT$ x H} 2: Ha HT$}8 E1:; H]9 HT$t HT$< R H? ]/ H 1N/ HH- H߅t 0 H8[]A\A]A^A_ > H8 H=, []A\A]A^A_H H k= HD$ HD$HH1= N= Hv H81[]A\A]A^A_LI HA L7 12 1z2 1[2 H0LH: 1 H0LH: 1 14 H 1 5 Ht$8H|$( ) HH 5 H ' , <5 H , 1.5 H Hk , *5 1H p HtHHD$e HD$HHD$S HD$4 H{ AŅ[4 1t4 H6 tH+24 HH H5f H=j \5 IPHA 1L, HD$Pj j* H HH3 LaIHtH I5 15 H E1v5 H LbIQHA HLM- HL$Q1j jE* H HH7 cHT$H $U HHtMH $HT$HE 7 H# t.H6 HK6 HH5h H H= @4 6 UH1H5 SH HT$ u1PH|$1E HHtHt$H uD$(% = @ u H U, H , HT HHĨ H[]16 HH= 7 LHD$ڮ HD$7 M1LL HD$@HD$HD$PHD$(D7 H\$1Mt$ HLd$@ LL: uL- , M96 LH H5$ H= 2 Hl$6 Ht 16 Hl t&I,$`6 HHO H5 H= 2 16 H & HrHH $ u$1U7 HHH $ H $17 ܺ \ H H $7 H, H5m H8 G 1S7 SHH H <$ t$L$KH?, HH@ H H[HD$U HD$Y8 H;4, z8 IcU\H8 H, H5 H81i 9 E1LH L 8 ; HI98 8 H T, IHLw7 H^, H5 H8'F 7 ID$H5 HPH3, H81 8 H , H5 H8E n8 M7Hq, I9F&I;V 1H9 ILH5N, H9qHH', H5 H8E 8 IRA 1HL- HD$(Pj j% H HH5 7 HPH^, H5Ǿ H81 7 LaIIl$1LH5 H=b :E x*PE1E11AVLHLj j j j H0j6 T7 HHCH7 H|$H$ H\$H$C 7 H, H5O H8D H 8 HCH7 HH$ H\$H$67 7 HH$ HD$HH7 H$7 H7 H5 1鉮 I~Ht H 1~9 PH|, H5 H8C 1Z17 7 Lp ; 1i: LO : D$ = E= H5 H1ۭ Hcn 1> H E1x@AY= 1Ҿ H tH5', H$ t H > L 뜾2 H5 @> c L[ sHC8H HH= H9> H, H5g H8B 1> HLHT$Ht$HL$ HL$Ht$HT$47 H(1[]A\A]HHt$ tHHSHt$7 6 H tHSH3HB 6 HH5 H H=% , L-% HHl LH5 , `L-% HL <H3HF 6 PH, H8sA 1ZLiHL)HHH~ AL. HxHL0K EB EB HZHH\$PI HD$E11J HD$ H@H@ HHH)HHH DH' H HD0H#I 1E1HD$? |$4 tLxL 1H\$ < HD$ HxHuHxHH4 ? NB D$0 "7 H|$ D$<\$4D$4|$@ u7: |$4 tH|$PL HxHA D$D A @ H|$K HT$|$(DLD\$4DT$ I DT$ D\$4HI*D\$4IDMj LHt$ HT$ DT$0I AYAZHHD$XDT$ D\$4{F D$<A9 HT$Ht$PDD\$ |$<Ĵ HD$PHD$4 D\$ t$HLD\$(W E1D$< HD\$@D\$(HD$ D |$4 LJ H, H5y H8> D$<\$4D$4D$D ? H_ HE H: D$D `? HD$ H@HHD$H^B H|$OJ < M|$H$B Hy, H5 H8Z> pHD$ LpHD L$<Ht$LDD\$ 莳 D\$ HHD$c|$4 L$<|$(LHD\$ W D\$ HI D$<1D$4 t$<D$8D$@ ;A LDT$4D\$ zI AD$ D\$ DT$4 M|$HDt$<Ht$LDD\$ Dϲ HD$H|$(LDH诲 D\$ HI H|$I LD\$ H AD$ D\$ @ M|$0HD$ LpHB HT$Ht$PDD\$ |$<2 HD$PH 1D\$ D$4kt$HLD\$( HD$ H11D$4 D\$(L$<t$@B M|$H\M|$HRHxH C E= E= t$HLD\$(W D\$(HHD$ t<D$<E1D$4 DT$<D$8D$@ A M|$H@iM|$0_H|$G LG ,H[ HT$ H{8I H{8H$H MIMugHHT$ t]I,E HC81Ҿ| HH@P t1HC81E11HHPpLbL≰ L`p/ uh1: HFH; H8 ; H@8: HHu t18 HuH^ t2 H- iH$H t3 H- pH5, H, Y H DHb- /Hu H HEHtUH E1D|$(MMILHD$ H9\$ ~$HE1LLHt HLMMD|$(D$ AWHcHI;. |$p % |$p s |$pHt$H jT$ H߃Hc> KHC8E1۾HHPpLjLLhpD HC8H $E1Ҿ6 HHPphxHJHHpD , 7 AWD$xLHPLL$(LD$ 6 ZYI;.^Ht$HG T$ H߃Hch *p|$peHt$H PHt$H ;T$ H߃Hc Ht$H H59 H+ H= vR8 1;9 E G H$ HtW H$ HtE H$ Ht3 MuHD$0Hx []A\A]A^A_LOC H$ 1H\$0H|$PE1 HEE H@p Ax19} )AG E F 1oN IPI9bN HU TN L |Lt H , H5Ѓ H86 YAx19}uIPH9UyHU E dAx19}UIPH9UGHU E o 2IPH9U$HU E 1Ia pH H HDH, H5D H81 gS E1^C 19c Hk(HED9 H$ Ht^ H$ HtL H$ Ht: 1Ht$0٩ E1E1LD$0HɐfOkY H|$HDth rZ H|$hE1LT$`Ht 1HT$(\` H|$pHt 1HD$(U` b` H, H5 H85 E1LL$0]HD$(H@Ht)@t"A #B H$ HALJ A MALEIK H|$Lj@ H|$`@ H|$`HtE1HL$(_ 谨 L8@ 裨 H, DH5C H81! H|$pHr_ h_ Dd$0Aw C Ax19}IPH9UHU E p jMq o v 1[]A\H[Hv Ht H9v HHHH[]A\1AH <5 @5 1[]A\LՅ6 <9 L E1|: Z[]A\A]A^A_H H L H L H L Z[]A\A]A^A_ø[ 1O E1Ll$N H8HH5 1[]A\A]A^A_+ Hr H5 HH, H81g S ISH2T ISH)T <V $V HHl$T 艦 V H HH5ή 1[]A\髜 1V H 1*X HE8Z HE8Z Eu H$ X c u1X Hx tH5, HE tо H X 1b{ E[ HH I$@ H, H0H t<H L HuH~ , H5/ H81 H? HPH), H5ڭ H81Б Lx L%7, I$@ H , H0H% tH) I}%~ 1[ 1 PJ HZL 1 Hh+ H8x t/ 鰀 H , HC, Hs, H;+ H#, 1H=q [ HH= HT$ HT$[ 1\ 1ҹ HH= [ ?J H[HH \ Ht$H<$Ht$H<$HH \ HPpHHtHz uH= < H=|v . H 1O\ H% B\ H, H H '\ 1 tC l\ = H=G9 + 1\ S\ H. IHu趦 HE8H5 LL@Hu+ QDATLKxH81詏 LQ ^_1\ HE8H5E HHHLJLBp(Lp0H&+ H81d AXAY뿃]] H tKH' II H Hւ H t6H' HH H) xHExHtHIHHT$H $ xH $HT$HAxHtHHH tL/' II VHH$ BH$HBxHtLII tH& HH Lf IGxHtHHH taH& HH H tHu& IIǀ H HExHtHIH iHExHtHHHPH+ H5 H81q 1G\ H+ H H ,\ HL$H<$1 H<$HL$H/t+ . L94H+ HHh H $D$ T$H $L9}q l 1?\ 1\ HB+ H5 H8+ "^ 聋 H HI&] H + H5< H8+ ] I] LH(v H5w H= j ] L ] E1IL{u E1M] \ \ ] H{ Aąyn] H H+ H5R H8+ & L% + H|$ HtHH9y H9Uˌ ` 1 HHՍ HD$p8 H+ H5թ H8* 1^ W LGzy Hc 1@AT8 Q LAzy Hc? 1@AT8 :^ H+ H5i H8!* b LLT$ t@LT$L{E1IuVE1M 鿑 LHxt H5} H=+~ E13 IƑ H + H5d H8) H{i AŅy1] H5 L1 %^ 1J^ H5 L1ؓ H=~p Z{ HS+ H5L H84) E1 H}+ HH LH ̓ Hg AT$ɞ HC u HU t#H+ H5 H8V uUHC uHE r H+ H5 H8 O ˝ ] 1P M9 鱝 M9 飝 L E1^ L H D H= $ ZH ^ 1}_ PH+ H5 H8' 1Z1 HD$HX`Ht%1 HH+ H|$H1H0莏 Ϟ H*+ H|$LH0r 鳞 Hm u HEHP01鴞 1鴞 I,$uID$LP01O 1> E1E1 E1E1E1 I? A LMI HHL$H4$# H4$HL$HH` HH[H|$i 1a HtX D$t3H5 H { HDH+ H8& |$ Ra ǚ a HHD$ HD$X HA1Ob LHLv 鱣 LDg IUr H9t2HBxIEL La L LQ \ Lf tIUIHIEI;E & Lf ' IU MvHAm AE Lf f IUP H9tHB<IEF LVf 1 IUAE H 铢 AE H ~ Am AE l Le * IU Le IU Le IU AE H" Le IU I~H I~H L`e IU H9tNHBtIEk L+e IU L e e IU Ld IUAE 4 Am AE " H+ H5:x H8# AE HVH;V tIHBIES IF HVH;V tAHBIE0 F 鶠 L 렾 L?d IU뜾 L$d | IU뤾 L d O IU; P IUI;U HB?IEAE # IUI;U HB{IEHD$(1Hl$0HD$HD$ HL$ H$H4$HT$HLe Li H|$(蠝 H|$0L蓝 IUI;U N HB[IEInHN Am AE s Lc VIU@ Lb IUڣ H9t HBfIEAFL Lb tIUHl$01H̅ IU I;U HBsIEH|$0Ht$@La H菇 骞 L=b eIUO L b IU AE a 1: U La IULH1蚦 H9~WIFLH<H I;U t@HBIE?Am AE La IUɝ L\a tIUH\ IG ] Hy+ HL% HH{ HH H LEHtH+t)LHLL1腛 LLHH P] HCHP0Im X\ IUHD$LR0HD$?\ IELP0+] IGLP0!] Im uNLP0H IH=s E1 IH\ M\ I/\ IGLP0\ Ht IIm \ IELP0\ HCHP0\ ] H+HSH̦ H5 ^ H+ H5s H8 ^ HH5s H LH5s H~ H5s Hj LL1H=s Hw^ H5 ] ; tHN+ H8 ^ j B []A\L-+ L鼦 L- + 鰦 L5+ Ht˦ ا H9HHH9H]F HF` HM HL[ ]A\7HH|$3 H|$t HHH1C 1_ 1fHs(CHH^ Ht$_ Ht$HC H+CH9^ MhHө H[H $ E1 ILL9- i tHUHB`H 4 Ω H+ H5=r H8 ū _ P7 H=~% v Zþ H=h% ` Na Iܸ LH_ H*( 蕐 H Kb 1c 1d H(+ HH5q H81| e O H H+ H5 H8 H' 鶱 H+ H5O H8 HO ̱ H+ H5 H8 鱱 n Џ IL 1e e u x-I|$:f 1AX HH ITILg E1Mt$pfI\$`M|$pIl$h H=̝ AD$` LHHs L I|$e H; .g H=> H=> H=> H=> ٫ H=> HtH E1L > H=O> C if []A\d Fh []A\H+ H5#p H8M H" 1LiD$XH|$`HD$@ID$ )D$0fD$HD$hPHA 1Lu, HD$Pj jf H HHh Ld$01h H{HuH{舛 h Ht$ : tIuh I놩 s HL H\$Lc LkHLO'I9 1Le HuH Oi ~ h F(E1F9i H{ } U- L n H< LELEMuL HU H o Hu H 9 HARH5m PH+ H81y A[]H8 H|$Ht) 1h H o h K HEEu{H HGn HELMM HM Lִ H R H֛ PHV+ H81l| A\A]`H5 HD$Hg EH Ԛ H HE냅L H LEL kL LpH+ HH0d IHgH LI MI|$H HL g LEMtiHU H ij HtbH~+ H5 H81w `۴ H{Hϴ HH5] HH+ H81w Li $L H , HH>G 1I$ g H+ H5&I H8 H 1kg H{I [H5a ]HH+ A\H81:w % H{I LH5 HH]+ H81 w H 1鋬 Hm+ H52J H8 H! 1g t tS( LD$PLH< H+ t$H5k MHH81 ZYHHtH H, H+ H53H H8 H+ H5~k 1H8j g []A\霉 A$H+ Hk0H# HE g H+ Hh# Hh# g H~ g He+ H H5' H81u 17h IHL+h IL&g PH + HH5 H81u ZPH+ HH5 H81^u ZHJHPH5 H+ H817u \ HHt$ Ht$: 1H9t'AHA;Tt IIά M II9t-AA9t鵫 + 饫 II LFHY II+ 1I H9tA HA;LPt[ ҫ H+ H8e 1h HD$ HD$g P H= - 1ZH HC tmHz Ńtx1I$>i r HuH[+ H5̗ H8 i 觊 i m H+ H5Ǘ H8 L-+ Qh H+ H5h H8 H+ H5h H8 HH+ H5 HD$H:j HD$H蛆 Gi Hd+ H84 H==> 1H /> LD$H|$ H|$LD$H/uD$LD$q D$LD$" Lw Ho Lg MtLZ LR 3H+ H8HG t @tHT$H5 1mr 1F H MuH+ HT$H5ܖ H81:r ˾Z H= I( 鎭 H\$(Ht H H|+ HT$H5g H81q HHL$HT$Ht$ Ht$HT$HL$x>{ HHL$HT$Ht$^ _ Ht$HT$HL$N F L$ H[]A\A] qh 1Yh <h h H- MMH鮵 H% HHT$HDT$D\$ D\$DT$HH Lڰ ID$HHD$- HHT$K<MHDT$D\$ D\$DT$H阰 L鐰 H鐰 H~ H HHT$HDT$D\$[ D\$DT$HHD L< K<H/ HHT$IHA DT$D\$ D\$DT$HH L L H Hӯ HHt$Hg / HCHCg /vPHCNQ$g HHt$g Fs<g HFHD$~#Cg HD$8g V#g ߀*g HH|$ g H- Ef /vfHC몍P/Ff B<v4t0H|$DHf Hu1HD$)uHHD$f H Ff A7f H+ Hʓ LH0 g H+ HHɓ LH01 L I,$u ID$LP0H+u HCHP0H@g Hm 5g HEHP0&g HCHP0g ID$LP0f H+uHP0H=+ H LH0s HR0g @f H IHIHm u HEHP0Lf H+ HV LH0 H& 1i 18 L Ht$L Wj HH c H|j Ij HL$ H]&-j j k Hj ID$LHH k[ j j A j HY_ Lq Li La k LQ LI Mu.MuLH$/ L' L H<$ L L 1al H L E1V H|$蹦 H|$ H L L H|$XHt H|$PHt H|$HHt H|$@Hty H|$(m F H|$HD$hHD$hH9EP H|$09 IH, j1 H+ H L-ߒ 1ҹ HL苬 uJH1[]A\A]L- HHT$L{ HT$tHHH?H3 , LE1 A i Hu1f(H|$r" ک" 9 i H 肁 fA*f(X 7 LV * LE1F LE1 6 H|$X{ L E1)m H L HAPE1L$, 1HD$ Pj j H HHtSHk HD$ HD$k * Hl PE1L, 11HD$ Pj jd H HH?k HD$ HD$H l H|$X{ E1l DI Hk |$s D$Aƃt DH'%HH. HtY1 IHl A k HYH." )D$ E1fD$HHD$0HLT$PD$8D$XH|$Xfz |$H3H{. 5I$ tHC HH L ID$xHtHHH+ H`^ H5 R H81^h HSH<% " t$ DL$t7C y AV HDL$ tAV C DL$ H1[]A\A]A^A_Ë HHHH H9u. HSHpMnH K$1 HH9t HHHH H - H55+ L[ u6H+ IHHH5 H81Rg H 3 Pj ) HL+ Hپ H H81j u(HuHu,H=+ F HH H H H}(LW03 HKu 1 LWH HT$t$H|$` H|$t$HT$tG @ i H&+ H5, H8 HD$HHH)HRH9 IVL9AF IC AC @tqIK IS0LLL\$ L\$ IHtqL Hl$HYk HHT$IHH)LH@IF: IHk 'k HT$H|$ IHL [ H5)5 L\$虐 L\$L k ISH\LL\$( L\$(xAC (IKIS /Ht$ Ht$i xx wk Ht$ Ht$i HHT$IHH)LH@IF~ IHk Sj H? HH)I;j AF LLL\$( L\$(HIXRA Lv, HHT$R1j j H Hj j H+ H ~ H<$w H<$HHt 1HH 1 H|$ H|$H/ 1Q I9W 1 I9W " I;W H unH+-P+ Ln j H;Ht 1H > 1j Hx u=H+ j Hz uH+ rj L1g] ?j HB(Zj H+o(HP(j H{+ HRH5( H81 c 1 HPHT+ H5͉ H81b L j HL~ j 2 H=:o j IA08#8#H{H H{E1L|$HG HH=6L H5X H| H+ H55 H8t 1 HH=K H5qX HD H 1 HsH lu H 1 I H4+ H5@X H8 H ` H s H=Q+ H+ H5 H8 b HsHt%H{(HX []A\A]^ Lf H=+ HX[]A\A] H HH H L HP t1HZ+ HѾ HÈ H81ad H߅t r H!+ H5r H81` Hp M H5< H% H+ HHT$H_ ! H\$H HH! H߉D$ D$f HG t8HH|$ H|$H/= H;-^+ & 1փ WA H1LE, HD$Pj j H HH8i -H Ci HwI H5.V H=7V 1(i HPH+ H5X H81_ 1i L H_j HL$ H:2 H5U H=YB ` 1n L=+ A 2m H+ H5m2 H8A H+ HH5U H81_ L 1m H6+ HH5U H81^ ] H H;+ H5U Lt$xH8 HT$pHt$hH|$`+i 1LHl$xH I HT$pHt$hH|$`H HtH H MJL =Lt$xHL=+ Lt$xoHHG H5T H= A Hm+ HLt$xH5T H81] L=M+ !D$8 6j HL+ m H(+ H50 H8 Lg\ HLH+ H5V H8 ` j ]H+ H5 H8k BH+ H5( H8P 'H+ H55 H85 Il Hy+ H5>0 H8 HL$0H/ H5#S H=? yHT$HD$@ h H|$(H$HG Lt$xL HD$(H2H H;D$xH$m H+ H5/ H8u H+ H5 H8Z 1H+ H5w H8? Z Hm Hx+ H5A Lt$xH8 L=]+ 1HL$(H. H5wR H=> l1 H+ H /o H{| IH H}g IH HL;S LA L E Hu H{ S AŅ~vHu`H{` R AŅ~]H H R AŅ~>Hu(H{( R AŅ~%AZn Hd+ Un Lw 1Jn E0n p 7r nY H)r H+ SH5Q H81zZ r H H+ H5Q H8w q HHD H5P H=ʸ E q H-m n H+ HH5:Q H81Z q L H$+ H8L Eoq { lq HT$8Ht$0H|$(Md HŅ HT$8Ht$0H|$(1 7q LbIM|$VLA HL8, HL$HQ1j j H IHm !H+ H5, H8` H+ H5 H8E p C@u*Cn H+ H5P H8 o H m H+ A H-Sl HD$m W Hm xH+ HD$m A m H+ H5 H8 p 8 o H+ H8i p/q H}+ H8M q H+ H5O H8B Z1[][E hq P躚 1Z x 1 H n LbIQA L., HHL$Q1j jW H HHfq (r 1r C q YV HuIyq H# H=L _ 1hr PH+ H5N H8i 1ZHf+ H5N H8O s r xj hr H}+ H5 H8 U HuH+ HH5 H81V Hs PH6+ H5*N H8 1Z 8 Lt 1)t Z1[]A\A]A^A_Ht JU HHt H+ H0_ zt 2m Mt ID$H5 LHP13V Qt HH H HH*t 1Ut H#6 wt HC`t k C t H1[]A\A]A^z |$ H5 T$ uu HCbu H߉T$ 5 T$ gu HCTu _u H5 ru E1zw H> <w 0{ tHCPHt H;C@u H+ H5 M H84 E1v HHA Iv L衾 H+ H + H HD$HHWv Hw ?y M H|$IE1v H Eu 1Pv IH( I Ht$Ht&LHe H|$l Ht 1Ht$ HCHt$(1LH HD$(; HD$IHtCH;?+ M Hh# LIz H|$IHHNu Ht苽 E1L耽 Su x H+ H5K H8 H|$Hu HN x D H< x Lt$(MPw Cw H|$Hw w H|$Hw w H@ t^ID$HHS0IHHHC0H|$I$H!褼 nt H 葼 E1Xt H+ H5J H8 H|$HH|$H w M w 1ҹ HH= r aH+ { H8t,H5%J y @H+ H5~ H8^ %H5~ M E1r H|$s H|$H/t9 D$P T$蒻 HHH1[]I H|$r H|$H/x | k $w H+ H5I H8 1xw v 8 uhGh H6w L Hw+ H >w H vFHHHH~OLl$I;]v H|$H_ xLl$v L謺 pH H9HBHH+ H5} H8 H|$o 3H+ H8軌 D;H#w z v A Hr w 1}x Ng w 1]x HӾ+ { H8t0H5H f H$Ht${ HtHٹ 1x H5| 6 H w HHt$H|$Z w H\+ H tH5G H fx H5M| H o ~H + H5GG H8 1x H+ H y A,$x H|$+ tH|$G x LgHx 1\y Ht$HLY { tEHHC HHu+e H"{ Ht(y H諸 1y 蟸 Hz HT$Ht$H<$`z gy 1 HtHb 1$z H+ HHQz 10 HB+ HH{ HH01#, z HD$8HChfHC`HL$HT$HD$0HCpHt$HD$(1HCp"Y Hl$HuMH|$η HL$(HT$0HHt$8X Hl$0Ht$HU\ HL$(HHHt$8 y H|$H~l Hv HD Ha H+ De H8讉 y [1H 6 Fz l 1HK8z H y H{ - 1 H+ HRH5z H813M H+ H5z H88 z 1HHK(赶 1z HB} H5JE LD% usA i| H<+ H5}{ H8 p~K Hx{ H+ H5 H8 E1| HH66 H5C H=X x مH5z Hvz HEHú+ H8c E1^| 1;{ HL$Hfot" D$l H $D)D$pL$h3{ A &{ D$l { 薵 | HR+ H5kz H8 H:+ H5C H8 kyJ Hz A o IH:H C HC LfHnH + H5V H== fH:"HC H$ 1)$ IH o oH Lf)$ H H$ J < 1L;-+ Hl$P I$ L; HD$PI$ LHHD$ f Lt$PM I~ IFLHHD$J- HD$H E1ɉ\$ LMLH9l$ HCH=fy L,IE ubHT$`LLL1 D$( L耳 D$(u6HD$H;CuHD$`HL$HDHHɻ+ H5y H8 H|$P8 | MIE1ۋ\$ LL\$P I$0 HT$L E HT$PHJ Hz HBLHT$ HHD$$, HD$Ht1Lt$ \$(HH9\$ 1\$(H|$PL芲 L-I IH HD$ID$HD$ID$D H+ H@ H Dj$D+j A*Glm D$ =*@$ A$r It$H$ M> ( $ A9% H4$LHT$hM1 LINa x IFH=Nw L,IE FE1L;-+ LT$Xc I$ L8 tZw HD$XI$( LHHD$ x1Hl$XH H=w " H|$XHt L - H5&w HHt+ H81"G Hε+ H5? H8' LO` H+ DH5qz H81F օtt1wzIt$H$ > pIE v L$ It$1ɺ L> xIt$ LM> 6Y H=|+ 1 HD$I;Fu3HD$HlH7Hp+ LH5v H81F H0+ H5v H8 bH5+ H5u H8 I$ L 7 L I$ HT$PL Lt$PMt I~ . IFLHHD$x( IHLd$E1H-v \$LH9\$ IFHL$I$F H|$HT$`LLY D$ 0 L訮 D$ ZHD$I;F% HD$`IDHI}贁 J H58= HH+ H81D 臁 H5s HHγ+ H81|D H+ H5as H8 UH5t H+ H8f Ht$<H) D$,[ D$,E1HLL$X迭 I$ HT$ LJ Hl$XH H==t mHt$`LH4 D$ D$ HE1HLD$XK Ht$`|$<L HH L! I$H L4 LtRI$ HT$PL +Ll$PMS H==u 8 Z H|$PHuI$x L-4 HD$PI$ LHHD$ Lt$PMD I~ N InLH9_ HD$HkE1ɉ\$Ll$ LMH9b IEH=u L4Ih 0HT$`LLL ( D$(T L̫ D$( I;m3 HD$`HL$HDHH2+ LH5@u H81A H+ H5s H8 LHT$`LL' A E1LHL$P3 H|$`LV IHUH+ H5s H8o C5~ H5s HH|+ H81*A H5q HZ+ H53r H8# M1Ll$ \$LHT$P蓪 I$ HT$L Ll$PM H=qs LHT$`LL& A Ep1LHD$P! Ht$`H|$L IH>9} H5q HH+ H81.@ 1L\$Ht$PƩ Li@ IH LhGH/+ H5s H8 H+ H5r H8 Hٱ+ H5bq H8 HH) = HcH|$ L| DILL|$H|$HΉT$HL$4 HL$T$H > H A HcI9 IMM HH) F H br HtDH;+ H5l. H81> i Ht$HLHL$ Ha HL$ Hu H 7Q H( Ll$IUENH q Ht+Hέ+ MH5Dr H81r> MAIH P HZ( HcHL$ $ D$M H=, HH ( H P H' a DIDI߉HD$HT$8DT$0LL$@JDD$H\$TL\$XHH Ծ H=$, H$ @ HH Ht$H<$ r Ht$H<$HJ H+ H51q H8A 1o H[+ H5 H5& H81< HB 0 H>萦 1ɸ I $Vp HA+ H5 H8 Hb 11p H{H p H{H p HQ tKC o tQH$ HH HtHuH} HH H}o H HHOo HEHPEt5Hg+ HѾ HHp H81n? zH螥 7H*+ H5p H81; Hy HPHf HP0HP0 HPHfG0^ 1HcH9}LHO@LHÃo L 1Rp H = t H~ H;-T+ u H鐝 Hj+ H5 H83 H+ H5 H8 H{`Lmg IHȝ HcC\I9|PHL| HH s(H{L[]A\A]A^g H{`:g HH| HS8s(H{Hj+ H5H9 H8 T L 12 ~6HH H L HEH+ H5a H81 : D HȨ+ H5i H8! H解 1颟 L蘣 1 H艣 L聣 1[]A\HH} H53< H= 1[ H%+ H5. H819 m H+ H5ى H8 R H+ H5 H8v 7 A . A H+ H5Z H8B A ` H+ H5 H8 ޠ HH5+ I- tOIAH H n+ HD$ He+ H5 H8 H} Ht 1HE J 1 Ll$1LL; u6Ht$ H|$. LHE = HE HtHX H@HD$隠 H+ LHH5 H81)8 IY(P1 Hֹ H=#7 >y 1 H觪 tHkѠ HH! H5# H=6 HS+ LH5" H=6 HP H{H~ ܠ ǡ 6 I$DE\MTMPLHH1A9~I|4HHcHI|HIT$8 H+ H|$Hp / HHtBHX+ H@H2 HHH|$HT 1 H+u HCHP0I/u IGLP0 IGLP0 IW0 IWH Hj+ H|$H H0 IFL$ LP0L$ IW0. IWH% X I/ IGL$ LP0L$ x IGH LԨ 6AG IGEHf L 5 LEH 5 H4 IHERHJ pH|$ 1S Y^HCHP0d HH鹠 HG0 HGH HG0齠 HGH鴠 HH[]A\A]A^A_IEhMcBT y AE0 IE`LT$LD$Jt65 LD$T$HHtkO M @ M H+ I9@ L9t"H; HI LHL$_ HL$HR Ax LD$HD$jK tLD$T$HL$O ǀMsMtIxHtLD$ LD$1IHMt9IxH9tHt LD$HL$Н LD$HL$HtHIHZH INL9t}H HI M +Hs8H{ DLD$LL$HL$R HL$LL$LD$IxH9t H^r1IL+ H1IMu1HH H55 H=2 I H1[H+ H5g H8; HH=oq HT$B HT$ 1 H + 11H=:q t ٟ HAԅ g 1LK E 1ҹ HH=,0 s tLH * HM+ H51 H8n 1 Hu H]IH I0 1鱟 Ο HG+ H5r1 H8 Z[]4 H= 1 H;+ HXW H+ H8=e HH|$] tH|$G Hǃ 1H1_ 1 HD$D HT$ 1l ID$LBH5փ IMHHx+ H81&1 1f L;%P+ uQH I98 L HHx HH H+ H5 H810 R H+ HJH5 HWH810 uHܟ+ IT$H5 H81~0 SHH=O 7 Z1[]1鹞 1ҹ H=YO q HL 騥 ҙ # 1H{H HF H9 H+ H591 H8 H+ H51 H8 H+ HQH5x H81/ Hš+ H51 H8 H+ H50 H8 H+ H5V H8~ w . Hu H+ H5 H8T Hژ 1鏨 L˘ H|$ H|$跘 H|$識 H襘 L蝘 L蓘 H|$艘 L ڦ Lr H|$f H|$\ HT LL mH؝+ H5H0 H8 H|$' kL L H|$ H|$ H HtCH|+ H5E H8E LH|$Ɨ H|$跗 H|$譗 IGL(Hx E1U H + HRH5a H81- \ Ht$H<$i tH<$Ht$G 0 1H H+ H@ L5+ I6H t'HCIUMHI6HJLHH 1 Hޖ 1 1 1 H+ H LZ LL Ņt1H+ H86 H(+ LH8]` 適 H { H` 1ک H+ HWH5 H81, 1 HǛ+ HWH5 H81j, H+ HWH5^ H81L, 1 H+ HWH5k H81), Z[]Ha+ HOH5~ H81, 1ǩ H>+ HOH5 H81+ * H H=+ H H1[La 1ת H˝+ H5| H8 Hֹ H=k- l H+ H5\- H8y > H E1_ H{ H衯 xHՔ 3 D$$E1í H踔 HD+ H5m H8 H蕔 L荔 ǭ H耔 H+ H5 H8 i^ H/+ H5 H8 H@ AHֹ H=, k ة H+ H5 HD$H:j H|$ 1 Hz+ H8J3 t A 1 H躓 1 H諓 A H蚓 H)+ H5, HD$H: HD$ UHSHH5~ AP t.Hw; H9CuYHH[]= H5M H uZ[]AQ t LYn H=5 R ZQL tI@ZLL u H=5 HZH跒 LO 1 , ϯ HP t H 黯 锯 H+ H~ LH0J 頰 L%֛+ H+ H+ LH0 v H|$1 H) H+ H81 t1 DxFE1ò H|$ H|$ Lݑ HՑ Lˑ H|$近 > HD$8H HD$HHL$8HI_ H+ HD$8H HD$HE1LCHq 鿴 E1L ] 鞴 HP A鰶 H{(Ht1HS(3 1t$ H+ H5 H8 )& He 01H N HH H5_ H=Y . A. H+ H5K H8 1HC@袐 鶳 1HC8蒐 陳 E1L[x聐 颳 H=+ H5f} H8 \ 1HC L , E1L 8 i H + H5| H8) 1HC0 LH H5 H=X > H+ H5_ H83 $ H% HPH8+ H5I| H81% :L%+ 1HC(s ` HH[]A\A]A^HV ͷ 1 t#H+ HH5)( H81z% η ķ Lc@[]A\3c" fCZ} C\ HxH> HxH5 L؎ ! H$+ ߸ E1LC8賎 霸 D 1HU0螎 R . D HM+ H5A H8 1[Cp HC01LI L|$H H$ HHuH[]A\A]A^A_' @ ]T H H+ 9 HHuZ 1ZLbIQA L+ HHL$Q1j j躣 H HHI 1 覍 饼 " HuI\ A Q H{ H=z ?, 1@ PH(+ H5 H8 1ZC #3 1H> ǽ 3 1H> Ľ H+ H ÃK H 1 1 1p ? ^ 11Hֹ H=' Rd t"H+ H3HSH@ ; 1 H= d t H;g H+ H5y H8 1[[LH]A\ H=Q0 葾 E1 1 H+ { H8tH5- 1[H5N q Hֹ H=vd vc 1 HuH MHby H5y HEH@+ H8 H\+ H5! H8 j H H5 H=.H ƫ K HJ+ = H>+ H + H5a& H8 I HtH+ H8* 88 H|$17, ? IG Ho+ H5x H88 H{& H D+ H;* IGH;H5x HP1 h Hώ+ H8) 7 ] H|$1+ 3 H=-+ I_ H|$1c+ LH H5 H=F Y H+ H5z H8N MHww H5w HEHU+ H8% H裉 u%| HH uHX HH H|$@D$@ 0( D$@D$H@ ( H|$@D$@ ( D$@D$ H|$@ LD$@ ' D$@D$ H+ H8bH=SY HHt#辈 H= $ HHt$襈 = 5 HP 5 L tSk L%Ԓ+ H H5# H1I<$Xp I<$Hv H5 12 H)+ ǃ| LI tiHH td11H|$| H+ > Ho^" 1HL$@H5V HD$@He+ H8r D$p k HX uHP uR D$x [ 1 u H8 D$ < H% H=nu 1 H|$% | H+ H8u 1H|$@D$@ % Dt$@w 3 8IvALLIH=u 1A f9 > LLH=u 1M9 LA tKLmu LH|$D$ $ Dt$ LW L }Q HH A 1H=T | D$r L YLLd$@ H+ 11| 0 H5 n H H; IH HH5@b 1H= ں H5. L IH6 H[" 1LLLd$@LHD$@ 2 LYLф L9 u.P t11H= [ y:LD$@ w# D$@| D$> L }Z H[" 1LH5 HD$@H+ H8 H=s 1 H|$@D$@ " D$@ H=^ H|$@D$@ " D$@ L߃ y A ,D8I0 H=q 1S E<$1LH++ Ld$@H86V Ln" AL胃 ELd$@LH" ALd$@L6" ALd$@v H=r 苵 E18 1 1 1H @ $ @ /tq/ LVHj / HHtQL$ HL/ Lv LHxH1@ L L L HuH+ H5Q H8ҷ 1[]A\HT+ H5q H8護 x H{ H H|$ D$ D$ & H+ H9 H H Lށ Lց H|$ D$ D$ H$+ 9 H=q H+H蓁 H苁 L胁 H|$ D$ Q D$ 8 A fH+ H+ ) H=Xq HH( H H|$ D$ D$ Hn+ + H=p HuH݀ H|$ D$ D$ H++ H=zp H2H|$ D$ p D$ W [ ܥ HH= HT$& HT$ H1[]ù H= W H* HEH5p HPH+ H81Z E1* HEH5p HPH+ H812 HH= HT$& HT$tHHH[] H1[]L L H L ѿ H+ H5Np H8 鶿 H*+ H5p H8ô LK LC H; 郿 H 1 H H 1 H E1h H~ L~ L~ H~ H~ HD$6 H|$AH/tVAt> H~ H~ L5 I/t * H{~ m L AD$@ 1 H|$Ht9~ H/~ L'~ H|$~ L ~ # I} H 1IU } H|$} I} H 1IE } 1 H} L} ~ H} q HkHtH1 H=N q H{H ZH[] H{H H 1' H+ H 錢 H$} [ HH[1]A\L LLDT$,HL$ HL$ DT$, H|$H_ Ht| HuYI$ Mt$IvInHt$ H+ HD$8 LzIGMoHD$ L%+ I$G E1? HUHt$H<Hz Ht$ 1 Hk 11 C 1 H|$ H|$M H HoHg 1 13 HHt2| HHt%H@ t Hj( u H 1f HPH + H5m H81 H HuH+ H5-m H8轰 H+ H5 H8襰 H+ H5m H81h 1Q H> HA 1[]A\z z 7 z z 1' x ' f P' H=չ HZI$ u L| y1 ID$xHuHJ HH HHHtHo H11 H+ HHS 1J 1HSHz X[]# Hy HH=C HT$$ HT$t6HII?H HI+ H5k H8 u p H< IHuL;# HHL[]A\A]A^A_HELl$ L蓺 o PHA 1LK0, HD$Pj j H HH X HPH~+ H5; H81K 1 HS1H H H}+ LLH5:k H81 Hx HA~+ HRH5 H81 Hx 2" LE "" MD$H Hn t.HHsHHH9~OH+ H5 H8蛭 E1 IT$0 IT$0 IT$H IT$H H[H { IT$H HSE1LH} Ha+ LH8A v L Hj|+ H5/ H8 H(1[]A\A]HH H5 H=6 ɗ HHh H5 H=6 誗 H |+ H5 H8袬 H(w HH L []A\A]A^ c8"u0H I9 HAHH H L HG{+ H8I H HHT$HL$Ht$ Ht$HL$HT$x>{ HHT$Ht$HL$o HL$Ht$HT$ H5v HEH5i HPH{+ H81e H HT$8 HuҺ LHZ K HH H5X H=3 H(1[]A\A]L H_z+ H5$ H8 HH H5 H=b3 ɕ H(z+ H5 H8 뜾| H=۴ 蓧 HH $ H4$H H}+ H W He HGH5h HPHz+ H812 X Hnz+ H5> H87 = HHHOz+ HH5g H81 Lt H z+ H H9 HH)HIH H|+ H5 H8ǩ HC H|+ H5 H8褩 ` HH~ D$dT$pH=c}+ ƃI9|$K q 0 1 H$ s & T$` IvHq IvHh HOy+ H50h H8 Hdx+ H56 H8 Hy+ H5g H8 Hx+ H5 H8Ǩ 1D$px @ HD$X H x+ H;H5 萨 I Ls < H|+ H5 H8h ! HtH zx+ H;J u L{ Lr H$ H$ 0 $ b L$`H$ H$ $ HP> HD$H$ P H9HO HL$dHD$h^ HH$ H H$ H$ $ Z HD$`H$ ? `; H= 9 , H|$z H|$G H$ HWH H$ L@E`? CHPv+ H5e H81 D$`. H$v+ H5V H8车 v c Hh I Hv+ H5 H8菦 H e H= ^ 2 MD$AI@`H H v+ ID$H;'z+ ttH;^x+ s r L HD$Xu Hp D$`0 H$ $ Hfp H|$hu|$p A u^Hl$hHD$h1HHHHHD$h s\Ld$XI$ LԾ HD$X L HD$X H$ H$ 0 $ L$`H$ H$ $ HPs HD$H$ IEAt1A E H0t+ H5 H8ɤ HHD$h E9DACd Ht+ H5 H8臤 @ Hs+ H5 H8d Ln PHrt+ H5b H8; 1Z H 1Z HuH$x+ H5 H8 Hn R Hxn E ; HH4 x H H(1[]H Iw Ld$ 1 Ic LjIQHA HL + HL$Q1j j܃ H HH U m 5 m H HEH H H}xH5 H\$AI_ H-r+ H5>0 H8Ƣ H r+ H9Ht8HH5xb 1 H1[A\A]1H H蔝 8 H5 b n HS HyL- HL$LZ HL$H t) H= tHsHHL[A\A] 1HHL$ YH|$L :~ H[l 1 o H q Hk(HHC H"l Hl 1 H 1Zà 1 I|$( I\$ uRHP ID$(Hu@Lk 1 H<$> H<$HHt HxLh k Lk Il$(It$0fHnHfI:")$ HtH;ID$(t HHtKfo$P fo $H{H Hk K,k H$k H{ b HA- U Hk Lj )1 1 Hj Hlp+ H5E` H85 1O Hr+ H0HVL H|r+ H0HV9 HQo+ H5b_ H8 H6o+ H5G- H8ϟ 1H Lj Hs+ H|$Ht$1H H ~ HH` H@ t } Hs 8 HPHbn+ H5{_ H81 Hi M LL Li Ht$LH3 HHL MtLji HtH]i 1x Y t HCx MMtL4i MtL'i H5p+ 讙 HtH 1; HHtH+ HAh EztHm+ H5 H8/ ]HLLd$ HT$HHLrh HE ycL}E1 tO MLdh HL$HL9| LH)LHL)H M B E1LEH H*q L}E Lg Lg Lg 1 IH Lg Lg [HL$HHL$H9 HD$MMMII)K<<Ll$ Lsg w W LVg HwHHGHt$ HD$ H}H HwHH}H H g 1HD$H|$Htf H|$Htf Hf HE{^ Hd H5] HHH) HEHLl+ H81 H|$HuI$ H= U f _ ;" H*YH,M H|$HtMf H|$HW:f ML H|$Hf Hk+ HRH5[ H81D Le Hxk+ H5 H8A Le o H5o+ e Ho+ Hu41{ Ht$~.Hkxa 1ҹ HH= < 1 Hj+ { H8txH5Z 讚 6{ tHCPHtH;C@t Ht< Hi+ H5B H8v 1 H7 ? Ld H11[]A\A] H5' 6 E1\ H HHt d 1H{hHSpS AkD$$HH<X HH Ict$$HSPIL$ HS0HH4Hs8HHHC@Ao$AoL$ID$(HK KHtjHC(ID$HLHHCH- IT$@At$$H{. HL= H߉D$ " D$ Hh+ H5Z H83 Hr ] Hu7H"h+ LHH5mZ H81 HHoc Hg+ H5 H81R LEc H=c H|$3c 1 H$c H|$c I Hc H|$b Hb HulH|$H xLIwHL$LH6 H|$t$b Hl+ HH} L-}l+ b KH|$tb <H|$eb -HXb H-g+ H} HCH} H5\Y HP1q Hb H 3 HHT$H@ _ HHT$II?H 1ҹ LHN9 % e HHt$ Ht$H H HIf+ H5X H8 1 HwHtaH( IHt@HLHH L6a ? IEH5X HPHf+ H81a E1 H=j+ # LH H5 H= 6 1{ u H 6j+ Ha H=gw D HM Hbe+ H5V H8 LH H5D H= ̀ IM( H-Gj+ IM~ HH=+ 7 [1]A\H} ƃ H IL$H@ HD$Dx Hd+ H5W H84 E1 IWH IWH U L_ tA Eb IL$H t P f , E1LLG IP v?IH Ml$H{ HD$H9 = M|$HP M|$HF t t HD$H9 u hG tԃIPHH H5` H=B ~ 1 HHt$g tHt$HF` HPHc+ H5 H81 1^ HH= 5 u>1, Hb+ H5 H8t HH H5 H= E~ ; 1 1 I $H H5 H= ~ HPH=c+ H5U H81 E1 HR . H1[]A\Q 1[]A\ HHu%H|$Ht$ Hb+ H5 H8角 1" H|$Ht$ E1HL$ IM H H5e H= [} HH H5 H= <} E1 HH= I4 uHPH9b+ H5T H81 H\ e Hk\ HӅ( HӅ 1[]A\LՅi IFMHII)L9LCL9 LDL$LL$LT$ LL$L$HHtZL9sULT$A M9 LDpD C9 IIH L MRH LLD H H)HIH HAtAtS vvLH wL9 H ta uH)HI H Hf wL9sHf t up L9g L uH)HI tL LHH)HIL HӅs LH=` .Q Lcu 79s L79r9uHH9u1HSHP LI\$ A|$ tI H L HwN HH=p \1 tHMe 虄 H 1 Im HH55 貴 HQ HEH_+ H8 1 1LH5k6 H=/= xA|$\ H(HHL[]A\A] HD$%Y HD$V H3 t1H9h Hk H^+ H5Q H8S hHo^+ H5 H88 MI HK^+ H5Q H8 )H]+ H H0i 1f 1 ¹ H ]+ H50M H8踍 1 H]+ H5 H8蛍 HT$(Ht$ HD$ HD$Hu*1D HT$(Ht$ H|$ HW H\+ H5L H81 1 H5_+ C H Hd\+ H5u H8 HL\+ H5v H8 벃{ tHCPHt H;C@ H\+ H5y H8賌 1 Ht H[+ { H8tH5* ~ H5 p 1" 18 1 H) HHL$H)A Hx HL$HS`H)KHHsX 1 1W 1 E1 E1 [ } AE` ( A i A \ L薗 AE` A : W Hu#1 AE` m A w A AE` ` L0 AE` A A 1҃- A 1҃ G` X ^ AE` F AuI}- HH Mu Hދh D` L> HH R EAAVT$L$ 蛴 Y^HH H HA AE` p AE` A}` A A A + AE` `AE` y A 1҃ A AE` 1҃ AE` " A}` rD$AE AE` A}` O HHX+ H5JM H8蒉 1Q HX+ H5UM H8u E1L S HH@ w 8 HHø Z HS 1 H HG H 1HG ) IGH t H.X+ H5OM H8Lj A |$h udLT$苜 T$HHtfT$$H= whd T$$A HD$ IǸ 9BE1LD$l$<1LD$ HW+ H5L H8= q HcH3\+ H5w H8 HHHD$ L[ Aă AG IO 1Ll9 a T$$LL$( A HV+ H5K H8~ IGHP1$ XMHLLPHATD$xPLL$8 H AJ HV+ H5'K H8 SI/I tIWH@tIW0 IWHHD$ Hx` t1E LN 1E 1E QL K HK PHQW+ LEH5 HE11H81?| ^_ A IX h HH H< IH Hp H=g 1^ HP LP } 1"E H H H c H|$ QR H|$ BR 1D GHY+ 1Ht$HH Ll$HHP 舆 Ht 1D h H=[ 1 W HX[]A\A]A^A_I eD IX TD IX CD HO 1H=q I H=r 1~ 1D N 1C 1C 1C L HD$H L|$(Dt$H|$ HH HL IH HxH5IU+ l |$ tHC H 1LY HD$HH H 1) IHtzHH y1 C LN a1B 1B k 1B L|$(Dt$n Ht1B H|$8N o 1B 1B H|$N LHLh; y1}B LM HM HH=c 1 1KB 볃 Ld$0X f J o I I H( +@ H t1 H=O ܚ H d H V+ Hl HQ+ H5 H8~ LH H5 H=J Om VHS+ H5G H8F _HS0H H5 H=G HHD1 1#A E1E1Li)D$0HDŽ$ DŽ$ IL$ HD$@ D$XLL$`D$ D$)$ f$ $ L$HL$hPHA 1L + HD$Pj ja H HH L$ Hl$01$ H{HtHt$ ( tIt H{Ht$ I H} HRP+ LH5F H81 1 HO+ HU8Hs8H8Y[]A\A]A^A_ HM Hs DD:A ÃuW1LHT$92HT$ 1? d LHT$* HT$HHt5H= 1 HT$ tIOH@tIO0 IOHHT$ HT$ IGH ] IGHu1LHT$1HT$9 tIwH@tIw0" IwH1> LHT$n HT$HHt*H=J 1 HT$7 IGH IGHHT$- HT$ IHT$Ht$H|$ 1L H Lb] uHT$Ht$H|$ HR+ H8 tH > G` - H c d 1] Hm H> 12 LV AD$` A$ 9 A$ E1& AD$` E1 A$ A$ E1 G` U L؉ AD$` : A$ 1HD$HHjH HD$ 1Z G` 19 C` 1҃$ 1҃ G` | H C` 1҃ } 1H f> v ε H=gf> R H=[f> } 1H5Mf> ; H= 1 H P 1Hz> HG 1Hy> 5G o ۄR+ H H 1҃ HZ[]A\A]þ H3k H< H{ LH+ HHt8 G` \ H % H C` gG` R L菇 AD$` A$ Li AD$` A$ A$ E1 AD$` E1 A$ A$ E1 E1? H C` O HɆ C` - G` C` E1 E1 Iy IAL E1L E 1H D x 1Hx D U 1Hx D E1L D J LF X[]A\A]Ë 1҃ 1҃ Hz C` p G` k HF C` < HG8Hx HN+ 7 H=? H莓 1HC`C 1H C 1H C G 1H C $ E1L C E1LKXC E1LSPC H@ H9Cx HM+ ; H=i? Hْv 1HCp9C C 1HCh)C & E1} C` E1 ` E1O G` H C` p MHHT$J4 HT$HItH H轃 C` ! P =p B Hf Huf{` Dcu6 Hpf Hn {` Dcu HPf HB {` k 1$ P =p tZ{` HDke HtH HH+ Hƹ HH01I HHC C` 똃{` Dk He IHto P =p u C` {` u@ HDsGe HH& {` Dsu# H$e HH ~H/ HH܍ H Hd IHHx/ HrIcL$IcT$HMcL$ McD$ PH PH:G+ H01، Y^HH E H% C` C` {` Dc H" C` LH߃ 1< H]H{ 1H1蔙 HH H C` 1҃ Hc HV Hg IHB H {` H- H{ L1 HH6 H& C` 1҃ 1҃ H H Hb HkLcH Lc@ HcPHcHH WPHZE+ HH01 AXAYHH G` f H;HcH< tX. P =p # H)b Huf{` Dcu6# H b Hl {` Dcu# Ha H P{` k 1 H Ht Ha HwLcH Lc@ HHcHHcPH ARPH D+ H01轉 A[A\HA 9 C` {` ZDc P1 G` y H H H` H H HHcHHcPHLcH Lc@ PH PHaC+ H01 ZYH } H H Hz` HmHy H\Lc@ LcH$HHcH HcPH~ VPHB+ H01胈 _AXHt H- C` P!H$b 1H` ; b 8 1HK( 8 1HS(HS@ 1H Z; " | 1H 6 Ha 1H HL H{1ɉ HE HkHtH/t1HHSL9u HGP0H?+ H537 H8Cp 1g H?+ H5>7 H8&p Hu?+ H5N7 H8p 1ܘ HX?+ H5a7 H8o H5 H=q - p ҙ H5 H=T - H5 H=A - HH Q H@ H9ޙ HH5 1H= 0 H[ H=9 !. H5Y H=& 3- H>+ H56 H8;o 1! 1L} HHt%IuLH=E 1 I饛 H9 E1靛 Hx9 HT$ H57 Hk>+ H81 HQ9 H|$G9 H?9 L79 1類 HT$ H5t7 M H>+ HT$ H56 H81K H8 H|$8 H8 H=+ HT$ H5w6 H81 HuH=+ HT$ H56 H81 HkC+ HL$(H HxHT$ Ht$H=5 } IHVHHHU L;8 ;18 H)8 H!8 H=+ H5 H8vm H7 HJB+ H8Z tO 1H5 Lp1 HHtUH HD$骛 HpHHX IHf nL7 aH7 H|$x7 <Lk7 =H|$H53 IHt}HL蒝 HH H<$-7 H|$#7 L蛄飜 H<$ 7 H|$7 1鉜 HH= s L}鳙 H<$6 H|$6 H<$6 H|$6 0 H<$6 Hݜ H|$? H|$ H?+ H5 H8k E1l Ht$LLMI苇 LH=sO t? IMH H5 H=LO VV IM H H5@ H=,O 6V wL$ Hپ 1H LL i srHHt~H5o IHtFH HHtfH HHt`HHLR LQ5 HI5 HA5 1\ LBqH葽 H=W vL 5 L4 H4 PH5u3 H=E 3( H=mt %g H H诤 LH褤 HH53 HH9+ H81 IH9+ LHH5-3 H81 Hr9+ H5 H8i H;+ H5ű H8i nHLD$A= LD$ NHLD$!= LD$ћ .H8+ H5(3 H8Xi P H{Ht$ 2 1S H{ IPHA 1L-+ HD$Pj j~I H HH Ld$0Li)D$01fHD$@ D$XIH|$`D$ D$HD$hH7+ Ht$hH8W H鯜 1AH5% H= h 3| Ht$P߉ItR H+ H9( ɠ ͠ Ht1 I HH=( H=( o2 HCH;HZ[]1ҹ HH= H32 1ġ H6+ H HH0g , H H=ԓ H=aK> I} HAU 1z HC;+ 釡 D$ H=sK> HK> D$ H=J> ; IH IHt!H=J> HA L } H tHLH$#` H$MAH H1H1IIHHAA AN HHT$H $v2 HT$x H $HAxHtH$LH$HH[0H H0 H=]J> HtJ> 14 1RHH5G0 H6+ H81 1YXH=D []SH Z[] H=I> H H;LHSHH H H=I> 1HѠ H=rI> r H=aI> H} HU 1ˡ H5/ H=u # PHHA L, 1HD$Pj jE H HH HKH H5L H=W O 1C H GH5 Ld ; $|D$ HcHf6t P HH= 1Ƣ HY8+ 饢 H9 I$ tH] I L+0 xID$xHtHI I H9 - H9$ LE1`. HX. R LK. LC. H;. j H.. 1 1ҹ LH=ƭ tĤ 1H9 Hu\HCL0LhIIE |$ a H<$LL HuNL- L- L- H- H HR2+ LH5- H81 Ln- I.b H 2+ H; u LB- H;LH5S- 1| L$- 111LL I} H( I$ e HL,$H Lt$, IT YH[] I>EtIFHAXH[]A\A]A^A_HIFYH[]A\A]A^A_HH M HHt 1ɉ H5- H= H^1+ H5 H8a HHD$ H|$H[]鵴 HH5c- H= 1" H5- H= L Hֹ H= q 7 1M [LH]A\q HO1+ HOH^ H5 - H81 1G P Hh3+ 鸦 1郧 H 1+ HJH5, H H81 1 鏧 釧 PH21+ H59 H8` 1ZH3+ H55 H8` 1é LLHD$:{ HT$ H* 1} H t HF3+ H5 H8/` L* 1} H= ez HK/+ DH5 H81 1銪 H蠆 { t(H{Pt!HSH1HxHH+C@H) 1; 1{$ tH{`u2 Hul H { H l Hq{ LH.+ { H8tH5ַ *_ FH5 _ 5 HH=+ r { tCHCPHt9H;C@t3H{鏨 H 2+ HH HH f 1 H H-+ H5 H8^ H) H=* 1W H( H HuHe-+ HH5K H81 й HH=N > He-+ H5Y H8] Z1[]A\A]蟽 HԪ 1˪ He( HEH5Zq 1HPH-+ H81蓾 ) i HLIe G HHt( HH[]A\A]" 1" Hi 1Z1鄫 1K Hr-+ HRH5) H81 H5T H=C Ы H{ HY Hp HZiUSQ HHtH@ HHU' HHZ[]ÀxEt HH Hc HH H9P8r+HX(H H HH 3 H@0۫ foL$0foT$@)L$)T$ T$H fol$0fot$@,$t$' 1T$ r LI HR H Hb T$ fod$@T$0fo\$0)d$ )\$H@H K H* 1飬 H|$ H H( fHnfH:"D$=PH.+ H5 H8u[ HZÃ颭 Bo H黭 H 1鳭 LYHDtE1L\$H)O< HQH$ 1I9~7 IIM A8tgHHĘ HHL[]A\A]A^A_ H ME1H1H1HD$L9,$|,G:4/t8CL/LHuIIHH)HL$E H} HT$1K ,I9~8 HHT$t;HTHD$H9~H$L)H= 3CL/LHtHD$IvEu@HI9t?M`L)MAt0I)HHHL Hڬ HT$Lˬ Ƭ Hl$ H). HHLk/ HHL閬 H=_ G X[]H - tXHSHu6C HS0 HSH} HS0= HSH4 H[H HZ)+ H5{& H81 1[H5)+ L tHSHuHC([8c H)+ IPH5% H81跹 m 1ά H+ m m HCH;LH[]A\H,+ LH5=& H81S H '+ LH5% H813 1 []A\A]A^ HE H/U> H.U> HPHr'+ H5 H8 X 1ZH" 1| H pĮ ; X Lf" 骮 LY" 靮 HDDDDDDD1H9 H觥 HHtvH*+ HL H L. LI" Mt=H! HcΪ HHt"HL@ HHD$! HD$HuLH! 1: L! HD$# [D 1O H{HG(HW`ǀ` H` E 騰 H[! ' R H=_ S H=! H@* } { H%+ H5 H8mV H)+ HH j H HH 1B HI M E1ɀ{Y LAE1{X A H{x1HKxHt H 1H H 1H e E1~C0Ht$1IH)+ D$H fH:"DL$H )D$|V DL$D$H1 H H HPH~%+ H57# H81% H H(H= []A\A]A^A_~ Ho$+ H5 H8U d {X HE$+ H5V H8T : H5B'+ HO H" HT( H;%+ L%$+ e L L L HD$L|$Iq HLLH;t$+ ; H x H9u1E1HT$8 1Ht$, Ht HF(E1HD$HtL%$$+ 1E1HD$ Ht.HHL$i HL$E11 Ih H{ D E1 LIHl$LHL$( H H|$ H E1HL$LL$PLHuLl$Gt ILL$ H|$HHT$Ht$K HT$HL$HHD$PLL$H>HHL$LL$ E1H|$XH\$XL\$Pi H|$X HL$D$ LL$w! H"+ H|$H5[! H8R HL$LL*1LLE1HT$HHL$1 HL$H|$ i HD$pHD$() Ih 1LE1HD$HHT$PLHL$h HL$FH 1HL$PLL$`Ht$P Ih HL${ HL$ LIh LHHw HD$PIHtOHtH= 1HD$PMt*HLLSh + L 1L|$PHD$PAL& HL$HtHHL$ HL$E11' L& Ih HL$1 HL$H|$pHL$ HL$ Ht$ H|$ L!+ I H HHL$h HL$HL$T HL H + H5v H8P E1HL$LD$PL H|$PH 1Ht$Ht$XHHL$; HL$HHD$PIHLE1 1HL$PHL$H& LE1LHL$ HL$H{ & HH HD$PIH HtHV E1LD$PHt(HT$PHLif xxL- 1Ld$PH|$PAL& A$ |$ u3E1& A# HL$LE1L" LH{ E1% LLE11' HHH=o []A\A]A^A_ H Ll L HcЃ H{pHHL L ME LAԅu - 1H߉D$ N> D$ 1ҹ HH= | ? " H5P"+ HH H5 H= 9 1! HSxL9|b 顫 H] + H5ƺ H8M 1 HCHHj Hk@H9] H)ź HH HxHkH< Ht$ H{8HiHCx1{ HsHHC@tHSPH9~HuHC`H| cu wHCPH + { H8 H5 GM HT$Ht$H|$螸 Hl$H H + HH0. HT$H|$ H { tHCPHCXH{8HS`H4H)`HK`oCP1oK@HkxH{XfH:HfmH)fH)HC`HK@H;l$0|hG HT$0Ht$ H{`H{8PhHl$0Hk`Hk@F H5 RL 'LkP HCP HT$H|$H .HC8Ht$ HHgHk`HHk@s 1% % VA L^, HHL$Q1j jJ, H HHZ 1錫 1H= A n HH AԪ 鿫 H 鲫 LHHg AE H`c邫 鼫 H H5aq HO H5 H1O | H|$g H|$$ x HC`E1fHL$(HT$0HHD$8HChHt$8C`HD$0HCpLKpHD$(w H|$8 H|$0 Hh + H8 g1H=X 袥 H\$(Ld$0L|$8HLL 1H=G w LLH L L HF H 9 Hh[]A\A]A^A_H + H HD$8TH + H HD$0KH + H8˳ uv1H= 騫 VH + IHAUMH 1H5 3 _AXx!H= 1觤 LLH 銫 He + H8U t= m H H 髪 L%~ + Ϫ H 骪 1H=J V |H=+ AR ; LZL`H58 Lٞ IH H LHK H+ LH@ HD$ I蠰 I9 HuH^+ H5 H8GH LO`Z H x E*A1L=d < H + * H=5 L=@ HbE A |$ H + H= L= HaEuA H + * H= L=´ HaLp_EzA鬫 L L L HL[ IHt_H+ I9GuJL_H|$HHLP IHtJHL$Ht@AG0L% [ ٪ LI H+ H5; H8F WL& 雪 H=׳ E1R HH H+ H|$H I* H|$HIt\ Ll$ LM9tE6 H+ H@ H [ Hӽ Ht(L9t#H|$ H 0 H|$ H + H|$ H3 H;EbH=v 1 H|$ ª . H+ H5 H8E 1 uLL H Hz+ LHH5 H81+ L D$ E H鿫 PHy+ H5 H8E 1ZH H HN+ H5 H8D H Ho 1E1H|$HtQ H|$ HtB H|$(Ht3 MtL& HtH MtL 1 H+ HRH5K H819 1\ H 饭 14 1H9' 1 1 ˣ HtHg 1雯 E 8 H Lk L 1F" ~H@H= []A\A]A^ H+ Hh Hh HD$HH H}H H;=+ u0HH HEH;+ LL$n LH MM鳯 HT$ HT$HH LL$E1LH C Lκ LT$ LL$H|$軛 H|$LL$LT$ It ILT$LL$l LL$LT$MHEH;+ MHLL$LD$I LD$LL$HHy N A Lκ LD$LL$H|$ H|$LL$LD$Hf ILD$LL$ LL$LD$L鄮 E1LD$LH MMM M $HLD$ H|$ L| ` Ht$LL$(LT$ H|$L H|$HD$L LD$LT$ LL$(M 1LLLL$ LT$= LD$LT$LL$ x.ILLL$LT$ LT$LL$M}L1LL$IIU I$LT$ H H|$ L|$ EMMDW LH M8E1MMM M] M $H++ H5P H8@ E1HMME M$> H+ 1I6Iu I4$1I>I} I<$H }HD$ LD$HH MMA Ht$H|$6K H|$H HLD$LL$u ML1LHLL$LD$記 LD$LL$y>1LLL$IIM I $` HX LD$1IIE I$ IHL' LD$LL$ Ξ PH+ H5 H8g? 1ZHE 1鑬 H<MHHHO H Htǃ ` H{E HwH Hh C 鍭 Hw0 H5 H= H5 H= H5Ԭ H= SHHu HSHsH;- H+ H Hֹ H= u1[AUIATIUHSAQH+ H@ H 芾 Hu0H H1+ H=^ HAX[]A\A]5XH;+ Ht#H HLLH ZH[]A\A]v X[]A\A]UHSHH8HB @t4HHt,H6+ H9Au HȬ HHu H( ! 11Hl$D$ H=! D$$ HD$(z HD$Hu H|$H0 y- H H5+ H=b HAWH|$Ht Hc+ Ht$1H Hl$H = HHu蜴 e H8[]IH駬 1 1 E1 E@ 1W []A\ H L E1\ L H L L H H-O+ HE 陭 H->+ HE L AWAVAUATUHSHH(H Hkg IHu 讳 H{H轄 u蔳 L\ LO HE @ H IHtHH u.HH 6}@ uSH訪 IHtCHH t L *H HL蟊 LA Ey H + H}H0 uHH L#{;{ ~DL xs H=Ϫ 1苶 HHt LHc HI - uC HHP HMPHcsLqHMI9~LcC 1ILt$I9 IEH$H9uCCL< LcsL9},HH HUH5 H= HD1ĵ H&HH H5 HDH= 1蜵 HHV LH|$n H|$D$P D$* CItxHt${L9}HH= N Ht$HYD$K D$ {H9,$ HcCHL$LH)HL$ HL$H HA H== HHHN1跴 HHtu LHD$ H|$D$o D$mG{ t%L聽 x3LH= . x C KH'{t11C H([]A\A]A^A_^M HCH;Cs"HPHS8 tHaEAE H CH, + H5 H88 H 1Q 豗 Ht BDXH + H5 H87 P WA H1LH+ HD$HPj j2 H HH LHQ H5ͧ H=S s" qHL$(Hd H5ϧ H=/ O" MHL$H H5 H= +" ) H Ζ HHD$鶰 EH۲ HG8HtH HL$H|$ H|$HL$t{HG1IE G G U H+ H5# LD$H86 H|$ќ LD$1I HGH5 HPH+ H815 1; AW1AVAUATUHSHHhHHT$@HD$HF @ucHt$Ϻ = Ht$H= v $ HCHt$Hx\ Ht$H=b C H + HH8)RHLM 轤 IH H; + u H sDUHۨ H{L 2 L ELDHK + H0K LمtAH L IELC4L> LA E* L%\+ HCHT$@HLl$PI$q HD$0W HT$XH|$HL7 r Ht$PH= 1_ H|$HIHt- H|$PHt H|$XHt M HD$@IHt1LH肠 yL L X LI$0 HLu RV ӫ H|$P I$ H HD$HtI$x H H$H L=+ L9u HI I$U I$U H$I$ H IH H豢 LHD$ H|$ x I$ HL IHug HY L9uL HD$+HO LHD$ H|$ y赒 H H}+ H H9C I$ H IHu苪 HD$ HD$(:L9u LB Hء LHD$(+ H|$( y> H HI$H e HHu( AL9u L 2HD$8} H|$8I My HuIHD$ HD$(II$ H IHt!L9u4LE1 'H|$} H|$n H<$e HX HT$ H4$1H=X a H<$H5 H }LK LH H Mu H\$ Ht$XL HT$(H9T$ }H$ HtBLl$XHtHD$XHI9LO1H|$ HID$H$ L9} HD$I)L,$L誳 H\$IHHM? A wHHHрuIHL>IHt A| uIL9IOݾ LoDHtL)H9}HII)HH)LH= Ӻ LL C</ u Hy LH=0a 蘺 y LH= L-O y xhHrLLd yQE1H H$LI9tH@ x/IH=` + xL/ 6H" MtL H\$ Le }L& L-+ H|$0IPo < IHtH@ u%L LH= 蛹 yo1 I L@ uOIXn L @ u<L L| LAa E LH= 9 y L8 H|$0 IHtH@ u/L < LH== H; f+ u'QL L LA EyT HG IHu: LH= 葸 ( HE H.+ H$HCH9 _H@ u LH=f O yLS Lv^ HuLL A LA& Ey LcPH{HM H H* I9D$ KD IH LHW LI ? H+ H;{ LkHHC(Mj H ,* I9MY HP Hr + H9P? HH@HtH9PtLq L5R PPHI7, LI< M Lk) LI M LLV LI Mu| H IFHx!) IH HLV LI Mu:Ջ HuwIFHx( IHtbHLOV LI MtGH4$H=՜ ` xDH4$ Lk x/H4$H= 7 xL; T HtZ L Ht$H=\ Ll$@ Le Ms LxY uU}L L IHu LH=/ 襵 ' LH讴 L L'[ HD$1H$H $H9L$ Li H4$L HI D LIB Mu h LH= yx L LI M IGE1HD$L9t$~7IG}LJHD$ x?H|$ Lγ x)IL LH=&[ 莴 x)H$L Hu 1H|$@Htb HZ Hh[]A\A]A^A_à ئ Ц Ȧ 鸦 鰦 騦 頦 阦 鐦 鈦 逦 x p h ` X P H @ 8 0 ( إ Х ȥ 鸥 鰥 騥 頥 阥 鐥 鈥 逥 x p h ` X P H @ 8 0 ( ؤ x H;* HE(H@H H H HHEH饫 ɫ Ȇ HB I L辮 , IE1 1MxN |$fnHD$HHsXHDŽ$ Hcf:"HD$Xfք$ HHHT$PHE H$ 1Hl$`H$ HT$@b H* IVH5B H810 H% MhM H_ I E1 M H4* IVH5 H81׆ 0 ~ H|$Ht$W xHt$ 餪 HcD փ霪 E1W 1[ HHt$. Ht$3 b HH p H5ƈ H= N @ HIz _ N,71H LIE0AE,E}( H$I9 A0A9LD$ LL$ LL$LD$ Z AIA LL$ LD$ LD$LL$ I H$I9 A w H* A9 AIA ucLL$ LD$ LD$LL$ tFH$I9 A8LL$ LD$菗 LL$ LD$A9 AIA t`AAHL$IHH$I9Z A A;M AIA uLL$ LD$~ LD$LL$ tLL$ LD$\ LD$LL$ t1 1 1t 1m LD$# LD$H LL$ LD$ LD$LL$ vLL$ LD$ LD$LL$ P | L9CT m LT$ LD$Lt$ LD$L\$LT$ # I HHLL$LD$踩 LD$LL$LcE H I H N,7M/ 8 HHT$o HT$LcEx`H J7I/ HH@(L,H 8LHiMu0IAE(H AE, Im H . LL$ LD$ LD$LL$ S LL$ LD$h LD$LL$ E1H u IO/ Lc DAMcIL)LH4H L) ) LL$ LD$ LD$LL$ l8 HLT$/ LT$LcExQH N HLT$)D$ LT$foD$LcEx H H N Lc I LD$M LD$r 8 HLT$LL$脧 LL$LT$LcE c HHLT$LL$T LL$LT$LcEx H ItH N,7* H &* LL$ LD$ LD$LL$ j LL$ LD$ LD$LL$ LD$^ LD$ 8 HHT$LL$蕦 LL$HT$LcE t LD$ LD$5 LL$ LD$ LD$LL$ c8 HHT$LL$! LL$HT$LcE H # LL$ LD$ LD$LL$ P LD$j LD$ LD$N LD$s Lc 8 HHT$ LT$LL$x LL$LT$LcHT$ Ex,H H LI J, I/ * 8 HHT$ L\$LL$ LL$L\$LcHT$ E H J7I$ @(A L,H 8LAE(I AE, AMu0IIMI,Y Ñ LT$LD$/ LD$LT$_% m 1 1 1 1Y 1 IA 1 1 Mv LD$ LD$ @IIV IvHHH LT$ LD$Lt$ LD$L\$LT$ LH D HH 5 XSNIAA ]LL$ LD$ LD$LL$ <H\$ Dd$E1H Dd$IMH\$ IAA LL$ LD$ LD$LL$ *LL$ LD$ LD$LL$ U LD$o LD$ LD$S LD$x 8 HLT$LL$芢 LL$LT$LcE' i A}( t t L9Co u LH A I( L9C? LHLL$LD$ LD$LL$LcEx H ItH J,7! H ! H֢ H-* H5V H8 H 1+ HB 3 z H" C` P 1ɍP H9 {` I H .? ʢ 1LHH; HH y H C` P隢 1ɍP銢 G` * 1HK + H{(H{. . 4y H H* H5 H8c 1 L L-| H> Hc* H5L H8, PHJ* H5 HWH81y 1ZLLD$ tNLD$AP 驤 1ɉL$H鑤 T$LH|$@o H|$@T$L, H H|$`Ht9 1ͥ LiH鱤 MxH邤 H@Hz HHq H( L[]A\A]A^A_ LiHt I@Hm I@Hd H|$ HHT$0, HU HT$0b HLt$( H|$`Ht H|$ M=L0Lf 馥 H=* Lt$(P MGHl$(LHD$H9}MHt$ HD LHމ {H$ HtHHD$0 HD$0H;g* tp|$H IHl$( M' H|$ HD$H5v LxXHxhIL@`M L H|$`H H0LD$0Hl$8MDd$(T$(LD$S LD$T$(釣 H= ] H|$8H LL) HD$HtHt$L: HH> H@ H~* H|$H5 H8B H|$ H|$`Ht H|$ +H|$LD$(k LD$(HIH|$`Ht { H|$ 6H|$e 'H|$ 1HL$XLH|$(H5\ ) H|$(tiHD$8LD$XH@MyIxiL9|dH$ LD$0H H$ HPHHHT$(Z| HT$(LD$0 H H|$`HH* H|$LH5 H81u AΈ x { x 0LD$0Hl$8MDd$(T$(LD$H LD$T$(| MLD$0Dd$(1Hl$8b I@HHD$ 鮟 H|$ LD$AP q HLD$( LD$(駡 Hj* H5 H83 H Ht* H50 H81t H s H 1ZSH! uH1H[L鈤 L|$a M$t LHL艋 xi LLLHl$H\$) L-* L96 L o L-* M HCH9EtL |$ + 1 1* HSE1HH\ * LLHL H鼤 HA IZ< r H0 1ZH* H8蹯 H HI 1 H: H0 H& H E1= Hu0H{0 k AŅ 1= E1 EAE 1J § 71+ L*y L蒶 H|$0Ht H|$(Ht HĈ H=O []A\A]A^A_饢 P10 C` P1 G` ݅ 鳧 H* H5@w H8 1e, HPH* H5I H81?r H HHp. LH[ H5Mh H=? p HtHA* H8{ tȈ L. H9, H5Q MtH5 H* H8 OH"* H5D H8 4H57 ȩ H5 H" HEH* H8 H[ H5g H={ X HPH* H5J H81'q 魧 H=~ H}* H5B H8 H HS McL$,McD$(Hz IcL$$IcT$ ARPHf* HH01' Y^HHt[ HZ[]A\A]à 2 C` ǃ {` u Dcg 鼧 o H C` 뎋 1HB IH H H HM IHo H H^ L> LcH,Lc@(IcL$$IcT$ WH Z G` c H&B IH H] IH H H McM McE sG` 臂 " Q^ P1N 1鹧 鯧 H([]A\A]A^A_@ HHhH+ Hx LHl Iȩ LW LO {< H<$y HLc 钧 @m Hs ̨ L H@HHt"H* H;t1H= { Iŧ LH I鲧 I@H+ I@H+ I I<_MCHHHD, I<_LBHHH* H* H5 H8 E1+ I I<_MCHHH, H HtHHT$ HT$HtHHT$ HT$HuJHH[]A\A]k H8 H ' HD; H HHH[]A\A] 2 譃 Hn* LHH} H01/h ܩ L-_} z I [ []A\: 9 HH]HH( H J H* H5 H8d v 1z d! Xà 1̬ tHH% AH0HЉ D 8Hff 8HL EI A0AA * D *Yt! XYp! u=o* fWO! H* H5 H8D \! X/! L 1鵬 VE1LE1j 1Ҿi } _AX Ѹ 郬 H* H5{ H8 1V HQ HI HjHQE1L$+ HHL$Q1j j H HH< Lt$ L=* Lt$LLHl$LH\$| L=e* L9" L 1 7 LL$XHt$`LL$8PHD$pPASL\$XSLD$(HL$HHT$PH|$@'@ H L\$@HIӲ HT$hH9 H$ H)HH$ 1H9$ IB AB A @8 IJ # IRHH|$LLT$8 LT$8IH L\$hLL\$8 L\$8 鋱 H|$ ( HD$@ HD$LpH; HD$@HH|$LH)L\$HDŽ$ H LT$@L\$HHIL+ 闱 IJIR -LLT$@L\$H LT$@xAB L\$H u!IJ IRH@IR0LL$(HT$MHHt$0H|$8LT$ LT$c11G 鋰 LL? H)IB k \ LbH鄱 H* H5_ H8 1龲 Lb0^ H/ H* H5Q H8 1 H 1ó HPH\HHWH z ۳ H HHt4 % hu Ht'H Hz* H5&x H8 e HtHG: ̴ HWHT$H HG H$ 1H H M < H@ 1i G` y 鈵 {` ku)H, H k鄵 P1} Vo Hq* H H[]A\A]A^+ L H $ L H H;5* B( HU* H<$1H Ht$HH HH6( 8( LT$LL$LD$LLLp H\$Hu'H|$Ht~ H|$H0 & L[Ht$LdY udH;u LLLo LD$Hu Ix6Y HT$H|$L{ ٶ H|$H 魶 HkHHHE { H|$Ht|l H|$Hu~H鉶 A fHHt? H|$H` , V IXHLH H|$HuH|$H. $ H|$Ht HHX* H5 H89 1e N L%(* Ht I9 tHE HZ[]A\A]E1M H* H5 H8 1 HyKPE111Lx+ HD$Pj j Ht$(* H Ht$Ht:H(HuhL`Mt8Lh Ht"H H* H5z H8b 1隷 H银 LhMtE11ض Lh϶ E1E1Ķ H^w { PH>* H5G HRH81b 1ZHH HH57t HH* H81b S G` u u ea H C` ݷ C` W ÷ 1҃鳷 1҃飷 C` 1҃錷 1҃| Z[]ù HH=s 6 i [1]A\H 1W I~ L襹 HC HHL HC H . H? H5 HL踾 LHC H{ H uH* H5~ H8^ ZHz* H5 H8C ?H HC 餸 I}( M}Mu Mmҷ P1 G` 5t 頸 ATIUHSHHHHu I|$PHt HӅt.HӅu%I|$XHt HӅuHHL[]A\9 []A\H1 E H1 6 H 1' L H HY Hֹ H=q K t,H+H[ HH H=)* H9# # 1# H H= 3 1$ H# H< LD$Ht$LL$ LL$Ht$HLD$ItKHJ HJ HKL= LHs HHD$ I9tL- Iߺ r պ H|$ H<$ 1 $ H|$ H|$tG @,$ $ a 1$ H* H5j% H8 Hp 1x IL^ H IHtL0 HHt$+ t9H|$+ t+Ht$1H H;* tH[]H HkH* HUH5 H81(^ 1O Ļ \ H{' ' HH* H5H/ H8 )! ' H= ! n' HYH!( ' 1' q\ HuHEH5 HPH* H81|] H' 1H[1[]A\A]A^1[]A\1[]A\111H胸 L LL$HL$(MHHT$0Ht$8 i H=; L 醿 H= HL$، MHL$HtLHL$~ HL$H|$HtHL$e HL$MtLHL$N HL$MtLHL$7 HL$HC`fHL$IHD$8HChC`HD$0HCpHD$(1HCpL L 1H= 7LH=m 1v IHtIH== i IH] H=! ܋ HL$H111H L|$0 r L|$0 L|$0 LQ HL$H= H= t HL$HLՅ []A\LՅ LՅ LՅm LՅU LՅ= LՅ% HL$4HT$0 LD$8f(辰 H& Hİ f([]A\A]A^j HH$ H$h' f(,$fTf/-ș! C' H* H5L H8 1+' 1H2 ' HHt$Ll$@ Ht$HHn& m & m & 1ҹ HH=k i $ 1& 1H* H5 H8! 1 Hk* H5 H8 QHR* H@ Hl= H9FtH* H H0@ HFHN(HV LN8LF0Hr y1 H* H ZI|HtHT$HAHT$uHH?~M$ 1鏽 韽 M\ u! T$' HL?M t\HCM@ H HHHL* H81b\ unI,$AD$u& MD$F' ! \$U' HCIHH5P HPH* H81X LC 5˘! t$' L( =! |$& H= Y E1 1[J H}* H [1[ ' H8 ' H=1> ' H* H8 a ' ' H* H5i H8 ' HH* LLH5 H81W T* H* H5 H8 L-2* ) H* HRH5C H81qW 1H IL 111 AWAVAUATUSH t$4HT$HL $H H* IH9Gt/ H=I oH=4i HLA ( HHt;H@ t.H$ $ I H9 IH$|$4H5z y& H4$H xM1M[HMuMtI9} MvH1D$DH|$81L\$PH|$(Lt$H|$ HD$Hx HD$HD$h$u" HHD$Hߋp H߉藿 H|$P t;HD$HL$PH;Hpu+|$D9l$DuH|$8 tHD$HL$8H;HxtJH|$(+HD$l$DHD$( H@pHD$PHD$H@xHD$8(Ht$(H<$l0 y HD$(H|$( HD$L`xHD$HXHD$LhpM M H$Ht$H|$4x LL1H=;g o IHn H4$HǺ } LAt EI H$ 1ҹ LH$ D$l PHD$tPLL$XDD$DH|$] D$PY^u L$ Mu" H$ H z IGHL$xHT$pLL$|LD$tHD$XHD$p HCHx C 6 |$p + |$t Hct$x |$| L HD$ H@ Hct$|L HD$H% D$t9D$p HT$Ht$ LB HH HVu HHt w IHu H H! LMHH$ H$ $ 1$ w IHuH诼 LGl Z H$ LHL tIEHuHz Ll w H8uH@8uH@t(uHPH@HDh,Lcr,AMc HPH@IIIR,DH$HcD9}O@<r@ wMILрt+ILcA9~OB + wLHHtI@)u/HH a (B<3[tIL9 B<+]MmtL9H d LH HL$ LHL4 HL$ HL,R Lj a yI Lbs HT$XHHt HHxL8 wHHHـtH|$H a IIHD$XHcT$lHIH)LL!HuHT$HL$ H)H9 D$@ H$Ht$H|$4t Ht$ L HD$ HxBHt$L HHx-|$@ tALL IHxLL IHy# H$ H IILL-6` L!HD$AIcH9|;H=t H9D$ } I9I9t H|$LuHH4$y y#H4$H=2 y xH$ Ht$H$ Hth腹 aL{ xS xJH|$b HD$H@HD$jH|$(H~ HH<$* H|$ u 1H|$ HĨ []A\A]A^A_ÃÃÃÃÃÃÃÃÃÃHH= HT$ _ HT$u H1[]A\#& 1ҹ HH= & & H脸 1w HCH5Z HPH* H81N 1 LT HsHt H{( H=#* Lc0{& LcHr& LuHC& LuH:& t$ H= N 1% & tC @% % AWAVAUATUSH H|$T$,L$8DD$<LL$@H H1H <u HuH~HHظ >m H=LD $ IH. L5* HL-D HH_' 1I W HH Md Hu= IHu 8d H@ / HHD$HtHHD$H|$6I@ HD$HI@ HHD$ fl IH H@ txLLD$P\ I LE1HD$0 Ld$Ld$PIH@ uEIL9t$0 LL$ HHuLd$bc MtL% L s< HHu6c HPHD$HHDH= ~ H H\$Hq HT$XHHL$PH|$P迵 HHT$XH9LHt|~/Ht /HHt$H<UH|$ HLLZB HG 1 HHNLd$Ld$1MtL> L6 HuL) H~ AŅyL H 1g 1҉HT$hHT$p8 Dž H5^ IH 111HV IHu L( HE H 1Hl$pA A A~@ uHt$hHL9 LI Ht2Hx HHt I HLI L Da E1H- 11DHu L H L! L-* IHLH# 1IX 'T LH謳 L HuN` 1Ht$pI H H\$p HHm Ht H` Y` OHE1F |$, ~H HHu W` 1D$,AA9} HI Ht$p1H Hl$pK HHt ` Hϲ HHC H$ tH$ HHC AAA tLkH@t Lk0LkHL{1LcM9}*LLD< wHHu΅t(LLH7 IHt HL D_ H$ tD$8)H$ (HT$Ht$@|$<k xAHt$|$8l x/Ht$ Hp xHt$H=1 q H虱 kHĈ []A\A]A^A_H[]A\A]A^A_ [ QF Ht H]* H8P uw^ 1ZLt$HL 遷 H* HH5 H81cG ! 鈷 Z H\$Mt HH5 L1.G HH5 L1G 鳷 Hl$LD$LLD$2 LD$LD$%! LD$ ! ! *2 1U0 / D$ DLLD$HDL$@)ƋD$()ʳ DL$@LD$HHI/ v0 DL$ LD$Hl$Hl$DL$<LD$ B2 L:2 HL$LD$ DL$<9L$( D$0( $ DLD$DL$^ DL$LD$X$ $ V( LD$DL$1 L1 DL$LD$0( LLD$1 LD$D$ 1E1l$D$@1E1A9~UEk HElIE1DT$($ % EuEDŽ$ - $ m- AFHL$P9}BEk HEl= wL$(= pv"9L$r' Aj L$ 0- " 9L$}%Aj L$ - 1E1E11HT$E1|$8 f ! H! H$ 7) $ % D)ȃ~QDDT$0LD$(DL$ DL$LD$(L$ s! DT$0YfIn\$ "/ D$D$(+ IE1E1E1 E1E1E111E1E1HL$E1I1E1H\$L# A T$dIDL$(Dd$`H\$XDT$<E L$ H I% $ DLD$DL$~ DL$LD$f(fIn\f$ f.% c% HH9= I. $ % = tTL% DLD$DL$!~ DL$LD$X$ $ % B/E1E1D$D$ 1N D$ Et/% = w k )A9tC$ xAt Y eE1% D$ $ 1 E1% D$ $ t$ IMDL$(H\$XDT$<Dd$`D9T$, ! H! H$ & HHD$Z H|$P Q. HĴ* H5 H8 b9 HHD$LD$8LL$ HHHD$ LL$ LD$8H Ll$HxLLD$8HD$ J 'LϪ HL$ LD$8HB\H\$IH\$H/ $ T9 H]* H5 H8 8 HE1D_v6 Li 8 H%* H5 H8 {8 H鳲 HiH駲 H1[]H|$PE E11 H5* X H|$PE H´ HE 鵴 Mi H)LHK S L E1C 1ڴ H=* H* H5 H8 1v: H耩 ^[]A\A]$S H=]* ; H Q* ; w> H< HS< ; H=(* : 1: HPH* H52 H81`? < H < H* H5@ H816? B H* H5# H81? B B߃^B Hv* щH5 H81> B C ` > LnHA1 C0HL)S1HD$HHC SHCK HC(GA = H* H5 H81m> B AHT$DIL HHA HD$HH5 H@HHH* H81 > Hħ A LnH2HH= 1D 1C 1 D HY* H5@ H81= H] AC HHH96C E1E1LE HH1E MZF J t HBHH<$E1HW LHM |$( @0 HPt6HA Ao b EщPH 0 |$ H<$ (I H HBHH<$E1HW LHHM |$( f@0 HPt6HA Ao b EfPHf 0 |$ 3 H<$ H `H @HBH HB0@HBHiHB0`I|$E111H|$EOA0 AW M9 B| HH DD!@ ALH)ω@H8L9D$ 9uII|$E111H|$EOA0 AW M9}JB| HH DD!р ALH)ωf@Hf8L9D$~59uI뱃|$( H<$ f@- oG 'G Hȃ|$( H=x x hH<$ @- !G F H<$ @- G D 9AqJ D! ALHA)ω@:HA9}F tu%IBHJ: IBHK6H@IBHtIB0H* H5L H8 C H= V IRHLyD IRHADA!A ALHHA)D@:HuډE F C |$( @0HPC HAt0Ao b EшPH 0B HD$pH 0E x HHG HRHF @IBHIB0at1H[Ht$Ht$HHHV< x H{ Ht$HFHuL HK HFfI HF]I HK HHHH)L t1fo x! f8?ȃK fo |x! f8?K IUK fo x! f8?K I9ٸ LIMHHNI) MILHH9HOIHLHPMLARMASMAVP H L HL$ HL$Ht$HT$ HT$Ht$HL$L$ L IL LL$ HL$HT$Ht$趪 Ht$HT$HL$L$ tL| M^L|$@ML K t- E(Q HHP P H@H Q H-* H5I H8 2R I8R Iw I?LHz |$` u2HSHCIG HmQ Iw L$PI?G HCIG PQ E1IW L9C~LLDIK H ,* X N PH* H5 HRH816 1Zþz H= 1 7 H[ H* H5 H8 1} ' 騭 \HA0 I پE H= E1; ǯ Lٟ L̟ E1骯 CHCH1ݯ Ht 1HH3袟 1^ 1Ӱ H茟 ð HWLFHtHB HDH* H E H5 H815 1R HR I~ R H;5* u$HE 6R H= Q Q HH* H5 H81*5 1OR HB HDHP* H $E H5 H814 WH\* H5! H8 H81[]A\A]HHy H5* H=T\ 軾 Iް HHR H5* H=-\ 蔾 H* H5 H8 1R IA ?R 1[]A\H{ HR R 1HH|$ t H|$G @uH5 Hi 1H1H醟 Hֹ H=F u [ HD* H5 H813 1 HKHh H5 H=AF 覽 H HI H5 H="F 臽 H L L H<$ H|$ 銴 HCfHnLsHLpfH:"AFΜ LƜ X H蹜 L豜 C H褜 6 H=* 蓜 L苜 H胜 x Hv Ln La HT 1餷 P| H=k ZRH * HH E H1 1YH HDQ HT AWAVAUATUHSHHXHwE1H~%Le 1ҹ HH= ?s u L-g* I@ Iȝ H9Q HI HD$%Q HI IQ H|$ HtHɤ* H9T$uH* H5ZD H8 BI9tMuH* H5PD H8 HtH9u Hw* H5GD H8` E1X MH5w H=?D IE1| xHD$H1I H HH\$HHD$ HHuG 芚 HD$Ht$1H I HD$H HHu G < H HH> HxH* H8:HH9t 9/ Ht Ht$1H I L|$H> HHwH HH这 Hx H* H8HH9 . Ht(k H|$Iȉ ϲ HHH|$I 貲 HH HCH HE LQ HD$ Hw H6Q HD$(Ha Ht$1I H L|$H6 HHuE M Iȉ L IH I L HD$H IF HD$H@ LP HD$0H H|$jP HHD$8 L H HT$8Ht$0HHD$褑 LI H|$ H|$ IT$ Mu ? H@ H* H0H~* H8Dž IHu7ٰ , H H* H8\ H脗 H| HHuH* E1H8( +HHtHPA| HDHL$(HT$ L IH# H MtL LF M 1LH5s H=a@ M H1Ζ LƖ H辖 H豖 QH褖 H蜖 H菖 H臖 Hz Hr C H` LX HP H > L6 H. H|$$ ,GC 6Mu1Ht$1I H L|$HN HHu C LLT t H|$HX[]A\A]A^A_j ML蕕 HXL[]A\A]A^A_à H7* H5HX H8 1 H* H5+ H8 |K PH* H5" H8 1ZHZHQA L * HHL$Q1j j H HHk ) Hu.H* H5> H83 HR* H5|> H8 H裔 e L9$H< I4> MtL > > MtL > MtL L~ UHSHHu: H= r Hל* .H|$Ht$1H H I HD$Hu'[H$^ H 164 HD$H8 HPH u%H蟓 H0* 1H5? HL$H8 Hl$ Ht} HE tlHuH} Hu'HK Hl* 1H5-= HT$H8 8|7 u1HH} u H|$7 HH H\$ttH\$HtjHC t]HsHu'H̒ 1H5< HD$Hߗ* H8 -HH u HH1@ HH腒 Hl$Hl$HH[]1ҹ HH=b i > H* H5# H8 H1[]A\H* H5U H8 I<$Z HHt$H6 HHD$ Ht$H & Hſ ~; x L k H}* H5 H8 P H* H5; H8 5 H~ ( L C 3 _ tHHD$fE1f/ H|$ f/h! r zf! f/ ff. Yh! fH,ȉΉH*\Yh! X9h! H,t Q tD$ = 11D H + HH)H4)H,(@4h1l g fWe! A D$H* H58: H8q ' D$ XD$ = 5=|FfҾ f.E΄u\ H%* H5 H8 듍 1H* H* 1ҹ HH=_ f H1[]A\H* { H8tH5A H5Q PE L 1H{pH{hC E1 H) E1H{hLSpC E1h H LH( HL IH8 Hk@/ IHC@L{8II?1 { t'LcPIt L;c@tIHC@L{8II? H * H58 H8 `L)( L E1H{hLKpB 1H{hHKpB L) L qN L Lэ CL LL$R MLL$A IK MQ HQ L K L脍 /7 E1N MuBO H* H57 E1H8 LM K H* H5 H8 LE1' K H* H5w7 H8| HD$0A HD$HD$J HCHH5 E1HHHl* H81# +K H͛ H8赌 H>* H5/ H8 H菌 1$ H-* H} + t IFH} HH5* HH1" 1 H HHd MR I LHA Z1[]LP H P AT$LL9P w H ƕ* 9t+HAl$LL9P 3 u HP P Hs JT H蘋 H舋 H~ Ht Hj H` HV HL HB H8 H. H$ H H sH fH YH LH܊ ?Hϊ 2H %H赊 H訊 H蛊 H莊 H聊 Ht Hg HZ HM H@ H3 H& H |H oH bH UH HH؉ ;Hˉ .H辉 !H豉 H褉 H藉 H芉 H} Hp Hc HV HI H< H/ H" H xH kH ^H QH DHԈ 7HLj *H躈 H譈 H蠈 H蓈 H膈 Hy Hl H_ HR HE H8 H+ H H tH gH ZH MH݇ @HЇ 3HÇ &H趇 H詇 H蜇 H菇 H肇 Hu Hh H[ HN HA H4 H' H }H pH cH VH IHن <H̆ /H迆 "H貆 H襆 H蘆 H苆 H~ Hq Hd HW HJ H= H0 H# H yH lH _H RH EHՅ 8Hȅ +H軅 H讅 H衅 H蔅 H臅 Hz Hm H` HS HF H9 H, H H uH hH [H NHބ AHф 4H =* HH$ H豄 1 H袄 A Ar HQ* H5:| H8 1; Hk H* H53 H8ù HK HHT$ H= - 1H$Ht$ + H= c HHZ[]nL HHtH HH P H=d $ HZHH 1H HP[]A\髃 V- L^ H;H 1H舃 HH5 H@HHHEHPH* H81 H;Ha 1HB R L 7 L 蘮 1Ƀ_!L 1L 1L 1L H؍* Hcދ zL H* Hc1Ƀ_!ZL $ 1ɅGL 1@L 1Ƀ 3L 1Ƀ &L t$ w2T$ 1H Pf_!K H[r$ K 1ҹ HH=~1 Y [1]A\H 1i H=( H DN H5_* H(H=`1 1[]A\A]A^A_2 MnH Lʊ AF V LLLJ IH HD$HxXHtHɊ* H9G HD$HpHHtLH=0 1p2 H H5* H5* u HD$HxXH MnH H=* 1^ HuH* H5 H8L LԀ HIQ - H=$ H- 1 HuHO* H5 H8 H|$Ht1HD$b H|$HIVO HHtLt$Q 9 H|$; tH|$G 1 HOH HɄ* H5 H8b 1rM T$ M LZ[H]A\A]A^A_ L 1 H* H8 tQ , 0R HHUIH F: H/ HEH5 H4* []A\H8A]1A^ HH : HSIH. H5 HEH* H8 P H, bQ HL* H8t t +, G HG* H8W 0 Z[]1H k. HH5 H=g. g x%11ۉ H5* H5> H8 Z[]~ H* H5 H8׳ 1! H;5ч* u H H߃* HIH5 H81 []A\' H* H5- 1H8 I AR t LLYG J H= 7 ZL@0 L@H H|$} H|$H} 19 HHL$賆 tGH|$H} HH=(g H * H5 H8Բ H|$HZ} HL$A $ HqH> HqH5 LHT$HIH)LLHIF HH H|$@Ht| H|$8Ht| 1E E HIL9 CD #vHD$8Ht$@HD$ IH H PHD$PPSATLD$(H|$86 H IHnHD$HLH)HL9 IVL9AF IB AB @$ IJIR0 uIRHHLLT$ ' LT$ HHtEL{ H\$Hm % AF HLLT$(f- LT$(HHhL{ IJIR LHT$HIH)LLHIFj[ HH aHH? L)HT$ AHT$ H ?{ 5{ LLT$(3 LT$(aAB H HT$H|$ ILL Q H5 LT$K< LT$ Q 1[]A\HE1 1 H<* HUH5 H81 Lz E1* IVH HUMLH5y H* H81 LHz HUMHH5 HUMLH5 HZHQA L[+ HHL$Q1j j H HHj [ Ha Ly @[]A\n# Ht LI9s'LI(LHH* H9G HH)HHHH9 HBH1H4H9sHtH4HB 1ҹ HH= ) P 1 ID$ Dl$ l$Hx0& HHtA Ht*HC HtHC HO Hx Lx 1E tHt$ H' |$ D$ IH HHڸ LH_x HWx H LFx H9x L1x xLH |$ H= M H?L)H9 fHH*XD$D$w Hw Lw 1O HoH+G IHtH H}H uw H5~}* HE LWw 뗋SHc5HRA Lk+ 1HD$(Pj j H HH2 SH|* H5S H8k Lv 0H|* H5h H8H Lv H\|* H5} H8% Lv Hv 1) HYHH1 L~v E1J '+ H{ ٜ HiHRE1L* 1HD$Pj j! H HHlK Hv 1'L PE1LU* 11HD$Pj j H HHtL'9K H# H{ & H1> Hu @ M$ LHI9INIoMLt I)G H麶 H5S}* H H H!z* H52j H8躪 1~ 1ҹ HH=s L + 1Y Hy* H57 H8x I<$Ht$x[ H{x1HKxHtt H 1H H 1H t Mu1, IH, Ht$H~ ~L 0 Ht$Hmt HH HD$HtTH+hH~HH uHt$ME HD LK H|$Htt Ls HH HD$HHx yaHD$E1H+hpH {* E1H1I$ C I} Hax* H5 H8 ;H= I | uH|$H[ c H|$Ht;s M.H{* H\$LH W HD$HtH s H|$ Lr Ht$H H{* LH W 9 HD$USHQH HhH)Hx.H9|)H~*HH)HH; HtH Z[]HHH HH?E1HыU ru H H LL1AуE H 1ҹ HH= I t&HI 1I # Hu H=I 1OI E1҃J C` E1҃2 E1҃! G` X HQ C` E1҃ H C` 1҃ G` 7 G` 1HT$ He C` v j H荕 C` G Hl$1 C` E {` l 1 1 1Ht$m H C` } HZ H DcH DcH H W H HcH$HcP HLcH,Lc@(PH PHv* H01J ZYH- V N } H轓 HG H5^ HF H/ Lc@(LcH,HHcH$HcP H VPH!v* H01迻 _AXHt. Ht C` C` {` P1 C` H C` G {` uDk % HuZ e u Hu C` G` ) C` AP H( AF` A - A H AF` \ A AF` B W AF` 0 A~` A L xOIVHcA~` HH@L$D$A P1 AF` A l A AF` P1 A F A P1 G` z H" A AF` P1[ HH=C D " HLu ~H}Ht$ { n Hu A A A AG` / Hu A { A l A AG` U A AG` i A` A @ LW x9IGA` JDhDp A A A AG` A AG` A` A Lŏ x8IGA` H؋XD` A A I A AG` A # A G` ; A 1 AG` A` A A L x<IWHcA` HDhDp A A w A AG` ` Hu A A A AG` Hu A A A AG` A n HuNA U Hu A A A AG` A AG` Hu A l AG` A AG` H AG` A , Hu A A A AG` A X HuEA l AG` E AG` # AG` A 6 A AG` A AG` k A` D A U Hu A A A AG` L x>IWIcA` HHDp $ A o A A AG` I Hu A A z A AG` c Hu A J AG` A AG` & AG` ] A L! x<IWIcA` HDpDh A A A AG` % Hu A q A b A AG` K Hu A 2 A # A AG` A` PA =p L Hu/A h H A x Ls HtA PA =p u AG` A` A P PA =p J LEo! IHt L HHB EoA A` = A "AG` $ A` . A u Hu A A z A AG` c Lӈ xTIWIcA` HDhDp A AG` A` A A AG` Hu A A A AG` AG` A` u"A_ c Hu A A A AG` AG` b AG` @ AG` A AG` v A` OW A AG` A )AG` + A` A LL1_ L)_ H L胆 HL IHA H IT$LLcH4Lc@0HHcJ,HcR(PHz PHh* H01q ZYHtA Q HNA AG` AZ1[] Hu;IS IPA L|* 1HD$Pj jKw H HH H(1[]A\A]A^A_M`I뷋 1҃ Hم xHSIcă{` HDhDp 1҃ 1҃ G` | , H} C` t f C` 1҃O 1҃< G` y H C` 1҃ HՄ x^HSHcŃ{` HDhDp 1҃ H C` C` 1҃i LmLu H L31 8 H x2H<$H ^ H$H,Q L 1 H: LmLu H HtGHtExHHH)H wEW HHH)H ? EHt HEH AE AIT A L=N' LjIHE AEE1H9E AMHHH9M | I9 ~ H H+ f~fEx>DzMcIL9 H H LHH UL HfInfH:"EH H H)H7g H H5! I H 8HHF(H$LnHF0HH,$ LmH Lu H H)H7[ H H4! I H 8HHF(H$LnHF0HH,$ H HL< L)HLiL) ALmL} MH x*H HcL4 L)HL"L) HEL;H LAU AIƃIT A tL=E' LjIHT$u HT$tHl 8 H HP LH x H$H H H,H 8 H H HT$#u HT$?l}( t u@ t L9s L3L HUHM Hb H L9sK L3H LmLu H H)H7= H H2! IH 8HHF(H$LnHF0HH,$ Iu HHL$V H AUH,$H HL$H9 HE HI L DxH H+ McIL9r\H H LHH L 8 H xLH<$H H$H, LH xH$H HtH,H1 H* H HUH $LL<$H 8LJU(F, HN0Mi V(LnD 8 Hj 0 H<$H tH$H,H뗾 H: H<$H H$H, HcHH9 H IHH LH H c 1L9s L 8 H # H<$H % H$H, #r ! qE1Ʌ HHI)L H>LmLu H7 H HELH 8LHE(F, F(H$Mi LnHF0HL<$ L 14 HT$q HT$< L 1 L 1 8 H H PH HcHL)H9 H J<>H HT$ HT$H L H9E H t E1Ʌn HHI)L 1T HMJt>HU HqH H HE HMHHHHHHT$ HT$x"H<$H tH$H,L $H HT$&p HT$ oH HHHT$] HT$x)H<$H tH$H,L 9H H H HUH Hw H 18 H S 1# uo AL3HA tL=' LjIvHT$2o HT$tH L E1Ʌ HHI)L VH L3LmL)Lu H7 H AE LH 8ID HFE(F, F(H$L<$HF0AE Ml H L 1 1L9s L 8 H xDH<$H H$H, E1Ʌ HHI)L H 8 HU x H$H HH,H HHH)H 8 H H$H HH,L 1 E HHH)H HCL[L9te1L9rl1M9 19| HD$I9b A> A9E ] AIA V AEIIL 1y Av f {@g l~ ]~ f_ @E Df 2Df "D+~ D~ fA_ l kAE 9 H HcЃHHHHH9@@j Ha H9 Ht$I9 2fA96 HIAE 9 H HcЃHH4HHH9 H H9 HD$I9< Aw H [* w H=[* 9 HIAE 9 H HcЃHHH HH9@@M HD H9 AA i AEIIL 1, L 1 L 1 L 1 AA tAEIIu6j tAA tAEIII j t\L 1 L 1 L 1 L 1r HL$i HL$ HD$I9= A6A} t 6 AIA / AEIIHD$I9 Aw HY* A9E AIA tAEIIPHD$I9 Aw HY* A9E AIA AEIIL 1_ L 1Q h tHULu HAHA tL=x' LjIHT$Rh HT$txAHHH)H HE uHCHL)H I9e L 1 HHzL3L HpH Hu HL)H9 H2LmLu H7 H HELH 8LHE(F, F(H$Mi LnHF0HL<$ fA> T L 1 H L 1 AE 9 H HcЃHHH HH9@@ H H9 HD$I9 A>HL$(HT$ r HT$ D$:q 9D$HT$ HL$(x HIAE 9 j AEAIT A LjIL 1 L 1 4f HD$I9 A>HL$(HT$ HT$D$ : t$ HT$HL$(9\ HILAEH+SHH9~ HLH)H Hf~HH+ fEH tFxBDzMcIL9 H H LHH kL H LmLu H H)H7vaH H?#! IH 8HHF(H$LnHF0HH,$ 8 H? H L m 8 H yH LH x H$H H$H,HK L 1 L 1 AA tAEIIx9d tL 1 L 1 H HcЃAHH4HD% HH9@@uHu AUIT t$LjIt)AEI IHT$c HT$tc tL 1 L 1 HT$]c HT$oMLMH )L$fI:L H Ht E HEHU L+H HEHp~HH9| )L9h HH H+ H H HEfoT$HPH HH HLxHEL HPUH L)H7 H HELH 8LHE(F, F(H$Mi LnHF0HL<$Q HN EC HHH)H + HT$a HT$ 7a 2 %E HHH)H EHuHEH H[ xH HHH)HH膙HU H 8 H xKH<$H H$H, DxH McIL)HL"L) H ` = 8L 1x L 1j L 1\ H HCHsH9 1L9s(AVfzw H=R* f_ 1I9s'Afzw HR* f_ 9 HD$I9= AIuH辐 3 AE AIIT A # LjIL 1t HD$I9 A6w H]P* 40I} AE AIIT A ttLjIHD$I9 A6A} AIA AEII`L 1 L 1 HT$ _ HT$uIL;sC fA~ 7 L 1s HCHKH9 1L9s=Avf t$ w-HL$t$ HL$H Pff_ 1I9s:Af L$ w+T$趉L$ T$H pff_ ȃ9~ LmLu H Ht8H= E2 HHH)H L EHt HEL IH Hm 9 HD$I9s A6A} h l AIA e AEIIL 1 L 1 A] L;s fA> ~ L 1 HCHSH9 1L9s=Avf t$ w-HT$?t$ HT$H Hff_ 1I9s:Af T$ w+L$T$ L$H pff_ Ѓ1 DPH McIL)L9r4ILH LL L e L9s1 * LHLT$v LT$x H<$H tH$H,L H HD$I9 AA;E AIA AEIIAEHLH9D$ L3AUIu H HG H H,$H IAUHE H9 AE IT : AA LjIYL 1 L 1 Z @LHD$I9sSfA> t>AIA t AE II1L3HE Z tL 1= L 1/ L 1! L 1 eZ &L 1 L 1 7Z ZL 1 L 1 Z Ww H HHH)HHT H HHH)HHˑ Hr H xH H$H,HF 8 H xH H$H,H L 1 E1 L 1 ~ Hrf~H fEHtPxLBHH H9 H J<>H HT$HT$H H L L)LmLu H7v7H E(LH 8LnF(H$F, HF0HL<$ 8 H xH$H HtH,H HHHT$ HT$x"H<$H tH$H,L H L 1 8 H> x H$H HH,H L 1P L 1B W HCHSH9 1L9s(AFfzw H I* f_ 1I9s'Afzw HH* f_ 1 H HHH)HH$L 1 L 1| L 1n HT$V HT$L 1D L 16 L9sD}( t t L9s+L3L HT$LV HT$HU H HE HMHHH1 H}HDHU HGH H oMH}H ) $fI:H H Ht M HEHU L3H HEHHqHH9| lL9pbHH H+ H H HUfo$HJH H H HLpHEL HPH UL)H7 H HULH 8LbU(L@0M@, I P(HL`5 Hp Ee HHH)H M DaH LD$McIL)H4L螌L) LD$LKf' H E1 HL$HT$L$DT L$HT$Lf' HL$ H AD$II9. L3AT$It$ HHL$L$ HHV H L$M4Le' HL$LHE AD$H96( A$I:4( AA l( LbH H HcHH)H9rIHH HHH H }( t u]L3H A HHLD$H$h H$LD$Ld' Hcx)H ItJ, H oL9s? : H a H HuHH 8Lfu(L@0I@, I p(L` HL$ L$L@d' Hcx`H I J, v 8 HLD$H $ H $LD$Lc' Hcx H ItJ, HIk f H HUH HLZL3H HxH E[H} HH)L9 H:LeLu H7 H HUHH 8LbU(L@0I@, I P(HL` HL$HT$L$BQ L$HT$Lc' HL$ PH HcHH)H9rzH H H<LD$H$H$LD$Lb' H H }( t un t L9s L3H A 7 HHLD$H$ H$LD$Hcx H ItJ, H L L9s It$ HL\$L$ HH L$H La' AD$L\$LH9u Hu M4 ~ Hzf~H fEx]HtXHcHH9< H H H<LD$H$謇H$H LZa' H LD$H H)LeLu H7 H U(HH 8L@0IȉP(HL`@, H 8 HHL$L$^ L$HL$L`' HcxH IJJ, A? 8 HHL$L$ L$HL$L`' HcxH I?J, 6 H HHLD$H$ H$LD$Hcx H ItJ, H HLeLu I7vJH HUHH 8LbU(L@0I@, I P(HL`@ HF 8 HHL$L$ L$HL$L_' HcxH ItJ, z HLD$ LD$LI_' HcxH J, 8 HL$ L$L_' HcxH J, H E1 HL$L$L L$HL$L^' , H E1v H H uQE1] HH H H+ H9rLH H H HHH EE1ۅ HHH)H HHLD$H$ H$LD$L^' HcxH ItJ, zx M9Y A>HL$L$ I|$ L$HL$L]' A$AIIA ttLbHM9 Ic6w H6<* 40I|$HL$L$ L$HL$L?]' tiA$AIIA t_LbHHL$HT$L$#K L$HT$L\' HL$\H E1 H E1 HL$HT$L$J L$HT$L\' HL$qH E1I H E1: M9 A6A<$HL$L$U L$HL$LB\' AIA AD$IHM9 A>HL$L$ A9$L$L[' HL$t{AIA tyAD$IH@H E1{ H E1l HL$L$I L$HL$L[' WpH E12 H E1# HL$L$kI L$HL$L;[' a'M9 Icw H9* A9$ AIA AD$IHaM9 A6A<$HL$L$S L$HL$LZ' h AIA b AD$IHH E1? H E10 HL$L$xH L$HL$LHZ' M4M9 A>HL$L$ A9$L$LZ' HL$uAIA t}AD$IHhM9 Icw H8* A9$ AIA AD$IHH E1V H E1G HL$L$G L$HL$L_Y' ]KH E1 H E1 HL$L$FG L$HL$LY' xH E1 H E1 HL$L$F L$HL$LX' M9 AIA tJA$IHM9 A> AIA A$IHHL$L$nF L$HL$L>X' t.H E1 M9sWA$A9t]AIA t[AD$IHuL\$L$F L$L\$LW' H E1 H E1v HL$L$E L$HL$LW' t~Hc H E18 M9sLA6A<$HL$L$ L$HL$LDW' t2AIA t0AD$IHH E1 H E1 HL$L$E L$HL$LV' tH E1 H E1 HL$L$D L$HL$LV' 'H{HCH<$H9 1L9 H$E1I9S D1΅ H E1 HCHsH9w 1L9sUA~ |$ wEHL$Ht$L$oT$ HL$LU' H Ht$HL$Pf_ 1I9sPA6 t$ wAHL$T$L$0o|$ HL$LU' H T$L$xf_@ 9 H E1/ E^ D= D= D4U DU @A_ @E A D[= D= DT tD;U A_ DSHL$L$B L$HL$LT' HCHSH9 1L9sUA~ |$ wEHL$HT$L$mt$ HL$L<T' H HT$HL$4pf_ ƃ1I9sOA T$ w@HL$t$L$rm|$ HL$LS' H t$L$xf_ Ѓ1aH E1x H E1i L9s H E1P L;s A> H E1- L;s A~ H E1 HCHsH9 1L9s%AFz H2* _ 1I9s&A6z H2* @_@ 9& H{HCH<$H9t/1L9r7H$E1I9rx1D9 H E1R H E1C E^ D: uD ; uDPR uDR @A_ @|E A D{: oD: _DQ OD[R A_ D.HCHL)HtI9 H E1t A> u HCHSH9th1L9s'AFz H5[1* @ƃ_ @1I9AzH&1* _ 1H E1 H E1ֽ LAD$H+SE1HH9 HLH)H HLeLu H H)H7v{H H IH 8HHP(HL@0IL` A$9 AD$AIA LbHH 8 HL$ L$L-P' Hc^鴿 H9E 2 H t!EE1ۅż HHH)H E1骼 A$9 g H HcЃHH<HHH9@@I H@ H9r M9 Icw H5G.* Hc2w L 4.* A419h HIM9 AIt$HHL$L$m L$HL$LO' t~A$AIIA ttLbHo8 HHL$L$Y L$HL$LN' HcxmH I J, H E1c H E1T HL$HT$L$< L$HT$LgN' HL$\N A$9 N H HcЃHHH4HH9@@0 H' D,$ILIH\$HL9 M9 A>HL$(LD$ ?G ;D$4G 9D$LD$ LM' HL$( HIA$9 V H HcЃHHH4HH9@@8 H/ Ld$ID,$IH\$HL9 M9 A>HL$(LD$ ; LD$ HL$(LM' 9 HIH E1髹 H E1霹 } NH L$HcHH)H4HrL$P L3H LeLu H H)H7. H H IH 8HHP(HL@0IL`Ȼ 8 HL$ L$L'L' Hcx5H I J, 閿 H E1LK' 鵸 } H HcЃAHH<HD% H@H9@@uHu AT$It%LbHtCAD$I HHL$HT$L$9 L$HT$LVK' HL$tAHL$L$Z9 L$HL$L*K' tH Eӻ HHH)H 黻 ILD,$H\$AA tHAD$IHDH\$LE1D,$H s H\$LE1D,$H X HL$L$8 L$HL$LpJ' t`H E1" H E1 8 HL$ L$L-J' Hc鴹 AA t0AD$IH~H E1鹶 H E1骶 HL$L$7 L$HL$LI' tA$9 ~VH HcЃHHHH@H9@@u;Ht6H9V M9 :A9> HIH E1 H E1 H E1 H E1 1L3HE AD$H9E } LeH Lu H H)H7R H H I H 8HHP(HL@0IL`/ LD,$Ld$H\$AA tAD$IHHL$L$6 L$HL$L\H' tLH\$LE1D,$H H\$LE1D,$H AA tAD$IH~HL$L$6 L$HL$LG' tHL$HT$L$5 L$HT$LG' HL$CH E1] H E1N E1AL$HHH9M | p I9g ~ H f~HfEH+ xTDqMcIL9 H H H LL$H@mL H LF' HL$fInfH:"EH H)H7! H H I H 8HHP(HL@0IL` 8 HL$ L$LpF' Hc LeLu MH x@H LD$HcHH)H $H4H_lH $H) L F' LD$HEL3LH A$AIփI4A tH E' LfHFHt$L$3 L$Ht$LE' t8 HL$ L$LE' Hc LHL$ L$HcxH I+J, "Ѵ Hȴ H E1 LAD$H+SHH9r ~ HLH)H Hf~HH+ fEH tExABHH H9 H H H HHH H LeLu H H)H7 H H IH 8HHP(HL@0IL`鸳 HEHU H$AL3HA tQH D' LbHvE HHH)H 霴 uHu7HEH 驶 HT$L$1 L$HT$LC' txōNH L$HcHH)H4HiL$LaC' E1L9s H E1L9s H HHLD$H$ H$LD$L C' HcxH IJJ, Az LeLu H H* MHt)x%DYH McIL)LH4L) HEH A$AIA tBH qB' LbH8 HL$ L$LHB' Hcϱ HT$L$J0 L$HT$LB' t H { 8 HL$t L$LA' HcxEH Iɵ J, HL$L$/ L$HL$LA' - / 8 HHL$L$ L$HL$LrA' HcxaH I J, 鰰 8 HHL$L$ L$HL$L+A' Hcx H I J, 霰 闰 H t!EE1ۅ HHH)H E1闭 AEAT$HE H9 M9 }A9> H L3LeH)Lu H7vBH A$HH 8IHPU(@, P(A$L@0IM$Hį 8 HHL$L$ L$HL$L@' HcxH ItJ, 鑯 HIHE +H t!EE1ۅ HHH)H E1逬 LeLu Hu4L3HEHHH)H zHE [E) HHH)H uHt HEH IH Hm M9 AD$A9 Dz HHLD$H$h H$LD$L>' Hc H I H J, ˮ HELu HAHA t7H >' LbHxAHHH)H HE HT$L$c, L$HT$L3>' t#LeLu H Ht,H֮ Eˮ HHH)H 鳮 MHty HEH IH Hm H L$HcHH)H4HcL$L=' 믍NH L$HcHH)H4HcL$L^=' !H E1 L9s}( t t L9sL3H A ܩ 餬 H HL$HT$L$+ L$HT$L<' HL$dpo L L H 1餵 H H L LHq l 藾 H|$@ H 馲 LF HA 1Ҿ\ HE1虔 HA_ 7 H" 1[Ë 1҃ʶ H5 xHSIcă{` HDhDpa 1҃鑶 1҃遶 G` U 軥 HV C` M ? C` 1҃( f; n H FL= Ҷ LL9ƶ f9 HnLL9 ;и 9 HVLL9 w H * 9 HnLL9S 33 H1Ht$H<$K H+ H<$Ht$tL9/rHL)H nLL9 ; 9uH ٵ VLL9ʵ w H * 9u8H騵 nLL9 3/3 tH逵 { v q l nLL9 ;膷 9u;HnLL9 32 u H; t H ҵ ͵ ȵ M,钵 Hص VLL9 Hcw H * 9u HڋFLL9{ 9t Hl g nLL9X 342 t&HnLL96 ;褶 9toH 1Ht$H<$5 H H<$Ht$tL9/rHL)H VLL9ٴ Hcw H O* 9t H鷴 鲴 E1醵 P1ص G` 韵 Lc@(LcH,HHcH$HcP H<& VPH* H01Y _AXH~ C` P1r H* H5& H83B 1C ס HR 1Zš HM G` > i P1醶 H HCH5 HHHEHPH* H81蕢 1N L L H/ H* H5 H8 1c Hà S HH= e I|$職 HcЃ Р H IHH I@H鏸 IHHҷ I@0} HzH齺 HB0 HBH HB0g HBH^ o Hѻ C` Pǻ 1ɍP鷻 G` Ŵ a A I MIx HL9 H H L G` v a Q鼾 Q鮾 P1鞾 H HE 1 詷 HEHH= HpH1[]z P鮿 H/ x=HSHcŃ{` HD`Dhc 1ɍPu 1ɍPe C` 1ɍPN G` 萳 H$ C` P G` \ ¿ C` = # 裞 HtJC` 1馿 H. xHKIcƃ{` HDx@D$ 뽃 {` $ L}! H* H5# H8k> H H 1i H * H5" H8>> H HU* H5&# H8 > H H5* H5" H8= H* 1H5 HS`H8= Hh pMuA H * H5 H8= TH * H5! H8= 9IEH< fCh H * H5# H8d= IB Hv * H5! H8?= <$ H H HE Hp * H5" H81 譜 HHE * H5" H81輝 tH * H59" H8< Y<$ HT H HEn H * H5" H8< #<$ H H K HE8 H * H5 H8U< <$ H H HE <$ Hp H HE <$ H H HE̿ <$ H H ֶ HE鱿 LHu H5ڶ H= & g<$ H H HEt L? ;L} , <$ Hr H j HE? <$ Hv H F HE$ <$ Ht H 7 HE <$ H H " HE <$ H H HEӾ IWA H1LE+ HD$(Pj ja H HHP qLaI<$ H H HEu G` ܮ w V P1 H] HJ H4 HY G` 膮 AG` t A` A P1 AG` E HL$HHT$HHH4 HD$ˬ HT$Ht^H AG` A A A H]E AG` A m H;E AG` 螭 A K HiH~ a L H E1I Ә H E13 H H H{Ht1 IHtH LH$d H $HtHtdH{H $ H $HHt,HHL$Χ HH$" L$HL$I * HWI H I H끸 WHAQMIHH AXAY[ËC(H{HL[? H`* H5 H87 1 HC* H5 H87 1G HGX PH * HH5 H81萘 1ZL4 E1 HE Hw IHl I8X A8X I8 I8 fAZ Y H * HH5H H81 1ZH* H5 H8 7 I8XMI8A[G@A 멾 LAZw I8h I8M I8AYFb I8Ẍ́ AIc~ Hc Hc# AIc 111 AIc Hc H>* H5Ǘ H8g6 1J ' A LH H3 * H5U H86 H(1[]A\A]A^A_LH HkHr H tDK 4 腕 H HkHB $ KHQ KHQu KHQj KHQ_ HJ* H5Ӗ H8s5 CHP1< KHQ1 KHQ& KHQ KHQ KHQ H|$ tH|$G LgH 1l H] >] L} H襼 E1 H蕼 ~ HuI HiH E1 PH<* H5e H84 1ZH9E HHt H@HSH HtAXH[]H{ Z1[]H L 1p 1 E1L H|$ Mt 1Q H5p HhL1[]A\A]A^A_p 1LH5 HhL1[]A\A]A^A_L HT |LIE1l HLH5 1 1I H|$ L 71I` H|$ HhLH5 1[]A\A]A^A_ŝ H5n 11H5 L訝 1H5 L芝 0 H5 L1c Lk KDH5B Lo@(IG8 10 H5 HLH5U 1 L <IRHhL1[H5 ]A\A]A^A_ܜ Lt$( H5 L1 L) H|$ Lt$(H|$H L H|$ }H|$( H|$ dHD$H5 LHDLo@(ID$8 1< tL? g1#o IH OHH5 L 3 Li$ m H H* H5 H891 1 H$ HD$ Z 1 1H{D$ HK 1D$ Hs 1 HL[1]H5! A\R 1| LS - LC L9 H=X` u41 HH=>` HT$J HT$U L R H 1 1 X[]1g 1 ~= fTf(. H8 * H5 H80 M " " t"tH9) H8 % H* H8HD$ H) H5 H81膐 1 H* H5 H81g ߹ 1 H|$ H|$ HH[]A\HAUATUSQH * Ha & Ht0HH@ u$HB) H5 H81 H 1]L\ HL{ HHtH 6艎 Hu, IHt HLHI t L= LH0 ZH[]A\A]1` H) H8o H) H8X HG) H8W HH=1 L tBI<$HWH H;) t H H() HRH5 H81ˎ y t HGHHxa t;H{HE HkH 1HCH7 M H* Q4 Hu^y{ 1Z1AVAUATUSH~ uH) H5 H8M- )LfHLh u HY) H5B H8"- E1 Hk * HH@ LpA A9 |)I A HcHȟ HtI 4 IHu []A\A]A^ HU H IEHu L[8 dI$Me HtHIc I I]HA L,I$[L]A\A]A^UH=#= SQH) H@ H H@ H Ě Ht'HuH- * HuH ) HE HhHHX Z[]H7 ! H= ( 1 H= ( AT$Hc u H= p( HcK H{E1fnf:"fC ,7 HL$0HT$4DLD$8 HHcD$4HIH d E1 |$0tH ; ? oHu 1|$0 ;H @0 1t$0; Lw HtHw H|$8 E1LT$8^ Law HYw HQw Hl$LBw Hl$HD$HtH+w HuL w U : u-Y f/T$(t D$LЉD$HHD$8HD$ D$LЉD$HHD$8HD$p LT$8E1^ \e ,fI*0Az\f/wRf(\f/wVAE9}WYYAt IcH=; |$(AY<|$(AA- D$$LT$D$H LT$ fd$(E |$H AtIcH=ϒ AYAA f(A^=z A |$(~ l$ D$ E1 D$ E1m Hvu Eti|$T Y! AfɋD$H*DD$TD$$YfD$(X fH~HljH @H H z E1" fA*YX fH~HljH @H H |$ tD$ A A A D$T A E1D$L H|$v3 1D$ q 1D$$ HH9D$8s x0tHD$ D$HD$$ HD$ ID$p HH߾ D|$ T$ HH Ls HD$H9Hs Ls E1 q HHt1H= H HH1 Ht1HHE H Lfs H1Zs j HMs i Ia [ RHuH5 H= 4 H) HH@ HvHAH Ht(H;p}"H@H9<uHH5 1H=: 5 HXH驑 H) H5K H8% H1[HHlp H5& H= H ) H5Y H8% H) H5 H8% HH=\ [K HH=C [: D$0 u 蘙 1 M D$0Q x H= U Ht$H|$HT$ 躐 Ht$H~HHtH5]= } Ht$HT$H|$s H|$T H|$J H|$Ht; H ) H- H 1 H) EE 1 L H Hu H|$ H|$A HI) Hz[ f 1 LH - 1 1 Hf HHH5 1[]A\A]A^A_= Hz@k JHl 1ҹ HH= ^r HI Mx9LL)I9 ML蘾 HHtrHH Hy L H 1~ I<$Ht$$ t1Ld$褥 HHtM! HE1 IHu艂 HuL\ # r) E1HH L3 L;5) u H HHf H) H5t H8d" []A\< HPHv) H5w H81 1 H E12 HSHE1HT) HH= tOHMe LLl$H$HUMx^H7 H 8 u I- H ) H5 H8! 1; I}Ht$ tI}H辋 uIչ LHI}Ht$蜋 tHueHHHUH5 H_) H81 Q Hv) H58 H8! UHSQH HuHH}H HtH1Z[]d HH[]6 q HtGw H) HPxHt/Hm ! / H) H5& H8~ H HH tH HH HHt$K HCxHt$HtHHH H HHt H Hd) H9tH 1 H) HHQH SH Ht HC H H HC Hu[AWAVAUIATUSH8LwL% HD$HuZQ1H HL9& M|IG uH) HT$ LH} eA yH|$ 15 M11H|$ Ht HT$1H9 L;|zHH>) HT$(LHr A xL|$(MRIG tjIOHD H)H~+IH|$HL$Lmn HL$y L F1H9}'ITH|$1H9~eH;TtH1HHL I9~$H|$H n yH|$HHD$!I L|HHT H8[]A\A]A^A_[LH]A\[]A\H) H LH0" 1 H=t \ HHH) H LH01\ H) Hx LH0 H{H輏 H 1 H{H褏 ]1 DIr%LC Hl$H$) 7 HAPE1Lh* 1HD$Pj jw H HH H Hl$ PE1L)* 11HD$Pj j6 H HH Hl$JHiH )D$E1fD$8HD$ HLT$@D$(D$HML- Hl$MxI H 1 I I { Hu ID { Hu Iv 1 L Ht$Lw\ Ht$Le\ LHCm HC H3 H H}H : A L= ! 1ҹ HH= 舽 [1]A\{ HuH z H H1[]A\I H IHtdH LH@ HpX IHtzH. LHHtWl L[ 1H9b <U H) H8袄 u: Q 1. 5z Ht L Z AWH H AVAUATUSHH H &+ H9 uH9+ H9 H1H5f E1141@ E1H$ D- = LD = A? HH$ H@ H$ @ H1H|$E9 IHtoIAh? tHD$ @ H H @ MpL9s@Dq$Et,D1H DH D)H H @ AI0tH E1E1& HH= n A 31l$(HH4$Ht$Ld$J DAUN J Ht[PMIH5ǔ U1H|$0L$<+3LHLHHk0HD$Z? YL$,1MH|$ IHH$II!qHH Ld$l$(Ll$0%H== H5\ H*M H'= H5_ HL)M H= H5Y HL LH5_ HL LA 1H` Lz LLHHL H %LH5F HL LH5P HIL A @ LIHL 1Gz LHHRL HT$H5> HI,L%j 3L H$H5= HH L HT$H5 HHL LHHT K Hٺ H= 0Hc.= H5 HK Hc= H5 HK H $ H5 HK Hc= H5 HHHsK Hc= H5 HHHVK LHHT FK Hĸ []A\A]A^A_H5ۓ HH Ht$IH IH H LIY I H|$ I誨 IHt Hʄ LI IQ 0u Hu I: H+b HCHP0S Hv) HSH5+ H81v H% Ht$T I t H I@E1D2 1M HcD$fnHS HS0f:"HHǃ fփ H1HC(I$Lc8H H HE H{ Hk L 9} A 1HH ?! H0" Hm N " Hg) HSH5L H81 u I@HHD$C H}H H L Im AtRE e H) H8} | x LeM H}IH U L~s H) HVH5 H81Pt H% Ix u+ > Hs) HVH5( H81t HU) H5 H8 1 H) 1 H HP) H59 H8 1ɉ Z1[]A\A] D Q H{Hh ? ^ LhH H$Lj 3 H$HXH1 IH E1L5 M9b H-) MB<A A<> W IM9uMuM9uH$H;) H9P LLJ<L)蟊 IHt3LH謃 L@ l IpH\ HT LL E1 H$1LhHE IH4 H ) HHрu7HH9' IC HI9 L0 H$Lx0 ~ t HPHX) H5M H81q ^H h) HHkPH q H H<$ (H$@ / HCHHL; R H= HCHH$LxH H$H) H9PtXH) +} L HZH@HZ0H9 A| HK HL GH HLD$| LD$M9B< J Iot|$ II9~| uIo, 18 K41HLD$c LD$Ht H HH H HH n J3|$ HGJHx K41LT$8LL$0LD$(H|$ Wc H|$ LD$(HLL$0LT$8to HL9 H H HHL$I L9n Lm Lm\ IM M X[]H 1Hپ Ha H H@) H8Px HP H=4* m Hum H 1Zm H, 1Z1l H ) H8۪ c [Dt8 EF Dt Ey e HHT$' H5) H5N H814n H a I>Ht1I ; H$ HA(LL)HA( H3) H5 H8 1fHshCHHP[]A\H1H#q u6Ht$H<$LcP]M HCPMtL< Hr H{P H{HHt 1HKH H{PHt 1HSP H{hHx1HCh hE1LSh E1L[P E1LcH HB) H5 H8 0 L 9 HCHP0^ M 11HLH衦 HtH+ } Yk Hu%I HPH) H5y H81_l H1[]A\A]H MzHuMzH LT$I9LD$INHxߍ IH HLt$1H $H9l$ H A H ) < HH ) I9J IEIA L HLLT$ HD$p| HT$LT$ uHLT$% LT$\ Hl$ L E1 HIl$ L E1 Hi) I9B IEIA L L E1 LH{ H߅uc r HLHT$ { HT$ Hߋl$_ LW KH) I9Bu IEIA L * HL- HH LLD$L$ L$LD$} ;IFHHD$ H LD$ I9INHxH LT$E1HT$诋 HT$LT$HLD$ ILT$IHމl$LI9I1 HL)H" HT$LLHt$ y Ht$ HH IH)I< HH I IEJ LLD$L$ /AF L$LD$o HD$LT$D0Ŋ IHLT$Hl$E1HHH\$ LT$HxHrE:4,` HsLT$l$MuH ) I9J% Hc M}L I <LT$l$Mu/H) I9Bv L HH IEJ 5L HHI ~LHx H߅ IMuL Hߋl$ LE1 H ) I9B IEIA L^ LT$H) I9BY HCMIIILM IEIA LH)HID,H HHtxI IEJ HpL HHI IEJ HL HH IEIA Ll$HLHD$ w HT$ uHW IHHl$? JLH_w H߅tL# .HLHD$ >w HT$ uH HIHdHl$ IH4$ H4$ LHv H߅u H ) < } LJDcL)H7{ IH H IEL4 H) <8 F LJDL)H0} IH H IEL4 Hn) < t!I Bsfv uHIvz HHt%H LHu H߅ L LHu Lur HM L94$)H) I9GIEIHL8I]L I L oLH@u Luk HM Hi) <8 tIrB| v uHIv{ HHtH F LHt H: lH) <8 tIT M9d Ij0 IjH L94$H) I9GIEIHL8ImL ? H) < I H ) I9J IEIA L H) H5A H82 LHs H߅ HLLT$ HD$s HT$LT$ uHLT$m LT$ Hl$W LO E1_ LHgs H߅ ' IHx C7xnH) < tmIsImLR L 1 KLcItWC' H ') < uCI軛 uIvL HHtH S IEH ] H9 $t/HKD'L)HS HH]H +IEH 8H) I9FuIEIHL0HL;r uH HL?H LH r H߅uc HLHT$ q HT$ Hߋl$ L EH ) I9Bu IEIA LR l HL/v HH( H) H5? H8 /MbH# H) H5> H8 LH7q H߅C , M H E1e HHT$ HT$ IZ0 IZH H4$轙 H4$ HI MAIEH,_ HLH{p H߅u? 5 + LHKp H߅u, HMzHo D IEH HHHT$ HT$ HH H,* Ht$ 1t |$ HAWAVAUATIUSHHGH IA t t _] Hu! rH) H5i H8 1vIH: HHtI9s=J,+HHT$HIIMI7HT$xtLmAW HH) H5* H8 A$ H[]A\A]A^A_AUATAUSH 1Ll$DL HHHu&} tH) H8袙 gH) H HXH= vAH HHu p H6HDHHHpū HH* HpL謫 HH H[]A\A]P H= ZAUATUHSHQHu HsHt1HH=V c uO H=: t5LcLk 1H0 HHtLLH u H/ 1ZH[]A\A]HS) H5 H8| 1" H 9] HH IT$LL HH I0 HHQ g H IT$LLH ζ HHD I HHIQ ! Hh H8 \ HH- IT$LL+ HH I0 HHP H IT$LLH , HH I HHP H H [ HH IT$H LL HH I8 HHDP Hc H [ HH( IT$L=* LLL HH I HHO H IT$LLL HH IP HHO t H H Z HH IT$LL~ HHt?I HHDO Hc IT$LLC HH AA H ) IH HHHN H BZ HH A|$ I](HIh HHN t|H IT$LLH HHB A.WH0 Y HHthIT$LLF HH#I HH(N A.HC H; *H jY HH A. HI HHM H e) C H Y) H Y HHtIT$LL HHeI HHjM BH ID$H L8Ly HH 1H L9 ID$D HcHH( hX HHIT$LL HH`IH HHL H 1x HH~I HHL [H IT$LLH { HH8I HH=L H\ I H HsHHI H I H I H I H IX H Ih H I H I( H I H wHxV HHIT$LL HHIH HHPK (Ho I HIh HH K H< IT$LL HHIp HHJ H , AH߃A HH V HHIT$LL HH^I HHcJ ;H肾 IT$LLb HH I HH$J HC IT$LL# HHI HHI H 3 IT$LL HHI0 HHI yH IT$LL HH]I@ HHbI :H聽 IT$LLa HH I HH#I HB q H5 IT$LL HHI HHH H % H %T HHIT$LL HHvI0 HH{H SH蚼 IT$LLH s HH0I HH5H HT I@ H]H sS HH IT$LL HHI HHG H IT$LL HHIH HHG bH詻 IT$LLH ɬ HH?I HHDG Hc IP HH G H; j IH HHF H B H BR HHIT$LL HHIH HHF pH跺 At$LZ HHWI HH\F 4H{ I HI HAAaH |Q HHIT$LL HHIH HHE H IT$LL HHI HHE kH貹 At$LU HHRI HHWE /Hv Li E1 H H H] a LjIH H H I HEH5 HPH) H81HO H(1[]A\A]A^A_H0) H(R InI M HuI A Lc L% ) A L H- ) L%) A H=R M ~ $ H H{` t LI HA 1M H{` u,H=k g~ IH L L L L H) H5 H8O 1 PHH) H59H H81 1Zd 1t H0! H0 HHt$ HT$tSHl$1 LBHHHD$@ q { HHR7 H5 P H=] 1 H% Ht$XH|$ 1H H|$@ Hl$@H|$ H|$ H|$ڶ HD$@HD$ z Lö 1LI賶 4 K H L1薶 L1芶 HI) LH5 1H81L _H) H5 H8 L1F 2Hһ) HV1H5 H81sL L 1K HL$pL$ H LXN H) H|$Hp 0 IH H) H|$`H \k IHJ H|$P Ht P LLku = LLst % LH=S <u H|$ LBt L5 LLu L H$H H$H x b HE H I HwH8) H59 H8! \H|$袴 H|$蘴 1Ht$HD$H []A\A]A^A_HD$H HE ^H|$[ H|$Q H|$XG HD$ HD$M |$w H ) Ht$@LS H5 L| T HT$Ht$ 1^ LLHI( AMtL踳 A Ej 1H/) H5 H8 L1y mH5_ L t`H") 1LH IH H@ I M H5 L uSH5) Lr H5S L[ HD) HL1H5 H81I I9?H59) L G HhM MuSHPH) H5* 1H81H L> *H|$P_ HHtbH\$PC @ tA@t2Hs0H~LAL .V HD$PH HD$ HD$PHpHHD$PHpHH=W w HD$H|$ H\$H` HtbHKH\$XHD$HL$ H4) H5 1H8 OH) H=T H L. BH|$ HD$HD$X1HD$ L|$HHŹ) 1L$@ H L4 IH H@ I M 贰 HE H' E H 1HQi pHQW yH|$PL16 HD$pE HM Mu1-T$pHt$PE1E1 L8 ,HPH) H5 1H81EF L H H$H @ @ uIH$H HpHH$H E1ILPM9~5Lm w&LHu IH$H HqH@tHq0H$H LL4 IHZH$H L <n L$ LL o -HLf H Hȶ) LH[]A\A]A^ H|$k H|$ H) HР KZ HH- H) H8 N u10 [ z t 1@ C Hts >z Hӳ) H5 H8 H$ 1 L% t&Mf LH. H5/ H=V J 1 H tIN H- H5a H=V Nj> HvH HH=V t HH H7) H5 H8 /H) H5 H8 HѲ) H5b H8 H|$ ID$HH$< ID$HH$. AE @ @ Me01HT$(I;U Lm 5 HD$HHyH) H H|$A艬 ETHD$(HPL}H H-) H5N H8 %L}Hc MeHgMeH^L 1 HHtHH ) H8u H 1 H=) B USHQ H=) H' HHE Ht Ha& Z[]AUIATIUHSHAQ x1H x%L xAXLLHH[]A\A]l Z1[]A\A]10 11 HL LD HD$E1E1L | H) HD$HHD$HH9BP H<$B L H|$(Ld$ H Lڪ 1 9C H) H H|$迳 tH|$G HOH 1f H ) H8| H1 H6) H5G H8 1 Hֹ H=4^ ρ Y 1 Hl$1H 1 L 1 H U H H|$HuL p H/ Hh) H5 H81 1 1H$\ 17 [1]A\1 H HH ) H5 H81? H) H5 H81? ` Hm HI> Ml LL L i H W H Hǭ) H5 H8` H , = HuH) H5 H83 H軨 H賨 L諨 = Ht"H蔨 H茨 H H;) H5 H8 H\ HT []A\UHH1SHH$HuH~ HHu/PA Lb[* 1HD$Pj j H HHu1vH?H- tH,$H( HH5zq H=[ H1k y< HHt#2 HHHHc HtH^0 HH<$Htm HH[]H[ Q HT$Ht$AH|$ H LHHp, HT$Ht$H|$h 2< HuH) HH8p H PA Lb* 1HD$Pj j¼ H HH 1HÍH~-؉ ; HuHa) H8H5Z 1< HG) H8uH5u 1< L H O H? 1i I Hl$ 1K I LDh H L H{0HufH{H 1HKޥ : HuH) HH8o H赥 H$) H5 H8 HC 1Hs0腥 1F 1 H H|$HtY LA 1 LHH=zY 1VV H L& H|$ Ht 1[HHD$ HD$ u HHtuHet HHC٤ H{Hz HG H3 9 Ht H ) H8D Z Q H{Hc H{Hu: ! Hk [N Hv=9 H9( HH=ۖ =A uZ1[] LjIUE1LL) HHL$Q1j j H HH HPH) H5 H81*: x H) fCJH51) 1H=K9 1虀 HCPH+ LwL-) M9 M IF L[ HHt t< } MZ E1LKP) { E1LS` ] <w fSJ} tH[) 6HC`H x HC`H LwL-L) M9tM D1 E1L[X订 1 HPH/) H5 H818 < t H>) LH5V H818 E< uЀ} H89 H9( H= y Z1[]H 1 1H[ H 1 HHHUH5 H]) H81 8 * H,) H5V H8 @K H55k H 1 HZ{ 1B H5 H H) H5U H8 H' H HKH)1HH<HS uE HS`HHu2H H H4 uHSR Hx) HHHW HI蒠 LL腠 H|$Htv LLH=T 1zQ H3 M LI\ H xH|$Hv $ H Ld$HM H|$Ht |P H=} 5 1ZHT$H<$ި t&H<$HT$G 4 H H9srSI 1H[]A\A]A^1B4/ H) H5 H$H815 tH$H~11;LwH LwH 44QH H< HH pf83HHAk J LH? IFLP0 I. IFLP0 H* HBHP0 H:) H|$H H01 L@H) H HKH|$H01b IFLP0z HBLL$HP0LL$ HHH|$H H) H01 1 IFLP0U Im IELP0 H=/p* * UH5oR SHQH) H@ HhHX O y H` H5 H- x H5"R H xƺ H5R H x H5R H x H5 R H z& H5Q H Z[]H@ HS HSH[]A\H) H5* H8K 1H) H5_ H81 11ҹ HH=~ 7t c 1H蓜 b H胜 H 1HSPi 1HK`Y AWAVAUIATIHHUSHHHtLiHx Hv IPE1L) 1HD$ Pj j H Hz MA HHX) HtIuXHHhHtIt/HLpMtIt'HHHt IIuHLx IHE1IHH9tEH9 IHE1HHC u!HPH) H5X H811 H9t.HE u!HPH) H5e H81[1 MthI9tGIF u!HPH|) H5m H81#1 U I|$x tPH= 9 < Ml$xMtcL=) LLLMl$xE1MtDH) H9uE1H9t0LHL$R IH H HL$ At$XH D$ At$YL ADž H֢) Ht$1H Ld$H L HHg ۙ IDŽ$ Mt!LL > L-() L9t0BH) H9uH9uD$E|$YAD$XH) H I\$(L9uIl$HH;H5 H t HHu HL9uH) H8 HE HPQ IHtAH@Q IHt1LH51 IHtLHLS tLט HϘ Hǘ LLLL uL諘 HE I|$(I\$(蘘 I|$HIl$H艘 L 1HH[]A\A]A^A_H;=١) u Hc1HQ HHu_- HHu1HZ1VT |~ HcY H) H ZPA LI* 1HD$Pj jԭ H HH? Hl$1 HI) Ht$HH8 H f HH 1 1 1J Hr 7 1 H ) LH5GL H81- 1 II@t!I Hc) H5D H8 H E1Ӄ* HHHHH9b H)Z HHHHH9F H> I? H@ ODL)HKLH9HOº? L)H9HO1IIHM L HH9uI@ LE1M Mu H L A@ I6I1IEH9HOL9IO1I)I)H)ODKLM L HH9uM LA? M?p H|$ H|$s HtL>II I1H|$vx H|$HHuу9 H|$Wx H|$HH.H) H5rJ 1H8 b fo/k G(Q Hך) H5mJ H8 1w H) H5J H8 H;N HS H ! H: > 4 > * HM) H5> H86 H@ k HD) H5 H8 hH)) H5I H8 MZ[]U: H&) H83 t A = HuH=I ( H5 H= 肇 H5I H=r o AU1HHAT1H ^* USH HD$HD$H\$T$IHI D$ PHD$P1LD$ 7 Y^ |$ g IH HC ŅxxH= < u% A H< Hu = Hc\$ Hi H ӱ< ; uCa x(Ll$t$|$ Ln tH) H8ue 1aH{ & LHD$HtH H{HCHt D$fnf:"D$CID$ H H0) fCH Hĸ []A\A]PHڙ) H5PH H8 1ZHPH9t3LO(III1IЃ?ILI9~ HGHr5H HW0HG ILHG HL)H H H#]* QHp 9uHv) H5 H81=( -H H9uʸ ?vH) H5G H8. 1ZATH{ AUHSH H|$HD$AHt$H% @ $ vHĠ []A\UHHSHHuH~ HHu2PA Ln* 1HD$Pj j H HHu1 Hș) H/1H5 H@ 1H蓰 y7H) HH0蝒 tH衒 H2) HH() HHEH[H u 1H H HHr H H7 yUH[]H͘) H5. H8 [1]A\ = H) De []H8A\~b L蕄 [H]A\鄄 P H=O G 1ZH 1 1 HI) HH5E H81 & 1[]A\1Ҿ@B ZA HA A Hm" HE HHtG HH5 H= 1 H5½ H=S 蠂 y x 1 1 H) H H) H5 H8} 1 Hw) H5X H8` Z1[]H HH H5' H=b5 1 > H{ I=@ L J H) H5D H8 1J A A HD$\$$M@ AH\$1H<$IDH 13H$ & L<$ HD$1H; {) L#S 8tHCL@H<$DH 1H$ C& : HD$t$$1H$ H<$0H5D H4눾 H=& HHZ[]U HHtH HHf H%) H5 H8 Ll$0 f.c zt E g DH A ," HuE g DH a HCH+C H9$ 5 U ! Hmr P H=4 HZHZ) H5 H8 p H ) H;+ Y H;H5 E H= 藾 GHHD$, o B- H|$(_ H\$(x" H) H5sB H8` 1 Hs 1HHD$(ы H\$(Z EFd LL$IcDD$H1HT$D$ D$HT$HDD$LL$I H@ IcH$1H9 <A| HHS 8 H= 藽 MHCH HCH H# H) H5m H8} HSH HSH H 1EҾ0 DD$AIHcH$L: HljLT$D)DHHcHHcT$LT$H1HIH9~A4@4H1EII Hj L|$(H$3 W HS) H5̹ H8謿 1 HpH H) H5ֹ H8膿 1 H=< > H=< Ht1H~< L! 1H5ع H< HB) H82 軉 a3 Z Ll$ QHw HVLd 1! ^_| W HI< HHt8H=A< t. : W H$< H 2 2 H) H5N H8艾 1 HcΧ< H5< =< h H5< =< 1.q =< uH =o< rLR H HYHPE1L`[* 1HD$Pj jo H HH H1[APE1L+[* 11HD$Pj j8 H HHtH?3 ƃuPH HuH) H@ H) H> H0߽ HuH 1 HBH) H@ e []A\k1 HL) H8 ' 4 H=8) HP IH HHIO LD$ m D$ H ) H5 H8趼 H1[]A\A]HHV H5 H== | 5 H L H5= H8c 뫹 HH== h^ a L֕ H5= H8' lH誆 H[]A\虆 H H|) LH0I H ) HLH0# AUATIUHSHQHȌ) H( H9( uJHuHt@H^= HT= uHut!1 H) H5 H8X HH5) H1Lh 0 HHtMtI$LcHtHE Hk HH=< 16 HCHu H脅 zL HC0Ht1H HHt11H=$) H HHC8@ H{8 tIuH HtZH[]A\A]AVAUIATUHS HuH) H5G H8_ IL HH H10 HHtXHXIu8HC IHt\I}0HH x7L萄 IuHL x.Hu Hm .Hc "HY LQ HG H? 1H[]A\A]A^1[]A\HӅ) H) H5 H8u Hl H= @ tHHfE1f/vfW#Y A H|$ Sf/+[ Y f/ D$ XD$ U fҾ f.E΄ut\B~Yr[ XZ H,ЉtuD$ = ~eH) H5 H8肸 u u ff.z tH) H5- H8; 1ɉD H Ј1,+ k z}16HF) HHkPL ID$HHHH} []A\+ ID$H 1 tHHD H0A Hȉ D tA8f *YY u=( fWW z Hd) H5e H8 X W XV zE1\ A~ ~ DF AIM9sA: tDsDHcM H) H5 H8脶 H H 15 HH H5~ H=:8 ; H 1[]A\ù HH=8 GX tZ HH H5 H=7 H藉 tI,$D H:) H5 H8ӵ l tKC L $) L $L9 H|$@Ht* H|$8Ht H|$PHt 1 ) V f9H H)IHHI) H|$P$ ; LsH I{H I{H f9H LL\$ LT$(蚈 L\$ <AC LT$([ L LHLL $@ L $ LD$H|$IHLLL $@ L $f9Ha E1 ILL$@L9u H|$`H 5 EEL9o = F,BLbAA A (D= v8A D)LHLH)HT$@HH$ O H)= wrM9s[CC4H $ w( % HT$@ H$ ǁ HT$@H$ 7 Ld$@H$ Ld$@H$ H IubILMLEH0I HEHD HD AHzI9rLgH ItL911 HA I L+ AIfnHAH H0fA:"fnHf:"flA@ H)HA wM9shA48C<H $ w5 HT$@H$ U HT$@H$ LD$@H$ LD$@H$ I L6 I HHHL!I L!H L9 H t&I,$ HH H5* H=3 H 1[]A\ù HH=`3 ,S t HT) H5 H8 HH H5 H="3 辛 HHy H5 H=3 蟛 H 1[]A\ù HH=2 R HH H5^ H=2 T H tI $g H) H5b H86 1 E1f MtLz MtLz 1H H[]A\A]A^A_L1zz MtL1iz E1 1Ht$h HKz QD$LH53 H=3 PD$HPD$<PD$@PD$DPDL$H1LD$`HL$X踯 H0aE1# H~) H5 1H8L >H~) H5q 1H8/ !H{~) H5, 1H8 H^~) H5 1H8 HA~) H5 1H8خ H$~) H5M 1H8軮 H~) H5 1H8螮 D Hw 1{$ D$8tNI9 E111E1Ld$] $ D$$ I E111E1Ll$- Htd$ D$ tII E111Lt$E1 8$ D$ t?I{ 111E1HD$ m Ht^ H_K Ht# D$tKI 111E1HD$k H H H 111E1HD$= Ht H0* H5N0 1H= I HD$XH@ HL$XH) H5#0 1H= 躗 HA y HL$`I PE1LKc+ 11HD$xPj j Ht$0 H IHXLd$ I HA ty y5HL$0I4 H H5%/ 1H= H IMpH H5 / 1H= Ɩ Hi IMx HA t:y yUHL$(I HE Iz H H5T. 1H=: D FH~ 3IMhHA t5HL$PItK0 HA v HL$HI H* H5- 1H= ʕ 111H|$ HC t:I 1 HD$H@ I 11 HHf* H51- 1H=E O QIF tKI> E111LL$7 } D$< I E111E1LT$ LH' H5b, 1H=ɍ Ӕ HH) H5, 1H= 诔 HL$H) H5T, 1H= 艔 H) H5 , 1H=^ h jE111LD$g H4D0JHHHJHJH H)IHI)g LD$H|$ILLLH $4 L $Ls H|$@Htqs H|$8Htbs H|$PHtSs 1Q G M| tC LkH Ή0JHHɉHJɉHJɉH} X H|$P H $ L $MH{H H{H HL\$(LT$ { x5C LT$ L\$(& L LHLL $3 L $IHx{ t&I $ HH[ H5 H=L+ 蝒 H 1[]A\ù HH=(+ I = Hv) H5 H8i HH H5} H=* : 뛾 H=4 E1 Hv) H5 H8 E1 H|$HH H|$@HO ItA HHcHHtAD s HTHHTAD H2 ITHD$0E1Lt$8EL$ IL$( AHD9|$ ~9J|H2= IGtgIHL$HHtE1 LE1 IcLt$8HLHDHD$0IHTL$ AD6 @L$( AH ELt$8DMcLHD$0ACL> @L$ L$( Hu) H5f H8覥 HH Ht) HU H5c H81Y E1_ HD$ H+D$8H LPH HT$8H _' H)I)1 = uAILL$ L9 齺 H|$@HW u EtHT$ HHL$` = uILL$ L9 L9 " 1f Hzv) H5^( H8諤 黻 } m Hu) H(; H-a HH 1 1H|$1HD$ PE1L%* 11HD$Pj j貄 H HH HH; x) HA Ht$Hd{ HHT HбH;D$ H&s) H5 H8迣 & HRE1L* 1HD$Pj j H HHv H1 H55' H=?' W HiHH5 HuAF T Hm H5" Hϸu AA ) H5 H豸 HJr) H5& H8 J ATUSHG uH r) H5o H81 HHu Hq) H5& H81s @HL%u) H I|$@ I|$H u HH I|$@! []A\RH=Gv) I H5 H tH5 H=? _ H=u) H5G m tH5 H=o? _ H= u) H5 C tH5 H=E? _ H=s) H5IE tH5 H=? x_ XUH SHQq Ht Ht) H(HXHJHHHHBH1҉Z[]Hֹ H=S% ^C 1[Mt I}HuHuH{H/ Y[]A\A], AXHH[]A\A]V Hֹ H=$ B Ht) H Ht) HHH@ H@Hx HX UHSQ^1 HHtHHK HH k HHZ[]Hֹ H=o$ mB HAt) H ATUSHG uH@p) H5 H8 IH=t) Hu$ HHu1 LF HuHC8HXj HHHuHH1HuHHC8I$LcHtHE 1HkWLHC C(4 t H r) I9D$t H -I|$ uHt H tHq) H9EuH} uH[]A\H E1 xHH[]A\_ HE1 H< þA H=C 軛 ~ 1HM Li k I Z1[]A\A]A^A_1v 1[Hm) H H5! Hr Hq) H|$Ht$1H H 4 HH H@ g HPH4m) H5 H81 Hh V H5g+ H B Hp) H5 H8ԝ 1t H AWHُ AVE1AUL-! ATfInUfH:"SHHH HtLq1IHR< H)D$0WHl$0HD$@D$XHT$`D$ D$HD$huH~ HHu2PHA 1L* HD$Pj j} H HH H;H& y H{5 AătIt2 HtQ H{Ht Ht$ 製 6 IuA H{d ADž Dt$ AHT$hDH5 H= AEE1虜 l |$XHÃt Dh EH|$PAAuEtdAHDDgt:H߃8_u7Et2| AtHH7k) LH5% H81 THQ gJ GDAH5 EtH-Hgp) L LH 8 H5 H81U 1#Hj) Ht$hH8 H H Yo) HH HĈ H[]A\A]A^A_HRk) HӚ HH0舛 1 1 Z Hj) LH8 HH)ځ C H1H|$H)H* I H|$裨H|$HI \ J R 1fIU 鵸 HEDDDDDDI9H~0H|n) H5U H8] 1s; IE w 1Զ H IA IHA A HHHBDDDDDDHa Hc1HHH0P H`d LXd a LLT$Fd LT$LLT$4d L,d H|$"d + Hj) L5l) H Iu H< H H Lc ڽ Hc ͽ HPHLi) H5m H81 Hc 餽 Hc 闽 Lc 銽 H 1y LLT$Zc LT$HPHh) H5 H81 H,c L$c - HPHh) H5 H81S Hb Lb Hg) H5 H81& Lb HPHVh) H5O H81 Lb 鮼 Lb ƻ Hb Lb 錼 Hvb Lnb w H{ AUfHnATH` U(1SfH:"H` HfH:"HH HtHiW11HHH$ L$ Ld$0HDŽ$ DŽ$ HD$@ D$XH|$`D$ D$)$ $ $ )L$0D$HD$huH~ HHu2PHA 1LD* HD$Pj jUw H HHu1sH;L tH{L tHuL$T$ E1LL H3H{HuH{Ht$^ uHt$ N tHuL L H H[]A\A]HT$H4$i H4$HT$xH HH[ # HPHf) H5D H81 HHT$H4$ii H4$HT$L鈽 |$T[\ v逼 H|$@HҾ 龽 HYHPA LLS* 1HD$Pj ju H HH H 1[HLl$ Lx LHL xLm Ll$LLL|$LH\$( L5e) L9 Lp_ L5d) D 1 Lt$w M$Xt LHL xL) Lt$LLHl$LH\$豪 L=d) L9 L^ } L=}d) 1 H 1 H{` 2 H<$ tHPd) HH0}` u1 Hz` H$H I}` u#HCHs LHHHd) H01c H I}` uHc) He LH0 չ HH=p 5 n Z1[]Huk HPHc) H5 H81< 1Z HY(M Hd) I $LLHCH? H=c) HHtfHkHH` HC C(IE LkHC8F Hn tlHd) HCI $LLH H$HtOHP0fHnfH:"C(Hu HX0 HH] HE HZ(Hs Hg) HD$@ H} uE1 H Gf) HmH} H-,f) H[H; ~#HHy HHD$\ HD$ H e) H5ؓ H=Ao O fInI{ Ll$1I fH:"LLL)D$腒 IHt HU tLʻ L \ E1麻 H[ E1麻 Hֹ H=! _3 % L[ fo $1LLL)\$ I] L%$a) I$ռ AtM9uL%Xc) I$鹼 M9uL%b) I$飼 HH H1 HP I H= l J<LLHIt Hi H81[]A\A]A^A_ HxHD$̼ MvH 11H|$鵼 15 IH USHVi H(HtHi 1HH~Z Z1[][]A\ E1 L9v LFm H DH H)L HD$M9 DH HV L HcI/u ujH~dHHHD$ H@LHH9}yA HĨ HLH[L]A\A]A^A_ HĨ LH[]A\A]A^A_7 LoLKt- H)E3H\ L)| HD$H LE11A H)LoHD$HGHD$H4 E<3HA SLHI fA9toHH9|ME11LT$E1L9l$|[KL- fD;<t]THL$HrIIH\$0HLH HLH H6 LH)HL$E 2 HL$(Lt 1A SfA9 Vu HH9HL$(H9t>NTL9T$ }HT$L)H DTHL$HWHL$IMEuHI9tI7L M)At I)HLLLG Hj H\$0HLH HLL HHS L4 H! HPHH)HP!HH)HP~;HRH9t fD9*t HHHH)HP L)HH H H|$LIV) IH Lt$ 1HD$W PH:^) H5Y H8[ 1ZH`) USHRH( tI} HA & H{HtV HkH@ XH[]V ATUSHHHt 1Hs{V H{ Ht 1HK gV H{0Ht 1HS0SV H{8Ht 1HC8?V H{ H-^) H@ H} L` H} Md$ MtOI$ Ht$HsHa_) HHtU H} b H} Md$t [1]A\HGUSHRH t| HkH@ XH[]|U HGH8Z) H5 H8ъ 1 H([]A\A]A^A_ HNH HNHz L=^ uAE " HY) H5 H8y HY) H5 H8a HZ) H5 H8I sHY) H5 H8. k 15 ID$H5< HHHCHPH+Z) H81 1& - H\) H5 H8T i 1 H \) HHQ H[) HHSf I9 J I9 < . L HY) HHQ HgY) HHQ L L{ 1@M8 f A HO011H<~HHA91Hø H|$cS H[S ݽ H|$LS HDS ƽ H|$5S H-S 鯽 SHwH1y IHt/HSHtHs(H5\) Iy tIy(H=\) Rf L[1ҹ HH= W* u[1]A\ H(\) H<[) H9CuH| 1u 1 1ҹ HH= * u[1]A\X H5[) U H->\) E1At 1- H HiH H1[]1LLLD$ LD$tL E1 LL$0HT$@ Mt H~L)H|$(H L|$(t H=JZ) I9uHQ IV LS LK HJV) H5cc H8 L+ r[H;H" 1H[MQ 1fHKhCH E1LKh+Q T E1LSPQ 6 E1L[H Q HP [ HW) H5hG H8P ( HjHQE1L) HHL$Q1j jf H HH 1ҹ HH=! ( H8 H} Ht$6 L|$Il$H Mt$MD$ M9 LL)M HM Hھ LD$N,1H $L-H $LD$H L)HXH IMt$H Hu[AE HX) H@HH# HE H(H[]A\A]A^A_HaT) H5 H8 1I9OMuFH9X) Hh# Hh# HhMD$HyHMT) H5& 1H8褄 HM L N,1H $L6H $HIuIMt$"LJ3MtSID$1H*r HHDHx LHr HHH1u=uCHIH;]uI|$8 uI\$HE fHPHS) H5D H8賃 ZUS1QHGHW H9}?H)HHxH9| 1Ht(HHW Hl HHHtH)HXHZ[]HWHGH~Hu H;puH8 tH HOH| HwH 1鴹 H)H| 1脊HCHS L9HHIB y HM HSHC飻 H,T) H5C H8赂 T HR) H5+ H8蚂 9 PHS) H5C H8~ Z1 HyV) H5\ H8Z H 1 Hx [ HQ) H5 H8 Bݻ Hs 1ҹ HH=MJ $ tHg H Q) H5J H8蹁 HQ) H5 H8螁 H1[]HHt$(U Ht$y HPHQ) H5 H81= HP) H5 H8E .8&tHJP) H8 @ LHH蛧 u|$11 x|$ 11y U |$|$ 1R LKK H 1z 1I1I7 PA L* 1HD$Pj j` H HH 1 H HbO) H8H[], 1 HHuH-.T) HHH H5T) H Hֹ H=WH " 1 HiJ 1 } Hu賔 HN) H8H[]A\ Q HQ PA Lh* 1HD$Pj j_ H HH 1H H HQ) H5 1H88 ! Hufo G( H|$H.` H|$Ho HG0? 1 HDR) HT$H xjH\$HthH% HHJI HtHHE t[H H&I < HuHM) H5 H81M HN) H57 H8O~ HnN) H5 H87~ HH H~M) H5} H8~ 1 HuHR) H5H H8} Ii HW IN LSH HKH 5 H H|$DQ H|$4 1HHf LwHw MD$H IX HoQ) H5 E1H8M} : 8L d DLL$ LL$ C LLL$Ht$B0 A Ht$LL$tI Hֹ H=<E .i H HMHB H5 H=E g 1 4 H HP) H5 H8c| 1j HP) O H H1[]A\HASE1LH?+ 1HD$Pj j\ H HH` APE1L?+ 11HD$Pj jf\ H HHtL > HiHE1逽 1 1 HO) H5M H8{ HKE1x H=}l t H1E1Q Z1[]HK) H5Q H8I{ DkKCK Hs DkKHAE EY H5 O) 1ɺ HM HQN) HT$(HHp xHLd$(MtKDkKCK E1LHL$HT$1Ht$2" DkKLH$2E H$j H!E D HE 1HD$1 D HD H|$V H LZ铨 fHֹ H=? E [ 1[Hֹ H=d V 1[Hֹ H=f Q 1[' HRD CH[]A\K 111j 1^ HCH9E L D |$ Lt$ L=xI) M$x LHL x@ Lt$LLHl$LH\$F L=/I) L9( LC 1 HCH9EH LlC |$ + L-H) L|$ M$w LHL x;H LLLHl$H\$讎 L-H) L9 LB 1 HCH9E! LB |$ ! Lt$! L=CH) M$v LHL x@ Lt$LLHl$LH\$ L=G) L9* LYB 1 1 a H! c H=,K) IHtAf1L5J) AD$H}(ID$ Ih I|$(Hn IHumLA E1e! H HuHHHH)H9mH2! L9)! HC1L)HH Hu H LHbA HsH}H轁 HIBA Ml$MNH} k ID$ H7IH ID$IH H}(Hh HHtk1I$H H~ IHE H@ I L I/AtTE? At H I/AuL H I/AtA L L H|$RI tH|$G / 1HH5x HH H+t9H8[]A\A]A^A_ HHtIcn8IcV@H HD$L,*p HCHH@0H8[]A\A]A^A_J H= LD$ HLHt1H IH LD$ 1HIpLĚ LD$ H= LD$ LD$ HH HHLD$ Hm LD$ HuHD$(HEHP0HT$(LD$ H HLLD$(HT$ > HT$ LD$(HH*uHBLD$ HP0LD$ I/utIGLD$ LP0H LD$ H. I/ IGLP0 I/ IGLP0 I/ IGLP0u Hl H $ HH=Y ) > H 1ҹ H=, HHt$¯ Ht$ Ht$ H|$ e HD${ HD$q H6C) H HE 1 HH= [1]A\HrF tHu HHU H5ھ H=H ] 1 HE) H5F H8 1[HpE) H59 H8 1[Ht$H<$E tH<$Ht$G 1HHWH LH=U E1" L5fF) ! HZF) $( L5NF) ' LHLI蘍I_) L%(F) 7) L= F) ( HF) % HF) % HE) H5( H8iq oL%E) & HE) HD$% HE) $ L=E) " IMHå H5D H=T \ IM H H5 H=T [ Hl; Ld; E1O, HT; LL; E1- LHi H߅uY-; e- H ; H$H C) H9H+ H HID$IH+ H?) H5 H8Kp : {H $H\C) H9A, ID$HA H, Hu#HH$HXLp g) H`- - LH H߅uNZ: , LHz H߅u<>: + H $HB) H9Au+ID$HA H+ : : HL HH+ HI9 L9 E1. H>) H5 H8 o HM9 L9 E1. HLLD$ LD$u=HLD$m9 LD$~. ~ Hu)IHD$HhL` 7- H59 Z.2 HLHT$K HT$uHHT$9 HT$1 H8 KL8 L8 LH Hua8 R0 HT$HIA) H9BuOIFH H/0 HL$H"A) H9Q. IELHMHHX0 a8 vHK<<L)] HH/ VH48 H,8 1{4 HHJ H߅uB8 3 HH. H߅u_7 S5 HH H߅uM7 4 7 H7 13 H~<) H5 H8m vL7 7 Z7 P Hu LUMtHL}(;1 Y5 L=BA) H 1 H5 H37 H&7 L 7 E189 LM 7 L7 E1>8 H;) H5 H8Ul HL|$6 L6 LH H߅uF6 8 LH H߅ 6 9 LH H߅uy6 8 o6 De6 ~ Hu LuMt HH](H$5 !: HH @) H$`5 6 UHSQHw1_ HHt/HUHtHu(H5?) H{ tH{(H=?) HZ[]H~2H J@) Hʊ1H9~LLw?) A LHù LH= uR[1]A\A]A^| HuH9 MFIx uVH5>;) 衿 t$Ixu I@(9 d9 H5;) y LHJ H5 H=T LU {IxuAH a9 Y[]A\A]A^A_" H5>) K: H>) : H5>) : H5>) 9 1` 1 L驷 1J M LHĴ H9) HRH5v6 H81 颵 I鞵 E1: L9: LF9 HH|${HHH*: H|$HH): 11H9 : 8u HI99 HH4 H9 HcAH/u A9 H9 H鞻 H9 L: H1< : H; H K=) {; H ?=) : H<) H5 H8h ; H =) 9; 1< HHk L)L9ILHHCAT,HEHK= A 1р?uHUH)HS /= HH> H> H> L)M9MMLH9HLH= Ha> HX> L> L)H> D4D84u H> D4D84tLr> L)HLe> H> H= <) > H=<) ,? H=) 6? [? H<) ? H9) H H=;) ? HwHtH(H=;) HuH<) tH9) H Hu H8) H HH9sHk<) tHHV<) < H=D;) @ HL@ H8) H H=#;) o@ H<) < Ic H;) < LH= s uR[1]A\A]A^ HuH=A MFIx uVH56) t$Ixu I@(A @ H56) LH H5 H= P {IxuAH @ SHwH1 IHt/HSHtHs(H5 :) Iy tIy(H=9) 3 L[HH H5 H= AP 13A H 9) A HHә H5 H=c P 1A H 9) A 1 H=9) A LH=8 uR[1]A\A]A^~ HuH\B MFIx uVH5@5) 裹 t$Ixu I@(7B A H55) { LHL H5 H= NO {IxuAH A L. L. TC IB 1 IH9C 7C H?[ AŃ:B HC 'B 1ҹ HH= u[1]A\]C H57) ZC 1ҹ HH=U u[1]A\kC UHSQHw1s HHt/HUHtHu(H57) H{ tH{(H=7) HZ[]1H9}?DL 8) G LAt H F8) B At H {7) B HUHSQHw1ݽ HHt/HUHtHu(H5O7) H{ tH{(H=;7) HZ[]11H9}ZD L8) GMAtu4H 7) F !AttL6) G 1 DH HuPHlB H)1ҹ0 LH1 Ht-Hx t HP(H q@u 0[]A\Hs6) 1111Ҽ H} IB B HH6) rB []A\ 1ҹ HH= B [1]A\@ HB 1~B HsH[H= ]1A\ [1]A\1>C H+ L+ fE H+ H<$+ PE H-4) H5f H81 H+ H<$+ L+ E L~+ H9D HC EtHpD H0) H5f H8` H@+ L8+ D HEgC HPH0) H5 H81X D H0) HJH5qe IVH813 HE HE H[a HHª H5| H= K 1F Ht$3 H|$E HtHH HHh* HE H]H6F HmH2G HV3 G E E E t-@t#H0HH)HF 1H$ * F HHHmHHHF HmHF ss A IM H L軅 L) HLL L葅 L) 韰 HCHH5> HHH/) H81豿 1HT$_ H2) H5 H8^ L7) 1HD$F H2) H5 H8^ L ) 1HD$ Hr1) H5[> H8[^ H 2) 鄯 HI9!IkPLL$Pf LL$HHD$ L( P 1HL$ٱ H( HX 11[]A\A]A^A_Ҹ H|$i 騱 HHF H5 H= H 1E HH? H5 H= }H H HH 1pF L9I$Hs@IOHs8HHHHC@F H6F | E { t3HkPHt)H;k@t#F Hj,) { H8t+H5 \ HL,) H5 H8\ 1E H5G \ H蘃 E xI|$H{@[]A\A]A^飪 H-0) HE E ' bE 1LaHD$0 D$HH|$PID$ )D$ fD$8D$XPHA 1L) HD$Pj j< H HHF Hl$ 1F H{Ht$ | F IQ1 1x H/) H Z HQ HGHHx 鹩 H=20) F 1'G 1ҹ HH=& 2G !H . Hu"LeHM,G G H/) MG G H=/) H HHb+) H5Sa H8+[ 1HK 1H 1HS H7+) H5Xa H8 [ H% 1HC 蛺 HI H1[]A\HASE1L(+ 1HD$Pj j7; H HHH HiHAPE1Lp(+ 11HD$Pj j: H HHtL uH H=.) H AVAUATUSHHHHHt HiHHxHHHu3HARE1L8d* 1HD$Pj j: H HHu1 A E1Ht(L/MtHtH Aău s HuËC(u HSBtH() H5' H8Y HsH tH{8HDL[]A\A]A^" 1 HHdLp HSHHs8C L y H# :HuLDL HH# HH[]A\A]A^H!)) H ZH=t-) G Aid AE } L߉T$82 T$8 BT$LL߉ƉD$8H L\$@H L. T$LL\$@HH DDH|$8b H|$8I" Ld$hMW AD$ e ML$HMD$DAEAPA0u DHD$ III9IMIL9D$ LI~EH|$LHPD\$LDT$@LL$8LD$ LD$ LL$8HDT$@D\$LI A tEIM9ZJ IQJ Hl$8K HD$ A L9IMLI D+HBDig EMLMcL)HHH9p Hk HLHyHt$ A.& HW&) H5 H8V H|$pHt 1HD$pj! |$H t H|$Y! 1@H m HuH\$ AJ P H=> ~S H5(') 苫 t0MCM L *) IH LLLIwI H)) LL\$8HH^ L6 L\$8HHtAHD$@ H|$@HD$8 L\$8MIC t\MCMK [H LH t IHL@LH 1H ICH5I\ HPH%) H81脶 HPH%) MH5j H81` L H%) H5 H8]U hDLDE IBH [%) M߉D$8t$8IGH H;HH5 H L@HCH5[ 1ϵ L\$@T$LHTML$H@ML$0H $) T$MH;觾 T$oHD$ I9IMIAt A+ AF A qID$HvAM %G H HG A tAIIAGAAAGI LHIF E1F MK(rH|$ uAu A VLE1DAWDDLD$xr _AXHHD$hL@LH dH") H5 H8}S H H#) H5 H8ZS eLH)HMx HHE|$H H|$0H HIHD$ M HD$`D$H HD$B LE1DH$ DAQAWLL$(耳 AZA[IHDB I{ I{u`AC D$[H|$ u'D$[IAGB AA0 IH[B HD$ A LL$[A A HLOD H5") & Ht$\L9f Ht8H= weD$[yH5") tI{uIC( D$[R膱 Ht+H !) H;» H;H5X Q H%) H5 H8Q A%HHI A AEп IHcH=1ɉL$H]H|$ H.D+HA P + LHHL@E: IcL9c Ht$ IA H9HMIpC Hh_E1H8IcDG5A Eeо/ HD+HBDo D)D9 Ek Gd,HD$H9D$`C H ) H5W H8UP H|$hHW MH5 ) 1 LDD$LD$0? A C LLLILL L)IC @LHHLH0Ht$ 3@ HD$ A I9IMIEB H ) H5 H8O HD$ A I9IMIB H|$ @ H ) H5V H8[O fX jDbAM @B H H+B AIIAGAAAG B EIA HEE1^? A. 胮 HwC HD$ A.? AA- ?AA+ 0AA# !AA > H ) H5I H8\N gPHw ) H5 H8@N 1Z1.D AUIATIUSHHuI} HHu&=Hֹ H= u1 H HHe Huz HHuI}Ht$ tIl$Dl$ HH9uH!) H5Q H8M HuLB {I|$ tID$(H!) Hy H HHH9HHNL$H)H|L`H&!) E,$H H[]A\A]ATUSHHxHu cLg1&LgHt HHHL9} []A\ IHH苸 x-H{ tH{(H=#!) LHH HHH1H[]A\H= 1[! HuH{ B 1B 1B LaIC H) H5X H8,L HH1[]A\A]HH H5# H=% 6 1H }| :C IJC H;) H5 H8K Hf H5 H= 6 [1]A\HG t&I,$DD HH* H5v H= l6 H 1[]A\ù HH=t x tC H) H5e H89K HH~ H5M H=6 6 1遞 AUATUSAPHu\e wHHwHLfhMt:I|$( t2IHyI$Ht HHxAID$(LYHH[]A\A]HFpHtHx tH= D H=_ 6 Z[]A\A]UHSHHD$ Hu)HGHx<H9|\H ) H5B H8>J XHHt$ < tHEHy HxH9~HxH9}HE(T$ 1HHSHH[1]| H[]LpM LmL`(M L}( O HHt|LA ILLL IHyiLLh 11HE[ 11HE N HE( Hu*HH C H) H5 H8*I 1H1 HLM LK<7HEL)HH] L=m ) 01(C Hi 1C H=K ) B LhM LeLx(M Lu( N HHt|LA ILLL IHyi11V 11HEI LLHE : HE( Hu*HH B H}) H5 H8H 1H1 HLM LK<.HEL)HH] L5Y ) 0H%) H5 H8G 1B L-0 ) B HO HHHHtHw(H5 ) HL1H9~@<DHDH@yHf) H [1]A\SHwH1 IHtHSHs Hx L[ù LH= - u [1]A\A]A^B MFIx tOIxu AH C 肦 HuHB H5U) 踛 LHz H5Β H= 1 H5*) 荛 tIxuI@(B Y[]A\A]A^A_Vw HD Hg) H5J H8HF !E HE C HwH LH=9 * u@[1]A\A]A^覥 HuHE MFIx tAIxuAH E E H5R) 赚 LHy H5ˑ H= 0 H5') 芚 tIxuI@(E SHwH1 IHtHSHs Hx L[HHy H5 H=^ 0 1E HHy H5m H=G / 1F LH=; u [1]A\A]A^ G MFIx tOIxu AH G Z HuHF H5-) 萙 LHax H5 H= c/ H5) e tIxuI@(F 1ҹ HH= X u[1]A\F H)) F 1ҹ HH= & u[1]A\F SHwH1臄 IHtHSHs Hx L[SHwH1Z IHtHSHs Hx L[G Hu?HF H)1ҹ0 LH@ Ht HT q@uH 0[]A\1HH H5 H= ". 1eG Ht$ H|$:G HtHH HH H(G HH H59 H=C - 1HHt$` H|$4G I?I N E1IHtiI9}uLL IHt@Lڕ HHtqLLHD$I ] L$ H|$ $yL E1H A$>G H A$/G Lg0F LgHF Ly E11hI H.) H5u H8A H1[]A\A]A^HHeu H5 H= , E1 I L) tLm H HH= tYH LH H56 H= ,, p HH9\$( |$<HHP H $LLH uHT$ H} H|$hHtn H|$PHt_ H|$XHtP 1 D : H|$h Ę H\$H$ tk HD$x HD$H\$(HH@HD$H\$ H9\$~<ID$H|$HHD$0 H '* LH9L$0I H Z H\$H\$(|$8 uH|$> D$8D$8 w wa LL$PHt$XLL$0H2 H PHD$xPt$(AWLD$(H|$0v H HHH@ H|$hHT$ e H|$ HD$V Ht$`HT$ IHH9t$|MHHT$ H|$hHՉ HD$`HLHH|$HD$pL|$`HD$ | L|$ HHT$v HT$tB yAHJHL$( uULBHE1Ll$@I݃L|$HLMD$<ALHT$ THHT$ HT$ nB LBH@tLB0롉l$(LH9l$ H|$H LD$pH5 L1LD$0MLD$0HL H $LHT$0E HT$0tpHHHT$c HT$NML|$(MAHLH9\$ H $HL? ]E L|$(LD$HT$H|$PLL H5 A OHT$ HD$pDMLl$@HHD$ )HT$ L|$HH LD$LHT$H|$0L 7 H5m DM HHH;) u.? HUHD$LpH/ Hl$(H\$H\$( sHH H D L zD H hD MoMw ID5 L9~HH趜 uH3HE LH|0 LWL+D HH舜 uLu H3C ÃÃÃH1HZ[]1[SHH Ht HH[5T [AD$IjF Hk 0HHI9F HJIH|$HHPOb f$I D$xI uHT$0HIHHLHJ HHG Ly cF HT$0HC%E 1HD$ f F IE 1E HL)HD$0HHD$0E1E H ) H H= 1[8 3 HuH{ K 1J 1K 1&K AW1 1AVAUATUHSHHhH|$Lt$LHz u.C L9* u%HHn H5` H= $ E1 HCHl$ Lc HT$L|$H$HuH! ) H5#y H89 HT$? IHtHT$H4$IHA L Hy1H ) HI]Hh# Hh# IM HHh# IM(NHLHD$y HT$H4$IEIHM} H)I<,y IE( Ht L H|$ tL? HhL[]A\A]A^A_AW1 1AVAUATUHSHHhH|$Lt$LH u.C L( u%HH)m H5ߛ H= g# E1 HCHl$ Lc HT$L|$H$HuH) H5w H898 HT$8> IHtHT$H4$IHA Lr Hy1HN ) Hh# Hh# IMHHh# IM HI](NHLHD$\x HT$H4$IEIHM} H)I<,9x IE(@ Ht L H|$ tL辝 HhL[]A\A]A^A_AWAVAUATU1SHHH HtHiHz HK) HHD$@ fHnLuLd$01fH:"HD$X)D$0WHT$`D$D$HD$huH~ HHu5PHA 1L) HD$Pj j* H HHu1 H;L輅 tH{Ϭ AŃtMt. HtH{Ht Ht$AW tIIu 16H{Ht ŅxIu1H{ Åy l D|$J H|$PAIuu u* 1ɅtHDDM DOL9\ 1@ HL HĈ H[]A\A]A^A_ø mF H) HH5)= H817 1KF S H= $2 1iF HAHP0F H() H = H05 AF HC tH [ & G 1ZÃI H ) H51= H84 bJ o HTJ I Hz ) H5X H84 4J H HT$ H$ HD$ tH H7H< HH RP$ $ LL$PL$ H$ H$ H$ H$ 貌 H H? H Hb) H5 H83 J H;-) tHE t4H} u-Hs8LLHH []A\A]A^A_ I H) H5^ H83 /I HI HI 11H< J _J 1J 1H< J SJ IE1LLHII MII9|HM E1H HHHIIHM;|" HumI] LHxIH?HH@~I:MH9H H[ 1H} HHxH0H:HH@>II9 鯋 IE1IM LHxI0HLHII MII9|"E1HM IHxHIHLHIIHM;|D 1nI H= i 贑 Hu(I|$ uHB) H5: H81跒 [1]A\A]A^HIT$ H)H9HHI LH= I H ) HH5I H81O Hv) H5u H8W1 {1ҹ HH=) \ I 1J 1yJ HS@H)HH?J HS8Hq HdJ 1]J HW I HCx I { tHCPHt H;C@I H ) H5 H80 oH( { H8t$H53 0 N- H"I ;H5ؽ c0 *H) H 1/J 1]J HHHHt1G(uHG@u HH~ PHg( H5 H8 0 1ZML L 虏 IHu%H|$Ht$ M H#( H5c H8/ 1M H|$Ht$ E1LD$rM IM H2d H5z{ H= p HH+c H5{ H= Q E1M HH=] ^ uL uAo`)d$0M Ht$ H|$ M HD$M HD$M Ht$H|$W SN Hl$N 1H+]Ld$HD$HP HT$Ht$LH' P H|$HRP HH( IPH5+8 H81Q ES H S H|( H57 H8E. S LL5 QQ HN( IQH58 H81 ES H rS H ( H5u7 H8- WS H( IPH5~7 H81褎 6S HH$C H$P XD$nQ $$\cC$$LQ H( IPH5$7 H81J IE UQ H ) H_LH O Hm( IH H7 H81s S H R H) H5+ H8, 1HD$AD$ " S Af ! ),$T !U H( H57 H8, Hz1HT$HHL$_X xLu,Ao$ HD$f:HC C(HE H Mu LkMu1HE 1} 1HU Lm Lc H<( H5-7 H8, 1U H H=( h HHtI$LcHE HkmU 1wU U HU H U H-(< HuP1H=8 < HHt311}HHu3 H=(< uHE H-(< +W &W 1 W HE W [1]A\ÃW H 1KX H>X H HH.X [X QX H 8 H9 ;Ws LL$LD$T$4$;V IH^ 4$CLLL$LD$T$ HAD$HI\$(5X LI H0L[]A\A]A^AԉAA Ml$J<HtCHW HH HH9 Ʃ IH J<J, LL$LD$T$4$gU IH 4$LL$HHLD$T$|W LHA HW H Hx I1M1 HTHtHITHH uKlHT$(HLL$L$HD$($; L$LL$t` HD$(HhL;D( Hs{L$ IH HKL$1H9 HT HIT HHC{LL$L$Hp豑 IHtdHCL$1LL$H9~ HL HIL HHI1HHHHE Il I MD(A H E1HL$I< L$I M II$HI$MV Dt$(HHL$A0U tl9D$$HL$ |$$ IHtGHL$HHH ILx(HD$H IF0HE In8L IH L E1U t$(LL$LHL$T$$T HHtI9 L IHU J<J U HH HtHsHIL U m IHp1hR IHV D$(LL$ILHL$T$$ƉD$6T KDH 11AD$tMLkK<HA S K LL$LMD(t$S IDH HHH uL T 11HL$T$<D$(Q HL$T$(HHLL$<MDHD$LL$(nS H|$Iq MYLL$(HL$DLT$$I<S LIA M $L+ I$H|L L HIH<1I K<O4 HD$ S ID(IDH H<$ L HD$ HtH 1 H<$ L HD$HtHu Hk 1^ H<$Y LQ H|$G 1H $HT$H $Ht$T H[1HIPU HIU w H! u H{ T H U HՅU Z[]A\A]HEHV HEHV H 1@W H]HW CxH( HKdX H( CU H2 KH2 KH2 KH2 KH2 KH:HK47@sW H]H[W L HHL\ = w'= vHV HH$IV H( LH0x tAHt$H_[ HH[ Hl0IHbV L W HHU W H( H( H5 H81j 1W H( H H5- H81D W iX =@B HH X X X Lr0X LrHvX H$( H5 H8" 1Y X HL$`LHZ H( H5 H81諂 HS 1Y H( H59- H8! H. H( H5- H8! H H H X AWAVAUATUSHH(H/( LFH0L8v Ht$HY j Ht$HY U H>Z HHA Ht$1H+t$a IHtVHk L|$IM LL)B*IHT$I9}7LHY #vH{H L H LH= 1 LH H Hv( LH0;u Ht$HT uqHt$HEU u`HU HHtPHD$Ht$1H)HHcH9~!L yf $fLTHHuܽ Q uH{H! 1?Ht$H HHtHT$H=ϧ 1H H L H(H[]A\A]A^A_à X HHW Hi( HH5 H81 1W HG( HH5* H81 ܃.X HGHX uHGH0HG0iX @HGHtHG0HGHQX HG0bX HHRi H5 H= H1[H( H5R H8 HH=ݦ up1kY HM HR H5<j H= 2 H( H5VR H8* HHQ H5>j H=} E11X E1X 3X HH=Z u^1Y H ( H5Q H8 I $HJR H5i H= HHCQ H5i H= i X } HHu%H|$ Ht$0Z H( H5lQ H8@ 1!Z I $HQ H5i H= HHP H5/i H= 1JZ HH=j t>Y Ht$7 HH{HL$I4$E1HA A EY E1[ I $H(Q H5ph H= f 1>[ H( H5P H8Y | HHuH|$Ht$ Z HH= B tY HHO H5/h H= Ht$` HHnHL$I4$E1HA j Y AU1 IATIUSHhH|$Hl$HBHwI<$1H t!N LH= 苽 u/C Hx u%I $HO H50g H= & 1) I1Ht$ 1LD$|$ IL$H; ( thHA t<Ht$HZ HHtH(H;D$t9H$( H5N H8 HkN H5f H=K f1It-I|$ڐ u00z IH>1t$Ht$ )1Ht$ LD$L$1Ht$ E1T$uLD$H|$HHL$Ht$e HHtHT$HH=} 1蹐 HH|$ tHF HhH[]A\A]y IHu%H|$Ht$ Y H ( H5M H8 1Y H|$Ht$ E1LD$|Y IM H,N H5te H=2 j HH%M H5e H= K E1 Y HH= X X ux HHu%H|$Ht$ SZ H`( H5%M H8 1dZ H|$Ht$ E1HL$ Z IM HoM H5d H= HHhL H5d H=g E1Y HH=D 蛺 "Y u HH=+ u uBH1[]A\H( H5\L H80 HHK H5Dd H= Y 1VZ L tLe Y 19Z LHwb H5c H= sH\ t&I,$Z HH?b H5c H=t H1[]A\ù HH=P 荹 t Z H( H5zK H8N HHJ H5bc H= H t&I,$Z HHa H5b H= H1[]A\ù HH= tIZ H ( H5J H8 HHbJ H5b H= 뜹 HH=z 蝸 u H1[]A\A]Z HHJ H5}b H=G : I|$莌 Z u HZ Ht( H59J H8 1Z L zM,$HZ 11Z LHr` H5a H= FHW t&I,$Z HH:` H5a H= | H 1[]A\ù HH=s 舷 t{Z H( H5uI H8I HHH H5]a H=5 뜹 HH=' / uBH1[]A\HQ( H5I H8 HHH H5` H= Z 10[ LU tLe Z 1[ LH1_ H5}` H= s s ` ` H( H5w H81-u H n` HHƄ$ ={ ` H ` H0( H5Q H8 LHt$ +` E~ Ht$?[ MnHW[ A3^ Mn0E[ |$t w) HX ] HL$hT$tg^ HD$xH+$ HQ^ H( H5N H8V H 1` ` HPHX( H5A H81s H H ( H8} t轊 H( H H}` v 1u H []A\A]A^ H|$c tH|$G )t LgH8t HoH.v H^x v Hfx H^w dw H^w v H^w pw H|$ H|$u v 1w D Hfw H^sw Sw H []A\0 H^Uw v H^Dw u HV 1_ HG `q IHu]H|$Ht$ ` H|$Ht$ LD$` 0q Hh` *H|$Ht$ LD$` H( H5wE H8K 1` HHD H5Z] H=j E1_ H|$Ht$ E1LD$&` IM HE H5\ H=+ 뛹 HH= z_ H([]A\A]A^A_ H(11[]A\A]A^A_6Q +A L z u1{ LeHy E x HD$8H;D$P) D0L@EA+~ | L@H R HD$ HD$4 HHD$ HD$ t$LHT$0|M m HT$0N} RHPH5IJ H( H81p HY12a ; ` Qo HuIY` A N` a HH= 臱 =a :I}褅 a n Ha H( H5OC H8# H1[]A\A]HHB H5,[ H= 1Ea L tMe ` 112a LHbY H5Z H=^ ]n IHu]H|$Ht$ c H|$Ht$ LD$rc -n H5c *H|$Ht$ LD$Nc H( H5tB H8H 1lc HHA H5WZ H=ܗ E1b H|$Ht$ E1LD$b HM HB H5Y H= 뛹 LH= a uhm IHu-H|$Ht$ c IM H5B H5}Y H=L s 1c H( H5A H8f HH= k b HH@ H5WY H= E1)c IM HA H5X H=֖ 1d l IHuH|$Ht$ md H*( H5@ H8 Ź HH= Ȯ c HHK@ H5X H=[ q E1c Hp( LH0ea u%L H1[]A\H{Hie H{H`e Ht$HD uHH E uH $ HH+l$H# HHt@ uHVH1H9} fBHHVH@tHV01HHH= 1[]A\Cp H( LH0` e L 1H1e Z1[]A\A]Hֹ H=P 耭 f 1g H {g 1H$L H Mu/H $Ng 1E1H$E1H $-g L 1g L LaIh H5( H5> H8 HH1[]A\A]HHRU H5a H=- 1H ; <h ILh H( H5> H8v HHU H5a H= G [1]A\ Ht$j H|$(HLρ j H|$( H|$ j HHY[]A\A]J HiHAPE1L) 1HD$0Pj jZ H HHk 1l LK HC 1l PE1LA) 11HD$0Pj j H HHtHHD$k Hv HH= t yl IL$H; C( l HA tlHt$H HtSHHD$H;D$HT$nl HJ( H5= H8 I $Hu= H5T H=_ 1gl Hl< H5T H=> Ht$ HHtHL$I4$E1HA n k H 1Ul H m m H7( H(Xm HH= > m H1[]A\ H L( HfNMA NIFm HfFm ٮ HfFm î HfFm \HFm H( H5~ H8o TIL$H; f( l HA tfHHt$ HH H;D$l Hs( H58; H8 HH H5R H=ُ H: H5R H= H HIHn H9; I$n Hl H0; ffA IfA@eq fIfA@Sq ?A IȀ?A@ʀAP-q L| Kq L 2q *fXo L L q L q H{HX Lp Lh p L[ p HHD$(Ip H{H L2 p L% H p L p H{Hߙ L {p L bp Hp H5 q Sq Iq ?q H q H]q AT1 UHSHH`H|$Ld$HBHwH;HG tU HH= Ԧ tHt$ HHu1 HL$H3E1LA j >1Lh uоC L u H H8 H58P H= . H~yHKH; 4( tlHA t@HHt$ HHhH;D$t:HI( H58 H8 AH7 H5O H= "Ht$ H|$OD HT$ HHH=l 1@z HH|$ tLi H`H[]A\ù LH= x op 6I~y tdA|$H ~nA|$I t!H( H5s[ H8 [1]A\A]A^ÃwwH HH( HH5A H81c b HuA|$H +H( H5* H8 [b HuHo A|$I cH( H5 H81Yc \ut3o Il$ o HtHd( H5 H8= Il$o H 1p : HH;p p ATIUHSHHHHu I|$PHu HӅt.HӅu%I|$hHt HӅuHHL[]A\; []A\AU1 IATIUSHhH|$Hl$HBHwI<$1He t!N LH=ʋ o u/C H\ u%I $H5 H5M H= 1) I1Ht$ 1LD$|$ IL$H; ( thHA t<Ht$H> HHtHH;D$t9H( H54 H8 HO4 H5L H= u f1It-I|$v u0` IH>1t$Ht$ )1Ht$ LD$L$1Ht$ E1T$uLD$H|$HHL$Ht$ HHtHT$HH=ah 1v HH|$ tH*f HhH[]A\A]L1 vo AGxHQ( IWo HA( AGU HAWHAWHAWHAWH AWH0IW AOpo K I_HfAGL|$LdL H}L{[o M~Hon M~Hfn n H|$ m H=< R H; Hlm 1Pn Ho L 1 =@B EA=@B `D@B p A o A d o A o 0E1AHo HH=[ L1b HH HH[]A\A]MAH0o MAH'o H1d H7 vUcvJ= v==' v0= w IHn LH$Hn =?B w I IIIII I9 A 1r 1r q D$O_o D$N_IuPLD$O_ IH IvI~( HD$Ho g q IH:p HH/p VHcHHt$AWARt$8AS舽 H0q HD$H Hp IHo I9tL1r H|$ r p Lb LD$LDHHq -q 1H|$ q I9tAu1E1HD$Zp 1E1H\$p f9yq 8iq H( H5` H8 Kq 1. E2q 1f. Eq 8q 8p HLD$ LD$HHtHL HHtO HHS HD$ H D$p HH9p HH9|p H SHH?Ht{ H{Htm H{ H[ H ( H5S H8 1ZH( H5 H8 PH( H5 H8 1Z1p 1HCP p 1HS` p E1q E1# q Hp Hp 1q Y Hq 1q 1q Y H|l LI$l H HHtL|$ HH HHtNH{ Al HPH( H5R AH81|Z k BY Hl A k k Hֹ H=S 耛 q 1[Hֹ H=ă [ q 1[Hֹ H=Mx 6 r 1[L E1Hr SHHu HsH;[ Hֹ H=V u1[SHHu HsH;[k Hֹ H=" 貚 u1[SHHu HsH;[S Hֹ H= z u1[AVAUATUHSHHL%( M$@ LFHwI9t IP`Hu#HF`H HH9Pp HH9BpuHV`Hu$LHH,$I$y H\$ H H9BpuL0 uA MM$y HLLno 1 tLHLH,$H\$ H;( Hu] E1LHH $I$~ Hl$k H;T( Hu-HCH9Eu H=>( E,H'( H HH[]A\A]A^Hֹ H=& p 1[HH( H<$Ht$Hpl H. HL( E1p L H 1q H 1r L H 1r < HM( HHQfr L H HHt( H<$Ht$Hk H- HHHG( H<$Ht$Hhg H- HHH=ީ N] r 1_s jm Bs HH= HT$if HT$u H1[]_s H= 脗 tNs L E1s HZ8 H9( At At H=Z < -t Z1[]H HI苿 Mt Lht At 11u E1v L( I u L( u APA L) HHL$Q1j j H HHv 1v "T HuLE HHtH( H5h H8G HϾ L nh Hu i i U1H SHHH5dg HILD$膒 u1 H$Ht$HӅxH( H H[]QH( H8HuH54~ H5=~ ZATIUHSH H u11HsLՅxH\( H []A\USPHoH_H AXHHH[H=} 1]n SHH H[H SHtKHR( HHH(r HI y7H ( H8\ u H( H8\ u HF 1mj H[c` HHtH;H H v v 1ҹ HH= 腔 1w H1[]A\H( HH5} H81S H( H5zJ H8 Hn( H5 H8 I<$Ht$ v I~` uH( H| LH0= 1w H( LH0 tL I$ȉ L IHtHHt HD$H L HH Ht$HQ' HD$耵 H|$HD$ѻ H|$ HT$(I$ LP LL$(MfInLL$fH:"D$ Ht$01H )D$0I$ H|$HD$U H|$K HD$H H5 L- ~v H( HYd LH0 L L L H|$ٺ LѺ oHt$H|$H / H|$HD$觺 H|$ Ly H|$t 臺 L Lr h L` u Ht$(H|$L <v HD$v Hc( H5z H8 1xv H$ov A@D$ (v Ht$(H|$ v HD$w Xw H( H5Tz H83 1v HD$v Ht$ H|$胜 2w HD$w H( H5z H8 1ew Ht$HG w H$Gw HD$x Hu( H5 H8 My " ,y H( H5y H8 'y HD$x ~=i )<$z f/${ { G` b 7{ L C` kb { LE1 { M9t"K,DkI { E1i{ MLJ4 ` IHuPL C` a ,{ C` E1a { E1z Ik1ZIcHHt覓 tAIcs 1Ht$~ 1L IcHHts tAIc$~ 1f.G EOGW ߌ z Iх Ho I^f^ H fHn<+u I HY LL H H( D$ $H8yV ؆ ,d $D$΅ ;+uO HCƅ I HV fHnHt$0H|$萙 HD$ Ht$ H|$o HD$Ç Ht$(H|$n HD$Y H( H52w H8 1< H$3 A@D$ ڇ HH&6 H5N H=\ h 1f H ) H( H5 H8H E1LD$@LD$8H|$8 H|$@ AL$ K H|$8 H|$@ H|$舵 HG( H5 H8 E Ag HY sJ H mL$ AR1AWLAUD$xPL$ LD$HHL$(t\ H HtE1 Aw a ' HCH+C H9X i H( H5z H83 A鎈 I H_ HpH% HpH H5 1J I Hta H4( H5 H8 + HP8 H9( W L% [ SI Hu(H( H5 H8 L ُ 1a 1y Am H L E1 Am Am Hdz Am H踳 Am H8J IH IVLH{ HH> H HL=? - H\ IVLH= HH Hp HL> H IVLH HH HH HL> H Ic~ ; HH H HL> H訲 H I IHx IVH &' LHe HH H` HL'> HF 鄒 Am LAm H* :Am 0Am H Am Am H Am Am Hֱ Am Am H躱 H` H IH IVLH~ HHQ H HL@= @ H_ IVLH@ HH/ H HL= HL= IVLLH HH H HL< Hٰ IV LLH HH H HLy< H蘰 I^(H HH HLE< Hd 颐 Am jAm HH XAm H6 FAm <Am H *Am Am H Am Am H Am Am HƯ H 2( *Am H訯 H F IHx IVH &$ LHe HH H` HL'; HF 鄏 H uF IH I^Hu HHH HL: b H IVLHH & HHJ H` HL: 9 H谮 Ic~7 HH. H HLY: Hx 鶎 Am ~Am H\ lH( H5 H8 YL%( I$O H _E IHV Am &H =E IHtIVH % LH HH H` HL9 tuH购 E1 H ( Am H莭 Am Am Hr Am xAm HV fAm \Am H: JAm AE H߃AE M'*H ~( Y Am H H #D IHIVH LH HH= H HLs8 , H蒬 IVLHH a l HH H HL.8 HM I^H HH HL7 H W H HC IHIVLH HH H HL7 HL= 跫 IVLLH HH H HLW7 Hv IVLLHT HH H HL7 H5 s H dB IHI^H HHX HL6 HL= ݪ IVLLH HH H HL}6 H蜪 IVLHH v HH H HL86 HW IV LHH & 1 HHi H HL5 X H IV(LLH HHD H HL5 3 Hѩ Am Am H赩 Am Am H虩 Am Am H} Am Am Ha qAm gAm HE UH ( Am H' 7H ( Am H Am Am H Am Am HѨ Am Am H赨 Am Am H虨 HX? IHlI^H HHX HL,4 HK IVLH HH H HL3 H IVLHH ܇ HH{ H HL3 j Hȧ IV LHH HHR H HLd3 A H胧 IV(LHd HH0 H HL&3 HE I^0H HH HL2 H O H @> IHIVH LH HH H HL2 H详 H ( ,Am H葦 Am Am Hu Am {Am HY iAm _Am H= MAm CAm H! 1H ( Am H HP5= IHIVLH HH H HL1 H諥 IVLH HH H HLN1 HL=K f IVLLHD HHk H HL1 Z H% IV LLH HHF H HL0 5 H I^(H2 HH HL0 H谤 H@; IHIVLHw HH H HL90 HX IVLH9 HH HP HL/ H X Am Am H Am Am H Am Am Hƣ Am Am H誣 H ( Am H茣 H : IH\IVLHP HH HH HL/ H1 o H `: IHIVLH HH% H HL. HL= Ϣ IVLLH HH H HLo. H莢 IVLLHl HH H HL.. HM 鋂 Am SAm H1 AH `9 IHIVL= LHL HH H HL- ~ H̡ IVLHH HHf H HLh- U H臡 IVLLHe HHA H HL'- 0 HF IV LLH$ HH Hp HL, H C H 48 IHIVLH HH H HL, t H誠 IVLHH HH\ H HLF, K He 飀 Am kAm HI YAm OAm H- =Am 3Am H !Am Am H Am Am Hٟ Am Am H轟 Am Am H衟 Am Am H腟 Am Am Hi yAm oAm HM ]Am SAm H1 AAm 7Am H %H`G6 IHIVH LH HH H HL* H趞 IVLHH ~ HH H HLR* Hq I^H HH HL * H= {~ H l5 IHc~ H O5 IHIVL=} LHL HH H HL) H軝 IVLHH n HH H HLW) Hv IVLLHT HHr H HL) a H5 IV LLH HHM Hp HL( < H 2} Hp&4 IHIVLH軾 HH H HL}( H蜜 AvH谸 HH Hh HLB( Ha IVLHB HH HH HL( H# a| Am )Am H Am Am H Am Am Hϛ Am Am H賛 Am H衛 Am Am H腛 Am Am Hi yAm oAm HM ]Am SAm H1 AAm 7Am H %Am Am Am H Am Am HӚ H ?( ^Am H赚 Am Am H虚 Am Am H} Am Am Ha qI|$` u"H( INILHt H012 1 Hģ( LH0 tL HH H52 H=U N Z1[]H ~ H- } . H Z1[]Hw1H=Z J H( H [1L%( I$h E H߃E p Lh E1G m H( H5 H8 Am AE H߃AE ( H 1 H ( [ H>( H5 H8g . HuH|( H5E H8E L%<( Ӄ H跘 L诘 H袘 LZ E H(HHJ( Ht$Ht$H|$uHa HHT$HPy HǃHt5 1H(1 1 HGH HuPH( H5 H8i 1ZHHuH]( H Hٗ 1 5 H=X 1H H`; H Hq 1 H( H5Y H8 H([]A\A]A^A_HFH HH EJ HY E1H- Jt L豄 tIL92 HHL tIEHH5~K u bIEH H(H 1L%i Ht L8 %HH9 HLL IEHH5,` H(L[]A\A]A^A_ Hv Ճ HH5J L Iu1L袃 HH5r9 HH5 | iH~|IEEtHH5 P =Iu L6 #HH5W L Iu L Et~HH5BR L AuHH5 HH5#W L Iu L胂 pAt1fHlHH5V LP P8HH5j 2 Iu L H^ H ;H5U t|HL IuH(L[]A\A]A^A_0 H( HH5c I9EIuHt0 vIuH(L[]A\A]A^A_Z HCH +( H9HHjU HDeHvH(1[]A\A]A^A_y[ H([]A\A]A^A_] Hv IUIEHV H*Hb HHuHu Hr> / HH5 L E1L5 H IE LJt臀 tII9w HLLb uNAlIEI]HD$HtxHIu LHD$' E1H- L-S L9d$~XHD$BDD$ wrHcD HHH5 {Iu L A1Ht H1111H( H5S H8X YH5qS HLP =Jt L5 "IH5$S H5S H5S H5R H5R H5 S 1H IELdI4$H L- HH5 L It$ L~ zHH9}PHH5 Lh uTHH5R N ;Iu L4~ !HH5{M "HH5`R L `1HtH5Q L}H5Q qHI} H5 R H5R 諿 ]H(L[]A\A]A^A_[ HH5Q w dIu L]} JHH5a LA .Iu L'} IuLNZ HH5]6 HH5C Iu L| IuLY HH5 Q 蜾 Iu L| oIuLY [UHH5P O <IEH0H(H$1L%C Ht L| HH9HLL IEHH52P ν IEHL M1L5%` IEHkH4H L{ nHLLi VIE LH4K{ 8HI9,HH5I L" v F _ H HcHA IEHPH H HH H HH5N HN HEHL觼 I]HH H HD$HCH HHC0H1 L HD$HHD$I)H 1H9l$ HLHtX M HH9l$ IH9l$ HH5 L uF H-M A9~ HH5 L蛻 HHL胻 pIuLly YA9h1LHH5} C O+1H5 M HXk H-:Z Z1> H-0 >Hr( H5M H8 H-3 1HD$3~L%ML H@L @IE@HD$A9 H^H L#MEE1D$JtT$LVx CIM9 Ht$HL/ uHvHt x H .Z HLH IuHt Lw I} LHHL豹 Iu zHH5 芹 wI]Ht L#MA9q1UA~HH5 F 3Iu L,w HH5kK L Iu Lv HH5:K Lڸ Iu Lv A1H'( H5J H8耾 1 L%GJ A9~ HH5 Le RIu@LJv 7HLL2 @IuL v 1 L%I v1 L%I c1 L%I P1 L%x< = L%|I '1 L%NI 1HH5I Lw dIE LH4Yu A1 L%H E1H{ HH5M L HsHtLS HC1H= HHs HL$HB H.HL$H)H E1u HH5 L蝶 HCJtL3S pHxJHC HLHHL$t7HH5s LO <Ht$ L4t !IHL9d$hH{( tMHH5% L HH5:H L Hs(L}R HH5;X L豵 IuHL$HCHLH)Ht3R pMy6H|$ KHQHCH H8 dHH5P L, HC0 LJt s uHH5DG L H{ t!HH5 Lȴ HCHt1H8 1H{( }1 1 L%!F 1 L% F 1 L%E 1 L%E 1 L%E H( H5BG H8 10s H( H51 H8ٹ H(( H5F H8 1s H ( H5F H8褹 H( H5F H8茹 Hۈ( H5wF H8t HÈ( H5MF H8\ H( H5F H8D H( H5XF H8, f1os 1[]A\L衃 H虃 u H范 H脃 t Hw t Lj Hb t HH=u Z ls 1$t P HuH( H5E H8腸 ~t 1HFu Ht L 1t 1Hs 1 HU( H5 H8> 1 H( H5 H8# v Hv 8 u H( H8T v Hp 1w Im u IELP0E13 H+uHCHE1P03 Ht$H|$) xGD$f(fT W f. X 1 S4 L$ 2 IELP0H+3 3 Lt$k3 Im tH+,4 HCHP0 4 IELP0H+ 4 E13 H5 H|$ H|$v IFI9Gw Lf |$ w w Hl$w L-Ն( w Lt LLL{. x@}w Hl$LLL|$HLt$ L-( L9w L v 1v HH= uZ1[]x 1ҹ H= ?X w ~-U fT+ax tQf($$`$$E \f/%W w H[]X\%U x XU E ^fT U ] |$Lx H( H5B H8y 1=x H-{( H} b Kx H} H5 J 6x 1x HO( H8 R Hx 1x H( H5 H8 Iy xy 蒈 Hy ݾ( H= 軱 E1~y H ( H5 H8趴 H( H5 H8螴 1z uM y nH( H8]Q SHHu HsH;[4[ Hֹ H=J [V u1[SHHu HsH;[ Hֹ H= J #V u1[L-( z Lv LHL+ xpz Lt$LLL|$LH\$ L-̃( L9z L+~ y Lt$fz HCI9Gz L~ |$ Ez hz 1y Hֹ H=}7 fU \z 1[Lj H| 1[Ht HT$HHuH<$Hu1} Ht} }} H ( H5m H8ղ 1HD$~ HІ( H5q H8豲 ~ L H 1 - t#C B Hs0p H= J 1y HPHk 6 ' A H( H5? H8 AwHs0@ ܀ HsHӀ HŃ( H5 H8 A L6% H f 1 H E Ht;Hׁ( HH5 H81{ % H( H5 H8耱 H $ H H1H e) HH$HILD$H%? 1> 1tH4$H|$H1ҹ HH=ت -S 1$ H( HH8\E 1 H( H5 H8ϰ I4$鶀 L}I8 L9tAHHT$HHD$ k HD$HD(HE S 1L H\Ht ) _ N E1H [HH@ ]A\[]A\1[]A\1[]A\HӅ: H ( ATIUHSHGHH@`Ht H HtH;( u!HZz LHH = H[]A\1v []A\HC@҂ E1ɂ Lc@˂ # Hx[[_ m H= O 1[Ã11҈M R @HEH HE0 HuH@` Hu0W w"HH5 HEHHHu7G# E 1HMHH}HU8HU0E ur1 DU HEAAuaH}(LIH)IHHI9sUA@ AXIIHH AXHH AXHH ICHMH@tHM0HuHA@tHu0HH_E1H)HIIIH9MBHLH9IBHL9sHHfNEu9HE@1fB HEE HM8HM0E u 1Hu(Hu@ނ A@HUHtHU0L@x ԃ U HHSH5 HӺ HH( ILD$H$1L 1tH$H|$HH[]ATUHS> HtHH> HHu Hw E1 HH HIw Hw L[]A\UHSQ # HHtHH̐ HHaw HHZ[]HOw HGw 1r H|$6w H<$+w H|$!w H<$Htw H|$Htw Lv Lv Lv 1LL Lv M L ^Mu'L LLv Mu$LƷ 21LGL请 1L0L蘷 Mu'L膷 L9v Mu;Ll 1LLU 1LL> 1LL' Lu Lu yLu lLu _Lu RLu ELu 8Lu +Mu"L譶 L`u L蘶 1LL聶 Lt L'u 1LLU 1LL> Le HG{( H5<8 H8@ |H} R H}(A H}00 q E1龇 + [1]A\A]A^, Hlt 1鈌 铍 Hz( H57 H8袩 L L-y( e HGH@`H H5T H9p( H|( H|$Ht$HT$ Hs L|$ 骍 IGH9CtLs |$ Lw LHL xZ Lt$LLL|$LH\$ L-x( L9< LSs Lt$霍 Hx( H 1 1[SHн H t蔙 HM H{( H@ H@ H HS H [HCH[H@ SHHHt 1HSr H{Ht 1HCr 1[PA L1Q) 1HD$Pj j` H HH_ 5y Hu+H{( H@ Hw( H5 H81y 1d } x HGHpH8hX 1[]A\HP H H H H H H H Hh H H H HX H H H H H Hx H H H HGH H|$zz t;H|$G 駍 pA 4 ) H y( H * HwH降 1 L%z( I$鵏 m E H߃E p Lp E1鎏 H \z( = Hu( H5Q H89 HGhHt1RHOhHp 1^11HSp Y L锏 DGHHEuAHJpHrxHtHA tH=7 1x! DH=V 1g! Hp; HuHl; HD; HD; H,; H\; WH t 1Y @T Ht1ZPA L@) 1HD$Pj j诅 H HH 1^ 8u$Ɉ 1@ H Hs( H8A AWAVAUATUSHHH8HuH~ HHu2PHA 1L9%) HD$Pj j H HH H; ŃtH{ Aău Ht H H{Ls.7 IHtHN LHn Hu HH L;5w( ux 1҉HDIۼLI` My趸8u*| tPH8LH=* 1[]A\A]A^A_G Hr( H8H8[]A\A]A^A_j@ L|$LLt u1]M8uD uj HLDI7LI MxLH=,* 1 H%r( H8? H8[]A\A]A^A_SHͶ H [HWHa t Y/ j Ht1ZAWL=1 H AVfInAUfH:"ATIHUS1H H<$HtHYHBA H1)$ HWHkDŽ$ H$ H$ H$ D$HD$$ $ uH~ HMu5PLA 1L) H$ Pj j\ H IH Ht$I<$ HtdMl$Mt HHu `L-u( I\$HtHtTI|$HuI|$ B# Aąy?: Ht$L ( HuL-Nu( A 1A 1A HT$PH-(u( 1HDt$I9 HtHRp( H5 H8 Hs( I9EtHp( H5Ӵ H8à L& HuI}1HT$(Ht$ tkI} 1HT$0Ht$ tR~D$ ~L$fH:"D$0fH:"L$(D$hL$X}HtpHr( H9Ct Hcp( H5| H8, 15 H荭 HuHsH<$HL$`HT$X/ tHs H<$HL$pHT$h u D$P A$H$ u1<$ t+H$ u Ho( LH5# H81x g$ DL M$ DL 3AALH$ EEHH5 HDH=. Ii < EHAuEtA1҃|$P H$ uT$X\$hHT$0)T$0)\$@ PA D$Pu<$ t:H$ 1ud$Xl$hHT$0)d$0)l$@DAk$ t)1ut$X|$hHt$0)t$0)|$@pA6H$ 1҅uT$X\$hHT$0)T$0)\$@1ɿ蘱AH EyHm( H8: HE H|$f H H[]A\A]A^A_AVIAUIATIU1SHG LH0 H HxH tHxt1Z; I~HN; HH5 HHm( H81@ CHx5` IE Ht'H{ I$Hu 1H@ Ht1Hg []A\A]A^AWH AVAUL-+ ATfInUfH:"1SHHHhHtHiH= )D$1WD$8HHD$ HT$@D$(D$HHuHx HHu3PHE1LZ) 1HD$Pj j| H HHuE1 HuA /H;HuH{ AąyHt$T tHuɋt$8DL uHT$HHuHo( 1H5*0 H=* {Ll$0MuL-' L5 I HuH|$H LH HHu 2誯 |$8HHIDžx tHLEt bHHL Hy'3I8"u H mH|$H 1 IHuE1VHIHL9tHA} u<LH)MJ IHtLH LA_e Et LRe I}IH H|$% HhL[]A\A]A^A_AWH AVAUATE1UH-w) SfHnfHnHfH:"H$ HfH:"H HtLaH9 1E1I)$ HWL$ H$ Lt$0DŽ$ H$ HD$@ D$XLD$`$ $ )L$0D$HD$huH~ HHu2RHA 1L) HD$ Pj jz H HH H;L H{L t|ItH{" AąydA $ 1DHHD$ uAHL$hH$ H5q H=( F x L- Im HuH$ G 1 H1t HD$HHtHP HT$٬ Ht$PHT$$ H$x H H$ HEt:H<$HD$ HD$Hy5MI8"u Hb LH$ Hb HH9t H|$H{ H\$L L H H[]A\A]A^A_AWH AVAUATIHHU1SH( ~&% ~ % fH:"HM" fH:"HtHiHq6 E1E1H)$ WH$ H$ 1HL$ LL$`L$ Lt$0DŽ$ L$ HD$@ D$X$ $ )L$0D$HD$huH~ HMu1WHL1A LC) HD$Pj jTw H IHtfI<$L tVI|$L tEI|$1L Åu0C L襆 u&IL$H H5u% H=% R 1 Ht<I|$Ht ÃtHu HtI|$ Ņy뷽 $ H=%% uRH5 % H= % SL$ L$ HL$xH$ Y^]ک $ Ht$PH$ H$ Iąx A菫Hc!H$ At 膥Hc謡HcL HtH$ HKi( H HL L H$ tLj H( H[]A\A]A^A_Hi( H5!$ H8 1 Hh( H5 $ H8Ҕ Hc( H81 Hy7APE1Lh ) 11HD$Pj j u H H H1[]A\HtH I HC Ht H H[C0t< t7H HC Hu11ҹ HH|$yd H|$tޅt HH 뺋D$ HuAE Hb( H8 1l H\$ LIHtAL; 1AHl$ 1q )D$ 1fIHD$0 D$HHT$PD$ D$8D$XHl HA H IO HEb( Ht$XH8 H x+USHP' {H,H肹 ZHc[]B Hd( H USWH! t HHB u V HtJ Hu YHc[]A Z1[]WH tP} Hcu Ht HuY 1ZAVAUATUSHHH Ht LqIH~HIHu5IPHA 1L\) HD$Pj jmr H HH- H;% AŃtH{ Ńu f Ht W H A ItuH{Y Aą u_=g( tV莥 D IlL y(=_g( u08&Ig( =Bg( t )=7g( uY8 DI軗L葷 yH`( H8- Eu#11l y| HuH Hc[]A\A]A^ H 1[]A\A]A^LH)H3 H HH> HH[ H f*X" 5 HD$LT$L$8L$LT$HD$f. MGI)o HP_( H5 H8 f \/ H+ Hֹ H=% 1 1~ 1[S f.0 fH~zu3 H1Ht M w0 fHnT/ f.r)H1fHnÉ躩fHnf.z u Ha( H a( H [ø Ht'H~ t PH7_( HH5]Y H81 1ZH=m 1 H|$ HH[]ؗ Ht$(H|$ Y } HD$ ~ |$ l 1 fT. D$ fV~. f./ E fTS. fV[. f.n/ E11҉|$ H]( H5 H8% 1t$ nfW- 鉀 0 | Hla( SHHH9t H( H9( t HsHt3HtH=y K uo H=zy / tUH{Hs uH]( H5ܢ H8t ,Ht H;5na( uH]( H5 H8N [&# 1[HH H5 H=] x 10 HHt$` HT$ H|$Hu$1 HHT$` HT$ 1HD$WW H\( HH5 H81 i K HW HD$1HE1N H\( H5` H8h A - H~\( H5 H8G H@ HV c H H6 Aă@ H H H\( HH5 H81 H|$PH DV H8 LHͭ Lt$PML I~ V MfH4$L HH E1LI9 IFH= N,IE 2 H $HT$hLL D$ LU D$Z I9^^ HD$hJDIH LH $ Lt$PM$ H= 諟 H $HT$`LH_ A藜 EE1LL|$PT H LH茬 I$ L|$PMg$ I n$ IGH4$HHD$ Pl HD$HK1Hl$0HHD$ H9p$ IGH= L4I H0 L t% ~% ś L=T HL$ I;O-. HL$DHE1LLD$P T D$HD$@1 HY( H5 H8W A W {Hh LH` = Ld$PM L=s L <H L A 1LHt$PYS Hp LH Hl$PH L虝 L<$HT$hHHLJ A肚 E1HHD$PR DPAWL$XDL$PDD$TT$\Ht$xx HL$HZYH YH LH> Ld$PM L5 L H $HT$hLH Aՙ E1H|$PL=R H LH˩ ; Ld$PMY L} H $HT$`LH1 Ai E1LHt$PQ H LH_ Hl$PH L BL4$HT$XHHL A E1HHD$PbQ AVD$HPL$\DL$TDD$XHT$hHt$pH|$xI HL$HZYHf H LH诨 @ Ld$PM L5z LZ H $HT$hLHrs AF EfE1LL|$PP H LH; Hl$PH L L4$HT$`HHL A֗ EE1HLD$P=P AQAVL$XDL$PDD$TT$\Ht$pH|$xH HL$HAZA[HC HU( H5Ȼ H8X A HnU( H5' H87 A HMU( H5ֻ H8 H5U( H5> H8 H U( H5ֻ H8 H LH L|$PM I IGH4$HHD$& IH Hl$ E1LHD$I98 HEH= N<IY H $HT$hLH D$0D LN D$0 HD$H9E HD$hKDIH"T( H5# H8 A HT( H5 H8ʃ A ! H5 HHS( H81 H|$PH8 LH賥 L|$PM I IGH4$HHD$ IHtHl$ E1LHD$I9' HEH=2 N<I ;H $HT$hLH D$0 LmM D$0 HD$H;E HD$hKDIHR( H5 H8蜂 A a \ H5 HHR( H81Q H8 LH芤 L|$PM I IGH4$HHD$ IHKHl$ E1LHD$I9 HEH= N<I H $HT$hLH D$0̓ LDL D$0HD$H;EE HD$hKDIHQ( H5C H8s A 8 3 H5T HHzQ( H81( |H0 LHa L|$PM M9 H= 7H $HT$hLH D$ D$E1LL\$PUK H@ LH [ L|$PM M9 H=5 舕 H $HT$`LH< D$s D$E1LLD$PJ H LHe Hl$PHS L9; H= ;H $HHT$XH 1HHL$P`J fnL$DfnD$L0 f:"L$@f:"D$HH<$H\$Xfl~L$hfH:"L$`)D$ )L$ H foL$foD$ HL$HXH@ H A 1LHD$PI E1L|$hdI1Hl$ LHt$PI H LH0 Hl$PHtH= HT$hHH AҐ E1HHD$P:I LPt$L$XDL$PDD$TT$\t$xw HL$HZYHD HN( H5 H8Y~ HUQ( H5 H8>~ rH8 LJ t H L. 4IE1Hl$ LL\$PsH H LH -Hl$PH H= 诒 HT$hHH A蟏 E1H|$PHH LAPt$L$XDL$PDD$TT$\t$xCk HL$HAYAZH rI1Hl$ LHD$PG HP LH@ >L|$PMn I x MoH4$Li H1Ld$LE1MIIM9 HEH=L J H蛑 H $HT$hHLO D$ 膎 HF D$ L9} HD$hKDIS A `t? A LH L5 tW A E1LLT$PxF E1LL$`1H|$PL\F 1Ht$XHD$1HHK( LH5( H81v 衍 HK( H5 H8v{ < H55 HHK( H811 HMN( H5 H86{ HRK( H5 H8{ zHN( H5x H8 { 4H K( H5 H8z I1LLd$LHD$PVE fnL$DfnD$L0 f:"L$@f:"D$HH<$fl)D$ H L`foD$HL$Hh@ HHEH=j J HM H $HT$HL D$08 HD D$0uL9u HD$hKDIM9|I1Dt$ LLHL$PmD fnL$DfnD$L0 f:"L$@f:"D$HH<$fl)D$ H HD$1HHL( H5 H8|y H0 LH蕛 Lt$PM H= C tH $HT$`LH A/ EO1LHD$PC H LH% Lt$PM I~ MnH4$L讼 HHHD$hDd$ E1IHD$LMIM9 HEH= J Hs H $HT$HLm D$0^ HB D$0sL;u HD$hKDIH LH> O Ld$PM+ H=Q H $HT$`LH蠾 A؉ E1H|$PL@B HH LHΙ Lt$PMH H= | H $HT$XLH0 Ah E1LHt$PA H LH^ o Lt$PM I~ MnH4$L HH$HD$hDd$ E1IHD$LMIM9 HEH= J H謋 H $HT$HLl D$0藈 HA D$0L9u HD$hKDIHzF( H5 H8Cv A HH LHV Hl$PH L9 H=( ,H $HHT$hH诼 E1HLD$PP@ fnL$DfnD$L0 f:"L$@f:"D$HH<$H\$hfl)D$ H foD$HL$ HX@ H. H0 LH| Lt$PM H=_ * [H $HT$`LH A E6E1LL\$P}? H LH ; Lt$PMY I~ ` MnH4$L蔸 HHHD$hDd$ E1IHD$LMIM9 HEH= J HY H $HT$HLi D$0D H> D$0YL9u HD$hKDIH0 LH$ u Lt$PMQ H=Ϭ ҈ H $HT$`LH膺 A辅 EE1LL|$P%> H LH賕 Lt$PM> I~ E MnH4$L< HHyHD$hDd$ E1IHD$LMIM9 HEH= J H 2H $HT$HLoh D$0 Hd= D$0L9u HD$hKDIHB( H5 H8r A ] HB( H5G H8wr A < HB( H5 H8Vr H5ج HHfB( H81 hHPB( H5A H8r H5c HH)B( H81 +IE1LDd$ LLT$Pg< fnL$DfnD$Lf:"L$@f:"D$HHD$`flfHnfH:"H H<$0 )L$ )D$ H foL$ foD$ HL$H@ H% IE1LDd$ LLl$P; fnL$DfnD$Lf:"L$@f:"D$HHD$`flfHnfH:"Ht~H<$0 )L$ )D$, H foL$ foD$ HL$H@ H錽 H @( H5 H8p HD$E1LHD$E1L H?( H5P 1H8np HD$H(HD$1HHSC( H5 H8<p pHH LHU Hl$PH H= 4H $HT$hHH跶 A E1HHt$PW: fnL$DfnD$Lf:"L$@f:"D$HH\$hflH H<$0 )D$ H foD$HL$ HX@ H, H}?( H5 H8Fo A H\?( H5m H8%o V H5| HH2?( H81 \HL>( H5 H8n HD$1HHD$1H 1LHD$PH9 fnL$DfnD$L0 f:"L$@f:"D$HH<$fl)D$ HfoD$HL$ Hh@ HHH LHy Hl$PH H= ' XH $HT$hHH۴ A E3E1HLl$Pz8 fnL$DfnD$Lf:"L$@f:"D$HH\$hflH H<$0 )D$ H foD$HL$ HX@ HO H=( H5! H8im A . H=( H5 H8Hm H57 HHU=( H81 WHo<( H5 1H8m HD$H2HD$E1L"I1LDd$ LHD$P_7 fnL$DfnD$Lf:"L$@f:"D$HHD$`flfHnfH:"HtDH<$0 )L$ )D$ HtMfoL$ foD$ HL$H@ H% H;( H5ǩ E1H8<l HD$L8hHD$E1L0XA E1HLT$P6 E1LL$h7HD$1H8!H>( H5r H8k H;( H5 H8k A | H>( H5ި H8k H>( H5 H8{k H;( H5 H8`k H|;( H5՝ H8Ek vHa;( H5 H8*k nE1LLT$P5 D$LD$D^ H LH& Ld$PM L5 L H $HT$hLH腱 A| EE1LL|$P$5 HH LH貌 Hl$PHT Ld L4$HT$`HHL AM| EmH1H\$P4 UAVL$XDL$PDD$TT$\Ht$pH|$x HL$HA]A^H Hh LH Ld$PM H=Ȝ ~ Hs0L迻 { A 1LHt$P4 HP LH蒋 Ll$PMO I} Y MeH4$L HHHD$hDt$ E1MHD$ILI H 9( H5 H8h A 髵 H8( H5 H8h HH LѺ u z tz A H8( LH5 H81S ~z H8( H5[ H8Sh A Hi8( H5 H82h HQ8( H5 H8h H98( H5b H8h H 8( H5O H8g H5f HH7( H81 H7( H5' H8g A l H= | H $HHT$`HD }y 1HH\$P1 \ Hr7( H5[ H8;g HH LHW 5 Ld$PM L5z L| 3H $HT$hLH趭 Ax E1LHt$PV1 H LH Hl$PH L{ HT$`HHκ Ax E1HHD$P0 Pt$L$XDL$PDD$TT$\t$pH|$x HL$HZYH ZHB6( H5ۤ H8 f A в H!6( H52 H8e A 鯲 H 6( H5 H8e H5 HH5( H81 H5( H5, H8e E1Hl$0LL\$P0 H LH蓇 PL|$PM I MoH4$L HHYHD$hDd$0E1IHD$ LMIM9D HEH= J Hy H $HT$ HL蕫 D$8v HD/ D$8L;}y HD$hKDIH4( H5h H8xd h> H5 HH4( H813 Yv L. uH LM % P 'v L. ]HP LH# !L|$PM* I MgH4$LL HHH\$E1M9 IGH= N,IE x H|$H $HT$hL8 qu L- M;guXHD$hJDIH=ܦ /x `H$Ht$hH u @1HHt$P- 醰 H5( H5% H8b 9 H5 HH2( H81 H2( H5U H8b L - L$DL $HDD$@T$Ht$L#l HL$HHH~2( H5_ H8Gb A HH LHZ K Ld$PM' L5 Lw 6H $HT$hLH蹨 As E1LHD$PY, H LH Ld$PM Lv H$Ht$`Lp As EE1LL|$P+ H LH} n Hl$PH L/v `HT$XHHg A s E?H1H\$P+ 4$D$HPL$\DL$TDD$XT$hHt$pH|$x. HL$H]A]H IE1LDd$0LLT$P*+ fnL$DfnD$Lf:"L$@f:"D$HHD$`flfHnfH:"L$H H<$0 )L$ )D$ H foL$ foD$ HL$HhH@ H DpHEH= LL$0J4HHt$t Ht$H $HT$hHHt$ TE D$q H|$ ;* D$L;}LL$0v HD$hKDI H H5 HH/( H81= Hy/( H5 H8B_ A IGH= LL$8LT$0J4HHt$t AHt$H $HT$hHHt$ 轥 D$p H|$ j) D$LL$8M;OLT$0unHD$hKDI˱ H.( H5e H8^ N[ H5, HH.( H81P H.( H5M H8U^ HQ1( H5 H8:^ nH61( H5 H8 ^ {H1( H5 H8^ 8 p L( &H.( H5 H8] A 霪 Hp Lݯ tt)o L7( o L ( H` L蜯 tt)~o L' go L' H L[ tt)=o L' s&o L' BH L tt)n Lt' 2n L]' H Lٮ tt)n L3' n L ' H L蘮 tt)zn L& cn L& H LW tt)9n L& o"n L& >H( L tt)m Lp& .m LY& H+( LH5; H81艼 m L,& HD$E1L H+( H5 H8q[ %Hm.( H5 H8V[ Hr+( H5 H8;[ H5 HHH+( H81 JH2+( H5+ H8Z I1LDd$ LHD$Pl% 4$D$HHPL$\DL$TDD$XHt$hH|$p HL$HZYHq H*( H5 H8Z H-( H5 H8kZ H)( H5 H8PZ HD$E1LyHa*( H5 H8*Z H&-( H5w H8Z C1ɃHM , H *( H5ޡ H8Y 9ED! MDAЉH )( H5e H81蓺 1 H}HH H5 赱 . Hu H? +1 Hu H tH}H H5: a tE1HEH HI9 N|1HI7臎 TIwHt H豱 6IwHɷ Hs IL= H}H5^E Lΰ E1HEHtWHI9 JL HH1HL$4 HL$HqHt H I1H'( H5 H8)X +1< H&( H5i H8 X 1 Hu H豰 rHuH H菰 +l HuH˳ HI HEHt H8 HU H H: HUH L2M H HI9 N|IwHt H vIwH H賐 [HEI룃+驮 Hu Ho H膐 jHu1ɺ H. OHuH躱 ;Hu(1ɺ H +< HuH H HuHƉ Hu 1ɺ H譮 Hu(Ht H +q̭ +ĭ HuH~ H衏 HuHN qHu 1ɺ H5 VHu(H Hs +P I HmHI H5 H袭 1ɺ HHȭ + Hu H + HuHt H +c龬 鷬 +鯬 HS$( H5$ H8T 1 H[]A\A]A^A_E11ޫ AȉH$( H5 H81荵 1ƋMDD9 9 HuLH AF$ A9F, IvHt H IvH H jHEIH 1I9 NtAV EN(D9wH<#( DH5R H81谴 1Hu Hx 9HuH H: HuHy +& Hu H( Hu H HuH Hь Hu H +b齪 Hu H迫 Hu H覫 gHuH Hh LHu H觩 +T Hu>t} uT HK HuHt H- Hu H + He"( H5V H8.R 1DL= H}H5> L- RE1HEH HI9 JL HH1HL$菪 HL$HqHt Hl IHu HM HuH\ H HuHN + 1U1HuLHΊ ʨ +Ѩ } xTH}Hr H5 ' 頨 H}H{ H5 鄨 H}H3 H5 h H ( H5 H8P 1HuH H7 HEHt H8 X HU HS H: I HUH4 L:M:H ( H5 H89P 1OHuHt? Hܨ HuH H躨 +<闧 H} u 鉧 H- ( H5 H8O 1E1VH ( H5q H8O 11>H ( H5 H8}O 1Hu HtH> uHuHtH> u+ H8 uH' +yԦ E1 Hp ( H5 H8 O 1 +駦 HHu HtH> uHuHtH> u+y H败 uDH裥 +P D9u6EF,A93AN,D9 Et Hߦ H ( H5 H8LN 1Ϧ H ( DH5 H81 1~ CD9 HsDHȦ 骧 H ( H5 H8M 1= CD9 Hs H艦 k HsHH Hs H] kHsHڦ H; HsHt5HHt-HCHt H; H ( H5 H8=M H ( H5 H8"M Hs H̥ 鮦 HsHL H譥 7 Hs H菥 q HsHk Hs1ɺ H HsH8 Hs H2 }HsgCD9 Hs1DH褤 CD9 Hs1DH肤 ĥ Hs1ɺ Hj 鬥 HsHCHtjHH H H9t]H5( H5 H8K Hs Hx Hs H_ Hs1Hu Hգ Hs1ɺ H躣 餤 HsH~ LHs H Ť 1.HC8 H+( H5 H8J HsHthH>~b1ɺ H1 s HsHt Hv HsHt HX HsHУ H( H5` H8hJ 9CD9u鶣 H g tH S HW HDHF AtAH; H) HEHc( H5 H81ڪ H( H5? H8I AȉH&( H5 H81蝪 9F, N,AЉH( H5A H81o `N,D9uօr 9j AH} H| HEH( H5̓ H81" Hs H []A\Hn( HH5 H81 1H;'( ATUSHtH;( t萨 Htf1[]A\Ë;C9H HHtH IHt^HH- thL! HP( H5٩ H8yH 1H~< H5= HH( H811 1q HHt 1XH L + 9AWMAVMAUAATIUHSHARHu H( H5 HHu.QMELj HHj AW7 H HHt7 1Z[]A\A]A^A_D H D Lc鞤 Hc郤 1| H$ 1I1HD$HD$ E1HD$H$ D$0 PAR Y^鄤 1驤 G` S Q黥 Q魥 Q韥 Q鑥 Q郥 P1s USHQ P =p u G` к {` t P1=Hߋk肜 Hu${` kt QH Huk V Z[]L 1I H= H HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H( H$ HL$H@ HT$HT$ HT$HHHD$ D$ 0 1H AWWAVAUIATI1USHH8HG`L|$Lt$(Ht$HD$(HGhLLG`HD$ HGpHWpHT$ HD$ Hl$HtH|$ H H H|$(| Ht$LLH)N HC`WLHT$LHHD$(HChC`HD$HCpHD$1HCpn Hl$ Ld$HE HLd HL躳 HL$LHHt$( H81[]A\A]A^A_H( Hh HxH*HHH H*XY f.5 zuQ軣 Hu^頴 1Z间 HH( Hh HQHm( H9FuF r f. zuj Ht 1oWf/rH( H5 H8C Y H( f/sH,Hh \H,Hh Hh ?HM( H ZH( Hh 輜 t H{1E1H HG(DG|HW`H` 1 HH8j Hm uHEHP0H5 H=) H5q H=) LȜ wL( H5^ 1 L 1P L L H L UHSHQ蓦 Hu3HE tH} te 3HL( H5~ H8 B HuH'( H5 H8A @HS u H( HRH5l H81袢 H8HHHtm 1Z[]H[ HD$S HD$ HaM H|$HD$H 鼧 $ HD$H H|$ 隧 x"H(H=x []A\A]A^A_ E1 E1 H5 H=&' )fnf:"fC HQ HHtWH@H HtGYHH[]H( HRH5J H81耡 H( H5}| H8@ H}( H H|$HujL 1 Hu( H5 H8>@ ũ H % H M( H; tH;H57 @ H|$Ht Hl$ Hp HHҨ ]Hֹ H= g 1[1[]A\SHH0Ht 1HC0 H( H[H H5 SHHH1H5 z H=z ? y1,{Ku H=( H HCxH{PHu ~ HtH [H5J H5J HS( H=C H@ H@ 1` QH ( HH5 H@ H@H H L 1 1t H( H ZH HG H HG(H QHt HF uHx( H5y H8A> HG HHw HtH 1ZQHt HF uH.( H5oy H8= HG(HHw(HtHj 1ZATUSRD H D#[]A\UHcHk"; SHHHH ;"; H( Hh0HP =z( t>Ht$ \$ Hy&@R V( Hcu tH5~ H H[]HG(HW`ǀ` H` , SHHuH;H u+ Hֹ H= u~ HuHR( H8 1[H ( H ÀK@@ ATIUHSHHHHuHHL[]A\qv HӅt[]A\H HL[H]A\ G` v 遨 V鳨 P1飨 G` G ƨ H蚨 IH H* H L 1ը G` د HL IVAH 顩 HEG C` 詯 P霩 HLH1+ HH@ L9$$t$Ds JT Iר H $HHT$HHH4 H$ۭ HT$HIulHF C` P C` | PE1 C` E1Ѯ PĨ E1P鳨 H8USHQ P =p u G` 肮 {` t P1< Hߋk( Hu {` ku5 H( Huk Q Z[]HWH; ( H W H; ( H C H;& ( H>i / H; ( H HVs HE H| H H H Hw է H ɧ H 齧 H 鱧 H 饧 H( O H5 H81 1郧 H w H k HZ _ H S H G H ; H / H\ # H= HV HGH@(Hp H8 Hw(H1H= U1SHQH t'H[H; H > ( HH; HH HZ[]Ã9]e 郾 1H|$ tH|$G 1鱧 HwH+ H)( H5( H87 1 f Hu H( H5 H87 1 : H H11 H ( H ~ H|$ tH|$G HwH 1Q 1鰨 H( H5 H87 AUATUSH( HR( H5c H86 HH=> HD$Hu1 H t6A HCH5̄ HPH ( H81w H|$H! L- ( HT$HI X y H( H8Y Ld$Mu HT$IP H^X yD H= 1Lı LH H H|$Hs} H|$ u Ld$Mu.HS(Ht$H=G 1u H|$HH H lH=2 1LM LH" Ht/H|$H } H|$ u'H|$H H|$Ht HW rH(H[]A\A]V H~( H5 H85 6 tH`( H5q H84 HH( H YH 1ZATUSHHH!( HT$H V y H( H8襞 X Ld$Mu HCH= HpH1[]A\ H( u&HCLH= Hp1 HHP $~ HCH5Q HPH.( H81 1L 1HH[]A\HS( HHHH@ H3= ATIUHSHHHuI|$1HtHH[]A\HӅt[]A\1钦 Ll$@1L<Ņ Ht H! HHA HCHf HCH|$ L % Ht$PH|$ HD$HD$ I$i Hd Ht$@ HH HCE ffH*D$HYh H*L$@XC H|$ q@H H=( H-( Ht/f H` H*HHK HC^CH|$ H ʚ;t H|$(H ʚ;H_ H HP( H8 n f >H{=j; u ^; Ht H HH HCH HCGHHt@B ʚ; I$1 H( H5 H81 fA_pHH9 H( H( H5+ H8f1 1 HH=3 h ܤ H H1[]A\H} HHt$H< HHD$ Ht$H 蛐 HuH酤 PH ( H5 H80 1ZL芲 I,$uL虐 6 Hs(H{ LS I,$[ Ժ H H L H7 H9( e e H= @ L H C HGHW(H@ H<} QA LJ( HHL$Q1j jM H HHy 19 a HuL; IHtH' H5 H8/ L 跣 L=; HWHG0HBHWHR H<N} HGHPHGH@ H<5} ATL%^ UHHSHHHf ( H9t5H( H9( t%1ILD$ LH u<HtL_ t+H<$ HHt1H0 Hu H0 1HT$fHnHfH:"@H[]A\H( AVAUATIHUHSH9t9H( H9( t)L; IH/H^' H5 H8'. EHtH= 褕 t0Hx4 HHt A K| Hu Hp 1-JDIM9u1H0 HtIT$HXHHP[]A\A]A^H'7 H9( L L H= 8 Z1[]H 1頥 H Hn7 H9( # # H= > Z1[]H 1騦 LՅo _ ATIUHSHHHuI|$1HtHH[]A\HӅt[]A\H; L3 7 H& * H 1¨ 1鿩 Hֹ H=x X 1[[1]A\A]A^L%Ď7 LL xHS(HKL1H5. O% HHtHK HsIH= [HHD]1A\A]A^韢 Hw Lo Lg [1]A\A]A^HT LL HB [ Hu1驫 1鱫 RH H' H YH= 1$ H=~ 1[ HuH{ W 1L 1T Hc' H5 H8,+ 1 HF' H5] H8+ 鴬 H W H W H=i Y1[]铡 莊 HuH{ 5 1* 12 Hw[HH=8 ]1A\W L/ [1]A\H' H5 H8* 1 j H 1HG' ( H;' H' H5; H80* 1̰ 鷰 ʉ Hu1J 1[]A\1HD$蛬 HHuH1[Ht$HH=W 1[c ~ HuH{ u 1j 1r H8 Z1[]L ' 鋲 H' H5ν H8) 1} 1 PH' H i H=h ZH1 Hm' H5 H86) 1 Դ 閴 馴 Hr|7 H9( Ѵ մ H|7 LH5t H=H 1[HH=5 X H= L' I ۴ 1 2 Hb 1j Z1[]H7 H9( H % H= P 鼵 H{Hض E1LC Ƕ HW0Hw1H={ A[[]A\A]闞 Lo Z1[]A\A]L] LU H' H5 H8' 1 1 G Hu k H' H5 H8r' Hu1 1 1и H' H5ػ H8;' 1w \ Ն HuHCHDHx uH' C( H0HV6 1 Lw Z1[]A\A]H= 1 H 8' 1L H}x7 H9( 頺 HH= $ H= s 1[1[Hv7 H9( H;-L' H9]uHE Hh t H Hs' H5[ H8 & 1O HH=4 膍 H= LH} H5q H= H' H5 H8% 1k H' H5ۺ H8z% H 1[, HtH{ 鋻 Hֹ H= ` 1 ݻ ATIUHSH HHu I|$Hu HӅt4HӅu+I|$Ht HӅuI|$(1Ht HH[]A\[]A\ATIUHSHHHuI|$1HtHH[]A\HӅt[]A\1[]A\1ZLL)HL9! L¸ L)IljL$H)M)HIH$KHD$M9S E IA9D$ M9ͼ 1A CA9$ IM9t,IM9s MuH IH | K<LT$ HCH$LD$L|$ H Ht$1H袄 LD$LT$ Hڻ IM9& H H HL$(KD4gM9 BHI)M9MCۺ MӺ 1H M9Ż A4$H u0IAFݺ L;L{镻 鐻 MI闺 Lc1LHL#̓ H H H O HuFH' H@ H' H>q HH0" H52' HQq H1H6` 1[ 1|u IHt/LH LI MtLHM 騼 L E1靼 H+t1߭ 1 H9F HD' H9t H9tH' H H' HH HH 1ҹ HH== ż 1醽 AWAVAUATIUHSHHHw H~'I,$(1ҹ HH=W e u1 H-;' H{: uHE t!HA IHu7賀 HuI'H;-' tHPH ' H5%p H81賁 1j HHtHSHCE1L| HHIHtXLcLL/a Ht7HHHD$: H|$u MM~M9}MH HH[]A\A]A^A_ATUSHHHHHt HiHH~HHHu/HARA LG( 1HD$Pj j_ H HHt9HL't H uf Ht1HLH[]A\骎 H1[]A\Ht$腲 Ht$HHt<H@HtGJHtSHuWHD$ HD$鬫 S H=a2 ! H钫 GH醫 G 隫 GH멹 w HQ' HH HH Lr E1ջ 1駼 H' H5 H8 H' H5- H8 Ha' H5m H8 ܼ JH HH 1ø H' H5֬ H8F C H' H5#n H8+ ( Hw' H5m H8 L) Hk H& IHt Hs8C HY xHsH鵽 Ľ L) 鷽 H=m 1= Hf' H5l H8 H' H57 H8o H Hi HH^ H' H5Ы H8@ d w Iz HE@; <Bw I J E4$闿 IH H] LIe ItzE(taH' H5C H8 逾 Hw' HH5 H81s} ` n HHtCE(uMHE@uCI$ HE@uM4$ | H Io{ Hн H' H5 H8 ޝ HHս E(tHN' H5w H8 鴽 HUBuHA$i I H= H ' HH5Gl H81}| j <A~<Ht <It M4$! L9rE4$ I wfE4$ X IH H LI I E(tnHz' H5 H8 IH HL LIz I E( H'' H5P H8 鍼 HE@uM4$F Sz H: IbHG tHu4G I逼 H' HH5j H81.{ H' HH5j H81{ H2' H8 H-k' uH} л 蹑 H} H1H5j z 鱻 I H= fE4$` E4$W 贬 IH HЈ LI% It|E(tLH' H5 H8s @ y H 3 HE@+ ;ftcA$ۻ HE@uM4$Ȼ HE@FM4$鱻 x H Imx H IZA$t HH' LH5i H81y 1 \x H H' H5 H8 19 ? HHL H5{ H= R 1鯼 HHL H5{ H= . 1[H|$Ht L E1. x HCH=n HpH1[]A\驓 1 HH= HT$趈HT$u H1[], H= ѹ t H0 1 1 xHCH= HpY1[]' 1h H' H5۬ H8Z 1 Ht' H5Mh H8= H 1| H+' H5dh H8 E1 HI x,HCH=P HpH81[]A\A]A^A_酒 H} E1_ HH= F~ @ 1s H= 豸 t$ ATIUHSHHHu I|$Hu HӅt4HӅu+I|$ Ht HӅuI|$1Ht HH[]A\[]A\AUH= IATILUHSHӺ AQH t$L!H} HuAXHSL[]H?A\A]H6 Z1[]A\A]SHHuH;Hsxh Hct!)Hֹ H=1 襷 t*u Hu[ 1[u Hu A H' H5f H8A H / H7' H5Ъ H8 H ' H5ժ H8 뽽 G HFH;' t H;' u P q ZAU ATUHSHQL-' H IH Vm u H{ uH4m Hs1HA#m HHm H{1HAm AttEtat]HsHE HHtHs HX IHu H k IH Hl H~ Lv 1Z[]A\A]ú n SHHu HsH;[t Hֹ H= 辵 u1[SHHu HsH;[!Hֹ H=h 艵 u1[HtHu- SHGHH@hHtHP@Ht[H@Ht[HAA t,H5A t 1ɺ H蒩 H;' u*H HCH5v HPH' H81s 1[Hֹ H= Դ SHHu HsH;[逊 Hֹ H= 藴 u1[SHHu HsH;[Hh Hֹ H=S _ u1[SHHu HsH;[l Hֹ H= ' u1[HHL' H<$Ht$Hg HI HSHHu HsH;[鋬 Hֹ H=ŧ ³ u1[HH' H<$Ht$Hg HRI HSHHu HsH;[ Hֹ H=h ] u1[HH' H<$Ht$Hhh HH HHHU' H<$Ht$Hh HH HSHHu HsH;[!Hֹ H=ަ β u1[LҦ HH' H<$Ht$H(h HHH HSHHu HsH;[|c Hֹ H=n S u1[SHHuHsH;H' [!Hֹ H=6 u1[_HH7' H<$Ht$Hj HG HSHHu HsH;[ Hֹ H=ѥ 譱 u1[HH' H<$Ht$H(k H=G HSHHu HsH;[ Hֹ H=t H u1[SHHu HsH;[ Hֹ H=A u1[HH5' H<$Ht$H0l HF HSHHu HsH;[$1 Hֹ H= 諰 u1[H{ Hs SHHuHCH9u,HI' *Hֹ H= ^ 1t H' H [SHHu HsH;[~ Hֹ H= u1[SHHu HsH;[!Hֹ H= u1[H 麂 AVAUATUHSHHL%' M$@ LFHwI9t IP`Hu&HF`H HH9 HH9 uHV`Hu$LHH,$I$v H\$H# H H9 uL$ uA MM$v HLL轄 1 tLHLH,$H\$" H;' Hu]9 E1LHH $I$n Hl$" H;' Hu-HCH9Eu H=' E)Hv' H HH[]A\A]A^H WH蠽 HctYR k Ht1ZH SHHu HsH;[% Hֹ H=! u1[WH蛍 HctY hk Ht1ZI髽 LiI韽 H1[]A\A]9k H鳾 H8 H' H5̡ H8a E1鿿 H HiH HLH[]A\2l H-3' L SH O H H' H [[]A\j HuHx' HH8U Lm E1 Luu ~`HH= []A\A]A^邛 E1{ Uj HuH!' LH8 E1O HH;| Lx E1; H E1 HE1 H1[]HiH HW H HT$HՅ0 HT$ HT$HՅ HT$ HHt H' H HHt H' H HHt H' H H' LH8Ý 1 HI h HuH' LH8蘝 HiH HK8 HK0 1V LML| H} 1 1HC`k ~[H= ]A\错 1# HCHH9 HPHPM S HGH AUIATIUSQLFH5U' I9t\L ' M9tPL uDLL u5H5' L:] u"H5' L'] uH<' H L|W HHy1 LeW Hxw H HcHH9tt H' WLLW txtH' 8xH9}LL- H9H9~LL H9|H Z[]A\A]AUIATUSQb HtKHŻ H} IHuf HELHY L H Z[]A\A]Ã8 H ' G` { N AG` { A` e A P1P AG` z l HZ AG` z A AG` z A A { A n H AG` gz A L G` Nz I V P1u G` z P1 HL$HHT$HHH4 HD$x HT$HtkH AG` y A` A A AG` y A A P1s H AG` [y A AG` Ay H AG` 'y A t G` y A A Vd H A AF` Pt AF` x A~` u An A ] AF` x A~` uAnV P1! A W G` Zx AvI~ H DH D@ ARDAv H=' 1L$ , A[]HH A M AvI~衦 HtKD@ DH VDAv H=' 1L$ ڭ _AXHHt-A A d A U b H A 8 A ) A AF` A A A b HuNA A eb Hu=A A AF` A AF` v A AF` _ 1 G` v e Lc@(LcH,HHcH$HcP HS VPH' H01G a _AXHt C` P1Y k1F P1? Ht$HHT$HHH4 HD$t HT$H H AG` u A` P A > HA AG` u A A AG` }u A A AG` Vu P1 G` ;u H AG` !u A 1҃r G` t ^` Hh C` > HCHP0 Ht$X1ɺ L _ HD$8Hx` u H' H|$8LH H01> I.tVHm u HEHP0HtH+u HCHP0H<$ t H $HH$HHu HAHP01H$W IFLP01H$I.uIFLP0Hx[]A\A]A^A_W IFLP0 H' HHQH Hc' H Ic 1 t ȃuH' HH HH 1A~- g L=' HMHL[LHA ]A\A]A^A_ :{> A~- uY1! A~- u1 L=' DD$ u%H{ DD$\ L=' 녋 HD< L=' cMIA<@> r < 1 HL$T$ uI~ T$HL$| H11b H{ Ht 1HK E H~ 6 HsPE1HHL ' e ] MtI.u IFLP0MtIm u IELP0MtI,$u ID$LP0j Lv' HHt$M Ht$ 1 Hot$ HF t$ H C. H?LLHH[]A\A]A^| IF8IvPILA HH u_HHLLJ I~@HH IF8IvPIHHH A L H+u HCHP01 IF8IvPILA HHX t1b HSHIuL I~@HH? IF8IvPIHHHt(A L H+uHCHP0A L A L OHsPMA HHc K C H' H5 T H8 1鲈 H 1 HPH' H5dM H81:\ 1 H' H5mM H8= F Z1[]A\A]H 1Zÿ 1 1R% HE H Hz E1 Hj H[1]A\ H' H H ' H5L H8 1 H' H5L H8 PH' H5L H8o ZH E1E H H HD$HH踍 L 1 L L H L肞 1w H' INHH5~L H81Z Hb HX HHD$I HD$HTPHHThf PA Lz( 1HD$Pj j H HH Hl$1x Hw' Ht$HH8M H\ Ht$` H 1 H H H H H H Hv Hl Hb HX 1ҹ HH=X К H' HH53 H81kY H1[]A\I<$Ht$肩 s USWH] Hu X Ht#NHHqg HH HtHyH|' H59$ H8Y1[]X H18 HHu1HpHx u Hq HZ[]ù HHHSH5J H' H81X AH8D[]A\A]A^A_H' H5J H8} HHHSH5J H' H81;X Hz' HSH5OJ H81 X J|H^K EHI IFL%|j LxMxO1 LHD$IFJ<R HD$ P1LL$0LD$8w HT$8H|$0Y^H9X tvILD H9P tH<$2 H|$( H$HHP HD$H L E1H<$ H|$ HD$HtH HX kLH 1+ I LX L L UH H|( SHHt$ tL |$ H1E HHtHH[]I } tH' H8z 5U HtH1[]AUATIH5' UHSAQH HLh L Hu1pHH' LHa M uHHtHEI9Eu"LHJ HtH H"T HuAXHL[H1]A\A]h ZH[]A\A]ATUHSH' HuHC' H5 H8 HsHIJ Hu\1T Ht1RHuH9HHtHCHq' H( H;( t#HS HsHЅyHsL\B HhH[]A\ E1 L9 LF HL$M9u L H H# Lv HcH=/u uhH~bHHHHH H|$ H9}pA HĨ MHH[L]HA\A]A^A_/ Ht4DHr*H) L^H)GJT 9 HL$H} L) HVH1A HT$H)ELnH|$L\ 1A MIL D9ttHH9|LE11H\$1L9d$|dN4 G9tdCL3Lt$IrIIH\$0LHD$H- Ht$HHo+ H LH)HL$|E F HD$(Nl5 1AA9D u HH9HD$(H9t>H|9H9|$ }HL$L)H DCL3Lt$IQHL$IGEuHI9tI1L{ v L)AHt I)HLHML". HK H\$0LH, HHLu* HHe L Lq H LH)H H H9 9*tHL)HHk LIp LF y=1: H蓻 E1LT$HHHa 1[H= ]1A\A]A^l H\$H H.' ATIUSPXHt1I|$0HHuH=R f H@L t y H E1aH= = H I|$0 HI|$0aW HtI|$ HHH= H1k HI谺 H診 L[]A\ATUSH tx([H=] ]A\龀 H IHu HV 1RH{Hk@蕍 HHxHLH= 1Yk HLH=O 1Ck HHV L H[]A\H HG1HG 1RH`' H5 HO0H8E 1^[H]A\A]A^v H蹹 H豹 1[H]A\A]A^[H]A\A]A^C HHtLH HHp H@Hx< H' H LM HE1B H5 L- H|$# H<$U H(H[]A\A]A^A_#N H L H=$ ! HHtHHD$<A H|$I迸 MiHt$LH= 1i LI蕸 H荸 L腸 H|${ HLp HLc HV LN 1$ "Ht$H(H=k 1[]A\A]A^A_;i H H1HGHt$HD$H' H0 J HSHH 1V Hu L Ht 7HHSHsuH=' 1[h HK HSH= 1Hs[h 1[H' H5kA H81M HVH;N' HuHu+HGH Hؼ' HRH5EA H81{M H9tH@H' H5 H81VM I H t 12 I MPI K Hu I K Hu IX 1 AWIHLAVAUATUHSHH8Mt MpIH~HIHu8IWA H1L!' HD$ Pj j2 H HHu1 IHE1HD$I H{Ht<r~ IHuK IHtHZ LI ItIt?H{2~ HHuJ IHt*qH?Z HI蔵 Iu IL H@ Hx]o HH+11H{M艓 HT$LHHCo Hu H/ HE HHk H8H[]A\A]A^A_DH= 1f HHt$LH\ H߅xش > H˴ 1 迴 HHz' H|$Ht$Hpj ! H HG(H@(HtHW@HxH;P} HDH Hٽ' H D HT- DHHtfHHHH)HHHfD9" HHH)H(~ H( HP HBH9s!HfD9"uHH)H H HH)HHSHHHHHuH~ HHu,ARA L]' 1HD$Pj jl H HHt*Hs(HHڿ 1 HH=- H[Z H1[HA AVAUATUSLg MtI$THHH HHt@LuPE1L;mH})IvI>I Hu H JDIHIH] [L]A\A]A^IXHPA L' 1HD$Pj j H HH H(1[]A\A]A^A_E1 HG HuI Ix Hݷ' H5$ H8 1/ 1ɉ H' 1 H Hζ' H5 H8g L 1 LL H \' H IyH5X' d MP0MY0W LL H ' H 1 LLY H' H HHH;=' tH' H 0 Ht' H@``pUSHQHGH;' t H;' u H{1Z t'H[H; H Y' HH HH˰ HZ[]ù LH=Jl ; n 1 E HuH I~Ht$ u HL$ u L$ d H& n H[]A\A]A^A_& LUH= LUH4 H' H5} H8~ 1g t E ATIUHSHHH$HwH ,1ҹ HH=x 1 uxI<$H th} L$$yHB' H56= H8 FEuHH= []A\ MyHH[]A\zj L1@% HD$HHu1f}Hp Lpk HHu%bHߋ( u \ H_' H )I9t H|$S yH|$Ht HD$H[]A\HP u H=zW t ATUSHHh] HHtH{HL IHuHl 1 H{PHSXHK`H;W}VHBH9uMHw H=8 = v= H=8 H9 HCHKXIL1*_ HH "H= 9 HIL1_ HHۭ Lӭ H[]A\USAPHG uG l HHyHy 諶 uNH;k|Hȴ' H5* H8 0@{ @ tHsH@@t Hs0HsH@YH[] Z[]ÉHϲ' HH58 H81sC WHX t%HHu$Hñ' H58 H8\ B Ht H5* Ya 1ZHOXHwHHtYLG`HWPMt&HuH ' HuH5' H=y 1] HuH' HuH5' H=y 1] HtHWPHtH=y 1k] Fi 1H\$HH! K 8 HPH' H5ky H81VB Hz' H5 H8[ SHHHT$Ht$j HcD$~D$fH:"H[1 1[]A\A]A^H(HH5y 1HT$ S t!|$ Ht$tH' H8} 1 H*D$YC H*L$XKQ H(H' H8} 1? H8HH5x 1HL$HT$ Ѡ tDHt$1H|$ x/H|$Ht$ ٥ t |$ |tHI' H8} 1 H&' H H8Hg' H5x H8 1 H聪 Hw Hm Hc H[ HQ SH1H5Ox HHT$ t+H|$Ht$ÅtvH' H8e| 1 Hc|$2 H[H1H|$q xH|$Hߕ 1HH1H|$訵 xH|$H1H H1H|$}xH|$H1HH1H|$Q 1x H|$rHH1H|$ xH|$HK1HSH1H5v H HT$ٞ t$H\$|$HDtHq' H8A{ 1H|$HQ xH|$H [ATUSH HF u HPH4' H5v H81> +~ HyH=7 42 HHu Hr uE1 Ld$HHSLMHXL1HPj LD$ ZYt$H<$Ht + H L" HHu H HH 1g HIܧ Hԧ H L[]A\H &+ HB SHHHt蜧 H[ SfHnHHF)$ u HPH' H5u H81= (~ HyH=V7 1 Hu HB u1HS1H($Hp HP(PH[H 1 H L L Hצ LϦ H? t! H' H W H W SHHHt蛦 H[ ; H [1]A\H(H[]A\A]A^A_ù LH=a } 1K ^; HuH I~Ht$ R H HM HPH' H52 H81,< 1= H|$ۮ H|$ HM' H52 H8 H謮 P IHI)L9s5?AHk L)M9MMLH9HLH" H H Hx L L)h D4D84u H D4D84tLk L)HL^ H} H" H HH|$ӭ H|$tH5 Hp 1HDD$ HH|$蕭 H|$tH5t Hp 1HH=' H Hw0G >Y >Q H|$A tH|$G HwH 1l Hw0 Hޫ' H H|$ tH|$G X HwHn 1 LH=u_ ?{ uH 1[]A\A]A^ I~Ht$ HL$ 胬 L$ 8 HuH H|$W tH|$G HwH 1 | W LG(HA@A@t#@tPHOHy1M< @tDHO@HHHHHM x[ HH u'P M 3HH uP M HxHǃHHPMtfy-L9@HtHHH@tHH0HEu$EtQDL9t5HEt@uHP@H|'Hx@H|'H@H|TH|MEt@uCHH8Ht:)HH8Ht/@t@t HP0H9uHPHH9uH9HHt H@0H|% HH8HtH褪 p HH! H5D: H= ] Z1[]H LIH)H(~I(9 Hf H H`H9sH9*uH)HH6 H)HI6 HuHk L f E1FH)Ź0 1LH IHt@ @ t<@t2Ip0HC PՃt[L]A\Ãu 0 H? IpHIpHƃtfH@ E111薍 H|$HD$1 HD$H8 H蓔 HϤ' H5b H8h 1 H' H5Ô H8K 1 AWWAVAUATAUHSHH|' Ht$H@ HC`L{pLshC`H$1HCpf H H|$HDI HHu L] `1LHHD$ LH> H|$4 Ht4De(H4$LLH詐 HaR HH[]A\A]A^A_ H<$HLL[]A\A]A^A_` AWAVAUATUSH T$ fHnH)L$H4 HHd IHuH菞 1 HT IHuHp Lh H=! e IH H=! E1E fHnHfH:"Htr1H|$8 (\$D$ H|$ L|$ Ld$(D$HH' Ld$0Hh# Ll$@HD$pDŽ$ H$ )D$P)\$` IE11H觝 L蟝 L藝 MtL芝 HuL Hx HĘ H[]A\A]A^A_AUIATIHUSHHH&b fHnfH:"Ht])$1HAD$x)D$WLd$ HL$8D$(b HHt)At$LH=' At$DHc HHuH 1 1C. 1Hs0HCHC fp S(fC,HE0HE fn@LHk0H HCPHEHC@HEHC8MtIE Wf~CpHSx1KXWHf8=LkHf~HcHfCt HHsIc$ HI HCh' HO^ HHH[]A\A]SHH ,HĠ' { H8tH5* W ?H5^ I 1H' H|$Ht$1H H HHu1蝛 Ho 1HCHsHSH[Hۢ' H ATIUHSHHHHu I|$PHt HӅtAHӅu8I|$XHt HӅu%I|$`Ht HӅuHHL[]A\y []A\Z[]1HC W 1HtHHWHDHGHtHHuHGH@HDAUHATUSQH ^ H 0V HcHL`1MtnM,$1L9}aI|HuRHL`1MtBM,$1L9}5I|Hu&HuuHPz u H@i1Z[]A\A]H 19~&L HMAL9}HH1HHHFHcHx'L H MAL9}HH 1H HH' H9GuH9FtH̢' H@``hHN' H9uH9tH' H AWAVIHAUE1ATMUHS1H L|$Ht$HL Ht$I< LH)> HtIM9tHHHĈ L[]A\A]A^A_1HHpHVHPVy1ɃtQ w tB1ɀ 6DE1Dʃ?A@tIF AkDσ? tًP LF)ʋPHtA8@xI|?)N DщPÍBwH' H9GuH9Ft H' H HN1H9OuHFH9G9u H' H H&' H HGH@H 鈐ATIUHSHHHHu I|$PHu HӅtHӅuHHL[]A\ []A\60 tHb' H9GuHGH H' H ÀKu H ' H H' H ÀK u H' H He' H HHHHt1ATIUHSHHHuI|$1HtHH[]A\HӅt[]A\H"' G H 밊H?H@t ? HGH@HuH' H TwH 6HtEfD<u<f Ht*fD<u!f HtfD<u f HG HuHv' H HGHW8Hcw$H H9~HO0HLHLH HHHHHt1Ht5HH9t&HHH9H9 ø ATIHUHSHLHp(LAHA" A'= fi A fD$!H1ILcIDύQDk D)߃0I B| @u!@t u Hc҃ D ,хx@uLD$ HHcH)LHLbHpH[]A\HHHHt1HHI1 IL A 1M9|LHUSH fC,YfA Ytf9rf9sIs1II)"f9uHL9uH1HA H1L M9|H[]LAVIHLZ,ATM@USHzz( HrH ?HjL IL L9q f?AHHHu߸ 1H)L$ H9HJ!HMH9})fD4XfE94Yt H)HLYHf PfA9 Qu HH9| HD- HHH)L9 f?A Ht H)H9HMHHL$ H9LHOH8Lb HL9J,&ILH9HOfD4XfE94YtQK$HL9sf?AHHHu HH)HHH9|HH9|1H9|(L)H>HfD4XfE94Yt H)HLYHfD4XfE94Yt HHHH[]A\A^I1 IL A 1M9|LHUSH C,A t9r9sIs1II)!9uHL9uH1HA H1L M9|H[]LAVIHATM USHzHZ,z( HrHjLIL L9O ?H uA 1I)IH9IJ!LMI9}&F4G94t I)JLID4E94u HH9| HH H)L9 ?D Mt H)H9HMHH I9~J HCLb L9N &ILI9LOD4E94tFJ L9sp?H u HH)HL9|LH9|1H9|'L)H7HD4E94t H)HLHD4E94tH HH[]A\A^ÊW uPH;^ H/^ tmHD^ taHB^ uV@H ^ H^ HEÉH] t,H ^ t H^ u@H] H] HEATUHSHLg@HH1L9u'HK(1L9tT x9u H 1[]A\AU1ATIUHSHHH:HrHHT$HL IH$I9HT$IHUJ I4LLmHE(u1HE CHH] ATL)L9ILHHEHCHx A 1р?u HSH)HU H H9HN1T,HH@uH؍KH)H9}A)H?@t,H[]A\A]AWE1AVAUIHATE1ULSHH Lt$Ht$HLHt$K| LL),HtII9t LL$HĈ L[]A\A]A^A_AU1ATIUHSHHH:HrHHHT$L I H4$I9Ht$IHuHKT- LLmL E(u1HE EHH] fAT\L)L9ILHHEHCHx fA D1р?u HSH)HU Hݺ H9HN1T,HH@uH؍KH)H9}fAD)H?@t,H[]A\A]AWE1AVAUIHATE1ULSHH Lt$Ht$HLHt$K<?LLL)hHtII9t LL<HĈ L[]A\A]A^A_HHk L)L9ILHHCAT,HEH A 1р?uHUH)HS HAWAVIHAUE1ATMUHS1H L|$Ht$HL Ht$I< LH)% HtIM9tHHHĈ L[]A\A]A^A_HHuHÔ' H ATIUHSHHHuI|$1HtHH[]A\HӅt[]A\ATIUHSHHHu I|$Hu HӅt!HӅuI|$ 1Ht HH[]A\[]A\HGH ATIUHSH@HHuHHL[]A\X HӅt[]A\AUIATIUHSQH_HxH| HtLAՅt1Z[]A\A]AUIATIUHS1QI|Hu HH u1 HAԅtZ[]A\A]Ê IILY7 y USHH LHk@ISL9uYHUI;S It HUHMHu0HS@1ۈ IHH\@HNJ y {I0IiH W7 H9u8H <ILHHt 1Hk@HHt@H H u HUI;S| Ȉ ID HUI ID(I1HS@[]HHHHt1HGH@ HHHG ÅHSH5 t.H2' H1HH[& H= +H' H1HH[ H=y ATIUHSHH|$E1ɺ HDHt$HzHHD$ u ;"t HH9rA$H[]A\SHH( HSH H)wHC(HC[HN' H 11HHHF1HV Hz' HHX HHX HuH`' 1H@ H@HP 1ATUSHK H@/H¸ H ~ K H9sBLd$LuLHNLuH' H@ H@HX 1H@[]A\F¸ uH2IHH9u1HMuJ HAWAVAUATUSHt>8u1IHHHMu/Ht \IIHBB8\u#HIMu MtHu J H I(wH(v I@ L9sIHHL)HI9r1L-: HHIL MT HI9uE1B,K MˍME GE1IAHF D1ɈL$ D$ u 1D8tAIwA 1E8HcHK\ H9HGHH9HFIJI9KD LGM9tIMM9 IL9V[]A\A]A^A_HV1H9} H9|tH1ø H HHH9rH9r$Ƅ$ H S HHHu1H H $YH[PHGH PHOLGHw HW(HG0HHx5LLI|MLHH|H@u M 1HyH6? H' H H HHHt1ÊWуtHR HR HEtHR Hٳ HEH tH HR HEHHHHt1H HHHt1HL$HD$H9uD$ 1HD$H9tD$H1HT$LH H9~E HL$D1 ʈT$D$H' SH( x1C(1[H' SH( x1C01[H6 H 6 H}6 H6 H6 H6 H6 H,6 H%6 H]6 HV6 HN6 HG6 H_6 HX6 ATIU1SHL9}H<H H[]A\ SH>H 1H1[SHH HLJ t H?Ht 1WC@ HC1C0[PH' H@ LHI I 1I A 1I A HK' 1A H _PH' H@ HxH H H' H ZHT' H@ H@PHuH' H 1u8HW:u/HBH@H;' tH;H' tH;O' !ø Ã@ t_WEt tMGHO8HH+G HHHx(H tt 1KD H6' G H HGH@ UHSHQ tCtH{H HcZ1[]SHH tCt H>' H H' H [HGHOHHHHu1Ht'HHHHDH1HuHHtHHGHwHt RH 1Y1SHH HCH[H@ H;52' t HtH1HG Hw Ht RH 1Y1USHPHoHL H@ ZH[]h SHHHt 1HKP H{Ht 1HS< 1WHC 1C([HGHt1RHOH 1^1HGHt1RHOH~ 1^1PH' H@ HxH ; H?' H ZÃ=K' u H' H P( H' H ZHGHt1RHOH~ 1^1HG(Ht1RHO(He~ 1^1HG(Ht1RHO(HF~ 1^1SHHHt 1HK'~ H{Ht 1HS~ H{ Ht 1HC } 1[1SHOHHt 1HS} H Ht1H } 1[HGHt1RHOH} 1^1HGHt1RHOH} 1^1HGHt1RHOHj} 1^1SH HHt 1HSF} H{Ht 1HC2} H[ SH HHt 1HC } Hͅ' H@ HPHc8 OH8 H¸ [H[r SHy HHt 1HS| H{Ht 1HC| Hb' H@ HPHc OH H@ [H[ SH HHt 1HCJ| H[ SH s* HCH[H@ HDG$1A9~-HO8H H HHO@HtH HxH HHHHcAFu19~H H HHcHxH H HAUAATU1SHQIϼ D9}LIP< XH[]A\A]髼 Ht PH 1Z1PH H' H ZPH 1ZP蜡 1ZHGHPP1HtHBHH;8' !@@_ H' Hcx_ Hc=h' s_ 1H=' @`_ HGH tHG(H' AWAVAUATULSAQHtEHIHH96HvIIM HHuL)LLI< 'uIl ZH[]A\A]A^A_SJLHtIA HxH[AVHAUMATIULSHH0WHy1AAbH Lt$D$LHA HIT$HD$ HHD$(HP HD$V LLLHLMW D$H0 []A\A]A^fD$fL$(d$fT$f\$fXd$)d$L$D$fL$fT$f\$(L$fD$D$T$fYT$f:fYf)T$L$D$HGHLD$> HIO HO HG@DHGH@HuH"' H HGH@HuH ' H HGHH H@8H H)HHHHHHG1ҀxEuH@HPHH%~' H=V' 11H8 H=' u H=' i H=bl( ] HtHH+ A¸ uH-SHH / 1x H5' S(H [H(. HWHH HHtH1H;= ' 1H;=[' 1H;=~' AUH1= Hj ATfHnH H UfHn1fH:"SHn fHnH fH:"1H-"( HH H$ H) H$ fH:"H H) $$ fHnH 3 fH:"H* )T$$ fHnH q fH:"Ht H$ ( $ fHnfH:"$ 5 L-( ( HLu%( HH=( H7 L$ ( LLu%( LH=B( H He( H nc ( $HfHn(d$( H$ H H \$XfH:"H? d$hH$ $ fHnfH:"H'( \$(HD$PH0HD$ $ d$81 ( Ht$PH=U( 1 ( Ht$ H=S( 1 ( HH={( 1uH-( ( HHu ( HH}0zH| tFH$ ( HHU1u&( HH=f( 9 H4 HEH []A\A]P1_ G` Z<` (( H ( HGHG)( H( H : =: 1H¬: 9t3HHt#H? LBH% L9sDH @ LH0HHTHDPHc|' H@ H5}' HxH`# 9 ' ZPH|' H ZH 1H É ! $ _$ S 3 x W g W>I 0 - = wHu HcHI L &L I $K N N YN N M >M L K +K zN 9N N M ~M L \L K J !N M M ^M %M L L BK I M M NM M L 3L K J I gM .M I L I K !K G 7F -`$ = wH HcH2G aJ @J /J J H I I I I I GH L UL 4H K *H J HJ F ^E -! WB HM HcH$I L K G XK G ~J I |F D G -X wH HcHE 6H G I F G )H (G G NK K F J F I I E D WyG H E .G H DG G - wH HcHD H F }H G F jJ 1J F I F H $H D :C W- wHL HcH3D E YF B G vD Ã1W8@ H+ HcHI UE H KE H iG D B Á p vi- W? Hҵ HcH)I D wH D G F C B Ái wz_ vi-a WB? H} HcHH _D G UD $G sF "C A B ÍB wi- W> H HcH+H C yG C F E B A ÍB wi-g W@> Hô HcHG ]C F SC "F qE B @ Áw e -f wHl HcHkA C aC E 7B vC F F B BF B hE D fA ? WÁo wze vi-g W = H HcHwF &B E B D :D @ P? g@ ÍX@ wi- W< H HcHE A @E A fD C d@ > Áx e vo-f wHD HcH? BE !A D A C 5C ? K> WÍX? - W ; H HcHA @ D D @ !D x@ GC B E? = Á~ wG gB H$: ? : l= : |> Ím> wi- W: HL HcHD ? UC ? {B A y> < ÁY O vi-Q W: H HcHC 8? B .? A LA = b< Ís= wi- W9 H HcH C > [B > A @ = ; Í0< wi- W"9 HA HcHB ?> A 5> A S@ = i; < ! 8 O! , -P! 9 Hް HcH> > GA > -A > A = @ > > V= A dA C= @ 9= @ W? < m: = = = = > w= ; = <; S> i7 | h -j 9 57 H` HcHk= @ i@ 0@ ? ? ? > = < I@ @ ; ? ; > > : ÁI wz? vi-A Wb6 Hٯ HcH? ; ? u; D> = B: 8 9 Íp9 wi- W5 Hx HcHK? : > : = = 9 $8 B< p5 >< \5 9 Á vo- wH HcH8 j> I: = ?: = ]< 9 s7 WÁ vo- 9wHٮ HcHX8 = 9 e= 9 < ; 8 6 W8 ÁO wzE vi-G W#4 H2 HcH= @9 < 69 < T; 8 j6 7 Í0r7 wi- W 3 HѮ HcH = 8 Z< 8 ; : ~7 5 ÁY v ? vo-@ wH HcH6 \< ;8 ; 18 ; O: 6 e5 WÁY wzO vi-Q W2 Hd HcH< 7 ]; 7 : 9 6 4 5 ÍP5 wi- W 2 H HcH; 97 : /7 9 M9 5 c4 -p t5 weH HcHW5 5 %4 ; : 6 I: 6 o9 WÁ2 2 - 2 = H HcHA8 `: ': 9 9 9 8 7 5 @: : 5 9 5 8 7 4 3 '4 Á' w|u' vk-w' wXHA HcHl5 9 b5 9 X5 '8 v7 %4 2 3 Á:0 0 -!0 wH) HcHh3 6 4 9 8 4 Z8 4 7 6 ~3 1 3 , 2/ W0 #/ 2 6 1 / w11 1 . 3 1 . 2 6 1 . u2 6 . 5 4 Q . N v. 4 N \. 3 M; B. w=f2 4 ,. j3 *8 . 4 . 1 0 N - %3 N - 1 1 N - w1*5 N - &7 ]N - J1 2 N w- 5 N c- 1 3 N F- w r2 N 0- 0 m2 pO - 0 - s4 N , /2 O , 0 B3 FQ , v0 EQ , LS @S vG-AS wH] HcH40 4 Z3 2 1 5 kQ =, 5 mQ ), O0 iQ , / z3 _ + p5 ^ + n. X + wBS w (3 S + \/ 3 V + ?/ . X l+ z^ `+ / E2 ^ C+ - _ /+ U/ _ + . H0 o * wd*0 b * w / _ * . 4 Lc * / g * W. 4 s * / ~v p* &. Á5 > / vJ-1 <0 =* H< HcH1 / 1 . 2 x ) . 0 ) wQ 0 , ) {- + ) - ) ) G- / ! t) *- `) >2 F L) . L 8) , Á) vi-! W ) H HcHx2 '. 1 . 0 ;0 , Q+ W ( Y, ÍYJ, wi- + q( H HcHW1 - )1 - O0 / M, Á ϩ vo-Щ )wHZ HcH+ 41 - 0 - / '/ + =* W-Ш K+ 9weH HcH.+ 0 , ;0 , a/ . _+ ) WÁ vi- W& H HcHk0 , / , . .. * D) ÍUU* wi-Q W& H HcH/ + =/ + c. - a* ( ) & vi- W% H. HcHi/ + . + - ,- ) B( W % wE* s ~% ) x j% , k V% ) +. 9% g* %% . % ( Á vJ- * $ H5 HcH* * * 9, Á - = H% HcH* + >+ -* <* K* ) A+ x* - - M- - , 2, + * * n- -- , , r, + P+ * ) - , , R, , + * 6* }( T, , + 9+ * ) &( m, 4, ( + ( * '* & =% D' K& Á# " - BwH HcH& + v+ -+ * [* ) ) X' + V+ + * * * y) ( & 6+ * & {* & ) ( % $ % Á W vt-X 'wH HcH$ =) d' S' R& ' (& _( % u# l* J w N* A b$ Á wR vA- $# } H\ HcH% % $ $ Í`# wi- W% H HcH) B% ( 8% ( V' $ l" Á wm v\- M" H HcH$ $ $ ' & # # - # wOHx HcH" R# i$ & ?$ F$ ! Áo Q -S H HcHW$ @( ' ' }' D' & "& a% # ' ' # $' {# J& % H" Á~ D _ + -a H HcH$ # f" M' ' & & Q& % /% n$ " & & z& 1& % _% $ $ L" & Z& 9" % /" $ M$ Á W vb-X 'wHR HcHU ! {# ! $ # Í wA- . Hq HcHd! C! J! Á vJ- H+ HcH" u$ ÍWT wS- " { H HcH o# " m Í wi-1 W H HcH$ 6 # , " J" ` Á& w vn- A H= HcH0 '" f! s" ! q % vS- HΤ HcH= ! J! S w1J Q R B T o % Á - W= H HcH" J" " ! /! c" *" ! 3 Á - $wH HcH ! ! d! ! I 6 }! D! # 7 M WÁ wz vi- W HD HcH E k i Í wi-7 W H HcHr ! 5 K ÁY O vi-Q W H HcH B h f ÁY O vi-Q W H0 HcHw & : P Ía wi- W Hء HcH I o m Í0 wi- W H HcH~ - # A W Á wz vi- W H) HcH R x v Í w{-1 W HȠ HcH v = 0 F Ál L O -Q W} H` HcH 8 f S a @ 6 T j Í{ wi-Q W H HcH c ÁY wzO vi-Q W- H HcH J @ ^ t Í`| wi- W HC HcH d Á= p v-q = wjH HcH5 [ : 0 N d { Áak q Ok -Pk H HcH % | K I W Án$ # -$ m H HcH4 k 7 [ Áij wz_j vi-aj W H HcH : 0 N d { Í@l wi-j W H HcH T z x Á k - W HQ HcH + r 9 , B ÍS -n W{ H HcHA Q _ > 4 R h Á = vf- 0wXH HcH f WÍ, -a H̠ HcH 6 O Á vi- WZ H] HcH w m < : Í wi-A W H HcHL % Á wv ve- _ H HcH | r A ? Í wi-Q W HN HcHQ * 0 v 3 v*- WK Hڞ HcH Í wi- W H HcH| + ! ? U w1 d w - ! Z * F c ) w ) w\ w ? # _ mb x ; d ! a ) ( ' & % $ # " ! _ ^ M D ; 2 ) ( _ U 9 ~ e l c J @ 6 % | W i V E WWr y @ 7 ^ % C G z q h V É PHƍ F@t H} 1Ht H0HH5' x G| Gd HH;="8' t*H;=5' t!H56' # H_ H HEHJ HW5' H@ HPH H= tHHH H Hs Ҩ ʨ HHQH5' H@ 8 H HuH5' H ZHGH Ht7H Ht/S1HPHHu 1 H HP[1ATH@5' IUHSHHWxH H9tHuHJHt HHAHE H:H;K I$HU HtHHHtHHtH []A\HGxH 4' HH9tHu H@HuHHH3' H@ HGxH8HtHH0Ht+ H3' HH@ H3' HHHH@ H ATIHUHSHHtH* MtL* Ht [H]A\* []A\HHWHHDPPHH1ZAUIATI UHSWH=D: D: Ht1AE HLHH 1yH=C: HC: Z[]A\A]AVIAUIATE1USHL;cs-HCJ,HtHUHuLHAօu Hm I1[]A\A]A^Éq HH5 HUHSQ Ht!HH5 HHwt H 1HZ[]ATHIUHSHt HLH 1y H []A\E111ٙ H H1 HH1H HHrH1H H HBHH1H HЉr1|$1|$AVIIɾ AU1ATIUH͉SH# H L$ IL LLﾀ H 1 HcLLH輒H []A\A]A^AVAUA ATUH- SHHĀH0' H@ L`IDH꾀 L1J H/' LHC HH(IHH IHHIuH[]A\A]A^HW0' 0 H5k H@ H@( H.0' ( H5T H@ H@ H0' H5= H@ H@ SH|HHH[UH6 HSfHnH HfH:"+' )$Xd S K ($ t@HSHt HS0HSHHPHSHPHE 1HH]EH[]H AWIAVAUATUSHQHo Lg(HiI)HHHE,A tHN4 HIv HHu!H{ HtOg WC@ C ,J< LqA t fs fBD5Hk L1Hk(Z[]A\A]A^A_1SH )0' H;@t H3 hH;}H /' H [P& ZHc H>.' @ H3.' HcX H|XHX 1ɉSHPac¸ uHHW-' t; Ht1H5 H(p¸ tH5C Hp[ËG@1G@H H-' H@(H-' H@0HHr-' HH gH HuHL)' H;5D)' u1H HIHHH|$IHT$Ig HD$LL$HIIP LD HD$HSH HH[H)HG(HW`Gx H` oH P=?O: u1 c1WkSH HtH1҉[P7 H8-' H ZH(' x tnUH SQH==: 5 H=<: tH=<: HHuH=<: ( 1 H H=<: H HtHCZ[]1AUIATUH SQL%+' I$@ I|$ HX H[HtML9 tH[L HtHE H I|$ MtL" H{ I|$ n 1Z[]A\A]AUAATI UHSHQHp" Hc A; t HE1HL H H{p H ZD[]A\A]ATL%*' UHSI$@ HHu HtHxI|$0HH[]A\HH&' SH U+' x t+H=H;: f H/;: H=0;: H;: l HHHH[H1H|$ gu|$ ylk Hl1\_PV_ZmUSQH&' H *' x t%H5 )' H-]:: H 1H HHHHZ[]H)' H@ H@H@ >V 7 Ht1ɉZHtSHn H[ UHSHQfmH E H t<@t 9uHHۋZ[])1 HAUAH9ATIUHFSAPHj1HLHDxp} uHxHHHHZ[]A\A]H(HA D$ Ht$ IH1HI0HHH wLH)bH(ù H(HH9D$ Ht$ HOH *' IL HHA LH)HuH9|H H(HF AWAVAUATUSHH8F LfуL$uLn(M Lf@13 t @t H0E1"HHE1I 4H^HHS E1I E1 A A 1Ҩ@u, A A HD$/E1HD$O ^wHL9| |$ t9|$LH[q P^w)Ht$ D$/IM9| CD ω HL$= w!H5M Ht$ W= w!H5( Ht$ /됉H5 |Ht$ lLHމYEt!H8 [H5Z ]A\A]A^A_3H8[]A\A]A^A_AWAVAUATUSAPHB"' x uA H5 1IH 4 H5ܪ E1L- L=L AD$D9~UIc LHk ALHu H5 {u Lb렺 LY[]A\A]A^A_FX[]A\A]A^A_AWH1H5h AVAUATUHSQH &' H;lHuH3 Z[]A\A]A^A_H_UH;H5 1SlDe1TIHI HuH;LH5 1#lH; 1 H5% l1|uHHu 1H t H= Pk H1E1H5 A kBL-DH;1D)H5 AkAtH H= jH3 I=^IuH H= jH;Nl% 1LH5% k1A| uHHu 1H t H=! gjk H1E1H5 jCL5 H;1DH5+ AjAtH H= jH3 I`]IuM H IH= L5 iDH;)M9sA$L1I*jM9rH3 \LLL)H~ H H= MekiL5 H;M9sA$L1IiH3 \H;kH;UHX[]A\A]A^A_AWAVAUATUHSHt H5 HH5 P ) HE8Ad L%~ L=Y H5 HhH Lu H5 IFpH H@ LiIvpX LOH請 H5 ߉D$ 0L$ HcwH5 IvxH HF tu H5~ Hm0HtcA H5 H[]A\A]A^A_ L= L}^ LiH[]A\A]A^A_ú ,AWAVAUATIUSHQHu HHuMuD$HHg . Mu$Lc H# ' LH H M L舁H5 Md$H E1L=9 L5 M I9u L L|I$ H5 UI9u!ID$P t H5 /L1҉AMd$Mt9El H5| AcO H5- 1Z[]A\A]A^A_Ëu4: uCUSQ`4: H t 1QHt HƉ6124: Z[]AUATUSHcRIHi ,`H M4: ; D(tCs{H|{ t/Hs 1D\Dm D^Dm s1DăDm X[]A\A]1UISR1҉ljKYt9 RX[]H ' H@ H@ ǀ PH ' H ZH ' 1H@ H@ PHU ' H ZH ' H@ H@ VHctYK Ʃ Ht1ZSH_ HHt 1HC H[} SH^ HCH[H@ SH^ HHtA H[| SH_ t 1H{ [SHF tHC[QHu H= $ H u10.: t".: ZAWAVAUATIHUSHHH' L(eHH- ' t Hu H][H} Ad 1A fe1I4.H<$臹 H<$HHu 6 LNo \ 1< D4$L4(H ' H Ht]LH1HL$a4$LLTHuZHL$LD$`t La |$Lu!n + D$G\ T$viu`kLUHŀ|+ t]Ht9LuM9r6HV Lnn H' H5 H8G [ Ad HH A HuHC HHuH L n 趻 [ HH[]A\A]A^A_AWAVAUATUSAPH' L@ L-' M9u uH9' H5. H8"G QL=Q ' HHII? u HIH=8Q> u. H*Q> Hu H' H5 H8F 1 Mu Z H=P> I HCMOuHLHOH"H MOtHLHAHLl H=P> 1IM HqH(TL`LLN HHt HHLR Hz ZH[]A\A]A^A_AWAVAUATUSHH=nB: DD$ t|$ uSN|$ OHB: IH5 HMt(LSLHc H5 HtHUSHHc H5{ o H5Jv \ H5g IL%n' Il$Ht:ߺ H5X %Hߺ H5I A|$ t H53 jA|$ t H5 MA|$ t H5 0A|$ t H5 H5% w H5Ru dM$@ ; HMtMnH L9ty E1Hm Lhd HUhH@`WE`HT$(HUpHD$ HT$01HUpH I$ H H$H L5' L9 HL$0HT$(HHt$ R H|$0 uILt$0HL$(L|$0HLHL$ H|$ H HL$LH|$HHL$H|$ HL$HtH MtL H$I$ Ht$81H HD$8C HHu H@ Y M9ueߺ H5s HLLm ՝ Cߺ H5s HLQLm 褝 Lm 萝 ~ gH?' SHH8HAH1҉Ǿ #UHSHPH' H8HAHHډǾ PH5 H=! SIHH1 H H|$ L$HT$HHD$ H H[PH5ӛ H= iH' H@ H` HJHq`U SU H]Hg HP' H [PH5{c H' H@ C ATU1SH%V HWHH9B0uV HHHV u9E1J|Htk II uHCH@ Ht [H]A\V []A\ATE1USHoHU HWHH9B0uV HHIV u;H~HH| Ht HsHCH@ Mt [L]A\)V []A\H' H@ HuPH5Yb H=r& 騿 PH5 H=6 PH5 H=< AUIATIUSHQLO u*1߃Av&FЃ v _1@! 9uH1LR L9tH3Z[]A\A]ATUSH0HL%;: Hl$HtT? HtL1 L訯 1HH;: 1HHH;: Hu5H5De H=` 1 L\ 1H1H~;: Y H0[]A\AUIATUHSH HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ =:: tFHY' :: L LD H5T lj[Ht(HLHHcA H5 .H$ HT$LLHD$HD$ D$ D$ 0 HD$JL >KL6ZA111PH1H5 PH5n H=L: PH5l H= g ATUHSH H J' HH;tH5I 1W H5O 1WHU H;1H5N WH;YLeH;1H5H LWHed MtIT$H;H5; 1hWH H=6 VH;'Y HT$Ht$H|$A H31HE H;XHt$HT$H|$ D H3 IH;H []A\XAV1MAUIH5 ATIHDUHSH ' H;VMtH;LH5 1VH;jXMtH;LH5z 1qVH H=s UH;.XMtH;LH5 15VH3 IH; XHt H;HH5w 1 VH;WCHEI @tLeH;AL9HH3 HH;WH5 H=u7 QHGI u"L A H E 1H O ω@`<`uAt%L A 1LH D Hs QL A N t}WIBHvL _ A L I A @ x%L / A H JD H 1LL A I9B8i L IBH[ Iz t%L A 1LH C H Izt%L A 1LH C H T@t%L A H C H 1L*y%L \ A 1LH rC H t%L 2 A 1LH HC H Iz( u%L A 1LH C H Ht%L A 1LH B Hy Iz8 L A 1LH B H] QWv*t%L z A! H B HV 1L L U A% Hu%L ; A& 1LH QB H IR8@tYH9t%L A( 1LH B H IRI9R0tOL A) 1LH A H ~H9u%L A, H A H 1LTIR(uYH9t%L | A8 1LH A Ht !IBI9B@tOL M A9 1LH cA H H9u%L # A; 1LH 9A H/ Iz8 u,Iz0 t%L A? 1LH A H Iz( u,Iz@ t%L AA 1LH @ H b tIrH@t Ir0IrHMJE11I9~ A9DBH @u]Aw%L = AT 1LH S@ H A L AU 1LH !@ Hn A L AX 1LH ? HN u`A w%L A[ 1LH ? H) NA L w A\ 1LH ? H A w%L I A_ 1LH _? H A v%L A` 1LH 1? H L5 t%L Ab 1LH ? Hq ZSHGI u"L J A H `> 1H UH A MJ(OHHH HIMZIMxI9~%L dJ A 1LH > Hk HGHxL9~%L 1J A 1LH = Hh HWL9Hy%L I A 1LH = Hm HL9~%L I A 1LH o= Hx f_ Muau%L I A 1LH == Hv 4H?tsHD ' H9tgL hI A 1LH = Hg t%L >I A 1LH < Hu I ~L I A 1H9~:$ H|I9}%L H A 1LH < H wHO HH L9t HJ(Ht}Hr Hu%L H A 1LH < Hf Hz0 uL SH A! aH T' H9Yu+H;qt%L 1H A% 1LH ; H- HHeM Hz( u3L G A5 H ; HT 1LHJ HuMusHHL9u H ' H9Yt%L G A1 1LH =; H 4HyoL oG A3 1LH ; H` Hz( tL CG A: 1LH : H M I L1Ҿ %L G A@ H : H 1LLH)I9~iHH@t%L F AE 1LH b: H YH I< uL F AG 1LH -: H $ [H ' HH@ Hp$H' HH@ Hp1p$U1H5p SHQHd' H@ 1H; x)HtHH H Ht HuHGP01Z[]U1H53 SHQH' H@ 1H x)HtHH H Ht HuHGP01Z[]Ha& IHIHH5S H81t( H HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H?' H$ HL$E1H@ HT$HT$ HT$HHHD$ D$ 0 S H S1HH=Ns7 K Ht9H HHXHqHQ KH@ HP0HH(HP8H HP[QsK HtH@ZH=-6 8 H HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ LD$HA 1H$ 1D$ HD$HD$ D$ 0 HD$ H H HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ LD$HE1HD$HHD$ H1D$ D$ 0 HD$ H P7sZH鵽 H= 驽 1rQ H= 閽 H= 銽 H=Y ~ HG(HxHtl H ' H HG(Hx HtO H ' H QLOIH55& L] L; ' L; & t uHb& H5 H8+, I@H# ' H8 HH9ZSHHyH& H5 H8+ 1H& WCH [SHHeyH& H5B H8+ 1H& C H [QH H& H5 H8q+ I tH& H5 H8S+ 1 H8& H ZQH H& H5 H8&+ I tHo& H5c H8+ 1 Hm& H ZQH 1u H& H ZHG0HthHW HO(H9J8t!1PH& H5d" HW0H8* 1YHWHwHHLHHG0HWHyH~HHG? HGH1HHH u7SH HCHHuHE& H5 H8.* 1HC81[1SHx H{H , HC8H{H? 1[H(D$HBHD$HG uHZ& H5CB H8) 1HWHLD$HwE1 H(PH& H5s H8{) 1ZUSQHH? HH h& tHH H߉ Z[]H~ u Ht"Hz tPHF& H57 H8) 1ZH& H H~ u Ht"Hz tPH & H5 H8( 1ZH& H H~ u Ht"Hz tPH& H5 H8( 1ZH& H ËG(uHWBu ǃ PH& H5 H8\( 1ZËG(uHWBu ǃ m PH& H5 H8&( 1ZPHB& H5{ H8 ( 1ZPH'& H5 H8' 1ZHGH;& t t @t ? 1H;Z& u0HO1H9}!HTLBA t @t H1PH& H5a H8q' ZQHuH& H5 H8P' ,H;5O& t-HF @uHY& H5R H8"' "H1HG8G@Hw8HtH 1ZQHuH& H5M H8& ,H;5& t-HF @uH& H5? H8& H1HG0Hw0HtH 1ZSH_HuH& H5 H8j& HH[SH5 H" 1tHC[SH5: H" 1tHC([SH5\ Hd" 1tHC [UHH5{ SHQA" tHk1Z[]UHH5 SHQ" tHk(1Z[]UHH5 SHQ! tHk 1Z[]USQHuH& H5 H8p% HH5̇ H! uHk1Z[]HH IH>H?AH9|A_pHHH9 Hi ʚ;E1Hiv H|$HD$A HD$I1D yH& H5) H8$ HHGLG H5[ IHOH=M MHPH8 HD1< HG H5 HH= HPH@[ HE1 Hw1H= OXHW1Hw H= HOHH9 H && HAH= HP1鸟 HW HGHt"HRH5rK HtHpH= 1鉟 H5TK HtHpH= 1k HO HW1HwH= Q Hw1H=, ? SHHR HSH= [H1 Hw1H= Hw1H= USHARO(Hou H` HE HH=F HPpL@x1AY[]點 wH1H=T 駞 Hw(H1H=g 钞 Hw(H1H= } SHH HSHHzuHRH=\ 1[O H= 1[@ HHHpHtHV HDH@He HH1 H5 H5 H5 H5 HOHHuH= 1ɝ HAH= HP1鳝 HWIH5 HuH5Q HdI HH= 1遝 H HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ HHD$ HD$HD$ LD$HD$H& D$ 0 H0/ H H LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ LD$ D$ HD$H HD$ D$ 0 HD$螅 H SH'fH\$1H|$H?vH$ HHw 1H @HeH)H9sH)HHR& HL$H5^ H81 H1[ATUHSHxOL%q& I|$ : I\$(Ht Hp Hy I|$ 9 H9u I|$ ( ,H| HuH& HH56 H81茀 1H[]A\ATUSH? Hu H H{UHt{L%& I$@ H;Bu HC 1Hu/H{HtR[]A\ HpI$8 詞 HHC HtH;H{Ht Ht[HI$8 ]A\q []A\U HHSH5P HӺ HH& ILD$H$1b 1tH$Ht$HH[]H F& H9Ot!PH& HH5. H81\ Z1USAPH& H9FtH& H5% H8M $~( Hu HC& HH5) H81 KHH9 tH& H50 H8 HFH H{ 11H HK1s(Z[]H$& HH@ IUHH1SHQJ 1tHH& H Z[]UHH1SHAP t HHctY[] } HtZ1[]QHGH;& t!HPHa& H52o H81~ Hj 1ZSH_HHuHH HtH1HuH[AVIAUATL% : UHSHL? HtBH;LHSHHthHtcH= : 1HW H= : ʛ :H5& L T_ HHLAsX DH_ 1LΛ H[]A\A]A^PHGH5/ HPHC& H81| 1ZSH H{Ht 1HC 1[USQ4 Ht*HH@H uQH@PHHHHu E 14< HHa u H& H5 H8 H HZ[]S LT HhH5 T !!HGH5߀ HPHd& H81| UHSVH}& 1H0 Ht*1Hp HHHHHH`G y H{ 1HZ[]SHWHBPHt H@Hu H& HRH5 H81{ HHu1EH@HPPHtHRHt H;B& u&HPH& H5f H81D{ H H[HkAUATIUHSHQHGL-z& L9t H;f& u&H{ˍ uE1 H[H; H & HEL9t H;.& u H}蓍 tHmH} H-& Mu HHE XID$L9t H;& u3I|$R tMd$HHI<$ HHE L%& H HHE HHE I$LHHj HI H MtL ZL[]A\A]AUATIUHSHQHGL-[& L9t H;G& u&H{謌 uE1 H[H; H & HEL9t H;& u H}t tHmH} H-& Mu HHE XID$L9t H;& u3I|$3 tMd$HHI<$ HHE L%g& H HHE HHE I$LHH HI H MtL ZL[]A\A]t H& H= H5&~ H81x H=& H8HtH1HH5 x H5` 1x H& HWH5} H81x H& HWH5~ H81cx ATL%& UHSHGHL9t H;& u$H} uE1gHmH} H-D& HCL9t H;l& u H{ъ tH[H; H & HE HHH HI Hw L[]A\ATL% & UHSHGHL9t H;& u$H}c uE1gHmH} H-& HCL9t H;& u H{- tH[H; H p& HE HHHV! HI H L[]A\ATL%z& UHSHGHL9t H;Z& u$H}迉 uE1gHmH} H-& HCL9t H;$& u H{艉 tH[H; H & HE HHH7 HI7 H/ L[]A\ATL%& UHSHGHL9t H;& u$H} uE1gHmH} H-X& HCL9t H;& u H{ tH[H; H (& HE HHH HI H L[]A\HwH( ATL%%& UHSHGHL9t H;& u$H}j uE1gHmH} H-& HCL9t H;& u H{4 tH[H; H w& HE HHH-9 HI H L[]A\ATL%& UHSHGHL9t H;a& u$H}Ƈ uE1gHmH} H-& HCL9t H;+& u H{萇 tH[H; H & HE HHHHI> H6 L[]A\ATL%& UHSHGHL9t H;& u$H}" uE1gHmH} H-_& HCL9t H;& u H{ tH[H; H /& HE HHHE HI H L[]A\ATL%9& UHSHGHL9t H;& u$H}~ uE1gHmH} H-& HCL9t H;& u H{H tH[H; H & HE HHHQ( HI H L[]A\ATL%& UHSHGHL9t H;u& u$H}څ uE1gHmH} H-& HCL9t H;?& u H{褅 tH[H; H & HE HHH]V HIR HJ L[]A\ATL%& UHSHGHL9t H;& u$H}6 uE1gHmH} H-s& HCL9t H;& u H{ tH[H; H C& HE HHH HI H L[]A\RIIHH5 & e tM@Iye tMILLX ATL%& UHSHGHL9t H;& u$H}V uE1gHmH} H-& HCL9t H;& u H{ tH[H; H c& HE HHH) HI H L[]A\ATL%m& UHSHGHL9t H;M& u$H}貃 uE1gHmH} H-& HCL9t H;& u H{| tH[H; H & HE HHHe HI* H" L[]A\ATL%& UHSHGHL9t H;& u$H} uE1gHmH} H-K& HCL9t H;s& u H{ tH[H; H & HE HHH HI H~ L[]A\ATL%%& UHSHGHL9t H;& u$H}j uE1gHmH} H-& HCL9t H;& u H{4 tH[H; H w& HE HHH HI H L[]A\ATL%& UHSHGHL9t H;a& u$H}Ɓ uE1gHmH} H-& HCL9t H;+& u H{萁 tH[H; H & HE HHHHI> H6 L[]A\ATL%& UHSHGHL9t H;& u$H}" uE1gHmH} H-_& HCL9t H;& u H{ tH[H; H /& HE HHH HI H L[]A\ATL%9& UHSHGHL9t H;& u$H}~ uE1gHmH} H-& HCL9t H;& u H{H tH[H; H & HE HHH HI H L[]A\ATL%& UHSHGHL9t H;u& u$H} uE1gHmH} H-& HCL9t H;?& u H{ tH[H; H & HE HHH譲 HIR HJ L[]A\ATL%& UHSHGHL9t H;& u$H}6 uE1gHmH} H-s& HCL9t H;& u H{ tH[H; H C& HE HHH HI H L[]A\ATL%M& UHSHGHL9t H;-& u$H}~ uE1gHmH} H-& HCL9t H;& u H{\~ tH[H; H & HE HHHd HI H L[]A\ATL%& UHSHGHL9t H;& u$H}} uE1gHmH} H-+& HCL9t H;S& u H{} tH[H; H & HE HHHa, HIf H^ L[]A\ATL%& UHSHGHL9t H;& u$H}J} uE1gHmH} H-& HCL9t H;& u H{} tH[H; H W& HE HHHm\ HI H L[]A\ATL%a& UHSHGHL9t H;A& u$H}| uE1gHmH} H-& HCL9t H; & u H{p| tH[H; H & HE HHHi HI H L[]A\ATUSLg HI|$p) I|$xH HIE H9 []A\ATUSLg HI|$p I|$xH HIE H9 []A\AWAVAUIATUSHHHo H;.t5H H.HqHA MHCHC HKHC(Hd HCLc<T$ L襮 Mu8LAH I)D艮 AătRLT$ H9 E9t?D9su9H}p HHuH Sx IE Hxx HuH:x H9 H[]A\A]A^A_H& IMHI9uM@L; & u Ix 鵉 QH5& L[ t I@H IAZATIUSHHHt$* HtEHLH HHt/H $Ht$Hu H9HHMHHIH[]A\#JHH[]A\AV1AUATUSH H V& HD$H9u HH HFIHLt$ uLHB& H5 H8 RHt$HT$LHHQ\ H|$At H|$j Ex HT$Ht$LH us1H []A\A]A^HHT$' yQ} H|$Hu1 <f HH H& H5ʒ H8R tH& H5 H84 16H8Hu H(& H !Hl& HT$H8 3' tHD$HQ 1u H& H ZSH 1uH; 3& H& tH [HH& HT$HH] & HD$Hu1HP u H HAVAUATIU1SL9uHtH HHtH Hu c HnLsMu H1 YIu H{HH= E1 t#H߃n *J|L`Ņu IM9|1 HB []A\A]A^H HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ HL$D$ HD$HD$ D$ 0 HD$貽1H Hl& HAHi H@ H& H01A ATIUHSHHuHLHV HGHHxCj u҃[]A\ATL%22 UHSHH ~& HH\$u 11LD$ LH uHLi u1 H|$ HHxHtH& H H[]A\USHQHu t=H[H; H & H轱 u$HCH5h HPH & H81b 1H HHR HZ[]USHRHGH HHHt( XH[] H<& SH8{k tH& H8ck Åuy [SHH H[H2SHHP H F HsHH= HHHtt [HN1| HHQHP tH8t Htl u H=h +HxH;p|%HtD H}& H5g H8 HTHH:HtH 1ZIH5S& HH9t+AQ t 1LYG @ H=m (1Z1LG QIH5& H!U u H= I@@ t1I@ZQIH5& HT u H= I@@ZSHn HHu1Y_ Ht'H & H;i tH;H5 H11HS HCHJ HC1[AWIAVAUIATIUHSLAQH L5A& L9uII L9u5/HG u 8n IHL9u IUHx!1 HG t n HHyLIHU L9uH; HIIHG tm HyLI$L9xL9m nH;Z[]A\A]A^A_SHHm HHu^ H1Hu:HCHu%HCHt HH|HPHH9HOHSH & H [SHH6m HHtH{ t 1HHHHS] H1Ht H& H [SHGH t H yH& H5 H8 & Hu&;] Ht1)H& H5d H8l H9rމ [HH u#\ H1Hv ? @r@w й- % = tNd = @ tBl = t6b = ` t*c = t p = t= s ? Eȉ% % 滃r綃wЃ@ ssൃx@@ ȉD$Ѓ 滃rɃᶃw ssൃxD$ Ѓ@t$ЈL$ 滃rɃᶃw stൃx@t$ H|$ L$ D$ ,j HQH> t H& H I[ Ht1ZWH t 1Y @镪 [ Ht1ZWH t 1Y ` @` Z Ht1ZWH t 1Y @+ Z Ht1ZSHGH t H yH&& H5% H8 "舩 HHt H PZ Ht1[SH^; H6Z [HH\& H9GtP H=a A1ZHG0H4& H9GtP H=a 1ZHGH & H9GtP H=a 1ZHGhH& H9GtP H=ia 1ZHG8APH& H9Gt H=@a 6H;5& t2HtHF tH H*& H5 H8 !1HG81Hw8 HtH 1ZH<& H9GtP H=` !1ZHG@APH& H9Gt H=` 6H;5& t2HtHF tH H& H5` H8 !1HG@1Hw@ HtHG 1ZH& H9GtP H=` y1ZHGHAPHj& H9Gt H=_ P7H;5j& t3HF tH#HPH& H5$` H81Y !1HGH1HwH HtH 1ZAPH& H9GtC H=o_ 6H;5& t2HtHF tH HY& H5 H8 !1HGp1Hwp HtH 1ZH& H9GtPE H=h( PZH 1HtHx H91~HDH1AWAVAUATUSQH& H@ LxH& H9GuHHx I H9] H=' 7H IIHt L3I9PE1HH4 i HHuNI 1JtHHL)HL9HLHI H|HtI HtLd1Z[]A\A]A^A_USHH7& H9Gtt H=]N HHHu H=>N Hh& HT$Hp / y1SH|$HtHG u k 1HD$Hl$HHf 1H= Hdq HHtH4 HH[]H & H9GtP H=M `1ZHGH& H9GtP" H=xM 81ZHGH+& H9GtPt H=PM 1ZHGH& H9GtP8 H=u 1ZHGHtH 1ATHI UfHnHSH HfH:"U& )$ HHPHIڋ xLe ($1HH]EH[]A\QH& H9FtH& H57Y H8_ "F(Ht HT& H]\ H012 #H HF( HVH H ZHb& HH@ x AWAVAUATUSHHHOLg(LLw8H4$IxhNlH4$ HL$IE L]L L3 u=L9s8HL$tH& H5> H8{ II@uH E11H[]A\A]A^A_ÍW?wLUHcH9 SHQHH(HH59 6 uH59 H6 uMZ1[]Ãÿ HC& ATIUSH@ 1Hh9 ~;H HcHHt$H8 L\K x tH x H& H 1[]A\H& AT1UHSLH HHL K y1>uH}(1HJ xt H](LH}HH]Ht谼 H!& H []A\SHDt%L - A 1HH & H,Z 袵H ] H; %L A 1HH % HZ fHS u%L A 1HH % HZ 4 s%L A 1HH j% H Z H Hu%L c A 1HH 9% H شs/H u%L . A 1HH % HY 裴tkH8 t%L A 1HH $ HG pH& Hp : t%L A 1HH $ H~Y 4 [USHQBt%L A( 1HH J< H H; %L y A) 1HH < HY γH{HCH s H s HZ []UHHSQ茀 HHuog HH HH' HHZ[]QH& H@ H o 1HtHH t 1Hx ZQH& Ha <L HtHPH HDZÍBwH& H9GuH9Ft H & H SHvӺ HG 1x"ut t H& H.& H [ÍB ATH & UHSH9Gu HH9Ft H& H THvHAԺ G u1HCH9E1x#Aut t H,& H& H []A\HD& H AUIATIUHS1QH;]}+Ht LF x u I $ Hϸ 1Z[]A\A]HHT$ HS1H1H H5f H HT$LL$LD$ # tHHt$1HT$HHD$V tu%HD$H HD$Hu HI& H H 1H [H9 USHH HF H9G HT$ Hw 1HƄ$ Hl$Ht$Ht$H|$H]-t u @Ht$HH t$tu H4$H|$ AE xu1HĨ []ø H }6 H9GuQH9FuKBSӃv Ho& H 21x%utt H& H H & H [H/& H H,& H9GuYH9FuSBSӃv H& H :HvH1x%utt H&& H H& H [H& H AVHBAUIATIUHSHHwHM4$~(I\$( H1H= p u=H K& Lt1&1I}HT$Ht$L xtH\$HHH[]A\A]A^UHHSHHDuH}1HT$HHD$ H[]AUATAUHSHAPHGL-& L9t H;ٻ& u H{>^ tWH[H; H & HEL9t H;& u H}^ t'HmH} H-P& YDHH[]A\A]cC Z1[]A\A]APIIH5& HA? t Iy? tIqIxDY C H& H ZH& H9GuH9Ft H& H HvHHHt tB L IcLH8tH& H HH8uHX& H HH8sHH8sHH8rHH8rHm& HR H@ H& H0h ATH_& UH-g& SHHHY& ydH& L%& LH& 辴 xL貴 xH覴 xLH5 H xHH5 H []A\USQ HHtH k HHϲ HHZ[]H= Q H= }Q H=P qQ H=y eQ H=Ɖ YQ H= MQ H= AQ H= 5Q SHLQ HtHxHH5 1H 1[UHSHAP? H8Ht YHH[]Z1[]V H8Ht 1H 1ZVH& H@ HH HPudHwHuH5" H=G H HuH5/Q H=( H;w~H5 H= ܤH& HYS H {& HP HH1A ZAUATUSHAPD%9 EtH& HP H0 2H& IHH5 9 1H@ 1 yAC1HKPHHs@HsP HtH u HAHP0HtHE HkPHLk@ 1F9 ZD[]A\A]H`& SH@ H & H9u11 xHHHH5 y1[H` uPHQ& HJP H0 1Z1H& H@ H` uPH & HP H0 1Z1ATUSnj H & HH{@a HSHHu BHSHH9*uLb HRHuE1H謯 H{@cd L[]A\UHSQHHu%D HuH?& HH5O H81E HZ[]H & AV AUATUHHSL@ 1HMuHI& HHF HE ~Hu H HHHA EtARIF0HCHyH& He LH0 H{ u#H& HR LH0 Hj[D]A\A]A^PZHAUATUHSHXHHuHu&&HGH HuHس& H5N H8 7H HtII LЉÅuH$LI$HD$HE I HX[]A\A]AUATUHSHXHHuHuII1LoG ÅtH$LI$HD$HE KI HX[]A\A]USHQHGH;& t H;& u H{1sV t'H[H; H & HH# HH( HZ[]USHQHGH;& t H;& u H{1V t'H[H; H ]& HHJ HHϬ HZ[]ATUS HH|& H5o H8 otH]& H5n H8 [HHuH& H5& H8 L%"& I4$s Hu fA HuI<$H5L H~HC[]A\UHHSQH& H0s HHu A HuHEH@hHu"H HyH Ht HHxHHZ[]ATIUH SHH賎 u1CHuHpHHt1HAu @ Ht@ HuHӴ& H []A\USHHAPH~u/HvHHHHt YHH[]:@ Ht Z1[]U1Hչ S HHH5S HILD$~ u1EHt$HHHtH$Hu ? Ht? HuH& H H[]SHHu#HHhu3H& H51 H8 -H& HH0q HHtHSh1 L? Ht[SHG HNH9HtH& H5J H8m H~H? HHu? Ht.11 HH9sH?& H5 H8 ҉ [QH\U u> Ht 1BP?vHB& H5I_ H8 HH9 HHH HuH²& H ZWHT t Yʍ E> Ht1ZATUSHHuH;T Ńu-!Hֹ H= u u1H= HuH{T Ãu = HuD sI5L H& H []A\QHGT t$HB& H@ H@ Hڱ& H x= Ht1ZQHT t$H& H@ H@p H& H 7= Ht1ZATIUSHHkp Hu)H{-{ H5H HHt& H81"> Ht$ HHM |$ Hu%Hu< H IH9rR=xNHb H< HtH& H8F u>RӃt5H9r+HI A $ 8H& H5= H8 H& H5> H8 H 1H[]A\ATIUSHHZo Hu)H{ z H5G HHc& H81= Ht$ HH< |$ Hu%Hu; H IH9rR=xNHsa H; HtH߯& H8E u>RӃt5H9r+H8 A $ 8H& H5a~ H8 H& H5b~ H8o H 1H[]A\ATIH5& USLGHL?0 tHCoI@`HtH tH HuG H1& IPH5F H81; 5: Hu+H9& HH5F H81; HxI$ []A\HHt$LtH|$Hj1H AUIATIUHSQH N tBHmH} H-`& HE MuLH LLH" H踤 Z[]A\A]UHSQHtHHuc j HHuHHG H߉m Z[]r =) SHHu+H& H@ H` uH˩& HH0 1 H [AVIAUMATMUHLSHHHf xI $HHLi IE 1[]A\A]A^PHx& H8舲 1ZPH& H8t 1ZSHHHHHt$uH H4$H|$H[H& H8- H1[PH& H8 1Z1@ SHHHT$ tu HD$H H& HH8l 1H[UHHSHH豹u0H}1HT$HHD$ xuH& HH8l 1HD$H H[]USHQO H-h& IH D H5z 1H} HtH} HH6l ZH[]K X[]Ht#HtHu He& H5C H8 K H& H5C H8s ATIUSHHHv+1ҹ H=]z my tH;Aj HHu1HHu #HQF HH覡 Hu 6 HuHL uH& H []A\HAPHWLJIH9rH& H5W H8 gHuY- LW(M2LA?HI9|HHGHr#H ITHH)HG HxH HJ|JL 1ZP HJ& H ZUHSHQH( u'舃 HtZHSH HHCHC(@ HK(HCHQHKHHCHS(HlH9C@sH1i H^ HC81҉Z[]QHz1x H& H ZU1SHHHHx HHkHL$It HCH9C@u H5& H5A H8V 1 Ht$H9|H4$H) qHH9~HuH4$H^VHH uH|$ H4$Hy 2HtHu Ht$H zHѨ& H H[]HAWAVAUATUSHHH$H9s1HQHHIEH HHt4HL9s1HE IkPE1t HE HuDH; ~H Hu HLHIJ46H4Hu HJL6HLM9t<H<$L HHt,MkPHu DHD$L&8 H|$uX 1.H;1 H} I9tHkPHH9 i VH[]A\A]A^A_S Jl Hu[G Hþ HO HH=e! Hu"H HD& H5Wv H8- 1' HLO HdR H H & H [USQHuHI& H5? H8 HHH 4 Hu1 HhHXZ[]USQHuH& H5? H8 HH 3 Hu1 hHXZ[]AVEAUIATIUHSH: x(H. x ELLHH[]A\A]A^p [H]A\A]A^AWIAVIAUATIUHSH( L Av AO 1AAAAAAAD$D9 IFIWI9MyIĿ LHIHy HŸ HHLH)H9k @ t@@MVHt MV0MVH t@MgHt Mg0MgHD9l$tEL$LDLT$DL$HT$lF HT$DL$HLT$Iu1 H A A I<*AF @tYAG @tRH HuHH9 H E1HHLI+_ 1HHIHdIHHLF HGHHHII<*LG H#HHLII<p H1D9l$t L 1H(H[]A\A]A^A_AWAVAUATUSHLgHo I9}{HGHL)N4HxH9HOM,1HSXME} AE MsJ{KQ HD$PF E} L HHHHILcH([]A\A]A^A_n H& H W HH W []A\A]A^A_HHPHp89 USV/ H5H u H& H 'H<& t tHHX HHX Y[] Z[] ATL%& UHSHGHL9t H;ڟ& u$H}?B uE1gHmH} H-|& HCL9t H;& u H{ B tH[H; H L& HE HHH3 HI跘 H诘 L[]A\ATL%V& UHSHGHL9t H;6& u$H}A uE1gHmH} H-ء& HCL9t H; & u H{eA tH[H; H & HE HHHt HI H L[]A\ù 11U UHSHHPk AXHH߉[ ]6 WHC t HH# , HtCH;xtH8 u HHuH=]@ 1Y k H>& H5 p H8 1ZSHHHF u HR H5 0 H=p 蔷 ZHt$H HHtEHuH;D$tHϛ& H5 H8h H1 gH1H[hj H1[UHSHHuHM H; .& u$xHֹ H=io )n u HA t*Ht$HV HH HH;D$t#rHy H5 H=o 蟶 1HMHA u H+ H5 H=n m \Ht$Hޢ HHtGHNH;D$tH& H5m H8A HHߺ ?H1[H]?i H1[]ATIUSHHuI $H; & u$xHֹ H=Fn l u HA t*Ht$H* HH HH;D$t#sHM H5} H=m s 1IL$HA u H H5 H=m @ tHt$H象 HHt_H!H;D$tH{& H5@ H8 8I|$X@ t HHH1[H]A\h ) HtH1[]A\ATUSHHHu,H HA u;HB H5 H=m 脴 2Hֹ H=l k uHHؠ IHu1 HAH;$uAHKH H& H9thHA t<Ht$H葠 HHtHH;D$t9H[& H5 H8 H H5 H=Kl ȳ s1LHfHHtH1[]A\f HHH[]A\19 SHHt$* Ht(HHH;D$tHė& H5 H8] 1HH[SHHu 1H GH;=>& tHG tHH HPH1& H5"5 H81( 1[SHHu 1H >HG t4HH HPHܗ& H54 H81( 1[HGS u|+ H( Ht C @u 1 HuH tHCHC@[ú t D1 AUL,ATIUHSHLQHc 9Er)HEH+E L9| Hu HU @~ @ t)MtLHU un@@HFHt HF0HFHtt/HHLH:HH1H L9s)f f PHH1H L9s HLe 1Z[]A\A]SHH,f Ht HH[;# 1[HG Hu! H APHu H=: 3HHtH@ tHy H= Y( ZHu : SHHWlQ H[Hu9 SHTQ H[UHSHHAPme HtYHHH[]G Z[]WH t Y % Ht1ZSHN6 1H9CuH{ [ HHHt$t*H|$@H @0 ǃt Hg $ Ht1HHHHt$>t5H|$HH H % ǃt H Q$ Ht1HAWAVAUATUSQH;=& u1 Hk& HIHH0a u,H HHu]LH HÎ FHCP1L-1 LpL9}HCPLL| uLLf xHZ[]A\A]A^A_HH=§9 cH=9 HD$HcH=9 HHL$? H=y9 H5ccHT$HD$H=T9 cH=x9 B H|$HUSHQHGH;& t H;& u H{16 t'H[H; H (& HHU HH蚍 HZ[]USHQHGH;2& t H;1& u H{16 t'H[H; H ϖ& HHl HHA HZ[]USHQHGH;ٓ& t H;ؗ& u H{136 t'H[H; H v& HH3f HH HZ[]Gך Hc( H& Hcx WHk8 t Yx ! Ht1ZPZHc[ PZHcL H^1 D$ D$D$ L$D$<Hc|$H P#% H& H@ H@Hc uQ! Hu^ 1Z USV_$u(HH r HH"g H踋 x YHc[] H& H Z[]H\& H@ Hc uQ Hu^P 1ZG S H5 H¹ y H50d H袹 x H5#d H芹 xȺ H5d Hr x H5 d HZ x H5c HB x@ H5c H* d H5c H H H5c H , H5c Hָ 1H5c H轸 H5c H衸 H5c H腸 H5 c Hi H5cc HM H5Wc H1 k H5b H O H5/c H 3 H5c Hݷ H5c H [AVAUATUSHuH & H H;F~HS& H5 H8| 1ۃ:IuxIH . HHtkIc} IHtUI( HH tKL跈 MeMuL% & I$I LHa tL腈 M &M M 1E LȉE d H\ H[]A\A]A^AVAUATUSHuH& H H I;F~HR& H5 H8{ IHh I7 HHu1\ I HuH Q& HIX HH H贇 I^HuH & HI HH_ H Ic~V HH I( HH( HH Ic~ HH I HH xrH Ic~ HHtSIH HH xCH Ic~ HHt$I@ HH xH跆 A $%A $A$HA$虆 H葆 [H]A\A]A^UHSHAPHuHSHsYH[] HH=s# O# uZ1[]H& H@ H@Hcp W0G4HcHH|? UHSQH HtHH|b HH HZ[]AUBATUSHvH Q& H IHHAH5M& tLEL Åt1HEI9E L;& u8Ht$ HG Hu w Htr:|$ uiHxdI9Eu^ @H _I}>IHu1GDHH LH ,Aut H Ō& HAutH .& HHH[]A\A]HUHSWHuH} _0 Ãu+ Hֹ H=:^ \ uu HukH}$0 ǃu x HuQHغ H H,H% H!Ӻ H H@H H H!H Hu / HuY[]"Z1[]H8_ H(H1ɺ HD$HGHD$GD$GH|$D$ " H(HHy HHHH HkHH< HFH H~ WH<XVHHus Ht 1 Y 1ZVH H& H5F H8莸 (I tHׇ& H5 H8p HYd 1ZV H& H5E H8C ( tH& H5w H8% HY 1ZHGH8 H@ tHGxH H0 HHHx(H@H?HHi Hx AWE1AVAUATUSHH(LGLg(HOLo8Ht$HxsOtHt$ HL$LD$IL( LHc xVIL9k8LD$HL$tHW& H5 H8@ +II@uM E1H(L[]A\A]A^A_ H(1[]A\A]A^A_AW1AVAUATIHHUH7[ SH8LÇ& Ml$HD$(ID$HL$Il$(Mt$8HD$ HD$ P1APLL$8ZY HD$(IT$HyHй HHHD$(HD$ HyHй HHHD$ H;T$ }HT$ H\$ H9\$(~H\$(HT$(1HJH9~ M H@HH9~HH@u M 1HHH)H)H9¸ HLH) te1 HH@u M 1LIHt$Ix^I| HH|$Z H|$D$, D$~H|$ H) BM9t$8tH& H5( H8h yH& HH54 H81( YH8[]A\A]A^A_H& H@ H@Hc Hg& 1H@ H@H H H9tH HHuQ Hu^ 1Z H=89 HuQd Hu^ 1Z V* HHtY 7 Ht1ZH?v H t'Hh HtRH YH > 9 HGHP HG@H9G(tHG HHHH HGHW H@ H< HGHP BDBLHH<x HWBDBLHH<Ř HhHt PH߇& H5 V H8蠳 1ZHWHHz(HxH Hz HHHtH H|g HuATUSHGHH@hHtH@Ht[]A\U t<H) IHtL HH葾 LH} H;- & u*H} HCH5z HPH& H81 1H[]A\Hu ATUSHGHH@hHt HPHHt[]A\H@Ht[]A\H tAH{ IHtQ HHH LH| H;-l& u*H| HCH5 HPHT& H81 1H[]A\PH# Z ATIUHSH H9t HsL9uHL# t1[]A\UHHSHQ豿1HH HtH} HH y H$| 1HZ[]AW1AVAUATUHSHHHHX HLl$8HT$LH $HD$8 x Lt$8Mu!Hc& H5 H8, A L% L tH|$8Ht{ H$Ht$0L u1LHD$8b{ H LH xLt$8MtL;5& u1LHD$8*{ 1HD$(@L sH$Ht$(L` y SE1LL|$8z H( LHo Lt$8MuHN& H5' H8 L Ht$$L E1LL\$8fz H LH L|$8MuH& H5 H8蜯 kL yHt$ L A E[E1LLT$8y HH LHw L|$8MtL;=6& uE1LLL$8y D$$D$ <L Ht$ L E1LLD$8fy H@ LH H\$8HtH; & u1H|$8H*y D$ D$;L rHt$H | V1HHt$8x Pt$L$0DL$(DD$,T$4Ht$8H|$@s HL$HZYHHHD[]A\A]A^A_UHSHHAPHCH;& t&H;& t H~& H5A H8ѭ -H; ˁ& t H y 1ɃHM H1H] 1Z[]ATUSLgHMtHHt H HHHlHHHL9} []A\! LHr x=1MLCLIIԹ M 1L9}I<HI<HHHH91H[]A\SHHHu W10HD$ HH+ xH|$ HШ H[SHH9 u HH(HHt H[()1[ATIUHSHHHD$HwH .1ҹ HH=: [N uRI<$Ht$7] t@H{Hl$%9 u.HC H+CHxH9~ 1HHIHHH[]A\(H1[]A\HHpH8i AWAVAUATUSHxHuH& H5M H8薫 &Hm& HH9Ft H5$P Hz& H8n AS IHD$( @0tBt6tHz& H5 H8) Hxz& H5 H81 럃|$(uI|$ u HOz& H5 H81 sHt$8H |$8 u HH9sH z& H5nO H8襪 2IT$AHR JH9~ Hy& H5 H81S H HZL$XD$PLh \$Ll$`LhHK Ll$hHD$HHcHA HHٰHAHLT$HL9l$`r 1A:L6Q D$PtD9tHcT$HAHD ȋT D9}A9DNH9D$Av(Hx& DH5 H81j HR ID$Lx L HD$Hk Lh y H|$s O HcHV H1HtH9D$| HAG0Hl$I% HHL|$ 1E1E1D9L$ NAI HD$fBDP D<xwxfXw%f2 w9f9 f# Jf H= Hc Hf6 f5 fDZ fS f w*fz Bf H HcHf wf t Sfd LLT$,T$,pv!AotfvApD@)@tB HcH H9u D9Һ LLoHIcLCLH9 LLLDHHHIcL LL^DHL LLED)HcHH8u D9Һ LL LHHI9 LHH IcMHIHM9rJ HLLDHL<j IcILZ HM9ryJ oIcIL7 HM9rVJ Lt6HM9r>N #LHHI9r$IIM9~IHM9rJ IcH LLDIcэH IHL!IH AL H LLHHL IHM9r J H IcHRLLDC yI1څOЅtM9r N IIcLI:L|$ IG(L@Hx IL9 Ht$<Ht$@HHt$DHHt$HHHHcD$<HHtHcT$DHH:uL$HuHH?H?7A III9}HtHI9rH HI9rH H <MH|$Hl$An ID$E1D$HD$H5 HH H@8H H)HHL,H軯 xF9t tID9D$ JLLH xhH9}HHHt/σtNAAuAu :tA9u0HHHtAumE1H9D$}DD$HD$zApH5G I_H5 INH5G A H7H5 H&H5 A H5xG H53 H HDHHt$膮 H~ EHt$#|$(uIL9l$ID$}XDu0Hu& H@ X@HJxSH9P@HcHDHHHu뵋H@QP@HcH|HHtl Lcl$HH 1AT$(MJ) HH8HxD[]A\A]A^A_SII1 HPHT$H\$LL$HHD$ t$HLfHnHHD$8fH:"D$(' H3HP[AT11Ҿ USHg R Hu C []A\HHZIHC H9CtHCHPHSD HO uHHL]+ [H]A\ AUAATAUHSHAPHHpHH9} HU HcHD D Dh H5 y1Z[]A\A]AW1@ AVAUATUSHHXDoH1D$ @ HD$ H" H SHD$0E1Hh T$8Hl$@HhH B H,$Hl$HHD$(H$H9D$@rHct$ H|$ HD$ H|$(yG Dt$8E9tȋD$(Ld$ D$ D)Ӂ L|$ ~ 1ɺ LLtp DD)~8 LLtG1LLt*1ۃ|LLjt DT$ E#H|$ j 1HX[]A\A]A^A_PHHHrHH9HL ZAWIAVMAUMATUSHt$ Ld$Pf f..@ z.u, Ht"IGH5 HPHo& H81 'y T$ @1 P HHuE1cH蚬HMt5HLL Hu HW HHHIH? HH HH' I.HtHL[]A\A]A^A_AVAUAATIUSHGHH9HNH6 tH;LH Hc{$H IHt.fnC$W1Lf8=f~HcHAFtL-n& OL-p& HHH{HHt-LHHHKLHLHS0{$LcAL8 1[]A\A]A^AUATUSH HGH Ht7H8 t1HFIH Ht H8 tH\$P H_ t!H*m& H5 H8 Aw HL H' Aąt H Ll$L9l$`}(Hn& H5 H8褜 H H 럾C H襌 tC H蔌 u"F H背 t4F Hr t#H4$H|$PLH H Hc|$$H= IHt'HcT$$1LA HI1H1HL$0) H1 H) 9~ L HMt6HT$0|$$LIrHHIHL$LHLS H H HĨ D[]A\A]G` 鱰 Q P1ݰ USHQ P =p u G` K {` t P1<z Hߋkȉ Hu {` kuv H證 Huk Q Z[]G` 遰 kڰ Qհ Qǰ P1鷰 USHQ P =p u G` {` t P1b Hߋk HuD{` ku# H Hu){` kt Q H Huk V Z[]USHQ P =p u G` {` t P1< Hߋk[ Hu {` ku H@ Huk Q Z[]^USHQ P =p u G` X {` t P1< HߋkՇ Hu {` ku H躇 Huk Q Z[]G` 9 I HUAH 鑯 La C` 錯 M9uZMLHT$J4 J HT$HHu2L C` y @ 10 IKkI̮ C` 1: 1 UHSAPHG HuYH[H]K HHHHy< Ht.H01HHHH9}LCH< MD8LD9HlZ[]AWAVAUATUSQHu1FL.IMtHw ILA1 HHtL9}ItDLU8 HDHZH[]A\A]A^A_UH=".6 SHQx IHt(1HHP HIH1HIXLAh# ZL[]AUIATIUHSHAPHH@Ht| 1u&H9}IT HM Jt HHHTJ#HZ[]A\A]ATIUH SH[ Ht/HuH-Bj& HuH 6j& HE HhI$L` HHX([]A\AWAVE1AUATIUSHHHHHt$L|$(DD$ IM9}_Ht$0H|$8L8 T$Ht$Hg HT$(Ht$0H|$8HD$> HD$HtMtKDH` IMtL_ H@8(t$Hd& H5] H8HH[]A\A]A^A_B @tHHHH[]A\A]A^A_ATIUH S# H H}(HHHxgF uInuHh& H HC Hh& CHEH}( H HC H h& Hh Y tu Hh& H HE H HC(H; IH_ L[]A\SH Ht HCH HtHCHu[ËW\ 鹓 WX@ 鬓 WP 韓 WX@ 钓 W\ 酓 AUATUHSQLgL Ht5HE1N uLHPHc& H5 H81 HE^ 13J|HGH;e& uHJ|IM9|(a HHuZH[]A\A]AUATUSQHG8H9G0r1 HH: U Hc{H Hc{ I Hc{ Iąy H #g& H HHt#Mt+MtHuNL] MuHu!0MtLi] MtL\] HtHO] HTH>] LmLe H](ZH[]A\A]AUATUSQHf& H9Gu HH9FtH b& H AH9u%~t H :d& H d& HmHO HW1Hw HHt(HK HS 1HsԷ IHu H\ 1!DHH HHg\ L_\ ZH[]A\A]USQl HHt%HOHwH¿ 1m HH"\ HHZ[]AUATUSHVHHt(HGH9Ct%Hld& H5U H8U HC1U HC LG H4 AH LO( IP HMt LH)HIHHHI,L$2gAx t2HHHHHjHHHuH HHL".HkHHHjHHHuH HHLbHHK0HC HCH;`& u I$L H;c& u HE HnH[(I$HE H;u5H{Lk LcHk H Z LZ H{ u1H '# HHtL`Hh 1HKZ ZH[]A\A]UHSQ Ht-H*MHH*E^2 XV Hu H9Z 1*H*M HCH*E^2 X$ HtHC HZ[]AWAVAUIATIUSQHtHL0 HH A|$E1I HHu ,HE JlAD$ED9~H# HHu HY 1XIcIHk LHP xHHUO HuHbY Mt$HLL yHAY HZH[]A\A]A^A_AV Dq AULiATIUHS舔 HtWDH託Ht?HCI<$薗Ht-HC I|$LHtHC(ID$x 虹 HuHX HC0H}H H߉X []A\A]A^WHF @tH14HHt1YPHa& H ZUHSQH_H{umHX tfH`HHH蛓 HH HUHBH HCHB H HC HEXH HC(HE`HtHRa& HHS0H HC8HHMHuHHt 1 H 1 HHHW HZ[]H1H AWAVAUATUSHHG u H=| 蜉HHII3 IHuyHL$HLHD HHtHt L|$Mu L^ LAAŃtH{ LH. H1E~ HLHH[]A\A]A^A_= H[]A\A]A^A_SHHu,H HA u=H- H5 H=0 v Hֹ H=0 - u19HsH8_HyH!\& H8 tH H_& H [SHHP+ Ht HH[ [UHSQ t!Hl[& HWH5 H81 hH{^& HHH H\ t إ 6/ Åy+Hz[& H8 t$H_& H5 H8Њ uHҢ Z[]USVHGHuHY& H8d HpHHx HHu11@0H}HM U HZ[]Hw1 驴 HW Hw1HJH+O0H= L / H !/ 1H!/ H5"/ H=$/ HOHW1HwLG H= / UHHSH(" HtzHHH y H Y& H5. H8踉 H@T KHHL$HT$HLD$D H߉T t#HL$HT$H=. 1Ht$H([] H(1[]AWHAVAUATE1UHSQHtA9} H@0AIcE1L-f. 1 HHu >JDHm0E9~2Lu HI LINxIvp1v HuHiS 1ZH[]A\A]A^A_HO(HWHwHtH=W 19 HO1H= ' HW& x u11H=" 1 U SPH=ql9 H ]l9 H-Nl9 H=Wl9 YHHH= [1] USWHx u Ht1wÍ@?vH\W& H5c H8 ޜ1߉0H} HuHtH5- HSHt H[& H YHH=2 [1]. Z[]HZ& H= H@ H@ 1 SH_HuHV& H5I H8H G < HH HcHH=h, [ H= [ H=P, [ H H:, H51, H= 1[ H , H5Է 1[H=z b H , H 1[H5+ H=+ > H Z& HH[H LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ LD$D$ HD$H5ִ HD$ D$ 0 HD$ H 1 UHSQ HtoHc} H< Hc}HC/ Hc}HC " Hc}HC( }HC0y Hc}HC8 H}HC@ HCH& Ht HO 1HZ[]AUIATIUHSAPHFH@ pDpLHc蹕 HHu HO HcUpH@PHu0HH H 1CKHH HEƃ [ HCH oO 1WHsC0MuHCLhxLk IE Mu HCL Lc(HI$ZH[]A\A]HHHH=rS& HH=cS& 11 SHHHH=U& HtAHHW& H@ u1HC@ HHC@Hu HN 1H[APHHHH==X& Ht1f@H HH@@J ZARH(W& IHH@ HWHr8H~ H47Hu#H5S& HJH1H^ H6 1ZHAYHm ATUSHHu0HKH;HA u=HG H5u H=( 2n Hֹ H=( G% u13HpV& 1HH@ HC8Dc,@(1C, HS8Dc,@*[]A\AUATIUHSHQHGL-X& L9t H; T& u&H{e uE1 H[H; H V& HEL9t H;S& u H}- tHmH} H-oV& Mu HHE XID$L9t H;S& u3I|$ tMd$HHI<$ HHE L% V& H HHE HHE I$LHH HIxL HpL MtLcL ZL[]A\A]H H UHH=+6 SQ$ HHt0HE HHCHE0HCHE8HE HC(HEHk HC0̰ HZ[]UHSHQ IHt.HsHPH HXHH 1Aƀ IpZL[]HH5 H=6 HH5H=6 HH5H=#6 yHH5d H=M6 cHHHWH5H=6 @HWH5FH=s6 )SHH=C6 IHt HP@ 1HI L L[SHH Ht 1HLHtHHLHH u[AWAMHAVAUATUH-e6 SHH(L_I9 DɉA oAA EfD!DmHHJ| H AHL $LD$E1DL\$m Ld$L $M9\$usID$HHwdI|$ t\HQ HHuH|$I - ID$ H<Mt$(H HHtI IIJ<N4I LI *HUQ HH IJ<HD$JcI I ] Hi Y HC HxH+ Hu E1Mr s1A!EED9sHL HtHHL HDCAT$J<D9s HO0HtHDJHJL Aֹ A!DpI H6 I9t Dɉ AMIJ<Hn E1AHLD$DLD$t7E HTH|$HIu $H JK<HH MH H H~DHH$ H$HI> J<H Ht 1J4G M7 H<蚨 IH 111A A9t`HDHtVELVLFAD H9hu'HHHHwHH HtH@(HK H 1K HHHKD HHH uA~Y;Wu2T$ HT$D $HD$ItD $DT$ t E Hs HHHH HujDT$ D $蛧 D $DT$ Hu1 H|$ uHS0HHP HS8HHS HHP HS(HDHP( ADPN{HHtHT$1H9}Ht HHt HHsHH9}HL HHLHI H([]A\A]A^A_S H H1H5 HILD$ 1tH$Ht$Hħ H[ UHSHHH0 taH{11LD$HHD$twt:HH4H[]鑥 H|$Hu-E HS HxHHP 1H[]xSHӤ IHtHHHX L[HHrK& H9GuHPH^J& H5 H8'z 1ZV HtHxY1ZAUATUSAPHN& H9GtHJ& H5 H8y &HI& HH9Ft HI& H5 H8y A Df(Et HL& HH5 H81m HH9~t HH& HH5 H81G P H9Ct HH& HH5 H81 Hs C( Hub1Hu HH\LhHLHDI9u LC HJ& HH8O H{HC]C YH[]A\A] ZD[]A\A]QHqH& H9Ft HH& HH5 H81h tt1 HzL& H ZSHHх HuHt HϠ Hu[d HeH& H5 H8.x 1[E AUATUHSAPHum+HGL`pMt=I|$ t5HHI< HHu+HLHAT$H߉VB HH= e" Z[]A\A]ATUHSHu(HGL`pMt9I|$ t1HH6< HHu*H1HAT$H߉A HH=F ! щ[]A\1Q 11H AVAUATAUS6 Ht3HLp8 u+xX t:H5% HVH& H8v HnA 18 ALf t!# ALf H5 t HsH1; HHtGH; HIA Mt/Hk`Ht>HZHx~ HHu L@ 1 H蝌AMIEHS\1LW LH@ HtHCPS\Lm8HEP19~HKhH4HMhH4HALAAu j1HHEx LL y H?@ ^HH/@ H[]A\A]A^HHt H5H& HI& H HHt H5sJ& H_I& H HHt H5KE& H?I& H H54E& Ǿ HFH H~=USH QH;HH Ht%H1H9}HpHHHHR01s Z[]AWHR AVAUAATUSH(H$HH& L@ ~IHu / HHt~ IHcH HHtaE1K<H:$ Hu H> BHSJII9uI~HH5 xl t.H> H5 H= 1H5 H= 1H~> E 1Ht$H|$L|$Ld$HD$e~ tlH\$HuH5a H=I 1HF& LH@ HHt)1H謶 yH > H5 H= ?1H= H([]A\A]A^A_H?E& 1҃8 cAUATIUSQL-yF& I@ I HK HtHH@ u51 HHt5H}HI tk H߅tX= Q= LHv tHtZH[]A\A]? X[]A\A]ATIUHSHt x#HuLHH[]A\YO HQ y[1]A\AWAVAUIATMULSHH8H|$L|$pHu H8MIL[L]A\A]A^A_ H9I IH LM1HLLDE1MD$MMMILIIVIHHI9m ~jHMuQLT$(IMIWPASH|$L\$0LL$(LD$ /ZYHLD$LL$L\$ LT$(uL; E1I$HxHHMH8L[]A\A]A^A_AUATUSHHtHGH u#; H=z 1m_L;et H; LeL HHu;1E1Ll$H$E11HLHN tHD$HSH J"IHH[]A\A]AUATUSHHF u HPH@& H5< H81C %HC& HHT$ILq Lp y1 H|$Hu& HD$HHtHLLk y,>HG u : H@& H5 H8o H\$HH y HO: HE: HC& H H[]A\A]U1W1S1HHT$0HL$ )D$ HD$(HW H>& z ~g?& H5C& I1H=$B& H ] fH:"@& )$i HD$ H H= S9 : H=R9 H=R9 HD$= H|$ H=R9 H-R9 HHt HH5H(t H 1H=R9 H\$ H|$ teH5@& H-=R9 H\$H H|$HH5t 1H +H|$HH51H t Y H|$(Ht 1HD$(8 H|$ Ht$ H|$Ht H|$Ht HD$(HH[]AVAUATUHSHHu0HM HA uAH8 H5 H={ zX 0 Hֹ H=] u Ht$HD HH H2{H;D$tH<& H5Q H8%m H}H觐 D,$ Ld$D$Hc|$xCHu HHt2LHDHDt$z}u&Hx D$A9|=?~ H[Hc|$E13 HHu ,HSAJD;d$}&McB| vHuH6 H%x 1Hx HH[]A\A]A^AW AVAUATUSHXHw?& H\$H@ HHpH 1 HtwHL|$PL5& L-W, PLL LsHH= 1LCK ZYIHt)HHf Lt*6 #6 HL9u H6 1HXH[]A\A]A^A_AUATU SHR: CHtHxHc HH E1: HIHu H2sL$LHH)H Hu H5 THMIcA<$ Ht I\$AH">& H@ H@ HzHPc t&H5 H=N {(H5 H=; h(XH[]A\A]5 B AV1AUATUS H| Hb AH8?& L I<$Ht6 HHE HH HA4 E& I H?& H(H} HtIEu2H HH LAb4 E H} H Ht IHu H:& H(H} HtFEu2H HHA LA4 E H} H Ht+ IHukH"?& L MtfI<$Ht] HHtFHH y H3 -t H3 HH HA3 EuI Hn3 1H[]A\A]A^AWAVAUATUSHx HD$pH|$H$LL$ HD$`HD$h Mu% H= me,HILHt%HA u* H=Ƿ ?e1` H~ tHE0Dm D@HD$EAMc~/LDD$H9p DD$HHD$`uE D$l H<$ t H$1LXMtHD$M\$H 1E1IL9~nH5& AHUH HDL : HLEH= Hu HHm PH7& H5 QHH81J H|$p AZA[d HcE(IH9 EHEH=a7& u3H s HuH H H?HH5p 1 AH5a H H! HDL D;M$LNH Hu HH SH?H5? QHH1 AXAY HE HL$0E1DD$DHD$XHD$XHD$(Ld$8H\$LEED9t$D4 HD$X8|uHHD$XHD$X8$uHHD$XL9t$~HD$JH fH E9 DHT$D)H<$ HHTt$H<$H| Hu' H Ht$0H|$8% HtvHLd$`L$ HATh Ht$8$ HT$0L$ LD$X. Y_HH? LT$HEHMALEIcLg L W E$D9 E$D9 E9H\$HUEH=B5& }gA9Lv H ( ANL2 LcID;E(H LLH Hu LH SH?H5K QH1 XZ DH\$AH D)HLDHuH Hh H?H5 1Q o Hu|$l t H|$`&p Y $ Ht$ H|$(F IIHL$0H\$E1Ld$8M~Hl$HLIG|5 IcL9 H\$IcH<$ H\t\Hl$ILIH<$LLD$R LD$Ht$HUEOH HuFH H| 6? HtF HHHHL$ HL$HtFHl$IH3& H5 H81& GAG|5 IcH9~"HT$IcLDOAHl$IHMHT$LH<$1 H|$`# Hx []A\A]A^A_AQHt%IHO tHHt"HN u H= _1HwQH1APIH^_ZH HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ HL$E1D$ HD$HD$ D$ 0 HD$ H H HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ HL$A D$ HD$HD$ D$ 0 HD$H H(E1HD$D$HIHL$HaH(H(A HD$D$HIHL$H4H(H LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ D$ IHHD$HD$ 1HD$D$ 0 Pj LL$H H LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ D$ IHHD$HD$ 1HD$D$ 0 PjLL$(H USHH~HHFHuHt2QA L& HHL$Q1j j2@ H HHu1H/HG HtHE HhH[]HHHHuH~ HHu+PA Lv& 1HD$Pj j? H HHt(H? tHHc鋲 ƾ Ht1HHHHHuH~ HHu+PA L& 1HD$Pj jL? H HHt%H? ǃt H P Ht1HHHHHuH~ HHu+PA L& 1HD$Pj j> H HHt(H? tHHc霱 Ht1HHHHHuH~ HHu+PA LN& 1HD$Pj j]> H HHt+H? t1@H [ Ht1HHHHHuH~ HHu+PA L& 1HD$Pj j= H HHt/H? t1@H` ۼ Ht1HHHHHuH~ HHu+PA L& 1HD$Pj ja= H HHt.H? t1 @H \ Ht1HHHHHuH~ HHu+PA L& 1HD$Pj j< H HHt"H? ǃt H% Ht1HHHHHuH~ HHu+PA L & 1HD$Pj jo< H HHt H?+ ǃt gz Ht1HAUATUSH^H(HFHuHt5QHA HL& HL$Q1j j; H HH LkH5*& H+I}U u HVLH5q H=~ 'F H{y AătH{h u 躺 Ht`论 HuVH;-.& t3HEH;e.& t(HPH +& H5 H8H(1[]A\A]靻 1H(DLH[]A\A]t H(1[]A\A]HHHHuH~ HHu/PA LI' 1HD$Pj j: H HHu1dH? u HuH-& H@ Hr-& H@ HׅyH])& HN H0fZ 먉 H-& H HSHHHHHuH~ HHu0APA L( 1HD$Pj j : H HHu1/H? HctH{`k HtH HtH[ATIUSHH t)H[H; H 4-& HHL H߉# []A\UHSHAPHFH;(& t$H;,& t HHtyY[]Ҧ HHCtatBHuH HHtIH+& Hu Hh H9t5Hln HH# H H'& HH5 H81A 1HZ[]APHFH;['& t H;",& ulCt"Hc^靫 HHtY 1ZAWIAVAAUATUSHH5V5 HH t H{ܬ uH'& H [ I@HSAuBI9u H *& HH*& HH, H9t,H~)& HHt)& HH Au I9tH9uLq IH H] HHuQL! Hp HH HLį ADžtWL! H! Ei L, IHu菶 IHH H HHu_HAD$\DHLX LA-! H%! L ! H! A LE1 D$ H H A Hw LJcH H H^ H EiC H| I9N(i Ha I93 N HF M3 H+ |$ L H E1H[]A\A]A^A_AT1USԒ Ht2HA DH|$ `uBL蝨 HHu H 1/HH Hu H IIAuH[]A\ATH6 USH9Fu BӃv H $& HRHI/ HHtI|$ IHu H 1 HH謭 LH H H[]A\RIH5"& HM tI@H$& H9PLDLX魑 UHSQH=, HtHH- HH HZ[]UHSQHtHHH-y y Ha 1HZ[]AUATUSHQH9u HGH# Hx LFL "& HM9tRH5b%& I9tFLj u:LLj u+H5!& LS uH5(& L@ uH*HCE1HtL`H菢 Hu1 L9~H HHu(Et!H~ H$& HH$& HHcH IHt&HL芥 LA? AuH1 H' B HpH$& HH$& HHZ[]A\A]USHH~HHFHt HjH HHHHv.QA LP' HHL$Q1j j2 H HHt 1HH7tHWHH[]y H1[]HBATUHSHHwE1HH} ~'Le! HH=' u1tHWHBPHt H@Hu H!& HRH5 H81R HMt6H=[6 HHtHHHXI$L` HH H[]A\AWIAVAUATEUHSHxHb$& H|$ Ht$LL$(H@ Hc$ H$ HD$z_ Ht+Ht$H|$H3 HD$HuH u HCHP0E1 HHDl$$ Hc$ E1V IHM $ DHcHyX H1H A9~ IHH19$ ~0 Ht$(HcH<HcHI|H<AHHcH<IM LE1E1HD$H|$0HL$(H\$XHD$0HD$HD$8HD$ H@xHD$@HD$HHD$ HD$PH$ HD$`H$ HD$h IHt4HL$(H|$HMMcHV IHtI IFLP0LMu&ME1ItIIGHL$LP0HL$LZ H u HCHP0HxL[]A\A]A^A_SHH= & i IHtHHHXL[H "& ATIUHSH@ HP t ȉ HH@ H H="& HHt"I$LcHtHE 1HkH߉C {H[]A\UHH=w6 SQ HHtHE HHh} HZ[]H3) HGHtH H AUATUHSVH_HH~ L-!& L9uYH[1]H=I A\A]t HHHH !& Hp - IHt H@ u;HEH8 LH@HH= HHP1 HH MtA7HEH8 LH@HMHH= HP1 HH L ZH[]A\A]SHH= & ~ IHtHHHX L[H & SHHH9t H( H9( t HsHu1HtH=9 2 uE H= t+H{ uH & H5a H8_L [I1[U1H- SHHHHD$u 11LD$ HH uHH蝳 u1 H|$;0 H[]H 1 ATL%1 & UHSI$ HtHH@ u6] HHt H}HI$ 1D H߅t 1 H[]A\H & H@ Hx SHu Hx Hu Hx [H!& H9Gu P9 H= G1ZSHu H= GHHG uC.[SH1x HCH@H [1QyZk XAUIATUHH5Q& SHAQH` HHp UHteIH & HHa tBu%HCHH5Z HPHg & H81 AXLLHH[]A\A]" Z[]A\A]IARHS & HH@ Ht%HV u,H & Ha H09J \Mt9IP u,Mt3IP u&H& Hk H0I 11HAY1 LHAXH{ 1ZH} USHAPHcHH=G H= H= H=L H1 HHtHH10 ^H[] YH1[1]0 X[]AUATUSQLfMFHGHWL@HtHB HDH& H H5& H81v IHVH1s/ HHu1 Hs HIT$L0 HH ZH[]A\A]SHGHHX HtH?@ Ht HH[ 1[UHSHHHARHC t H@8HHuAYHHHH[]K HLHH1HX[] H& AVAUATUSL@ H H& HO LH0G 1DHIHLHIRuIu HKLIUM<HLH(uH[]A\A]A^USHH= Q Hu1BHHHƿ 1p HH HtH& HH8 HHk HZ[]UHHSHAPH& H9t H( H9( t HuHu1HtH=uv u) H=Yv tHuHY[]T Z1[]SHuHt& H5 H8=F HHR HuH{HCHt 1[à yH= 1 ATUSHHHB& HT$H h Ld$Mu?C@HHHu H5 HEH= HCHH[]A\18 H@ uBC@H u H5t HHE觋H=g HH1L HHL $~ HCH5M HPH*& H81 1L 1HH[]A\AUATUSHAPLg@H9u,A HH HHHHS H HHt^Mu^H[]A\A]BH{ u (l C(HEL HAIHt#LH'nuL H 1YH[]A\A]}/ ZH[]A\A]SH. HtHH H[AUATUSHAPLgM HH H 5x HC I HGHW(LlHG@HxH9HOHC8E1HL9~qH{0?u0H Hu Lc HS HH HC HC0H? H+C0L)H9HOIHrHK0HQHK HS0IE LlLcH H1HL9s Y[]A\A]J ? IHu1_HC@HxHIH9} JD HIHE1HL9~'HLq- HHu LA : IHL* ZH[]A\A]ATL%5 UHSHL9u]11_ HHtHHE@H}HC@uHEHU(HHt3b HH, Ht H H 1sHM@Hy Hʯ HE1HH5g 1 HHtLCLLږ u.HEIHH5 HPH& H81蒢 H: H[]A\UH1SQHHtHHlHH HHZ[]þ 9 19 Q Hu 1 H ZAUIATIUHcSAPa HHt9H|MtLLH5{ 1 H L议 HHHp ZH[]A\A]ù 뗹 UHSHH& HT$ HH\ V HHt |$ HH?= HH H HEH5 HPH& H81? HH[]UHSHH& HT$ H[ HHt |$ HH< HH H HEH5 HPH'& H81͠ HH[]UHSHH+& HT$ H] r HHt |$ HH[< HH0 H HEH5` HPH& H81[ HH[]HSHHNH~HHpH8 HtHxuHXHH H[AWIAVAUMATUHSHH(T$pLd$hD$ I' Lt$hE1MIM;' HMtIE HxHE HHMtIHxHHL$ HL$xLL$T$ ۳ @ LL$HD$`IċT$ I)HM M I4$HH ID$HE1LT$IOIRAP$ $ DD$$APMCPH$ HPL\$@H0 L\$HD$`ILT$I+HM97f E1IMMI} HxH} MuH1CMt6I4$HHy I4$Hy ID$H H3ID$E1Mu 'H1HMMH1HE1H([]A\A]A^A_ÀH ueUHSQH& GHH@ H HtH HG@H Ht(HH輪 HH Ht Ho 1Z[]1UHSHAPtE15H= & 2 IHt1HhHXH HE HtHLZL[]UHSHAP/uYHH[]Z1[]SHu H1[v1[UHSQHu@ߛ H 0 & HuH;{ H; tEI6H& H8 u!H& HH9FuH~ Hc EJ 1HZ[]ATIUSH Ht=HH@H HH& Hu H & H8肥 t I|$贿 1H[]A\HH= & ATIHUSHH E HudHHD$HHt$Ld$Hw& u HHa r H Hz H\$r HHv HtHi 1H []A\Hw0HHuH5& Hz11. H;5& AVAUATUHStHHt LoMt HE IvLwL;5 & Ht[H]HA\LA]11A^ IHt>11LA8 Hu L !HUIHfHnHfH:"L` @[L]A\A]A^11e SHtE1/H=& W IHtHX11LI@AP HL[AUW1ATUSHRHGHo`LghG`LopHOpHx H & H9GuHu & (i HHt. '# y H & HH0 tH XL[LH]A\A] UHSQ H8躧 H H} HHt Hu H & H H}HCHt蚹 Hu H & H HC }芗 H HC(}CHtoH}HC0Ht N Hu VHx & H H} HC8Ht + Hu 3HU & H H}(HC@Ht Hu H2 & H HCH H 1HZ[]ATI1US袺 HtKHKHH訩 u=Hl MHHt!LHHuHG J1J H/ H[]A\AWAVAUATIHUSHHHt$Yu4H| & H8d u1" H& H5 H81! ZK F I CHHu I?E1HL跧 HHu1L HL$?|$Ht$HHLD$%Qt1HT$"u L9 HI1 L7] Ht$HuSH u ̪ HP|$^ HHHH& H5J H817 H L%HH触 HHH[]A\A]A^A_AWAVAUATUSH Hu1 HHAIE1L|$E9} 1Hھ LƄ$ yHuHME9u$ t< uAH\$MHt CHH r LHu HL HHu111H H H[]A\A]A^A_ATUSHG u+ FHb& HHIH5" H8襘 x HuH e LHH[]A\S [1]A\ATUSHG u Ƙ H& IHHH5 H8= xiHuH-#e HHL HHtGH@ u.ID$HH5K HHH& H816 H H[]A\p [1]A\ATUSHG u FHJ& HHIH5« H8荗 x HuH sd LHH[]A\+ [1]A\ATUSHG u讗 (H& HHIH5 H8( y1XHuH- d HLHv+ HHtH@ u)HHH~& HH5 H81" H H[]A\AWWIAVAUIATUSHH8HB`H4$HD$(HBhHRpC`HD$ HT$1HSpHuH& H HD$ HL$HT$ HHt$(蒞 Hl$HHuH & Ld$ Lt$( 1LLbX IHt9H4$LA LHHD$m LL$AI u IALP0Eu H8HLLH[]A\A]A^A_R MtIu IFLP0MtI $u ID$LP0Ht!HM uHEHH@0H8[]A\A]A^A_H8[]A\A]A^A_Qb HtH耒 t 1ZAWH= IAVIAUATUSHH& H4$L@ > Ht 8 HtH5 HGu 1 H Y H HHu L芥 S. HAHHuH=T H H H9 HHHH)e HHuHU 1 H|$ H|$IW Mu Hs% "HLa LH3 HuH& H0L u)H H4$HLLP HH NL HH& 1HHT H81芔 H߉蠠 CH)& H "& H HHHH[]A\A]A^A_AVIAUATIH= USg H HH5 H` HHO H 7 HHuߣ 1( H WL 1HCHC胁 IH HH IH H5v H!` HHtLQ7 HCHHu` H1覤 H "Ls Lk HCHtHz Lr Lj .H` HX 1HL HD L< H[]A\A]A^17| AVAUATIH=) US@f Hu I H5 HH@_ HH L IHuH H H1H1 IHt-HC HI H L L *Hv Hn Lf VHY I[L]A\A]A^H H% H5 H8- tH% H5 H8z- 1-HG Ht$1H HD$H & H 9. HH H% H5 H8$- tHm% H5~ H8- 1-HG Ht$1H HD$H9 & HP - HH H% H5( H8, tH% H5 H8, 1-HG Ht$1H HD$H% H Q- HH H% H5 H8<, tH% H5 H8 , 1-HG Ht$1H HD$HQ% Hh , HAUATIUHSHHHw H~'M,$(1ҹ HH=V u1 L-% { H% H5 H8+ ԃ{ tH% H5 H8b+ H-% I1H $H LH ', HHt ~C 1LH H fI:")$+ H[]A\A]SHHHW0H7% HH$t H 1H + Hǰ)HH H 1HT$H + H1CpHt 1H[SHH_HuH% H5 H8R* Bg H_H; I% t.H% Ht$1H H\$H + HHHH[H 4HL% H tH5 H) H5C H) 1-HGHt$1H HD$H% H * HAVAUATIHH5 USHGHH9t!H 5 H98 tIt$HFHw 7HtH= Ґ uڃ H= @ tI|$Mt$ Ml$ ~;I|$( IHu螈 HHtH LH` HtL%3% LLH HqLL" H]L%g HL1LH=¡5 ! HCH2LHL1H=^5 ! 1HCHu H{H1HC []A\A]A^H Ht$(HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ HL$HD$ HD$HD$ HD$H}% D$ 0 H0H% H ߄ H HuH=hj 1锂 AW1L= AVL5d AUL- ATL% UH-6 SHHQY 3ta'uH=Y 1@ FF^w L1, 2 w L1 v L1 L1 HZH[1]A\A]A^A_݁ H Ht$(HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ HL$HD$ HD$HD$ HD$H% D$ 0 H0Hj% H v H USHHHGH;*% t H;)% u H{1脙 tHH[H; H % HH % Ht$1H H\$Hu & HH HH[]USHHHGH;% t H;% u H{1 tHH[H; H G% HH% Ht$1H H\$HH^ & HH HH[]UHSHHt>H$HH5% 1HHl$H H % HHu H= 14 HH[]H H1HGHt$HD$H% Hu Y% HHu>H% H9GuH% H` ATUSH; HtcHL%J# I<$HtR۴ HHt.HHv x tHIv HH處 yH] HtHP 1H[]A\ATIUHSHHHwH#<1ҹ HH= u1 H} n HHu; HuH% Ht$1H Ld$HЙ #$ H HS HH HtHxH1} HHyHHE% 1LH 1誽 H;% Ht^HtYH% HH0Ǵ HI< IuQ Ht H$ H} tH}(H=% Lc HH HH[]A\AVL5% AUATUHSLGHLL8w uH5% L%w uHHEE1HtL`H% H9Cu2Hiq L9|%HE% HH1[]H A\1A]A^韼 LCLLv uH5M% Lv tHS1HtHBI9}H1 _ IHtH苻 IHuL E1 H}LWv H`? Hw HEILx HHt*HHAօx4u H HLi tL 詀 Ht"|Lw Lo Hg g[L]A\A]A^UHSHAPHu HsHu/HH= , u) H= tHsHY[] Z1[]S Ht HxHHt{ y H 1$H{ Ht ] xH H"% H [So Ht HxHHt) y H} 1Hq H% H [AUATUSQ) HHtMHx Lh(4] H{I(] H{H ] HMLHH= 1 HH HZH[]A\A]VH H% H5Ĭ H8L I tH% H5w H8. 1)HPHu H"% H Hf% YH8 ZHHtHG% H PH% H5 H8 1Zà 3QH% H tH5Qw H (H5 H H% HHP h 1ZATUSHuH% H5ͫ H8U %HI8 HHuHi% HH8螲 1HL HH H[]A\U1SHVHU% HH HvH;% uHi H{HY1[]TZ[]U11SHH(H-% HHD$H 'HuHT$Ht$H|$ H H{1H H|$HHt HT$Ht$躩 HtH 1H(H[]H% H1HP Hi% H1H HP% H1H rH7% HHH XH % HHHH >H% HHH $H% HHHX H% HHHx H% HHH AUATIUSQL-% Ia H HH@ uH2% H5 H81| RMI\ tLH6 7Hj Åy)HO% H8迅 tH% H5_ H8 H- Z[]A\A]H1 H% HH@b a AUATIUHSAQLoI HtLLHx HHu7LF y<H@H HtHUHAXH[]A\A]HH}LY[]A\A] ZH[]A\A]UHH5>5 SHHQl (t1VHEH54 HPH% H81{ H1 HHtHH8 HHu H HZ[]AW1AVAUATUHSHHHHx HLd$8HT$LH $HD$8_< Ll$8MtL;- % u1LHD$8 1HD$0KH= . tH|$8H aH$Ht$0Lm + u1LHD$8A HH LH; x Ll$8Mu!H% H5[ H8{ A L5 La. mH $HT$(LH` N+ JE1LL|$8 H( LHD; xLl$8MuH'% H5 H8 pL- Ht$$Ln_ * E1LL\$8? H LH: L|$8MuH% H5 H8u Lh- tHt$ L^ A[* EVE1LLT$8 HH LHP: L|$8MtL;=% uE1LLL$8 D$$D$ <L, Ht$ Ln^ ) E1LLD$8? H@ LH9 H\$8HtH; % u1H|$8H D$ D$;La, mHt$H] U) Q1HHt$8 Pt$L$0DL$(DD$,T$4Ht$8H|$@XR HL$HZYHu oHHD[]A\A]A^A_AWAVIAUATUH1SHHHHt$8Ll$8Hx HHT$L8 x L|$8Mu#H% H5 H8z D$ L% L^+ tH|$8Ht LHt$0L)j B( u1LHL$8 Hp LH=8 xL|$8MtL;= % u1LHT$8w 1HD$(AL* tHT$(LLH\ ' R1LHD$8- H LH7 L|$8MtL;=z% u1LHD$8 1HD$ >LP* LHt$ L.gA' 1LHD$8 H( LH87 L|$8MuH% H5 H8 aL) qHt$ L^[ & UE1LL\$8/ H LH6 L|$8MuH% H55 H8e LX) Ht$LZ D$J& |$ E1LLT$8 HH LH=6 L|$8MtL;=% uE1LLL$8r D$ D$<L( nHt$L[Z % RE1LLD$8, H@ LH5 H\$8HtH; y% u1H|$8H D$D$;LN( Ht$HY B% 1HHt$8 AVD$PL$,DL$$DD$(HT$0Ht$8H|$@B HL$HZYHD$HH[]A\A]A^A_AW1AVAUATIUHSHHhH LLl$PHT$ LHD$P4 x L|$PMu H% H5n H8n I u%" H5{ HHi% H81s IGHE1HHD$諏 H$Hq Ld$MHD$I9 ID$H=\ N<I& ; HT$XHLHLD$# D D$ HD$I9D$tH% H5& H8 HD$XH $JDIeM1Ld$LHD$P H LLr3 L|$PMuHQ% H5 H8 I u%Ӯ H5 HH% H81q F IGHHHD$_ HD$H$ Ld$E1MHD$I9 ID$H= N<I% HT$XHLHLD$(y" D$( HD$I9D$tHM% H5~ H86 HD$XHL$JDIdM1Ld$LHD$P HX LL!2 {Lt$PMtL;5% uE1LL|$PV E1Lt$HFH=% $ HT$HHLH! E1LL\$P H LL1 L|$PMuHs% H5 H8< I u% H5 HH<% H81o h IGHHHD$职 HD$HF Ld$(E1MHD$I9 ID$H=. N<I# HT$XHLHLD$0 D$0 HD$I;D$tHo% H5P H8X HD$XHL$JDIdME1Ld$(LLT$P H LLB0 L|$PMuH!% H5" H8 wI u%裫 H54 HH% H81n IGHHHD$/ IH Ll$0E1Ld$(MMHD$I9 ID$H=ֈ N,IE Y" HT$XHLHT LD$<B D$< HD$I;D$tH% H5 H8 ] HD$XKDIhME1Ld$(Ll$0LLL$P[ H LL. CL|$PMtL;=% uE1LLD$P 1H|$@EH= y! HT$@HLHg 1LHt$P H( LL^. L|$PMuH=% H5 H8 I u%迩 H5 HH% H81l 2 IGHHHD$K IH Lt$(E1MHD$I9 IFH= N<I HT$XHLH4R LD$0h D$0 HD$I;FtH=% H5 H8& HD$XKDIkM1Lt$(LHL$P 8 HH\$@Ll$H!l Ht5H $LhLp HHL$HX(HHHL$L`0HHHL$ H1"HD$ 1HH|$PH! Hh[]A\A]A^A_AWE1AVAUATIUHSHHhH LHD$PHT$ HLD$PHD$f, x L|$PMu HI% H5 H8 L-ш L HT$HHLHP 1LHt$PP H HT$L+ xL|$PMuH% H5 H8 qL{ & HT$@HLH0P i 1LHL$P H HT$L^+ Lt$PMuH=% H5> H8 I~ u%迦 H5H HH% H81i IFHHHD$K HD$H` HD$XLd$0E1MHD$(HD$I9 ID$LN4Iv ! HT$(HLH+O LD$<_ D$< HD$I;D$tH3% H5 H8 HD$XHL$JDIhM1Ld$0LHT$Py H HT$L* Ld$PMuH% H5 H8 L uOHt$XL/N u71LHD$P L$XHT$IHt$@H|$H* HL$ HHuH|$PH- #Hh[]A\A]A^A_AWE1AVAUIATIUSHH8H LL|$(HT$LLD$() x Lt$(Mu H% H5Ն H8 H= tH|$(Ht, HT$ LLHWM u1LHt$( H LL( xLl$(MtL;-N% u1LHL$( 1HT$EH=e mHT$LLHL K1LHD$(w Ht$H|$ L2 HL$HHH8[]A\A]A^A_AWE1AVAUATUSH H;5% HT$ LD$hu H1H ILt$hHHH( LL' L|$hMuHn% H5 H87 f L-Å L# Ht$dLK 1LHD$h H LL' L|$hMuH% H5~ H8 L Ht$`L4K y 1LHD$h HH LL& L|$hMuHs% H5< H8< k L/ Ht$\LJ # 1LHD$h H@ LL& L|$hMuH% H5 H8 L Ht$XL@J 1LHD$h H LU HH LL% | Ld$hMuH_% H5 H8( W H= HT$xHLHI A E LE1Lt$hk L$\T$`IDD$Xt$dH|$x- HL$ HH H LT HH LL$ H\$hHuH% H5 H8M | H=9 < ( HH$ y 0 HHE1 Ld$h L$\T$`IDD$Xt$dHu HL$ HH E1 H LS AŃ o H LL# L|$hMuH% H5 H8q I u%* H5 HHq% H81 b . MoHLE H$H HE1HLII9 IGH= N$I$ HT$xLLH LD$ R D$ I9_tH% H5b H8 HD$xH $JDIpE1LL\$h L$\T$`MDD$Xt$dH<$ HL$ HHk0 H LMR X } H LL:" 6 L|$hMuH% H5 H8 I u%蛝 H5 HH% H81` IGHHHD$'} H$H~ Dl$(E1Ld$0MMHD$I9 ID$H=ł N,IE P < HT$xHLHF LD$89 D$8 HD$I9D$tH % H5 H8 HD$xH $JDIdME1Ld$0Dl$(LLT$hN H LL Lt$hMuH% H5T H8 I~ u%= H5f HH% H812_ A IFHHHD$()B HD$H Ld$0E1MHD$(I9 ID$H=n N4I HT$xHLH,LD$8 ^ D$8 HD$(I9D$tH% H5 H8 HD$xHL$JDIdME1Ld$0LLL$h H HT$hL H\$hHtH; G% uE1HLD$h 1H|$xBH= HHt$xHP 1HHt$hr UD$`PL$tDL$lDD$pH$ Ht$ H|$W HL$0HZYH H LN Aǃ H LL L|$hMuHy% H5ʀ H8B q H= 1 HT$pHLHB A E 1LHD$h H LL L|$hMuH% H5 H8 I u%u H5 HH% H81j\ y IGHHHD$a? H$HX HD$xLd$0E1MHD$(HD$I9 ID$H= N<I) HT$(HLH[LD$8 D$8 HD$I;D$tH% H5' H8 HD$xH $JDIeM1Ld$0LHD$h- HD$hH LHHD$0 L|$hMuH% H5 H8Y I u% H5 HHY% H81[ IGHHHD$(= HD$H HD$xH\$@E1LHD$8HD$(I9 HCH=~ N<I Ht$8HLM LD$L - D$L HD$(H;CtH% H5 H8p _ HD$xHL$JDIiIH\$@1LHD$h H HT$0LY U L|$hMuH8% H5Q H8 0 I u%躖 H5c HH% H81Y MwHL< HD$(H HDl$0LE1MIIM9 HEH=2} J Hv b HT$xLHLH߉D$8_ D$82 L;}tH9% H5~ H8" HD$xHL$(JDIp1HDl$0HD$h PAVD$hPD$tPHL$HD$ D$ HT$0Ht$ H$ 9 HL$@H HH H LI AŃ HX LL H\$hHtH; Y% uE1HLt$h E1Ll$xCH=.~ ) HHt$xHK E1HLd$h fnL$\8 HH\$xf:"L$XfnD$df:"D$`fl)$W H ($HL$ HX@(HA E H LH H LL Lt$hMtL;5F% uE1LL\$h E1LT$xFH=C} HT$xHLHH E1LLL$hl HX HT$hL H\$hHtH; % uE1HLD$h- 1H|$pBH=| t HHt$pH`I y U 1HHt$h fnL$\fnD$d8 Hf:"L$Xf:"D$`fl~L$xfH:"L$p)D$) $MV H ( $(D$ HL$ H@(H H LF u A H HT$hL xL|$hMuH% H5{ H8 I u%= H5{ HH% H812U A IGHE1HH$'8 IH H$I9 IGH={ N,IE HT$xHLH8LD$ j D$ H$I;GtH% H5{ H8 HD$xKDIl1LHL$h fnL$\8 Hf:"L$XfnD$df:"D$`fl)$T Ht ($HL$ L`@(H]HD$ 1HHH% LH5.{ H81S H|$hH2艽 (HĈ D[]A\A]A^A_AWE1AVAUATUSHhL%% HT$ LD$@L9u 1E1H L HL|$@HIH( LH g Ll$@MuH% H5z H8c B H=z R Ht$<L8 F 1LHT$@诼 H LH= HD$@H$HuH% H5z H8 H=Uz Q H<$Ht$8Z8 A E2 H<$1HD$@) HH LH c HT$@HtL9u1LHD$@ D$<D$4EH=y H$G H<$Ht$47 : H<$1HD$@袻 H@ LH0 HT$@HtL9u1LHD$@j D$8D$0EH=Iy H$ A H<$Ht$0J7 $ H<$1HD$@ H8 HB W H LH 5 Ht$@HtL9uE1LL\$@º E1LT$PLH=y H4$ H4$HT$PLH6 v H<$E1LL$@l HX LH HL$@HtL9uE1LLD$@3 1H|$HHH=sx H $ H<$LHt$HaC z H<$1Ht$@ H LHp x L|$@Mu!HS% H5,x H8 A I u%ό H58x HH% H81O h IGLE1HH$2 HHF H$I9 IGH=w J4HHt$ Ht$HT$XLHHt$( D$y H|$( D$ H$I;GtHJ% H5w H83 HD$XJDI_1LHL$@蝸 fnL$40 Lf:"L$0fnD$<f:"D$8fl~L$PfH:"L$H)D$) $O Ht%( $(D$HXH\$ H@ H?HD$ 1HH% HH59w H81WN H|$@HM CHhD[]A\A]A^A_AWE1AVAUIATIUHSHHXH LLt$@LT$@LD x L|$@Mu#H'% H5v H8 D$ H=v r HT$8HLH D$ |$ K E1LLL$@( H LL xL|$@MtL;=y% uE1LLD$@ 1H|$0EH=ov J HT$0HLH2 8 1LHt$@衶 H LL/ Ld$@MuH% H5'v H8 I|$ u%菉 H50v HHֻ% H81L B ID$HHH${/ IH" HD$HE1HD$H$I9 ID$H=yu J4HHt$ H Ht$ HT$HHHt$(V D$ - H|$(裵 D$ H$I;D$tH% H5u H8 HD$HKDI]1LHL$@P HD$8fHnfH:"D$0Hu H% H5u H8 1IU - H)$K Ht($Lp IE 1IE H|$@H_ڴ UD$HX[]A\A]A^A_Q|J HtH说 a 1ZHx Ht H5( GJ PH% H5` H8 1ZQJ HtHY }a 1ZUHSHAPHu HsHu/HH= Q u) H= 蓋 tHsHY[]pg Z1[]AWAVAUIHATIUSHHH% HL$L@ Lq Ht3HHuI]pIFH5 H IHu H} 1_PH9% ILj LL$HLHȀ 1萃 LHE ZYHt H6 LHLL5v HH HH[]A\A]A^A_AWIAVAUATUHSHH,y Hu1 IHu Hu$ Hi HHu L趲 Ht!Hh HH L蓲 L5O% I@ H@HuH5f. H= 趥H H5Q IHut_ 7I 1HH$H Hl$~ LI MtLLHHLLI HuL Hݱ HtHα HH[]A\A]A^A_111P ZH& ATUSHHw H( H H{HI LHf HtsHsHK HH=% HH IHu H{3 H+ H{ " 2H% H[H 9& HL[H]H= 1A\J [1]A\SH H@HHD$HtH H H|$HHt记 Ht*Hj% H % HH=xz H1J HH@H[UHSAQH0% H % HtHHUHHtHMHAXH=l [1]2J 1;h HHtYHH=z [1]J Z1[]SHɸ% HH "% HSHHtHKHtH={ 1[I H=Hl 1[I SH% HH $ HSHHtHKH= l 1[I H=l 1[zI SH:% HH $ HSHHtH=Z 1[HI H=k 1[9I 0 HOHWtXUHSVH} HHtTH~ HH Ht<H% Hx $ YH[HH=x 1]H Hw1H=x H Z1[]ATL%j% UHSHGHL9t H;J% u$H}W uE1gHmH} H-% HCL9t H;% u H{yW tH[H; H % HE HHHD HI' H L[]A\AWIAVAUATUHSHHHH5 % c8 H}R8 HEIxH$ HH; 1 HHH 1HD$(HT$HT$HT$ HD$LD$H<$HL$HT$Ht$ Ll$Lt$HL|$(IE LIL3B IHuVB HtB+ H LH9; t LLHA2 L LLL 1] IH HH+ Ly 躬 谬 L訬 MtL蛬 L蓬 1Ht$01Hl$0H HD$HD$H-% Hp IHt>HH yL: H2 H* LH L H H %H H L MtLܫ H|$HuKNLHHt>HD$0Ht$01Hu% H Hl$8Hp HHu H肫 1y HHH[]A\A]A^A_UHSQ,o Ht-H}(HHu H % Hj HHu H* 1 HUH=* H1E HH HZ[]UHSQHP H_uHX tvHt H Hq HHu1 HUPHtHy% HH x#HUXHt3HV% HH@ yHs HuH ݳ% HH; ӳ% HUHuu 1 HHٿ 1q HH& HZ[]UIHH5Af5 SQHv4 tHLLHHR u H p% HAHp0HuH5C% Hx1L1諆 HHtHHC t H蜩 1HZ[]SIHuL% HD% HHH@ Hկ HHu11HG 1[AWAVAUIATUSH LrHt$0HT$HL$XMu H% HH5$ H81L? Hl$X1Hl$p` HH HE t LEH A Hl$pLt$E1M H裨 IM9( Nd I|$Ld$p H5% 2 t{A|$0 tsHl% I9D$ueIL$HHA HAHu{HHHL$Hi HL$aHLt$ H 1 H% HT$xLH} u ~3HL$xH; =% t HmH!% H9TsH螧 < HuLHN HLt$t xHLt$ HHW L|$xHl$X1L|$Hl$XL9 HD$HT$H|H% H`} yHHl$ / L|$xMt L;=g% uHHEHL tH5 L14i IH5Kq L1 i IL裦 HLd$X薦 Mu HEHl$ tHL}HHD$ HD$XA HD$ M9tEH|$I M9MMHS HG LHMH% H5f H81c< HD$01H@HHD$(v 1HL$xHD$`HT$HL$@HuH|$ѥ 1 L|$HHL$(H9L$w HD$0HL$L|IG tHD$`IL|H< L-E% HT$@LI} Ņ~Lt$xL\ LL HT$hI} L Lt$h1Mt@HL$HH9}HL$L;|t HHHL$ LH4 H LI ; HT$pIr Lh $ Ld$pM ID$ Mt$M HD$LH@HD$8 HD$xHu Lj Ll$xE11LAHLI9~fID1H9T$8~CHL$H;DtHHD$ HL$HHTHRH tHP HT$xH HDHHHDLl$xLL>: LIã L軣 I1ILHI裣 MuH|$`蒣 H|$舣 t*IOH|$`HIWBLH_ HyzHD$`L|HHD$yH|$4 HD$`(HHHPH|$PAH|$PHH!iHĈ []A\A]A^A_ATUHSHHH{ t HS HsHHIHu苸HC Hu1 H{H LHŊC0E0蒢 H[]A\AVAUATUHSHHH{ t HSHsHHHHu HCHu1YLpMu H H;L`A I$M9}%JtLL LH Ht IILH H[]A\A]A^ATUSHH~HHFHuHt.VA L& HHL$Q1j j荷 H HHt*HHA u!H! H5HB H=~ 1 HH5 IHtHH;$tH % H5 H8 H10 HHtH=T Hg HHt L HCHu H vH HH[]A\11/ SHHHX Hߺ [H/ 11 USHQHGH;9% t H;8% u H{1I t'H[H; H ֩% HHSx HHH HZ[]AWAVAUATUSH8LHt$I HH|$Ht$ HD$H HD$(E11IHD$AH|$ HL$(A HDHHIMD$HHH|$I9LOI9}=AIcL9}DHUH|$L4L uHt$LS HHu1HtI9~LIHtHH8H[]A\A]A^A_H AWAVAUATUSHXLx M IE H HD$ L|$0HD$HD$(HHD$te1HL$0HL$HT$LH0 tEH|$(HG tH5 uHl$ HtH}H5%% H9t k u11HD$8E1A HT$0HD$HL$HT$LL趱 HD$(H@ tLD$ H5h% Ix( tI@HtHx@ tHtG1HD$HHL$HT$@Ht$HH; t%Ht$@HF tH|$( j u\Et H5z ;} H50 &}Ht$(IE1~MtC H5z |LJ} H5 Z | H5 |HX[]A\A]A^A_Ã=% J AWHh& E1AVAUIATUSH889tIH IuA E1A |$ a% Iċ D$Iiǰ IT z t1ɋ|$ ItJ1EL5 t! H5 m |Iiϰ Ml ?W1Ll$ D$Hz_ LHD$(1c+ H5\ {LxLH{ L{5% 輅H5% D$A$H8[]A\A]A^A_ATUHSHL%y% I$@ 蔷 HHu 0 HuGH= Ht6HH1H H $I$ Hl$ HHN HHH[]A\SE1H1HH y& H\B HLD$IL$LD${ H<$H p% Hu H|$Hu?MH9t+ u$HGH5[ HPH[% H81 1 N1yAH9u1Ix1HH+ uHGH5[ HPH % H810 1H[H(Ht)HG t Ht HF t HtHu H= s1 A E1D$I@LD$HD$[? H(H(Ht)HG t Ht HF t HtHu H= 1"A A D$I@LD$HD$> H(U HSHQ' u1= - w t HHS' tHCHPH;% H;V% H;% H;% H;l% H% H5Z H80 J H=t]vCȃwQH{t!uAHGH@H;% tH;ơ% u' 1tHC8uH@H c% H9HtH% H5ߴ H8 Z[]AT1IUHS1Ht*$x xXxdD9 HpH HHE H9 HDPDH D9~H% DH5 H81. 5D9uy0;x$t+;x$tH$H^% AЉH5 H81- 1ED@$D9oH0% H5 H81- Ӻ Lv% K뼸 []A\UHSHQH6 HsH HCHuHsHu$ HpHt H% u HC(HuHs01Ht!H HpHt H$ uwH 1HtHH{1HtHHH9}H1% H5W H8 <HS HCHuHu ,H1HtHH9tH% H5W H8 111ɺ H# tHs H# Z[]AUATUSQHtE1H> IHuGH% H5W H8" NHu L# t9Hu1ɺ LX# t"IL;+} Jl LHu # u1 Z[]A\A]SH5J H u H[$ H% H56W H81l+ 1[AUATUSQDN0V(D9~ Hę% DH5 H818+ FF,HHyD9uy<;F4u 5y,9F4t'AЉH|% K4H5 H81* 1V D9u%DC4A9} HJ% H5 H81* ϋE E ;E~H% H5 + H8 몋ȃ H HcHHsH HCH;% u H ~% H9HtH% H5"V H8R vHs H - HSHCHuHu *H1HtHH9tHe% H5V H8 "H{HuLkE11Mt3 u1 L9 Kt>u#HFH;% u IIE H % H9HtHuHSHC HuHu -H1HtHH9tH% H5U H8S tHs H [HCt&uH@Hp% H5U H8 *E1HC1HtHI9 J|0" I҅uH % H5o H8 H{H( H{HuHsHuH{ uH% H5*U H8R s1H4HsHtH>H% H54U H8 =1Hb yH% H5 o H8 M 6Hs1H0 Hs1H Hs 1H Z[]A\A]Ht=AUAATIU1SHQH9+~HtDLt H Z[]A\A]ø UHSHH5 QHk tHH, Z[]UHSHAQ x 軙 u= Hu HAX[]C @u1 He Hu= Hu HY[] H9 K uHSHtH9PuLKL;HuD@ Dƃ@@8u t@H{Ht H{0H{HA tA@HpHt Hp0HpHI1҅Z[]ATUSHHu,H HA u;H H5 H=-m 1Hֹ H=m g uy xHx uE1 HKL#HA u HL H5 H=l 莯 Ȁy y1LHkQ HHuH uH1Q HHu H& HHHc HI H L[]A\A 11W@ HATHrR IHUH=3R SHN1? Ht HHǺ LtM H߉Z []A\ATUH-% SH_HH~GH9tBH{0HHHt+I Ht H{0L *# HtH} H HE HHE H[]A\ATIUHSHHHw H~'I,$(1ҹ HH=q :e u1L H-% { ,HS% { H8tH5 H5MP H{8 u{ u"0{, t HCx x9HK u+HCPHtH;C@uH% H5j H8 f{$ uHH=q []A\+ H{h1> t^3 HHCp HHuPH u貌 ~CH1Hi% H fH:"H )$ HHu1HL? Hu9 1H{hHspA HH[]A\AT1I U SHHPHHHH% y$A9 HH H5$ H=i T .C Hu u!HH H5$ H=zi $ 1 HL耩 HH|$ tH]' HPH[]A\SE1H1HH U& H2i HH\$LD$LL$ID$ ģ tBH Åx4 HHt'|$ t$1ssHHt H% H8~ 1 HƉDs+ uHh% H H[AUATIUHSHAPHw H~'I $(1ҹ HH=n ?b u1 H % DmEyHU% H5I H8 Eu^H=w) []A\A]H; ԓ% u1ɺ 1H= HHuHH HL Hu9 Iz1HDL t H~% H8N\ H 6ZH[]A\A]UHSHQHwH :1ҹ HH=^ :a u14H} Y5 ǃu Ht \ xH% H Z[]S H=M& x HtH y H? 1H[ATUHSH HT$Ht$D (H|$H) H% H8][ 1H=L 1h} HT$Ht$H|$5 D#H 1[]A\USHHH(u4 t Hk HHt H}Z 1 H1HtH .H([]AVHBAUIATUHSHH@HwH;4 Aău+ HH=e _ u_: HuUH{E1H~LsHt$Mm Hlx/HL]x H\$ HDHt I} Z 1H>-H@[]A\A]A^AUATUSHAP% ILA Et-8u 蟠 t1 H% H8Y[]A\A]Y H% H Z[]A\A]HHHHuH~ HHu+PA L?& 1HD$Pj j H HHt%H?Ht$XP tH5e% |$H)1HHHHHuH~ HHu+PA L,?& 1HD$Pj j{ H HHt%H?Ht$O tH5W% |$H1HAVAUATUHHSHp1 tIL H1Ht LI[LA Et(V8u t1NHe% H85X =t$PHt$Pt$Pt$Pt$Pt$PLL$PLD$HHL$@HT$8Ht$0: H0Hp[]A\A]A^ÃuH% H8W AVIAUAATAUHSu $ HH="c u HH IF HHpP艞 HI M L-) LH H H*EY[] H*M X* HN H*EY5] HCH*MX* H$ HC H} | H HC(H}(f H HC0H}0P H HC8H}8: H HC@H}@$ H HCHH}H H HCPH}P H HCXH}X HtxHC`H}` HtfHChH}h HtTHCpH}p HtBHCxH}x Ht0H H HtH H j Hu H} .H IcL HD[H]H=;a A\1A]A^m/ [1]A\A]A^AW1AVAUATUHHHSHH 38& H LL$LD$W1tw1D|$Dt$Ll$D$ { DHt$ LDIUL y"8u t1"T$ LHH % H8T HĨ []A\A]A^A_AVAUATUSHHHH HuH~ HHu/RA L7& 1HD$Pj j H HH H?- Aăt 1Lt$D$ Ht]R8uB uJo H|$LDIL xNjT$LH$H,% H8S 1HĠ []A\A]A^AU1ATUSHHHHU_ H(HL$LL$LD$ 1tTHt$Hl$HDl$ HDd$1t-HDDuH% H8hS Hw% H H([]A\A]AT1USHHHH^ HHLD$z 1tKHt$Hl$HD$$H1t*HDftH% H8R H% H H[]A\U1HHSH5k^ 1HHT$载 tZ|$Ht$ tH% H8R H4HE Hx6$ HHtHc|$ Hu H 1HCHH[]AVAUATUSHH011H|$HuH>% H8R H H*D$HHC H* % Ld$(Hx8Ll$ ^ $fI~H*D$^D$}# HHtD$Z% Hu H= 1_HCfIn;% HtHC I*^$#% HtHC(I*^$ % HtHC0H*^$$ HtHC8H0H[]A\A]A^ÿ AW1AVAUATUHHHSH\ 1H HL$ LL$LD$7 1D|$Dt$Ld$ D$0Dl$ DLDHDH߉D$ @ D$ y8u!Y tV|$0 u#H % H H% H8^P HHE HxH " HHtHc|$0 Hu H} 1OHC|$4 HtHC Hc|$ HtHC(Hc|$8v HtHC0Hc|$(c HtHC8HĨ H[]A\A]A^A_AVHAUATUS uH% H5A H8諲 I IHy1 H= ~Hہ% H56[ H8t H< E1肺 HM9tzLL_ HHtPH@ u+H[% H5Z H8$ H| H vHJ4Hu| H追 Qu| IHLy H% H8N H芽 H} H% H []A\A]A^AVAUIATUSHHH@ yH% H8]N HLt$nK HHu51 LLd LH{ HCH?w#LeuPHYL IHu |$ uHt"HP% @ HH5? H81 { Huq8tH% H8M TH|$ 6 HT$ H% H5? H8H1 \& HuHz Hz H@[]A\A]A^AWAVAUATIUSHH HuHl$0I<$Hu') Hֹ H=X R u ID$ H H$ H|$H& H$ HD$ H|$HyH~% H5X H8葯 L|$ HH|$Lu L$0 H|$LLILA AuV% t" u H*% H IH.~% H8K 8ǒ un- HHH)HD$k1HC LHx(Hĸ []A\A]A^A_AVAUATUHHSH HH1t{H$ HL$ L$ LLIeL u(B8u t1!HQ}% H8!K HE LHx7(HĀ []A\A]A^þ ' WHL$ tHcu Ht HuY\ 1ZUHSQHuH} $ Ãu-!Hֹ H=V O u1;3 HuH}# ƃu Hu1҉& xHX% H Z[]H1 [ S 1豾x 11H b% ljZ y N[ATIUS LHܾHr tH{% H8I []A\Q11 &yH{% H8I ZSH1HH & HU H LL$ LD$D$ ^ t4H% H@ H{! u H{% H; HH0薬 1g|$t>Ht$u|$=x؋L$t HI{% H; HH01m 뵋D$Hc=% ҁ% D$ ́% + HĠ [WH! tHcu ? Ht3 HuYZ 1ZH1!T HT$ D$ 1ij1yH]z% H8-H HUHSQHuH} p! Ãu-!Hֹ H=2T M u19 HuH}3! ƃu Hu؉WxH~% H Z[]AVAUATUSHHHF u HH. H5 H=S p )~ yHt$H7 HHu8H} u1 HfH;D$t Hy% H5U H8) 1E1 HXH H\$H9sB H< IHt־1HHډ8LIqHA$t"uIH9rWH^LH4 IHu 01HHMA4$H"A<$ HtHx% H8YF 1 L=Y HL" H HH[]A\A]A^SHH;56}% thHFH t<Ht$H HHtrHH;D$t6HIx% H5 H8 KH H5. H=T 趓 /1HJHHuHw% H8E H1[F H1[UHSH HuH} Ãui"Hֹ H=Q pJ u H H} tH}w% H5( H8 Ht H}I Ńu" HutC?wHT$1rC?w1HT$Zt$ % $ 1Ht$߉$ 'yHv% H8dD 1 Hq{% H HĨ []HBAVIAUATUSHHwH; Ńu0$ LH=pP :I u1 HuH{L Aău HuI~KLkIt H{! Aut HtE1L;-z% tHv% H5P H8蛦 E111D HyHu% H8_C THkz% H []A\A]A^SHĀHHǵtHTu% H8$C HĀ HHPHH[UHSH H\$H_1t\HH$ H$ Ht$ HeHK t袺Ht% H8B Hc|$ H []SHĀHHtHt% H8XB &HuHĀ HHOHH[AU11ATUSAQ艰yH6t% H8AX[]A\A]A u^1[]A\A]' HcH HHu Y[]A\A] HƉ2AŃuHs% H8A H胰 EHcE1F' HHt*E9~B< Ht#HUJIHF H< 1H0 Hn ZH[]A\A]USHHT$ Ht$H|$1yH>s% H8A 8|$ 胮|$Hw|$HkHHH=(I H1 H[]USHHT$ Ht$H|$ӵyHr% H8@ 8|$ |$Hy |$Hm HHH=H H1& H[]ATHUS AtH BHHuJ Ht1_H! HHu []A\` HDH"H߉Ņt t (Hr% []A\H8? # HHJ H[]A\SHH\$HHuHq% H8? Hr# H[UHSAP tu18Ht' HtZ1[]Ã; tHlq% H8^[]9? YHc[] ATUSHHHHuH~ HHu.UHA 1L & HD$Pj jx H HHt|H;4 ŃtH{$ Ãu v HtOj HuE蠶E1ۉމDI^A<$ tHp% H8H[]A\p> HHc[]A\ H1[]A\ATUSHHH HuH~ HHu5PHA 1LN & HD$Pj j蟁 H HHu1 H;T ŃtH{D Aău Ht HuH{ u o HuD蠱uHo% H8H []A\= Ht% H H []A\WH t>y H{o% H8^J= Ht1ZÉY HHHHuH~ HHu+PA L & 1HD$Pj j膀 H HHtCH?B ǃt Ƹy Hn% H8H< z Ht HcH' 1HHHHHuH~ HHu+PA Lc & 1HD$Pj j H HHtCH? ǃt by H_n% H8H+< Ht HcH 1HHHH5H 1HT$ 1t&|$ yHm% H8; HcD HH(HH5NH 1HT$ 赦 u1`|$ Ht$菫tHm% H8|; &H*D$Y@ H*L$Xf.? zu Hur? H(USV` HxH yH;m% H8Y[]; Hr% H Z[]AWH1HAVHG AUATUSH(HL$LD$ u1 D$H|$D$7 IHt߿@ _HHu 1 A@ HL8 IHZ IV u-Hm% H5.- H814 Lg H} L LIg My1 HO Hjl% H5F H8 H軸4 I~#Hp% H5F H8ל H菸 IcI9|xMcM9|A?~EoELNIHu HI IN?H1HHLL$L4 DLHLHH\$LHH9L DHHH HuKLf |$HH.t H k% H88 H裷H薷Ho% H H肷LJf H([]A\A]A^A_AWH1H5{E AVAUATUSHHT$ 肣 u1M D|$ A @ HcLo? IIHHu H HLDAątPH 8tH(j% H87 H AuHo% H5* H8 br1R HHt~HLAEtaIcHHL9sMHHHD LrA AIHtBHHV Ltd H")d AH"HHHd HH[]A\A]A^A_HE111Ht$ H|$D$D$ 讫tHh% H86 :|$11\ x)|$ 11K xT$ t$H= 1Q |$tѡ|$ tá1HHHHt$ k- t,|$ 辩uHkh% H8H76 HHm% H 1HATUS1D HܡHHu%H%h% } H8t5 H5.) H HDe H[]A\HHHt$ It,|$ zyHg% H8H5 Hl% H 1HHHHt$ t,|$ yHg% H8HK5 H\l% H 1HSHHHuH;Ht$ 诺u# Hֹ H= B .: u1AH{Ht$ztt$|$ yHf% H8H[4 Hk% H H[HHHt$ At,|$ ayHf% H8Hz4 Hk% H 1HHHHt$ t,|$ yyHff% H8H24 HCk% H 1HSHHHuH;Ht$ 觺u# Hֹ H=@ 9 u1AH{Ht$rtt$|$ 莢yHe% H8H[3 Hj% H H[HH1HLD$ HH & 61t&|$ ũyHe% H8R3 Hc HV蝧yHZe% H8Y)3 H:j% H ZHHH5(@ 1HT$ 1t&|$ yHe% H82 HcU HV誝yHd% H8Y2 Hi% H ZHH1HHL$ H? LD$ؽ 1t,t$|$ 胡yHd% H8`2 Hoi% H HWH t{y HXd% H8^'2 Ht1ZHcY HH1HHL$ H%? LD$> 1t,t$|$ 艣yHc% H81 Hh% H HAUATUSHHHuH; Ńu2"Hֹ H=> 6 u * H H{Ht$mtxH{ Ãt+Ll$e ډLI覬LH軺 Hy# Ht1H)c% H80 HtHH[]A\A]a HtH1[]A\A]HH t H|$.t"Hb% H80 'T H1HtT$ t$H= 12 HUSHHHuH;Ht$ a' u$ Hֹ H=t= _5 unH{Ht$ H$& 3tPt$|$ H1E QHHtHH[]Z } tHa% H8/ HtH1[]SHHHuH;Ht$ )u# Hֹ H=< 4 u1WH{Ht$tH{Ht$t؋T$t$|$ [yHXa% H8H[#/ H4f% H H[SHHHuH;Ht$ 蛵u# Hֹ H=2< 4 u1WH{Ht$ftH{Ht$Tt؋T$t$|$ yH`% H8H[. He% H H[H 1L /e% HD$HD$HHPH =& 1LD$ 0Y^1t/T$t$ 赡yHB`% H8. Hc HATUSHHH Ht HiHH~HHHu5HPHA 1L& HD$Pj j?q H HH H;Ht$ גtsHt H{ Ãu4 HtR Dd$ 莤 DH1H uHc_% H8H []A\+- H Hc[]A\ H 1[]A\UHHSH(HuH~ HHu/PA L& 1HD$Pj j`p H HHu1RH?Ht$ # t\$ ֣ Ht$HgH- uH^% H8z, H|$5 H([]ATUSHHH HuH~ HHu2PHA 1L& HD$Pj jo H HHu1mH;Ht$# tH{Ht$R tً\$Ld$ LHHi uH]% H8H []A\+ Hb% H H []A\AUATUHSAPHuY1[1]A\A]+ HsHD(IE HHt E,$H1H+ HHX HZH[]A\A]AUATIUSH L I|$ Hl$ItH H訝H H膠HL{ HIt$8yH\% H8 $D HFHH t= L H []A\A]H\% HH8L S覡 HΔH 1q 1u Hja% H [USWH t/g H͠Hó t H@\% H8Y[] * Ht1p uHa% H Z[]ATIUSH HuI<$+ Ńu+ Hֹ H= 7 . uq^ HugHI|$HtSHH$ H$ HډH$ 虔ŅtN(Hm[% H8=) p t1HĀ HH6HHĀ []A\AWAVAUATUSHHHXHt HiHH~HHHu5HPHA 1L, & HD$0Pj j=l H HH H; AŃtH{ Aƃu 5 Ht & H H{d IHtH LIU Iu Ht$iH H{Ht'Ht*L{ My*HfZ% H5_ H8 /H=^% L=^% H ^% H9tHl$Hu 1 1I9tH\$ LHu1Þ E1MHIDHD)LHD$ HD$Hy]8u#n tHU HdY% H84' M$11HX[]A\A]A^A_AWAVAUATUHHSHxHtLa1|$,IM|$!Lz1҉T$,H~HIHu5IPHA 1Lc& HD$HPj j4j H HH6 H} D$ tH} Aƃu + Ht H H}Z IHtHz LHS Hu2 H HMu HsX% H5l H8 MtPHMHt MIu HH \% Lm MtIu 8L-\% H}(Ht$,HL$HL$uDL-\% LL-\% D$,D$HlH-\% H9tLd$0HL|u 1 E1I9tHl$8LHYu1b DL$IH|$ IDLőLHD$訮 HD$Hy8uk tH H W% H8$ Hx[]A\A]A^A_AT1USH|$ Ld$ ٛ LHH4 y苜8u.Qk t10l$ Hc H=8 HƉ1 HyV% H8I$ H[]A\AWAVAUATUSHHHuH; AŃu2"Hֹ H=x1 .) u H HkH uHW% H5Y H8ц IH Ht$HHHA xz蹚 L4$DDHLHH Hy_8u %j Ņt1FHt$DLD8I*Hy%uHHU% E} H8# HuHHH[]A\A]A^A_ H1[]A\A]A^A_AWAVAUATUHSH(HuH} Aău2"Hֹ H=0 ' u N H H} IHtH LHP Hu HH H}Ht$U L|$Hy($ H?T% H8H([]A\A]A^A_" H1 HD$HHtqLp LLHID轙LHD$` Ht$Hy豙8u wh t H9t'H|$ HS% H8! HO 1HD$H([]A\A]A^A_AWHBAVIAUATUSHH8HwH; AŃu2" LH=. H& u] HO H{Ht$Hk 5 E1I~ H{5 Aău H HD$HHD$ݱ uHS% H5S H8裃 ɳ HH Ht$(H|$ HHA 賮 腗 L|$ DEHL$IL踐LHͩ Hy#8uf AƅtE1Ht$(LD(IHy&EuH R% E,$H8 HuHH8H[]A\A]A^A_ H81[]A\A]A^A_AVAUATUSHHHuH; Aău2"Hֹ H=, $ u H HkHn uHkR% H5 H84 z] HHxmE1Ht$HHHPxS$ L4$DILЙLHu Hy˖8u@e tHt$LHuc Hu)HHH[]A\A]A^ HP% H8w H1[]A\A]A^AV1 AUATUSHH`HH|$Ld$uH; Ńu2"Hֹ H=+ D# u H H{1LO C L q u#HKHz H5 H=8+ k H{Ht$trLt$ǔ HT$ LHt$I0LH Hy*k8u 1d tH|O% H8L Ht HN H Ht1H|$ tL} H`H[]A\A]A^AWHBAVAUIATUSHH8HwH;G Aƃu2" LH=K* ! uQ v HC H{Ht$Hk) E1I~ H{ Aău4 H HD$HHD$艭 uHO% H5O H8O u HH E1Ht$(H|$ HHbx8 Ll$ DEHL$ILLH耥 Hy֓8u b tHt$(L51Hl$(uHM% H8 HLI HuHH8H[]A\A]A^A_z H81[]A\A]A^A_AVAUATUSHHHuH; Ńu0$Hֹ H=( J u1 HuH{Ht$tH{HtL4$Ll$ LLI襘L[ u a t땅u HQ% H "薒HL% H8H[]A\A]A^y H[]A\A]A^AWAVAUATUSHHHuH; Ńu0$Hֹ H=' [ u1 HuH{Ht$"tH{HtH{K Aăt L<$Lt$ Ht` u DLLI蛋LA tЅu HP% H $臑HK% H8H[]A\A]A^A_h H[]A\A]A^A_AUATUSHHH(Ht LaIH~HIHu5IPHA 1L% HD$Pj j\ H HH/ H; IHu Ht H LHaF HuFItH{ ub H 蔐 HJ% H8H([]A\A]u It H{ Aău Ht E1HxH1 HD$HLh Hux b!8u)^ xGHSLD> 1荋HHxHJ% H8 H9t H|$C HD$ HdE 1H([]A\A]AVAUATIUHSHuH} Hcu0$Hֹ H= u1 ' HuHM% HmMt$ L@ I|$ uHI% H_ LH0z 믍C?vH{I% H LH0z H藵 uCIvA 贽 u7I6HE1袽 u%HI% H0 LH05z =L-;L] &LOI HuHH% H8{ HH;^8 HTHHE H*Hu HhM% H []A\A]A^HL% H@ a] ATIH5# USH@H\$HRS H%s A|$( u H5# Hs y H5# Hr yjI|$D[ HHtXHH Hx05C LH= 1D HHt(HH HyC B H6x H 1H@[]A\ATH5" UHSH@H\$HbR H5r H}Z IH HH LxwB H} t@ H5" Hq xiH}IZ IHtXHH Lx0:B HH= 1I HHt(HH Hy B B H;w H 1H@[]A\SHHHJ% HT$Hp f u HY HD$HD$H[AWAVAUIATIUSHH HZ H1HD$ I9~5HIcD H;B} HtHJ% H萑 HD$ HLd$( 1LmHG L fD5 Hc1HD$ HD$HD$HL$HT$Ht$ H\T H H|$IH H@ tL HHu pH I< 1H)H LHHt@ IhHCH= XfE4 HKHE% LH8u H4@ L*@ H []A\A]A^A_SH轊 H( tf H{Ht 1HK? H{Ht 1HS? H{ Ht 1HC ? HCH[H@ PHtH% H@ HxH 襰 HI% H ZQHIH% HHH@ Hy1H= Z6 XQHH% HHH@ H y1H=y Z5 XHP u H= R UHSQHhӍ HHt|H}PHuXHU`H;w}HHFH9u?H=< = v= H=_ H HCHUXH1 HHHH= 1 HHH> HZ[]HGHxu HxTV _ HGHHt HE% H9PtD H H AVAUATUHSH HE% H8 u=HE% H8v u*HB% H8c uHC% H8P HT$Ht$H|$ Ld$L臌 HHt|L G% 1HH= 1 Lt$IHtRH¿ 1H LHh= Mt!HTD% HH81 MtQLD= GMtJL5= @H|$Ht$= Hl$MtL= HtH= HHt:'L< H|$Ht< H< HtHH []A\A]A^< H []A\A]A^ATUSHH HuH+H[HU u' Hֹ H= u HC } y{ x#HPE uy H?E i E @tS @uHA% H5R H8rq ? HKLEHs0uHsHH}0 uH}HL Hc u5Hc u)HCHRH5. HHH3A% H81 I1HL< |$$~#H>B% H57 H8p L Hl$P1HH u L l|$t~(HA% H5 H8}p L H =HL$`HT$Ht$PH<$!L H HĠ Hc[]A\^ HĠ 1[]A\AWHAVAUATUSH1HE H H@ @t H{: H5 H=p IHtwL}11DLHHD$q H|$I4: Mt;H5 L蠞 t>HL: LL9}BLvHL詿 HuH9 L9 H(H5 LO uHH9 L9 HH[]A\A]A^A_ATIHUHSQ HuzHHEH;z@% uET f. v? H;i?% u4HB% Hn8 HHH |HH+9 HtHLH H߉9 []A\AVHA% AUATUHSHH9F LnHH5 Th u E1L5] M~3JtHxIM9}HLHh uIt HH5V Hg )HH5| Hg u{[]A\A]A^[]A\A]A^AWAVAUAATIUSHXHl$HG D$LHD$@ Ht:AL6HE1D$ M9~$JtT$ H u H IHl HHuJEu0HH5 Lg Ãt#HL1 HL Hh7 HX[]A\A]A^A_ATUSH t []A\ H-?% H~HH8V HW RIHtgHH V HU H0LH6 Ht=HHO H6 )Hv[]A\~H;% H5 H8 l []A\ATIUSHH~ # H& H1A H#?% HHW VH5 HHH HEHe u H 6 HH Hu 6 5 AD$ I|$ uW rt"st&at*H:% H5 H8.k pH5B H5< H5- HHe uE H51 Hd t-It$ HtHHH54 []A\d []A\H AWAVAUE1ATUHSHHL6M9 NdH H5 HA|$ HDHod I4$1HY" HH5[ H>d tuIt$ H(" t_ID$HtIH E1HD$L9|$~7HH5P Hc t,ID$ HJt! tII(1H[]A\A]A^A_1UHHH5֥ SHAPc t;Hu H! t&HuHtYHH[H5 ]Wc Z[]UHSHQH6? u;1H} t2HH5 Hc tHu H! Z[]AWHH1AVH T+& AUATUSHXHD$HT$(HT$ HT$HT$H PHD$ PHD$0PHD$@PHD$,PHD$XP1LL$hLD$pzK H0tS=V IHtFH\$Ht L-\<% L9u10 HC u#HPHX8% H5 H81 1? L5i;% Hߋl$ Im IH H HIp HHu L`2 H LHT$HIP L<2 L|$HMu H*2 mHLM LI2 H 2 MtJM9t=1LJ LI1 Mt+uLHc\ HHt H L1 L1 HPLt$St$8LL$HDD$,HL$PHT$`Ht$XMV H HHtHi1 HXH[]A\A]A^A_HG t Ht1 P 1ZUHSHQtH1HH HHtHu HH0 HHZ[]ATIUHSHHu0HM HA u>Hа H5 H=n Q Hֹ H=P $ uyHHc= HHtfHsH;$tH.5% H5 H8e @1; H}Ht$uLM? H5 H8e H;=9% t!Ht$ u1[H|$7 H1H8oHl$HHu Hl4% H8< HtH/ 1V HHtH/ HH[]A\ATUSHHH HtHi1H|$H 1HT$H~HHHu8HPHA 1Lg% HD$Pj j8E H HHu1 H;Ht$ tHt H{6 Au* HtA HD$HX x HDHtH uHS3% H8# H Hc薷 HH|$Ht. H H[]A\ATH V 1USHHH fHnfH:"HpH H)D$ WHl$ HD$0D$HH|$PD$8D$XuH~ HHu5RHA 1L% HD$Pj jC H HHu1 H;H舲 tH{Ht$ H % Net!x\$ |$HI1A$ރt dpH H|$@E~HHt Hd H7A$t uH1% H8 H|$X)r HtNH0 HpH[]A\ATHHH UfHnHT 1SfH:"H`H)D$WHl$HD$ D$8HT$@D$(D$HuH~ HHu/PA L% 1HD$Pj jB H HHu1RH?H. tv H|$0I8xLn yH0% Ht$HH8膵 H H 5% HH/ H`H[]A\AWAVAUE1ATUSHHH HtLiH HS I1fHn1HH|$fH:"HT$`MuLd$0)D$0WHD$@ D$XD$D$HD$huH~ HHu5PHA 1L% HD$Pj jjA H HHu1 H;L tMtcH{Ht# Ńt MIuHN Ht빽 H{HuH{Ht$k u Ht$etIu D|$Lt$lt AH|$PItHLDk LqL覆 t,t8uC t H /% H8 H H 3% HLT HĈ H[]A\A]A^A_AVAUE1ATUSHHHpHtLiH HQ IHD$0 fHn1HD$HfH:"HT$PLd$ )D$ WD$D$8D$XuH~ HHu5PHA 1L% HD$Pj j? H HHu1 H;L( tItBH{Ht 0 ŃtIu*| Ht뻽 H{Ht$ u뢽 Dt$r AH|$@ItHDt GwL t,Ts8uB tGHb-% H82 H H >2% HL諴 HpH[]A\A]A^AT1USHHHpHtHAHe L$0HD$0 fHn1HO HfH:"D$HHl$ )D$ WHT$PD$ D$8D$XuH~ HHu2PHA 1Le% HD$Pj j= H HHu19H;H苬 tIut$ HHH{Ht$ #~ uH襳 HpH[]A\ATUHSHHt$脭 ÅtBLd$ID$HXHe HE HtHIt$ Hǻ 1LL' H[]A\AWAVIAUATUSAPHHxHH9rHIE1d HHu ^& AIE McI9}3IFLLH@hPHHt"HJ4 Hu& 1H Me LH1ZH[]A\A]A^A_AWAVAUATUHSH8Ht$ H$HxHxHH9s E1 Hc IHtHb' HH H*7IH HC tIE t Ld$1$H+% H5y 1H81% j % H$H9, HHP IHA HL|P IH* Ht$(Ls LHt$ ^ Lt$(uL]% HU% HD$ I~ HD$tI~!= nHt5H)% H5M H8Z L% H|$% H$ HD$Iv H= HP 1c LI$ H|$$ Mt\Ht$LH HD$L$ H$ 4L$ H$ 1IHD$H(,Hj$ 1H^$ LV$ HL褡H8L[]A\A]A^A_ATUHHSHHLHMt M`IHxHt H <IAQL% E11HD$Pj j 9 H HtBMtH8 x/H߹ H}) Hct H[]A\8 賸 HtH1[]A\AQHuHHMt Ix tH(% H5$ H8X 9P0t 1 @! 1H) Hcu D HuY 1ZSE1HHLD$HuH;Ht$ u# Hֹ H= c u1FH{Ht${H|$tt$H G^uH$'% H8 H H ,% HH|$Htv" HH[AWAVAUIATUSHXHFH|$ u HHK H5 H=& B '~ yL} IHu; H+ uE1' 1Ht$H pk F H3cIHuA E1LL HHu%1HLHL$} H\$H H|$Ht$ LHLD$ont#1HT$"uH?I97MIH@} H\$Hu8H''% LH5 H81k 1H} H\$Hu 1H|$HD H11H LI HXL[]A\A]A^A_UHSH Ht 1Ht$HH> uH H|$H.dH߉t H[]AUATIUSHQH uCH HHt3H HHt'LH趌 HI MyH 1 H HuHi)% H Z[]A\A]USHQHF t H~H&HHHCH5 HPHG%% H81 H8* t1 WHuHCL HHto H} HG u HPH$% H5 H81蒵 Hu%P HuH#% H5 H8T zHxHu(H-x(% HCH9tLHF u!HPHw$% H5 H81 3H{(Ht蛸 y HHs(HE HZ[]1ٿ UHSHAQʧ tXH{PHt E1LCPq H{hHt 1Hsh] 1HKXHSPHLKhLC`H5 g u1HKhHKPHCPH HChH 1Z[]U1SHHH5 HHD$HT$1f u1:HsHHT$ 1R| HHtHH((% H8 HH HH[]AWAVIH5 AUATUSHLH(HF&% HT$HL$HT$H@ H@H 1HD$HD$1f t$H|$̀ u H"% H5 H8R 1f f^ HD$HtLxE1E1Mu;H!% H5 H8WR H"% H0c DDIM9}@HD$J|H HG @uH^!% LH5 H81Ҳ H9u EtlH"% H5 H8Q H&% H9uEu@AEt9H!% HH0 teu H!% HSH5 H81Y CHHu H`&% H(HT$LHE Ht HT$fHnHfH:"D$@HH|$ H([]A\A]A^A_ATIUHSHc xLHH[]A\ [1]A\HHH5 1HT$- 1t/H|${ H5v HH%% H81@kH$% H HSH1H52 HHT$ u11H|$1 HHt8/u H "% H 5"% \ HHH[ATH1H5 USH HL$HT$q u1uH|$Ht$* HHtH|$H HHtAH$HD$H9H)HH| it L%!% L%"% I$HLl[ Hd[ H H[]A\S1HHH5& HHT$ 1tD$ C0H\#% H H[S1HHH5 t Hc{0[阢 1[S1HHH5 HHT$ f 1tD$ C(H"% H H[S1HHH5 2 t Hc{([4 1[SH1H5v H HL$HT$D$ LD$ u1FcHL$ x H|$Ht$^2 HHt cH)H*^R H [H8HH5X 1HL$HT$ tBHt$H|$I x/H|$Ht$ t |$ -etH % H8 1 H!% H H8SE1H1H5 HHT$LD$ t H|$ yH % H5 H8M 1[ H|$HXu H % HT$H5* H81* ƃuHD % H5 H8-M H# H[HHH5 1HT$ D$ [ t#|$ YtH; % H5B H8L 1 H % H HU1HH4 SH5 HHD$H1LD$ t&H<$11HHu-H{0 t+H 1 H!HHt HH9l$HH[]U1HH4 SH5" HHD$H1LD$p t$H<$15 HHu-H{0 t+Hx 1 H 6 HHt_ HH9l$HH[]SHE1H5 1HHT$ DD$ 1tA|$ t!_ H _Hq ^HZ % H H[HHH5F 1HT$ u1D|$ 蔃tH=+48 Hu H % H HcD$ HHi H\ Hc HAU1ATUHSHH(HL$H $Hu&H % 1IHHL$H5 u^HH= uIHD$H$HD$HT$HuPH % H@ H@8HxHu HQ % H5% H8:J Hw HL$HT$E xH % H9D$u1HD$Ld$Ll$MtLL\, HHtI$1H{IE LkHtV H{LcHtD H{ Hk Ht2 1H([]A\A]H(D$HBHD$HG uH% H5a H8]I 1HWHHwLD$A N H(ATAUHSH, 0 HWbHu.-] H HH= cHyo H; ,\ HHHIH5 1_cLGo AHt b H+ HH HCH s HSH{ H bH t sEHH~ H5x Hr IHtCHPH Hx EbLݨ Hը )HPH0% H5 H81ר H诨 %HVtH% H8 Ha[]A\UHSHHu-HM HA u;H4 H5 H= v2 4Hֹ H= uHt$H HHu1AH4UH;D$tH% H5S{ H8'G HuHɔ uH% H H[]1 ATUS HP =p u G` {` t P1L HDc5 HHt$ H{5 HHtHH1f Dc1 Q []A\USHQ P =p u G` 肺 {` t P1BHߋkd Hu){` kt Q H4 Huk V Z[]ATUS HP =p u G` {` t P1GHDcە HHt$ Hf4 HHtHH1Q Dc1 Q []A\ATUS HP =p u G` l {` t P1G} HDc3 HHt H8 HHtHH1 Dc1 Q []A\Pt$`t$`D$`Pt$`t$`t$`t$`t$`t$`t$`t$`AQEAȉщ1 HhUHHSQo Hu ) #H}HHƑ H߉ tZ[]AVAUATUSHuH-2% HE S I;F~H% H5c H8C IH I蹥 HHu1 IU LLK0 HH I$ HH H, IULL 0 HH I$ HHΙ tH IULLH / 8 HHtTI$ HH葙 tBH Ic}茖 HHt$I$ HHa tH A"AAHAk Hc [H]A\A]A^AWAVAUATUSQHuH-% HE H;F~HU% H5a H8~B s IIȃa Hv HcHH HH IVHL. IHu1 H HH MnMuL-% IE I$H H 譣 HH H 萣 HH IVH ). HL 7 IH_ I$ HHߗ ` L IVHLH 6 IH I$ HH蚗 L MnMuL-"% IE I$ H ͢ HH IVHLb- IH I$ HH# LL=< IVLHL6 IH[ I$ HHۖ \ L IVHLH 5 IH I$ HH薖 L IV LHL5 IH I$ H 迡 HH MnMuh_H 蜡 HH IVHLIHr I$ HH s L MnMuL-z% IE I$X BH ( HH IVH HL4 IH I$ LHw L 1Ic~(j IH I$( HH; L[ Ic~,2 IH I$ HH xxL' Ic~0 IHt[I$H HHӔ xHL Ic~4Α IHt+I$@ HH裔 xL ; - % Lȉ L Hu1 H ZH[]A\A]A^A_AVAUATUSHuL%% I$ H;F~H % H5\ H8= IH8 Id IHuE1 IHLHH I HL踓 H IVHL) HHt^I HL tLH IVHLH r }2 HHt"I HLC tHg HȉQ LI ([L]A\A]A^AVAUATUSHuH-% HE H;F~H> % H5[ H8g< IH` I# HHu1 IHL( IHtWI HH| tEL IVHL( IHt"I HHG tLk LȉU HM m[H]A\A]A^AVAUATUSHuL%% I$ H;F~HB % H5Z H8k; E1:II H8 IH IVHL' HHl I HLo j H InHuH-% HE IX HL9 4 HY IVHLH ( 30 HH I HL H Ic~ HH I( HL辐 H Ic~$赍 HH I HL臐 xrH Ic~(肍 HHtiIH HLX xCH| Ic~,S HHt:I@ HL) xHM < ) *Hȉ3 H# MuE1 L [L]A\A]A^ATUHSH HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ Hj % L@ HtHu L1SH[ HHtNHHHL$LH$ A D$ HD$HD$ D$ 0 HD$7$ HH, HH H[]A\AVE1AUIATUHHSHHL h HP > HH H1H5 =r HH# HxH % H0 uH;% H5 H88 Le(MuHE0Ht+H &I$1HL跷 LA\ Ey H{0HC0Ht@ HE8HtH H{8C@HC8Ht H % HT$HLq LY xVHl$HtDHze t3!4 HI Mt+HLL蓍 L y I] 1 H H[]A\A]A^AWWAAVAAUATMUHSHHA H$L$tAtEE Hڠ mHH<$j IHur Hb L =Hw % HH0s u6Ha IHtH<$Hà L xt HE I,$%H* % H}H0& uEt HE Il$1 H}PtC HD$HT1菸 IHA1Et1u HHf HD$01HD$ D$Ht$D$,HL$H9L$ HEPHL$H= HDHD$J LD$ L$,DH$H|$`y eG [G Ht$0Ht*L H|$0y H|$8Hu% Ht$8Ht HŦ H|$8y { HD$7LLHNxZEt7IT$HH5y#I<$Ht81I $7 L/ Hu-=L HsH fL HtH L I<$Ht 1I$ I|$H1ID$ HH[]A\A]A^A_AWAVAUATUSHLvMuH % H H% HIHH0ڈ uIEHHl 1` HHt1E1N IHu#H. 1< IEJ4H;5% u IM9|;HC HH9F u#HC(H9F(uHC8H9F8uHC0LH9F0HE y>1p IHt/M|$E1IM9~$ID$LJ<znyL 1 H1IL Lm xH $Hu H % HH} tT~H; % u H< HH_ HA$ ExH}~ HHH1H' H HH L HH[]A\A]A^A_S1H H H5 H HD$LD$1 u1PH|$Ht$ xHT$t$1LD$HxH\$Hu H % H HHR H H[AT1 USHHH5 H HD$LD$1' u1 H|$Ht$ xHT$t$LD$H߹ PxHl$HHuH>% Ld$MuH5-% 1)Z H L1Z LH HtH} H H[]A\SHHH uH# % H5 H80 &HFH uH % H5 H80 1l1HHT$H5 C tL$C DIL$ ЈC HCH;W% t&H5% HL$H1H H ) H H[ÄATHk% IUSt HX H IL$H 1 HH H@ u HX H$ H5 H8/ WHkIT$H9}%H$ HH5V H81g H $I$Hs HHH [H]A\Y} [1]A\AT1I U SHHPHHHHu y$ܦ HHc H5g H=E .C H u!HHc H57 H= 1 HLHH|$ tH HPH[]A\AT1I U SHHPHHHH迒 y$& HHb H5 H= 9 .C HZ u!HHb H5 H=Z 11HLHH|$ tHE HPH[]A\H:% A 1Hv H0 1Ř AWAVAUIATUHSHH(HD$HwH .1ҹ HH= uYH} Ht$~ tGL5 % HT$LLd$Ix zO x#11- Hl$HHudHtH E1C HAA H H LH L1I IH M H Mh LHh HHu MxL;c\ H@ WHPH$ H5 HL$H811 H|$ U E1Mx)I9INI9"IB|9 uL9 IB|9 uA H@ u)HPH$ H5 H81譌 LU IwHu L? HSHHHT$f HT$y L H{ IOIw tHC(H$ HHL HCHtHS(H$ | g L;cdHsHtH{(H=$ k IHtH H HtHu Hm H(L[]A\A]A^A_AWAVAUATI1USQQ HtFHH$ L={ L LLL1 HHu uH 1 H;`$ u H} uA H@ u(H H HN$ H5 H8* H{ u#H HW$ HHh# H$HH蠛 HAe E8YHO ZH[]A\A]A^A_SWH@H<$H)D$)D$ P H|$(HHtP5 H@H[SWH@H<$H)D$)D$ S H|$(Ht5 H@[UHSH O u B 1HcHHh HHtHH1H1H o H []AWMAVMAUAATIUH=: SV` HHtY|$H t H$ H$ PH$ Ht$HEMH AWH 1AVq HH H HZH[]A\A]A^A_AVIAUATUHSHH.H}HA/HuH8$ 1H8k2HHH~Hp1Dk@HtH=c _ IHu1 5$ ADLH$ L& H PP1AVL5$ I 蝒 H LI MtLI j LI MtH L Ht H~L襵 HHW []A\A]A^HH> DFHk$ u,Eu'H|$Ht$1H H ' H H H ? 1H@ ɑ HǃHtI 1HAW11AVAUATUSH HT$xHDŽ$ $ Ƅ$ H$ H5ٳ H8a& Ht H$ H5 H8@& 1 HR4 H9GugH Htx x={] ueH=% h 1χ HHtH迧 HAt ExtH.$ H5X~ H8% H5.$ Huo{_ uH$ H5۽ H8% NH >L%$ L|$`1H\$`H LI$ H>& HH HC H1LI$ HD$`& HHH{8 y H k H8 HHD$xu 萄 HH HL$@H$ H5 8 oHD$@H H@H)D$xHy HC81LI$ȍ H HD$`\% HD$H H*HD$@A Hl$Y LH HD$(HD$xHD$ L,H{8My Ht$ H{8HL$(1MH4Z I$ HI] IELHD$Q HL$H9L$ HC81LI$ȍ H HD$`|$ IHw H@ u#H$ H56 H8]# L G 1HL$<LLH5 6 t.HD$`HP u)HB$ HRH5 H81 L HhL| Hu/Hl$HD$T$<Lt$xH)ʼn$ $ HN 9I) I)HzHt$ Hl$k $ E1HT$@E1HJHB HLHD$I$ HL$HD$ H{8HL$H9L$Z HL$Ht$ 1A HgX HHD$([ H|$(Lw HC81LH I$ȍ $ MHD$`" IH H@ u#H$ H5x H8! L' 1HL$<LLH5 4 t.HT$`HB u)HPH$ H5 H81' L 1 HBLHD$( HD$(Hu,I9'Hc$ HD$xL)E1D$<$ 1$ L9~ HD$H{8HL$H9L$uhL=$ 1H , H+V I$ 谋 HIuZ MnL! Ƅ$ I9}H$ H5 H8n c~C81LfH:"D$I$ H )D$`-! H|$H HH $ H|$xfHzHT$XHt$PH|$He ~C81LfH:"D$I$ H )D$` H|$HHT$XHt$PH H|$5 H\H$ OHĘ H[]A\A]A^A_ATUHSH HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ Hs$ L@ HtHu L:9HXO HHtKHHHL$E1H$ LD$ HD$HD$ D$ 0 HD$C HH8 HH H[]A\AVAUIATIUH-$ SHH9uHI} HHI<$rI} H{HH$ H0t\Fs tH>H 1~H IHu HIHu IFLP0HtI] HE I,$1fr tGHLH 1H5 + HHtH@H IE HG H I$HuHGP0HE Im HHE I,$[]A\A]A^AUIATIUSHQH{HtGHHH1LH HH Hu H9$ H8) t I|$[ 1ZH[]A\A]HH5 HH5 sHH5 dH HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ HL$E1D$ HD$H2y HD$ D$ 0 HD$ H PAQE1APE1/HATIUSHHHHt$ <u'{ HuH$ H5 H8 1 ŅtH|$Ht H4$HuH=; 螬 H H)1 HHtID$H H8HpH)~{ HHu H IL$D H L DHu LLL$I9r MtA)AH $Ht II)H9ACRH= HP1 ^_H[]A\HGH@(Hp H8 HG(Hp H8 SHH芰 HtLH8 HT$H< x4HT$HsHtHH=D 1[, HH=Ӯ 1[ H1[AWAVIAUATIUHSH( H H` H}Hv< xtL,$MuI|$ ~k1L%I .LNJ HHtGI;D$}HHL%$ Hd LDH}迷 MHH5z HH $ H81z 11Ht$I9t$~BL IHtHD$HLITo L HD$HpM 1L|$HD$HT$Ht$LLJ t~Ht$L l bHt$uCL HGI9D$~*HEHL$H5ֱ HPH$ H81y HT$Ht$H2o ÅiH<$HtJ H([]A\A]A^A_USHQ> Hu+H5-% 1HHPW HE HHtH] Z[]UHSQ Ht-H}hHHu LJ$ I IHu H 10HUXHMHuH$ H= H1诎 HH HZ[]AUATUSQI tH1$ H5%p H8 >HFHH tH~+HHHCH5 HPH$ H81jx 1W 1H脰 IHtH1H' Ly LmLIIHtMmHL9+ y L" H{J LL" H}(Lk HG u!HPH $ H5# H81w B Hu)lv H)H$ H5 H8 HxHu0H-$ HCH9tLHF u!HPH$ H5 H816w H{hHtz y HHshHE HZ[]A\A]ATIUHSHHHD$HwH .1ҹ HH= urI<$Ht$ t`{H Hl$H$ H5& H8 ={I tH$ H5m H8 H2 xHHH[]A\EH1[]A\SHH H$ H5 H8C I Ht H$ H5}m H8" 1 2 xH+3% H9CuHHEHHuiH@$ Ht$1H H\$H HHtH@ u)HPH$ H5 H81uu H fH{ u H RHH[AUATUSHQHx tHh Ht,HcWXt9HH)1H HtHcWXt#HH)Z1H= []A\A]~ L`(L`I9s H!Ld E1H˾ H'IcH9}HtHPI9rAHHu H!HH)HH HX[]A\A]us H$ SH H56 H8w y1{ HS HB t HB [PHm$ H59 H8v Z AWHBAVAUIATIUSHHXHw IIm !< LH= u_I} Aăupr HtBE1{ H$ H5 H8 !CD$t H$ H5 H8w 1 H4 H9CutH Ht!x xGHE {] uqH=X { 1Hs IHtH LA ExtH[$ H5j H8 xH5X$ H Hu_AtAA E H$ A A 1DH5. H81tr L%$ HI$H #j uH= z H Ht$81H I$ H\$8 HH\ L-m$ HIH i k uH=X Kz X Ld$81I H LH\$8 HH' @ H{xE1LSxHt+ H E1L HtE1L HC8Ht1I 1LHD$8H = HH H{ 11A Hy I0 { HI MH{0 t3IH Lh ƅy Ln bHuLD L5$ 1HIH ]h u H$ HH5< H81fp HD$81I H HH\$8HD$G HH H IH Ld$ HE1 Lf LP HD$(L|$ Lcl$0H$LHD$@D$4L|$8Dl$HD$D$L\ H8 ~C 1LHD$I0 H fH:")D$ H|$I M L H{x1HsxHt H 1H Ht1H H{8Hu~ $f~L$Eu4 Ht$y L$H{ H 1I x IHX H@ u)HPH$ H5 H81n LE " t$1LH= K H H H Ht |$ t H $ H S$ H{8E1L1I HIG H{xLcxHt 1H{xH = L9}H $ H5 H8 iL 6t$1HI H= 腃 HtBH H HtH H{0 t0Mu1|$ D$t$Hy H HXH[]A\A]A^A_USHQHGH;$ t H;$ u H{1 t'H[H; H ;$ HH HH HZ[]AWMAVAAUIHATIUSLARÜ HtLH賌 IHuHc A^Ht"H萜 HHuL@ H8 LMIDLH}AHtH L H ZD[]A\A]A^A_ATIUSHH HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ Ht$D$ HD$H=I HD$ D$ 0 HD$ HHt] E1E1HH Ly/Lt tE HH1H5#| j H H 1 C@ H []A\AWMAVAAUIHATUSHH LL$t:)D$`)L$p)$ )$ )$ )$ )$ )$ 譊 AHH HtH萚 HH H$ H|$Ht$D$0 HD$ HD$0D$ 0 HD$(n IHuAG; HHtPLIEj HLj AW H LI MtLE1 HtH H H D[]A\A]A^A_UHSAS HtWHH IHu Hc :HU@HuHyAZHH1[H={ ]<m AYHH=o [1]'m Z1[]þ AWAVAUATUSHH$ H@ Hu H=ϣ 11H5' H y1 HHtHE Lp(I~ I Mn(M MeMtrLK IHuMd$I$ O3 HHtOL蟙 IHu HO 5HHH" HD$ 3 L+ D$ y Mm sH1 I~ ņ HH[]A\A]A^A_AW1H5C AVAUATUSQH$ H@ 1Hr y1 Ҙ HHtHE Lp(I~ 4 Mn(M M}MtqIG8HhHt^}Et"HU Hc HH H9E8sHm0I 2 IHtIHU(Ht(HLa! L x'MMm tH́ HHuL H1 I~ 虅 ZH[]A\A]A^A_U SHQHHQ HC8H{HHhHk8\ Hu<{@ t6HR$ HSH8 HHT HHt ZHH[]; X[]SHHHt Hxf} HCH[H@ AUAATIHUHSQQHuEt8.} LY Hu*$HH8xLY Hu H1HhZ[]A\A]SE1HH "& HHH HHD$ DD$ L)P1LL$ AYAZ1tT$Ht$H<H[HH=$ 1%SHTu HU HHxH=$ 1[1[H$ H@ 7d SHd H߾ [e AWH AVAUATUH-j SH HDHA|$,Ht$8HT$HL$LD$ H u H3$ HH51 H81d H|$L4 HD$PH H,$ HH5 H81d rH|$ d) u H$ HH5 H81ud GH|$Ht$PӦIHt0H 8 u0H$ HH5 H819d Ht$PL5KE1( H|$ Ht$H6HD$HtH H; #$ 11謅 IH H5 Ha HH H|$`E1I@AE t4H$ H8詟 HA J H$ / HI$ HUHE tL9 HEJ L9 J\HCH tH{ uHl$ H5 H85 H{ Hua Hp H H HN H$0 HL$@L$ HHT$XPH5ݝ HD$LP1L$ ZY2 H$ L^s H$ uAD$0 L$DHW H|$`t$@dAE Hy$ H8I H$ 1HT$XHH$0 H5v $0 H|$`@AE eN1HT$XH$ HL$0 H5a < t\$0 $ H|$`AE H$ H8蕝 'H$ H5M H8 HH\$` &H H H|$`b1 E11AH$0 IA$tHJ$ H8 H$ tBH$ ]v ƃt H$0 dA$t _ Ht 1탼$ tH$ t@̀H$ t@L$ H$ LM H$0 LHKA$\ H$ L$0 t?H$ H$ Ht$0M6 Ht$0LH) A$ H$ H$ 1H$ HT$XH5ț K HD$DH$ H|$8HHD$02 H|$XH$0 H;=$ HD$8t0t ƃtH|$8H A$tj(^ HtmHt$0H|$8HnA$uCL<A$u1HD$LD$ H5H H=u HL$HP81\ y# H$$ H8 H$0 w xHD$|$, MLLL$HH$ Hp tjt#A$HD$Hp8H$ H8cQ Hu7=Hc$ P HHt,H "Ht-H1n !HtH_ 1HH$0 LIHt$HH|$ EHt$PLEHtH HĈ L[]A\A]A^A_AWIHAVAUATU1SH H|$HtHiH H HHD$0 fHnH]Ld$ 1fH:"HHT$P)D$ WD$HD$8D$XuH~ HMu5PLA 1Lo% HD$xPj j H IHu1F I?LjK tIGHD$IGHD$H MoMt HH Io Ht H I(Ht&5r Aƃt Hu ~[ HtxE1I0Ht"r tHumP[ HtJ1I8HtHtVIG@Ht1HtJIwHD1111E11E121111E11#1111E11111 11111VMPW RLAVULD$@HL$8Ht$HH0HLwQ H H[]A\A]A^A_AWIHAVAUATU1SH H|$HtHiH H HHD$0 fHnH]Ld$ 1fH:"HHT$P)D$ WD$HD$8D$XuH~ HMu5PLA 1Lm% HD$xPj j H IHu1C I?LEI tIGHD$IGHD$H MoMt HH Io Ht H I(Ht&p Aƃt Hu YY HtxE1I0Ht"o tHum+Y HtJ1I8HtHtVIG@Ht1HtJIwHD1111E11E121111E11#1111E11111 11111VMPW1RLAVULD$@HL$8Ht$HH0HLUO H H[]A\A]A^A_AVH1H= AUATUHH5 S x\1E1L5uF({ HHuAIL;e}:NlL(E tIEH HtHLLЅtH 1H[]A\A]A^AWH1H= AVAUATIH5O USQI 1z HHtHC$ H@ LpI I Lm L9tKIEM}H M9tL9uMm LH5<LЅtLHLi yH HL9u1ZH[]A\A]A^A_AVAUIATAUS x Ht8A H D$ HHE1H5K H=; ^ y#H 8uV u LDI1bLh xH\ 1H $ 藤 y*H$ 1HH8Ɠ H w[]A\A]A^USQHt?w HHu "n 1H12b HH HZ[]AWI1WAVAAUATUSH8L%v$ 4$HL$HT$ DD$ I$@ Ht$(HC`HD$(HChC`HD$ HCpH{pHHD$a Hc<$;I HD$Hu111Hӱ 2H|$ HI$ IK t111H觱 L 1Ht$x HcH HD$Hu111Ht Ll$LMuHH$ Hl$ I$ HK t111H9 MtL蜿 1HL$Ex IchH HD$Hu111H Lt$LMuH$ I$ H K t111Hʰ MtL- 1҃|$ HT$x"Hc|$ G HD$Hu111H荰 Ll$LMuHa$ I$H HJ t111HW MtL躾 1HD$Mt|LI$x HkJ t111H 4$1L_ HD$IHt/HI$ H,J t111Hگ LB 111H¯ H#$ Ll$(L;( HD$M$ HHLH$ xIH|$Hu8H HD$IHt*HLHI t111HK L賽 111H3 I0 H$HL- x'H|$Htz $H$ LH6I t111H HL$H8HLH[]A\A]A^A_î AUATUSQH$ L@ HuAHHs IHt!ىHA ZL[]A\A] 111La Aى1X[]A\A]AUHH5 SHQHG@Lt!H5! tH5b H3 HDHX$ H8 E,U$M(u H;D@nKH1Z[]AVAUIATIUS1ID$8H;X}eH@LH,H}F uHH}8I H}0I= H}(I1 H} H% I|$pSDEFH?HH&$ H5 H8 [1]A\A]A^AWAVAUATUSHH(HuH{Ht$L+謄 u'D Hֹ H=0 ڒ u" HKHA u H4; H5n H=0 v HH IH HRH;$tH$ H5r$ H8F 1Lt$LHl$HD$LD$H LH H5K0 HD$ IHtoH5Z LH\$t^H5I LtSH5 I LA nt@H $ H5 H8 H, HtH 1 A A t IHtLIDHL)u IHtHH< IHuLfi H边 Hu똋D$A E LHLd LI L.i H膹 HtHy MQI^LH1' H(H[]A\A]A^A_ATUHHSH HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ Ht$D$ HD$HD$ D$ 0 HD$ HHtZHE8HU E1E1L%y$ Hދ I<$y3I<$W te Hp HH1TX H\ 1 HP H []A\1a E1Pb A1]ATPHI HHc Hc HIPHޚ PHԾ$ H01r HATAUHHS HHtLAHH L% LDe[ HcS LcK,HLcC(HcK$PHr$ ATH01 HXZL HtE` H[]A\UH1H SHHHH$ H 1W HH H@ u HPH$ H5y H81?M 31111D$H$Hl$HL$ HL$HL$(n HD$8Hu1$HN H|$8H衶 H|$(Ht HH臶 HHH[]SW1H@H<$1D$)D$)D$ jn HD$8HHt$H H|$8H8 H|$(Hti H@H[ATUHSH Hcu"Ld$0ID$H= wLu HHuHĐ H[]A\MHL HWHH HH HĐ H[]A\USHWHF u HH5 H5:N H= .~ y H$ HH@ i y HF u1 u H$ H YHH[]Rs Z[]AUHBATIUSHHHwL+Hk I~=! LH= W u1gH{v` ƃu I HuL# fHnHfH:"HtHJ$ H1)$H H HHX HH[]A\A]AUI1ATH5> UHSHH= > HH xoHT$1 IHL,$HD$@L\$8fHnHD$(H$@ fH:"D$>$ u"HLd H|$0HtPz L+HH []A\A]AUIATIUHSWH=͖ HuH$ H5 H8 HH1H5Z H= y1 HHHLL HH ZH[]A\A]AUATUSQLgHuH$ H5 H8^ ,HFH u$HPHi$ H5 H81I L-0$ HIH1LH5J H=J @ xH5$ Hm t La u1 u A$ t H$ H5[ H81H |LHL fHK I$ tH} t [ A tH H]sL 1Z[]A\A]UHSAPHtiH;5>$ Ht]HF uHE$ H5 H8 &IHH e 1H5I H=I * yN1 H-1H Re HH5t! H=` x11ۉ H}@H]@Ht% 1Z[]AWAVAUATUSHHL=ҹ$ Ht$1H|$HT$ t$<I@ H$ H98t 1E1HL$THIȝ wf HHtH;0$ tIȉ IHu] 1HT$Hh HD$HtHIx #f HHt6 HHu] L5*Y 10H@L5Y t Hbh IHu U] L5X I He IHtH IHu,"] j L X HH HtmHͯ cH@ tLg Hu(\ Gj L xX HHuGHt#H苯 HD$( j LL$(HHu!Lh Mu LS PM SHD$LPt$8HT$(Ht$8H|$0IO H IHtH MtL MtL MuH^ \$< u\ dIXn b HHu Hb^ ZD LD$ LIHt$HH HH2^ H&H1 y HH[]A\A]A^A_SDu C x [ATIUHHSxd Hu B HHLHH߉ []A\1AWIAVAUATUSH(H H|$Ld$HD$HtIH $ L@ Hx HL_c Hu'H= s HIH MtL胭 H LH!c Hu'H=א s HHH HtHE E1H|$LLÃuAFB Ht<H$ H8L ŅtAmAu-Z A |w t1A1H([]A\A]A^A_ATIUHHSb Hu gA HHLHH߉芬 []A\1AVIAUAATIHUSb Ht HLLDH*D H߉@ []A\A]A^111AUIATAUHSAQHt HMb HHu @ *AX1[]A\A]GA HLDH6A H߉̫ Z[]A\A]111H1AWEAVMAUIATAUHHSARa HHt,QHHEt$HMLDJ HH_ H^_ZH[]A\A]A^A_HE1j HHj |HHAQE1iHUSHQHu,H HA u;HR H5I, H=e ? XHֹ H=J T u9H H{HjV Ãt"1H5 HH= 9 y1G? HtH;ÅtH߮$ H8| x uH$ H Z[]AWH AVAUL- ATfInE1UfH:"HSHH HtLaH:~ 1)D$@HWD$hLt$@HD$PHT$pD$ D$XD$xuH~ HHu8PHA 1LR% HHD$ Pj jt H HHu1 H;L. tH{Ht$FtH{Ht$EtIIu 0H{HuH{ \` ŅyHt$ j tIuɋ\$ T$hLD|$Dd$1 bt$hL1 LAEDDEHT$xH53 H=1 I |$hIŃtDDWH|$`Au EtDD3uEt EHDAD DD\L tH$ Ht$xH8*1 H H f$ HL3 HĘ H[]A\A]A^A_AWHT E1AVL5X AUfInfInIATfH:"Hg UfH:"SHH HtLyH{ 11)D$pHWHt$PLd$pH$ Hl$ DŽ$ H$ HD$0 D$H$ $ )L$ D$8D$XuI~ IHu8PHA 1LW% LHD$Pj jƼ H HHu1 H;LX+ tH{HH+ tMItH{] Åy $ L/ uHL$XH$ H5 H= x $ Ht$@IŅx /Hc H$ t 9HcHcL Ht H$ H$ H8/ H H T$ HL1 H1 H H[]A\A]A^A_AUATUSHHHHuH~ HHu5PHA 1LKW% HD$Pj j\ H HHu1 H;Q ŃtH{Q Ãu S: HtG: HuA1ىH5] H=^ yZ8u, uw I{LA EuHJ$ H8H[]A\A]w H!$ H H[]A\A]AVAUATUSHHH HuH~ HHu5PHA 1LM% HD$Pj jA H HHu1 H;O ŃtH{Ht$u69 HtH{HtD4$Dl$A1H5 H=s ED x\ DDI,L t3 8uϼ tQH$ H8H []A\A]A^u H$ H H []A\A]A^AUH ATUSHHH fHn1fH:"HxH)D$ WHl$ HD$0 D$HHT$PD$8D$XuH~ HHu5PHA 1LL% HD$Pj jø H HHu1 H;HU' tH{Ht$tH{HtD,$\$A1HT$XH5 H= E x H|$@DIyL? yH$ Ht$XH8W+ H H $ HH . HxH[]A\A]H AWfHnAVH8 IAU(E1ATfH:"H( UfH:"SHH HtLiW11HDŽ$ Hl$0L$ HDŽ$ H$ HD$@ D$XHt$`D$$)$ $ $ )L$0D$HD$huI~ IHu8PHA 1L\N% LHD$Pj j H HHu1 H;L|% tH{Hl% tMMIu MH{HtHt$ tMItH{HuH{ W ÅyH tIuH$ D<$Dt$tH|$H uH$ t#H|$P tHr$ H5t H8 0AAHL$hH$ EH5? H= EEAEE1 h AHL$PH$ Iu Aut AHDD HL t!H$ HT$hH$ H8r H H Ш$ HL=+ H5+ H H[]A\A]A^A_H AVE1AUfHnHc IAT(UfH:"HW SfH:"HH HtLqW11HDŽ$ Hl$0L$ HDŽ$ H$ HD$@ D$XHt$`D$ )$ $ $ )L$0D$HD$huI~ IHu8PHA 1LM% LHD$Pj j! H HHu1= H;L" tH{H" tMIu9\$ AHL$hH5' H$ H= DE1s y7H{HuH{Ht$ uxT kIuH$ tH|$H uH$ t#H|$P tH#$ H5 r H8 " HT$PH$ It HL t!H$ HT$hH$ H8o H H \$ HL( H( H H[]A\A]A^AUH= H= ATfHnUfH:"1SHHhH)D$WLd$HD$ D$8HD$@D$(D$HuH;L u Hֹ s u HkHEH uH$ H5p H8x H HD$HH$ H5p H8K Ht$HtHHtH Ll$8 u#Hu$ H5p H8 LHOL$ HT$H1HH5i H=B x H|$0H Hݟ$ H8m LHL*' Hh1[]A\A]AVH AUATUSHHH~ fHn1fH:"HĀH@o H)D$0WLl$0HD$@D$XHT$`D$HD$huH~ HHu2PHA 1LvN% HD$ Pj j臰 H HHQ H;L > LcLsID$H uH$ H5o H8 L HD$HH$ H5o H8 L* uH$ H5o H8` Ht$LrHH H 8 uH$ H5o H8$ oHt$LsHHtZHT$h1MLH5y H=R} - x)|$XHHޅx H|$PH|$h"AHt$HHt$HL % H1[]A\A]A^UH1HSH| HHL$LD$ u1XH\$l$1H5} H=| Hى xՉމuH@$ H8k ٱ uH$ H H[]UH1HSHr| HHL$ LD$ u1Ml$\$ 1H5j7 H=I| x*uH$ H8j H$ H H[]AUATIUSHHuI<$C Ãu0$Hֹ H={ fo u1 , HuI|$wC Ńu , HuI|$Ht$*tLl$1H5{ H={ M" x LILP yH͛$ H8H[]A\A]i H$ H H[]A\A]AUH1ATUHH5 SH={ AP y1WJ8u- ug HILA EuH9$ H8Y[]A\A]i H$ H Z[]A\A]UHSHHuH} 8B Ãu+ Hֹ H=wz m u.k+ Hu$H}Ht$(tHt$H[]H1[]SHHHHuH~ HHu,ARA LM% 1HD$Pj jɫ H HHtCH?Ht$0_ t2\$1H5y H=J Q xH5F$ H[ H1[AUHHATUSHHtHYH$H H$HxHHHu2HPE1LCh% 1HD$Pj j H HHu1 Hu4H˝$ H $H5wQ H=y L@ H1Me yH?HK{ u1L HHtHteH~"Hk$ Hj LH01 fHyHD$ Hj LH0J FHHHkI t8)I$ I HHu HI9u H HH[]A\A]AWIAVIAUATUSHHHvHt HjHL} L~HIv.PLA 1L% HD$ Pj j蝩 H IHt1M2H5$ I~ u"HVLH5*9 H= г E1G IJHA u H H5w H= 蝳 MH $ MbMtIIu IMjMt IHuIIj I9t)ID$ uHu$ H5Vi H8> YI9t1IE u$HH$ H5Qi H8 ,HIIHUAF\ uDH9u$tH $ H5v H8 H9t#H$ H5i H8 HcH9u E1 LEI9t,Hߖ$ IVxH5i H8HH1[]A\A]A^A_D( 1MtFI9~AHTHRH;$ t*Hg$ HRH5h H8HH1[]A\A]A^A_' H1LH5n HL$H=u : Ht$L1C IHI9tI$Hx L` Q I9tIE Mn8H9t HE InHHII94HHL[]A\A]A^A_AWAVAUATIHUSHXH$ H9t!H( H9( tIt$HFHw 8HtH=6 - u H=6 .h I|$L< $u% Hu I|$ -< D$u% HU I|$( < D$ u`% H5 I|$0; D$(u@% H I|$8; D$,u % H I|$@; D$@u % H Mt$HIF u"LH9B H5/t H=5 ID$PHD$H@ u$HL$HD H5s H=h5 ͯ f Il$XHE u"HHD H5s H=45 虯 2 ID$`HD$H@ u$HL$HsD H5s H=4 ^ IL$hHA u H H5s H=4 - y y;ID$hIL$pHD$0HA u0H H5Ls H=4 H菗 ut y y;ID$pIL$xHD$8HA u0HX H5s H=54 蚮 3 H= u" y y!ID$xI$ HD$H9 D$Du!H u # H I$ HD$ H@ u$HL$ H6@ H5}r H=3 M$ IG u"LH? H5Rr H=i3 έ g ID$H~tI$ HS u"HHB H5 r H='3 茭 % Ht>M$ IE u,LHdB H5q H=2 O E11E1PD$HLH5E H=E PD$<PD$@PD$,PD$0PDL$01LD$hHL$`O H0 <$ yHN$ H5c H8 p |$ yH,$ H5c H8 N |$ yH $ H5c H8 , |$( yH$ H5c H8 Ho-HH H|$Y-IHu Hދ Ht H7-H HHuH貋 L誋 Mt L-I I1MtOAWt$(D$TPt$`t$Xt$XAUSATUt$`AVD$ D$ $ T$lt$h|$`)! H`HH$) L! H MH$tL H$1HX[]A\A]A^A_ATHw USHHHn fHn1fH:"HpH_ H)D$ WHl$ HD$0D$HHT$PD$8D$XuH~ HHu5PHA 1L@% HD$Pj jO H HHu1 H;H tH{Ht$ t؋|$HH\$t HHgHT$X1HH5BQ H=n 裿 xz H|$@HI:L yHM$ Ht$XH8 H H $$ HH HpH[]A\AVAUATUHSHHL%D$ M$@ LFHwI9t IP`Hu#HF`H HH9PX HH9BXuHV`Hu$LHH,$I$Xv H\$ H H9BXuL uA MM$Xv HLL!6 1 tLHLH,$H\$N H;7$ Hu]蝈 E1LHH $I$m Hl$ H;$ Hu-HCH9Eu H=$ Z E,Hڍ$ H HH[]A\A]A^AVAUATUHSHHL%$ M$@ LFHwI9t IP`Hu#HF`H HH9P` HH9B`uHV`Hu$LHH,$I$x H\$I H H9B`uL uA MM$x HLL4 1 tLHLH,$H\$ H;$ Hu]= E1LHH $I$Px Hl$ H;$ Hu-HCH9Eu H=$ E,Hz$ H HH[]A\A]A^HI SG uH4$ H5^ H8 'HHu9J tH $ H5^ H8 1@H;5$ tHuHsC GJ11蚎 H{HHu C [1kH11j H1 USAP uH$ H5y^ H8q dHH#Y H} HtH}HY[] Ht>H6$ H9Cu1HEH@J E 豅 H"$ H5/ H8 1<H$ H8$ t2 HЉ$ H8@ H$ H8$ uHZ[]S uH$ H5?] H8觺 1&HHWX H{HL~Hu C [H2X USH(G HouHa$ H5R] H8J }K H~ H $ G H8艓 1 0 }J t4H$ H{ G H8uH5%] H5O] 뷀}I tHۈ$ G H8$ H;5Í$ tH$ H5+* H8裹 uG EJHHu.H$ EIH1E11H}W HH 1 H5O HD$HD$R HD$P1LL$LD$(W Y^LD$HL$1HHT$W H{H|HH p11H讋 H{ HtHCH(H[]H|Ht@H$ H9G 4 HCH51- @J H$ C H8 QHC@J Hs$ C H8\" t$H{ $0 H)$ H8虑 HE$ H8%" uH(H[]H5$ USPD$ u |$8u1H$ Hl$0H\$(H8tHHھ A qH=U[ juAWAVAUATUH-R SHhH $ LP HH Lu@ LS 1H|$ fHnH fH:"D$ 6 LIp L AŅuMt;LL6 t,DH|$ fHnH~f fH:"D$M E1H|$ DLd$H@ Hu H=' ou H HELh(Ax xcIh H 6 HEHxp]y3DH|$ H H)Z fHnfH:"D$ HLp H=H7 tBH=?7 \y21H|$ H He fHnfH:"D$P =7 ~*& H=7 I1 Բ7 L-5$ H&$ 17 1L<7 t# 27 HK7 H HH9up& Ht$81Ht$HCPN H{ [H{@A[H A[Ht$1A^ HC0HxH[D xE y21H|$ H\Q HX fHnfH:"D$; 1ҹ L1H8 #4 IHt8HC0I9Et.H|$ ~! HEd fH:"D$ H{ 0 1Lc(HS(MtXL9c0u 1I$Lc(FL貯I|$Ht X I|$HHtǴ A|$X M4$uLs$ MH{ E3 H{( u+1H|$ ~B! Hc fH:"D$/LH8 $3 HE1H Hh[]A\A]A^A_t D$ H (L$0(T$@ $T$jUSHH$ D$ H@ H@0H9BtHF$ H5_W H8/ 11H=c ] y1\ H|$ 111耼ÅuE> uH$ H8O l$ Hc< H=b HƉ1i) H[]AWAVAUATUSH(HG HNH9tH$ H5V H8聲 H$ LvH-r$ L90t?HF L%$ L~(Ln0HD$I$@ I$ x2 HHtH9uLI9uHE HHE H^ H5 b L HHu1@ H9uHx| HE HH HH=a M< 1HD$I9t HT$I$ L Ll$Mu " H= H1,- IHt0L H; Ly{ H{ O{ ( HH=Qa ; xQHH=K ; x>HT$LLH(sI$ Ht$1H H\$ӱ HHu Hc{ Y{ HQ{ HE HH([]A\A]A^A_AVAUIATIUSHH/H=` y~DsLHLtDss x{HxL-\ HL: x{HxHL: x{HˈxHL: []A\A]A^ATUS HP =p u G` $ {` t P1G} HDc艞 HHt HA HHtHH1dw Dc1 Q []A\C` IDc> G` # {` ?> 1> 1y> AWIAVAUATUSH( P =p u G` ,# A` tA P1[ AGLD$t` HD$H) A PA =p u AG` " A` Ew蘶 IH Eo`E 1۽ L+ HuEwIw H+ HHugGL_ HHtH9u%HLHT$H4 HT$HtIIEwHL譹 AG` " A :IcH9~I4HUAH4Lv Ht$HLA ? D$AG1A QA H([]A\A]A^A_G` ! {` -= 1w= C` IDc= 1T= HE1߸ C` C! 4> H轸 C` !! > E1> E1C` = A 싃 E1= G` D= C` E1 = ATUS HP =p u G` {` t P1CHDc] HHt H {` HuHH1s Dc1 Q []A\AWIAVAUATUSH( P =p u G` A` tA P1[ AGLD$HD$H) A PA =p u AG` A` Ew[ IH Eo`E 1۽ L HuEwIw H( HHugGL{HHtH9u%HLHT$H4 HT$HtIIEwHLp AG` A :IcH9~I4HUAH4L9 Ht$HLA D$AG1A QA H([]A\A]A^A_AUATUSHAR P =p u G` 9 {` t 1 BDc p uC` {` uWX HDk茘 HHuF{` Dku4Z Hm HHu'{` DkuY HN HHu z Hȉ # HtZLcH Lc@ HEHcMHcUH PHV PHz$ HH019 AXAYHH H 1 {` DcufH HHtL H蝗 IHt7H]Z Ht*H0 Ht McM McE H HcM$HcU W`{` Dct 1ɍPx1HH5xbV tQHY HHtA H Ht/LcH Lc@ HL HcM$HcU V C` PDc P HZ[]A\A]G` ȿ HL IT$AH H~ C` M9t#JT DcI鲿 E1 MHHT$J4 D HT$HIuPH C` s 駿 C` E1V 銿 E1y H` E1( H覲 C` C` E1 E1ؿ G` H HE C` 饿 USHQ P =p u G` s {` t P1BHߋke Hu){` kt Q Hϔ Huk V Z[]LHE1薱 C` D: G` 8 E1": C` E1 : E19 H$ C` 9 ATUS HP =p u G` Q {` t P1CHDc# HHt H{` HuHH1l Dc1 Q []A\AWIAVAUATUSH( P =p u G` A` tA P1[ AGLD$HD$H) A PA =p u AG` b A` Ew) IH Eo`E 1۽ L輒 HuEwIw HW! HHugGL{HHtH9u%HLHT$H4 HT$HtIIEwHL> AG` A :IcH9~I4HUAH4L Ht$HLA D$AG1A QA H([]A\A]A^A_ATUS HP =p u G` {` 8 HDc萑 {` d Hy HH HHtv HS Htd HA HtR1 Hm t?Hq$ MH G HH01 HH H 1 {` Dct 1ɍP 8 HÐ {` d H謐 HH H蓐 H HHts Hp {` u` H] HtN HK Ht< H9 Ht*1 He t C` PDc P H[]A\ATUS HP =p u G` ! {` z HDc規 H H萏 {` HNR HH He H H HtvH[{` uh H4 HtVHcM$HcU PHHDE IIPHq$ H01L Z^HH H} 1 {` Dc z H辎 Ht@ H謎 {` u-HnQ Ht H\Z{` u H~ Hu.{` Dcu:z Hb Ht HP Ht H {` Dct 1ɍP z H H H H P =p u C` 7 {` u0 Hߋk Hu#{` ku H覍 Hu H HC ȉ H%p$ HH01 HHu u C` PDch P H[]A\ATUS HP =p u G` h {` 8 HDc {` H HtzHy, Htm H跌 Ht[HE HtN H蘌 Ht<H4o$ H HH01 HH 7 H 1 {` Dct 1ɍP 8 H0 {` H HH H+ H H H HD Htt H̋ Htb H躋 HtP1 H t=Hcl$ MHB HH01 HHu C` PDc P H[]A\ATUS HP =p u G` | {` u{ HDc Ht[H HtN H Ht<Hm$ H+ HH01F HH H 1 {` Dct 1ɍP H~ HH H Htt HX Htb HF HtP1 Hr t=Hj$ MH@ HH01 HHu I C` PDc< P H[]A\USHR P =p u G` {` uN Hߋk蓉 Ht6Hֹ {` u( Hs HtH=Τ; uH1zb k ȉ X[]AWAVAUATUSHH P =p u G` p {` u! k= IHu C` I 1P Dk`EuE1A H} HHt9M9u(MLHT$J4 HT$HHt&IKkI뷉kHs L HHu LO C` P*IcL9}I4HMAH4L P HH[]A\A]A^A_A A~` LHA HtC间 H赤 AF` A P) HE1莤 A P 韴 A 鐴 A PA =p z LJ IHt2 L5 Ht LI HtLRA~` A A Ef鯲 Hu3A Hţ AF` ( A P9 A AF` 鷳 A 騳 AF` A~` $fA AF` t PE1Գ AF` E1 A P鵳 A E1P飳 G` w A AF` V W L H L΅ H1 L Hof$ AMH< LH01 HHtA B C HZA AF` ML; AG` A Pɵ Hu A Y A J A AG` 3 L1֡ A Pq A` LHA Ho } A PA =p z LEwt IHt L4G HtL"PA` A` EwuPz L4 IHt; L Ht) L Ht1 L9 A A Ao鰲 A AG` A AG` A` A ˳ A 鼳 AG` P1 AG` 1 A Pٳ } L- H L H1 L? Hc$ AMH%: LH01X HH A 鎲 HusA L艟 AG` A P A 1P G` 醰 A 鏲 A 進 A AG` i H'A AG` Hrf$ H@ IH_f$ H@ Hx HPb$ AVAUATUSx tDAII H=v7 LLDn/ H=v7 []A\A]A^Ha$ z t5UH SPH=uv7 H H=_v7 Z1[]øAP9Ht H1YH0f$ H Zþ8 H= & fHH% H H % H9uH HDlHH @ ATUSHH Eu"Hia$ 8t)=g$ t^=g$ H HE[]A\; DL$ HL$HT$H4$cDL$ H$HLD$HL$H H[]A\}e DL$ HL$HT$H4$7 DL$ HL$HT$H4$dg$ l H HEH錛ff. SHנH H H H1tiHt/H ( tH ( [ OHH9 f D ( ' H~ ( T ( ԹT ( HwH9i[Ë ( D HI% H" H % H9u1HHf H HH% H) H ҍ% H9uH HD\HHHHҸ HHEH9f H7 6HD$HD$Hf. HtYH3333333H(u&H9HK% HT H9uHt;H1HH % HHHH % H H9u۾ HHHt Ht雥 ff. @ HATUSHPH9HAHrHH}E HEH` H9? qd$ V H I ~H% ?HL@L9 HH HHPH HHqHHE A AA H A HHrHHHHuDu'uHH HPH[]A\ HfGt @ HtP(9P,sH@I@L@;HHpP(1H HHHt$ Ht$HHH HHH >H UH1HD$ DHD$ HL$(HL$0HL$8HL$@HL$HHH H=H3HHT$HD$b$ H t#gHt[ATLfUHSH7H=s HK K1THHH HuLHL[H}HE(]A\ff. @ AWAVIAUIATUSH H H7H= HLe ]1THHH HuHL9IMEIH @ LHP LHT LL$@ HLH HLLI~AV HILDLE1MD$LATHHHuAAD$ AD$ AD$HK(H @ HCLLI9IF͉L9r6MaL9sLH)LHHĈ L[]A\A]A^A_LI Ht$@H)@ HH9HGȉHĈ H1[]A\A]A^A_LHHٸKLI9HLLIF͉Uff. USHHHj@8-z]zSzIz?z5z+z!RGHH WHH GHH WHH GHH WHH GHH Ѐ<|||||{|p|eH[]fAWAVAUATUSHHHH LwM Hrj7 HHHD IF(H uI HC`fHD$HChC`H$HCpHCp HD$H! ? IHH@ u&1L ˱ Im l IHyIF(L M fEI H E111HH IH I ! IHHS8C,Ld$( IFL HH H"Z$ HLH^ H|$(AHe EHEL|$0Ll$8 H@8HD H H H9 HY$ HL$0H@ HE0D\$@0E1A 1H` 1HHH) D\$HD$(EH H( Hm HEHP0K! k,p H{H uHC@HS8H@@2H{` uuIE1HPIHtqI/tCIm t0EHL$H$HHt$A 1Im uE1IELP0IGLP0HS8H{` tI.$AIVLR0HPHR0IUHD$LR0HD${fEtHT$0E1 HHD\$3B D\$IWLHAWM?MG@ D\$Ht$01H D\$1HHHD\$( D\$FHS8 H{` k,zH{H u2HC@HS8H@@2H{` u,E1HN I.lHs8H{` tAff. @ H1 AUATUHSH(H H H9 IJ H& .HHH?HH)HHi ʚ;H) HT$HD$M$ HlAutW s H([]A\A] D HS㥛 H9%Li A M?HL)H9J H& .HHH?HH)HHi ʚ;H) HT$ HT$HHD$D AŃEtFu9MM) t;$ f D H託u 버uu1n H ʚ;HGH ʚ;Ha3ff. Hff. H H_KH$HT$H>H9H}% H9Hi ʚ;H~$HHH)H9HH t!H HH)H9HHHPH<$H3l H$Zff. fH ʚ;HHH HHVfHwHf. HGHw 鈗 PZÐAWAVAUATUSHHX:Iċ D$8HS$ H@Ht H9HkL}(M I` LHD$5AƅAx Ix M La ALJx Ip H9 I - L& HR$ H@Ht H9EhLDuhA` Ex1ɅD u|A A DudH &L贚9D$8A$HX[]A\A]A^A_Ip I I ZDxI Ld$0IHHD$ Dt$<M A@B L|$@I HD$(Ih HHDHIH=]t7 HT$HD$L @ ʚ;Ht$HiD$ HD$HHt$@HHHH|$ HT$HLLHD$@nt4VMM LLd$0L% c HD$(I9 H Q$ H@Ht I9tEh Ed D$< HT$, 1ɅExT$. AUATUSHHL%P$ HI$@ HP ) HH HoL$ H! H D HucHC HKHC HC I$@ H@H HCHrfHnH HfH:"CHJHH[]A\A]ÐHH9JH=6|% H8|% HCH.HkHKHk I$@ H@H HCHrfHnH HfH:"HCHJH[]A\A]f H=K$ t HHHCI @uGH=_7 H=_7 L IHt HtIEH=_7 Lkf D AUATIUSHH H L-N$ HHH I@ HHHH)H9H$ HfH ( I@ HoC 9 I$ Lcu#H,J$ Ru H HH[]A\A]I$H@uDH=^7 H=i^7 H HHt HtHEH=l^7 Hk붃 f^P QH` FDžP 1ɉP *ff. HXHHx% Hu HH=x% H9 |P$ HVH ~H v% ?HLBL9t]HBHHJHt HX D J(9J,sHRIPLBHX HHrz(H HXHt$ Ht$Hu @ Hw% HH=w% H9u-H HE}HHT|7 ]HXHD$ 11HD$(HD$0HD$8HD$@HD$HHD$ HH H=H3HHT$HD$/O$ f. SHH@=O$ HCH= wz=N$ uq{Ht% ?HHrH9tJHBHHJHtH@[ËJ(9J,sHRHVHrHHrz(1Hj HuH荅 1HD$1HD$ HL$HL$ HL$(HL$0HL$8HH H=H3HHT$HD$-N$ AUATUSHH x7 H: CH x7 HH; uH HCr H H HPsHST- H s% fHnHfHn@B 9h$uHXHHPHH[]A\A]Éh$HX0 @ 0)Hډh(H,HP1HHH+y7 HCHHH@$ P H @ HSsCHS Hw7 H/1HJ($HtHPsHSt =L$ =L$ L%1w7 M ID$ H=dt% Hw7 Zt% IH HɃ Hv7 Hv7 M,$HH9v7 Hv7 sHv7 1DMl$I|$? tKAD$? @ )IMl$AD$f1LH v7 L%xv7 AD$HH4AD$ AD$@ 8v7 A aDH=`x7 Hk0HH3Dv7 H=x7 A|$LMk0L"E1ɍpL 9s2Hk0HHD H0D9rLD%u7 H u7 I1H=Ν 4M 1HK$ Qff. USHHH Hwu HC$ RuH H[]HH@uDH=X7 ,H=W7 H HHt HtHEH=W7 Hk USHHHC$ @uH H[]HGH @uDH=W7 H=SW7 H HHt HtHEH=VW7 Ho붐HF$ HOH@ H@H HGHrfHnH HfH:"GHJff. fAWAVAUIATUSHLg Il$HHI M<IGHH D$ H9XL4 K<4 H IGHH9X{K|4[ H IH[H9XQK|41 H IGH0H9X&K|4 H IGHH9XK|4 HteIGHH9XK|4L} Ht:Kl4HE HH9XHIH~ Iu I}11 Me`Il$HHG M4IFHjH _C$ H9XYL, K<, H IFH1H9X'K|, H IHH9XK|, H IFHH9XK|, H IFHH9XK|,i HtcIFHH9XK|,Lu> Ht8Kl,HE HZH9XPHIH Iuf D 1H[]A\A]A^A_ff. @ SHH}E111HH HD$HH|$ HD$H[ff. HB$ ATUHS8 HP L@ MHH T ZI9HH1[]A\ SH}HE11H1[ @ USHH Ht HC tH;A$ uC t H[] D H4H=no7 HtWHH H6HH9t%H} HHHE H/uHGH@0H[]C HHC Ho7 HHuHA$ ATH E$ UH-E$ SH@ HP( ti( HH¨ Hg=$ @uaH f Hqq; Hk HC( HHC HRq; HCH[]A\f D H=!>$ ,HHu0HCI @uHH=Q7 H=WQ7 L IHt HtID$H=YQ7 GLc벐AWAVAUATUSLH H|$HL$H IIHt{L47H|$H LLt$@ IH AD$ {@JIT$0LL IHLl$M9uUH HĘ L[]A\A]A^A_ M HH H)H?$ L I$Ht$X1L|$P HHT$LLd$PI HT$fHn1fH:"D$hHT$(HT$ )D$pH|$H\$@HH9 D$`HT$X HD$pHL$PHA @ II)Ё z HH)Ha GP? HLD$pH|$L OV HqLuH0HHHOH9sH9' HH)HwDFA? H @0HH9$ wI@bHHL;M H=$ H W L W LM H|$(H H|$ H L j I HH)H wDODVA?9 ! u EQA?R HA H)H|$HD$p HD$M H9'HT$HL5ԓ H)H)ILl$8H\$0u H|$ Ń o Ht$(PLH AWHD$(PHD$8PHD$PPHD$`PH|$8LL$pLD$x@ H0H|$(Ht3 H|$ Htp3 H|$PHta3 E1$ HD$pHH w HH)H wDGDNA? } u u EHA?, HHAfHH9 b@ fHHIHNL AIHIIADAI H0fAnHI I(A fnfAEEA H8fAnHfAnfAfAfAffbfbfl@HwH9LH9w *} HH)HwDFA?# HHfH F`HD$H+D$HL50 IH\0.LH+D$HH<1 g HH)H wDNA? W u DOEQA? DWEZA?G HA 7DA1H)H|$HHD$p7 H)H|$HHD$p 1H GP? = 8 Ht\G?vPH|$ HLD$pII)IHu*wDNA?l ; TH|$LD$pxH|$LD$pHD$H+D$HL5k IHX}@ HHHH91 H|$LD$pHD$ M8H)HpL)H\$x L oHD$0H+D$8HD$O RII)Ё HH)H~^wDODVA? u EQA?l HA wDNA? [ smH|$HLw Lt$@ IH- HOH9H9T- GP?X= < +HHL$pH|$ 9 (|$`w1 LC Lt$8LHD$0H9 L)HD$I 1I ; DGEPA?fA MItDO?v8H)HIHH)HI II)ILIH|$Ht$p'HD$HLl$pHt$X|$` LIH Ll$pwDODWD^A? tQ u EYA?<EZA?l HA 7D' w;H|$Ht$p1C ff. H14$ AVAUIATIUHSH@ HP( tY( HH¨ H/$ @uTH H d; Lc Hk(HLkHc; HCH[]A\A]A^H=0$ AHHuHCI @uGH=/D7 MH=C7 L> IHtA HtIFH=C7 <ULs볐AWAVAUATUSHH H HHH9 0 A E1A H}HHxHHuH1$ H HC! H.$ H H E AHkAHCDc D+0 HC( HH[]A\A]A^A_ HH A A H9 H E1 fB HkHSHȠHCC A/ HC8 HC0 AtR EtVHk@HS(/f H Hq1$ H W H W D 1fj HC@ HC( H E1A H? I߀@ H=A7 H=nA7 L IHt HtIGH=qA7 H* E1A H1D+H HS(HS@HS8HS0L{n_[]A\A]A^A_D @ HQ0$ S8 P H@ HHH Ht T sH9[ff. AWAVAUATUSHHG LnHHIL=.$ M9uLfI IExH)HIH@ HE H3$ H9h L9{ HL$LHHJ IHHt'HD$HsH[]A\A]A^A_f. Lm Lt$I} AE | LL AMIuIU @4H} O HwHW H H HHHHHU(HHLpHIH} u"HC @! IF @x H^; HEHHEH^; HE o@f @HD$H[]A\A]A^A_ @ H1$ H9G HLLHIHf !Lf D m f4BAM HA} HHvHHHZL"LrHIH} "f. x 1H茧 钼 HH HuvH;,$ u H{ HHa]; HEHHEHM]; HE o@f @HD$f D HH Hu6H;-,$ uǻH H9ux % >HCbHw H9uIA % &IF뤾 H蛦 Lm f E4LHyf D ff. fUSHHHoHExH<H[]ff. HI@8 HH9r 8 z HH9s.uHPH9 H9uHH)H~ f. H)LHHr0HLHHVMHHѺ H9 I4H1ɨt t < f<H| f11MHHr0ILIIRMHHѺ L9 M H1@t A @t < fA< Ht A D HWH9 HH7H$ LWI0IpL9 LOI HWMHIpH9 LOI LW MHIpL9 LOI HW(MHIp H9[ LO I LW0MH Ip(L9rMLO(I HW8MH(Ip0H9s f. LLBIZ LLBHL9sH9 DE- HBDH9 DBE HBDFH9srDBE HBDFH9sWDBE HBDFH9s<DBE HBDFHVH9s 0@ HH@rH9uH)f ILH#0 HpH9s9HH9L HLH9H L#HuHHH9HH#VtHHLIH)H&H HtgHtUHtCHt1Ht Ht LO MHL M HL M HL M HL M HL M HL M HL9L HJM LLMLLLMLLLHQ8MLLLMLLL ML LL(ML(LL0ML0L9qHH HtgHtUHtCHt1Ht Ht LO MHL M HL M HL M HL M HL M HL M HH9jL HJM LLMLLLMLLLHQ8MLLLMLLL ML LL(ML(LL0ML0H9 HLf D USHHoHtHH[]f D G H@Hw t0@tH{02 HCHHH[]H{H HCHnf. Ht;HH$ HHH5C H9u!H"$ HpH8K HtH1HHu H"$ HHH8Hp f. AUIIHHmodnarodATI8UHH1HarenegylSHHuespemosH1H1HsetybdetIH1I6 E1H H=7 Hc Hf DKI0H KL!H H IH H[L!H ]A\H H1H A]L H1HIHH1HHHHH1H1H H1H4H HH1HH1H HHHHH1H1H HH HH1HH1H HHHHH1H1H HH HH1HH4H1HH1HH1H H1 HL#H IkH1H L1HH<HHH1HHHH1HH H1L1IHvRHLcH H1H L1HH<8HHH1HHHH1HIKH H1L1IH1 HHH\HHl DKIfD M L1L H [J<HH]H1L1I A\HH4JHHH1H A]H1L1@HH HH1HH1H HHHHH1H1H HH HH1HH1HH HHHH1H1H HH HH1HHHHH1H1H HH1H1 D DKI VfD M D LcN,M $HH IH1H L1HJ<HHH1HHLHH1HL)H H1L1IHoff. AWIAVAUATIUHSH HLvL-6 $ 1M9@X HH-$$ uH=$$ HD$ HD$H{ HC HC( u"HE @ IG @ HC LHHP 2 HC H HHT M9 H*H=P; LzHCHWHP; HSo@fn @1H[]A\A]A^A_f HH H H; $ HQ $ HKH@ H@H HrfHnHHCH fH:"CHJf HH H H;9 $ uI u E1fDrH HHM9H O; HjL"LzHQHC HQ H9uo % ^HE H) H9u@A % FIGGH} 1ɉ MLHf D AWADHAVAUA IATKT- UHSHHI@ @A H $ H@ HP@ Mu L㉂ HHH0 H HV f~F HF LfF HIH4 H HH[]A\A]A^A_ IMu DD$ I< HHDD$ DH HV @nF D~ HF LfF A^HHIr*M HIIHHL9' HAt HAt HfPAt IH HA fAD HK1LID HHf. @ K dH $ Mu DD$ HI< H@ NHHSDD$ f D HK1LID HHHfA 9fAD ,f D HtfHtOHtAHt3Ht%HtHt Hz H<HH<HH<HH<HH<HH<HL9nH<H|H|H|H| H|(H|0H|8H@L9r9 A 1AAD g1AAL X @0AH`$ A DIH@ E f H/t @ 鋔 ff. AWIAVAUIATIUSHXIl$ Du EtrH$ H9F LH^ HHy 1IE HXH[]A\A]A^A_f D A M HHHHHHD(f D M L] MHHMH\$HHIHD$M!փBK 3HxPH|$L IL<MIH9tCM;tfIOtML#t$~E K sHy D H @ M HHIIHD H LL$@LT$8LD$0L\$(Ht$ H|$ H|$Ht$ L\$(LD$0H/LT$8LL$@ SI;l$ PI;F_Mf D M EMILE MIHHOI!Ѓ K 8H HIO<O|9I!f ID$(H Kc HWLL$HLT$@Ht$8D$ R0LL$HLT$@Ht$8LD$0L\$(D$ H|$ K xb 1Kc PHHLI<H|$H?H9wL;W:H LT$HLL$@HL$8L\$0LD$(Ht$ H|$D H|$D$ D$I;l$ Ht$ LT$HHL$H|$H;9ELD$(L\$0HL$8LL$@ff. fAW L IAVIAUIATIUSH(O IOMHHhII!Ѓ K H HHI<L9 L;g LKHLDI!Q K HxwHHI<L9tmL;g I KMDI!{ @ K GHnHtMLOHMD I!K GHyf D HuH(H[]A\A]A^A_ H H D HwI;u HtG AU 1 HAu @ @b Iu0 g @E H0LD$LL$L$ YL$ LL$LD$B 8 D Kc HOH*LOHMD I! ~Kc HwI;upHG AU 1 SHAu @ &@tfIu0 @tPH0LD$LL$L$ XL$ LL$LD$Yf D LKHLDI!HHIuHHHIuH 鉥鄥 D O LG HHHH!i| y f IHIIDH!Ѐ| xH HHDH!Ѐ| xHHHDH!Ѓ A< yf D IfA<@ xHHHHDH!I<@HpH HHDH!ЃSI<@Hyà Ic<H:HHHHDH!Ѓ 8Ic<룃 I<@HDà Ic<룃 Ic<鋤ff. @ AWAVAUATUSH(H_H L=$ IILl$fIlHEHl$L9y E v@C MHUHE0HH9 8H $ u @_ HpH9 xu @_ HpH9 xu @_ HpH9 xu @_ HpH9 xu @_ HpH9tjxu@_upHpH9tQxu@_uWHpH9t8xu@_u>HH9t 8u@_u&HH9u L HD$H9 H1H([]A\A]A^A_ H;$ tMH; $ uHI HD$HH1Ht$D$|$ u>H|$< 1HvbIDMcA$ VH|$ HD$HDIDH Mt f AVAUATUS@?H_ Lg(H{ Q @A[HE HHc K LmHHO Ht HHD MF { $ HE1Ei L9k LHHP+ oLo^Xof ` on0h0ov@Hp@H} H/$ H9n H$ H@ {HPuN{ tHHc O<H H0 HE HXL)fHnfI:"@1[]A\A]A^ D H=:% H:% f D @1 HE HHE1 D L9k KTm HHx HH} LHl HH} LH M9> LNHHMtHIHLRfHnfI:"LQAM~LHHH#f. o HHvIH9wH~ HuHHHz to:HH yH9uEH H1Ҁ IL9}<LE(LH)I IHH HfHnHHfK:"HLH HA1LHE(AD$H)E LH:k HLHHLHJHH_H+1)HNHHHtHko?H<HH|L9| Ԟ O HH ATIE1UHhSH_ " <uRD IHM9t8OHL`HL!~Ӄ f<CusfD CIHM9u[]A\ @ MHIIDH!<tMHI ID H!tHHuui~ ~;U @ LHHLLLH!f<Cl랃 <u<D IHM9 SÃ:HCIHID H!fLHHHDH!<t5 ŝHc@fHH=6% % 7% H H5$ S HH[;7 HH1H HHt^HH"% HHtIHH %? D9L~!HVHH~HtJtu[ @ A9EuH 6% HH 5% H9 EH-:7 [f F$ H3% HHPfHnfH:")FHpHr[HVHFH R87 HBHPF H @HH @:7 {HCHHFHHsH9u Hs(HuuH4C;Ct| H< uH H9HC(HK H HH HK HA(HB fHnfH:"C HtHX(HZ [ ;~t1HHHs HwHC(H Hp HF(H877 1H;H ,77 HC C H3 H=\4% f4% 1H-67 H [H 77 HH67 1HS(HC HtHX(H=77 H 67 H 67 [H567 l H/t f HG`0f HG`0f SG HuQH(H @ HCHH@ H9 HH=3% [%3% ̚H HH=n57 ٚH{(C H H}y#~ @ HKHH9]dC G H{8Hu%KH{HH>54H[t5HSH@AH9 S HKHH{8HtH9{HuHK0nH AWHAV!AUATUSHH8t HH{ H 6H H H0 H ϯH{ C HP w 1H́ H H8 H H " H8 H8 HD$(H=% L L- % HD$u1e HS`H- Ht H,H} uQI8I} 9 I} tIcEH= H= H= wH= H,H} tMu0M~L;=$ IVH HL$LLH8 H Hm H;-$ H=$ 1Mu O IH7 H$ @+ HD$ IOLH@ H@H IGHrfHnH HfH:"AGHJHI_?E111HLNHD$(H6 H|$fHD$(IGH6 IG LLIo0Iu0Mo(L ޫI/eIGLP0V Hl$ Lp LI 811H= % HJ HHH LHK HAKE D HShH- HI8I} L M H L Ht H} w L M H$ H H@b HH 6 u.H HU H H $ HJ 4L ME* H I$ @ H H{ H Hb$ H{( u ID$(HC(H uI$ H H uI$ H H# LH0F + H5i$ LF . H5$ LF H5C$ LF ) H5$$ L|F ) H5$ LeF S H5# LNF * H5/# L7F " LX A$ @f MwI H$ A Ld$MMMHb HD$KlHE L HC`LHt HU`H] HCPLHt HUPH HChHt HUhHe HCpHt HUpH H HtH HG H{0 v H{@ u H uHE@HC@H H H{H u H uHEHHCHH H H{X HS8N HEXHA Mf I;EX Hu HE8H7 H u$ z# H H H H u"H HtM I9 H w H H uH H HuH H H H X H/ H H H H uH Hj Hr H( H( H M H0 H( HH uHH Hr& H uH H& HH1@. H@ B `u `H H IM9/Ld$MtYH{P u ID$PHCPH{` u ID$`HC`H{h u ID$hHChH{p u ID$pHCpH uI$ H H % D H= D u H@ H;# ƨHH{x LP 1MeM H @tH ^πH 1H8[]A\A]A^A_ HSpH- HHSPHH- IGxHSLHH/ HL$LLqHcH|$( HI|HG tH'~ / HI9uHH} IH/ HpHLH!LH(6H} uL ;@H@ H5# H9@ H Q# H@ H{x ~H Ht$H|$A H|$H Hx# Hf A . :H H HExHCx H MI; H H H( uH( H H0 H0 H}MB HH I90 " HuHH H H qH HaI9 TH HHHE8HMt I9E8HC8HCXHHE8HH H~xH Hc- H( H( HH0 I9( 9 H HH vHH HfH I9H tHH H[IupHxHHLH Mu H2H Hu HrHT HHRHHPH HH{0 HE0HI9E0HC0I}hLHHHLIH Mu H2H Mu HrH1 Hu HJHA Hx u HJH Hx( u HJ(HA Hx8 u HJ8H Hx@ u HJ@H" HxH HRHHH H IM`LHHxLIHZ Mu H2H9 Mu HrH8 Hu HrH Hx u HrH| Hx u Hz H Hx( u Hz(H Hx0 u Hz0H Hx8 u Hz8H Hx@ u Hz@H HxH u HzHH HxP u HzPH HxX u HzXH Hx` u Hz`H( Hxh u HzhHt Hxp u HzpH Hxx u HzxH H uH H H uH HM H uH H H uH H7 H uH H H uH HH uH HxH uH HH uH HxH uH H H uH HN H uH H H uH H5 H uH H; H uH HIH uH HH uH H H uH HH mH H]I HHH8H H H2H! HHRH H{0 wHE0HeMMPHxHHLM# M! L M) HaHzHh HHRHg uHH I<$ ]LH:G HH& HpHLHHI(I<$ uHX H~H~ 1HL sHH9uH8 H H H;&# ʀH 1H8 H H 1$K H HP X:Hh H5H@ @ Hh H H@ HMI;@ H0 H2HH H0 7HH H'MH H I9 H H H H H RH{r H{IHH HH]: GL I<$ u E,% I I<$ AD$ LHB HH$ HpH AD$@$ HE1aHAHm uHEHP0Et H H H H EH0Mu HrHn Hu HJH~ Hx uMHJHtDHx( Hp8HHu HJ(HuDHu HJ8Hz Hx@ tLWH0H<DHx( HJ(HHx8 Hp@HH(u HJ8H, Hu HJ@H> HxH HRHHHPHM$I; H H2 H HH H Y H5 H H HCXMu H H Mu HJH Hu HJH Hx u HJH LH]# H Hf H5 (H H# H7 H# HCxMu H:H; Mu HzHF! H HJH Hx u HJH L'H-o# H9 eH Mu L M Hu HzH H HRHH9VMu LM.! HHzHނI9yjHHRHI9Q9 Hu H:Hy H\HRHLH{0 HE0HH0 HH( HEHCHH @H aH3 HLNhHx@I9I8 HH8Hu HJ@H HxH HRHHHNhH9QHH* H HH H Z H6 H H I9:H8ML9 LH!H @ @OH AH 3Ao$ @H I$ HHLI_'E111HLfHD$(HƀLH`l HH LpH A AD$@ HLE1詼HAE?L2HpHpHu HJH Hu HJHHx( u HJ(HHx8 HJ8HHx@ HpHHH8u HJ@H HMpxHpHHH H H H u;HuH H 1Mt I9 đH H HHw H H Hx Hp(HHu HJHvHu HJ(HHx8 u HJ8HHx@ HJ@HHxH HH@H! HLN`H I9yxx HxxHuH H H uH HW HIu0H=# L1 Wa~MI9 tH H$H HHx xHJHkHx(I9J] HHHu HJ(H Hx8 u HJ8HLH9~uHxlH H @H H H HE0H}MH HLN`HHpI9yh HxhHu HzpHX Hxx u HzxHZHdHHLNhHx8I9I(e HH(Hu HJ8HHx@ u HJ@H HH Hxh HHpHx`u HzhH Hu HzpH Hxx u HzxH H u H Hu1H H H uH H HuH H H uH H H uH H1H HLN`HHxI9yp HxpHu HzxHH uH H HHpLHHu HrH Mu HrH> Hx u Hz H Hx( Hz(HHx0 HH8Hx(u Hz0H Hu Hz8H Hx@ u Hz@H HxH HzHH HxP HHXHxHu HzPH Hu HzXH Hx` u Hz`HHxh d HzhHW Hxp HHxHxhu HzpHs Hu HzxH H uH HH H H H H H H Hi H H H H uH H H +H H1HI9JHH HL - A5H Hx@ HHHHx8u Hz@H( Hu HzHHNHxP u HzPH HxX HzXH Hx` HHhHxXu Hz`H'Hu HzhHNHxp u HzpH Hxx HzxH H HxxH uH H#HuH HNH uH H H uH H 1H HLN`H I9 HuH H H uH H HHH H HH H 11HL) IH He LHH I<$IH*E|$H A@HL* A11L1 H HxH HHPHx@u HzHH Hu HzPH HxX u HzXHHx` u Hz`H1Hx Hx Hpu HrHw Hu Hz H= Hx( u Hz(H?Hx0 Hz0HHx8 HH@Hx0u Hz8HHu Hz@HHxH u HzHH?HxP ! HzPH HxX HH`HxPu HzXHHu Hz`HHxh u HzhH?Hxp u HzpH 11H0Mu HrHHu HrHHx u HrH@ Hx Hz HHx( HH0Hx u Hz(HHu Hz0HHx8 u Hz8HHx@ u Hz@H11I H9oH H H9 !鈃HxHZHRHMHPDHHLN`HHPI9yH Hu HzPHu$HxX u HzXHu`HHH<HLN`HHXI9yPz HxPHu HzXHu(Hx` u Hz`HZ HHHLN`HH`I9yXHu Hz`H" Hxh u HzhH`HHKHLN`H I9 " HuH HTH uH H HHHLN`HH8I9y07 Hu Hz8H Hx@ u Hz@H HH H H H !H H HiH H H H Hu3H ɆH H1ID$ HC H H H H H HH HHx HpHp(u Hz HHu Hz(HHx0 u Hz0HHx8 Hz8HzmHpHLN`HH(I9y Y Hu Hz(Hu(Hx0 u Hz0H<HH>HLN`HH0I9y(I Hu Hz0HHx8 u Hz8H HHHLN`H I9 HuH HpH H Hy遆H vH gH H H H ~ H HueH H HlH 3H H H sH H11H H H H H HHH H H H H| H 6 H H11H H H1HLN`H I9 u;HuH H\H H HHH HtH H HH χH H H ^H H1HLN`H I9 t:H Hu H Hu,H uH HH"HtHLN`H I9 u;HuH HH H H*HH HtH tH H( H pH HĆ1H H Hb H ƅH H1i1|HAzH H H zH H H H H1 Hx(HLH5HzH<HHRH;LX MwISH0 M a}HH H HH H H HLN`H I9 t:H Hu H Hu5H uH H HHtH HLN`H I9 t>H Hu H Hu9H |H HrHHtHBqHLN`H I9 rrH HuH H H ~~HH H cH H H H udH HfHuH HH uH HH {H Hz1HuH HtHLN`H I9 tBH HuH HH HH HHt 9HTHLNhHxHI9I@~qHHRHHH H H H u{H HHuKH HH uH HH uH H1AH uH HtJHu+H HH uH HtH uH HzHLN`H I9 tBH HuH HBH H_H HOHtH{0 HP=yHOxHRHuH{0 HE0HH0HyHRHuH{0 cHE0HkQH H0;He}HzHlHHRHkHxI9J`zHu HJHHx( u HJ(HLoHH H HHxHH,0HLN`HHHI9y@u.Hu HzHHHxP u HzPH H=Hx@HtHLN`HH@I9y8u*Hu Hz@HuHxH u HzHHHHx8HtHx0HI9 gHM`hHxI9Ju*Hu HJHu'Hx u Hz HLHHHtHx I9Ju.Hu Hz HHx( u Hz(HLHHHtH H HwkH$ H H H KH H;kHxx H Hxpu HzxH0HuH HcH uH HH B H H2 H H H H H4 Hu|H HukH dmH H H mH Hm1 jH 7H H'~jyjH mH H H lH H%m1H H HuH kH H H =lH Hl1EH9>cHkHRHcH{0 HE0H(iH WrH HY H iH HIl1HHLN`HHhI9y`JeHu HzhH.Hxp u HzpHHH H1Hx H1?HH H H H H HaH H H aeH H H ecH Hb1HYaH1 I9zaHu HJH`Hx HJH@gH0dH HufH QdH Hu*H =aH H b1 lgjM9aaaal@jqlllaazquazla{h t}axasanaZuda_aZaUaiq=z_q3zUqPqKqUSHHtuHm HHtZH~H Hx1=H# HKH@ H@H HCHrfHnH HfH:"CHJHH[]ÐH# H H HH[]H# H H f. H# ATUHS8 HzP zL@ M]zHH OzT I9;zH u HH= LcaoCSLHH CHH SHH CHH SHH CHH SHH HHrHHHHuBu%u[H}LHE(]A\ HfGt @ Ht[]A\fHXHzH$ HUHH={$ H9 \# HVH ~H $ ?HLBL9t]HBHHJHt HX D J(9J,sHRIPLBHX HHrz(H HXHt$Ht$Hu @ H$ HeH=$ H9u4H HE]HyH46 ] HXHD$ 11HD$(HD$0HD$8HD$@HD$HHD$ HH H=H3HHT$HD$# H9yHH0u H92yHHH=$ %$ H1Hf. UHHSHHHX# O HSH {H;$ ?HL@L9 HP H HHHtYH0ufBB HXH[]fHHr H1HHuNu1t HXH[] H(9H,s@H@I@L@f1HfGt Ht HHpx(H ?Ht$V}Ht$HH$ D HeHH H 6 HD$ 1HD$ HT$(HT$0HT$8HT$@HT$H1HH H=H3HHT$HD$# ^ff. HH=$ % $ AVAUATUSH HD$ H(wHGH;# t0H;# u0 wHwHr H []A\A]A^HHH|$ HH H|$ @ IH HE1HD$H LL)I HEH HH M9H HD$J\II It'HEH HH HD$J\IHEH HH HD$J\I @ M9 HD$MnHJ\HEM HHtmHD$HIJ\HE HHtJHD$HJ\HEMu HHt'HD$MuJ\(HEH HHd觍 Q HudM9}H|$LA uNH菼HD$#I LHItH|$LA tHD$J\IHH|$Ht:H21ff. HtHG tHwH ff. H UHHSHH H H~UHU HHPHtCHUHHP Ht1HUHHP(Ht HL HHLHH9u H1# HpH@ HRH HPHyfHnH H7fH:"@HqH[] H# H H f. USHHsH# H@ H@HDHt?H H HtBHKH Ѓ H}# Pu6H HH[]HH9fsHH=# H[]`HCH @uGH=6 kH=6 H HHt HtHEH=6 nsHk AVAUATUSHrH HH(IL-# HHHH} H HM@ HHHHH)H9rH uHrfH I@ LoCA A A 9 LcH Hku!H # RuH H[]A\A]A^HE H@uDH=6 jH=L6 H蔏 HHt藌 HtHEH=O6 mHkA d\AP NH` CADžP B 1AP %ff. fAUATUHSHHWHp HOHBHHH HOHBHHgHG H9A0} L%# M$@ M8qA 1/ HuA H H]HH H<H H H/l HKH H|H H/F HKH H|H H/ HKH H|Hx H/ HKHtpH|HV H/ HHtNH|H(H/tHr4H<HH/uHGP0HuHHf H=$ $ I$@ HPHc OsH5# H9uufH H Mt#A I A t H[]A\A]f. HGHP0HuW D HEH@ Mu @ I$@ HPHc OYH@ nHOHkH9A0nHI$@ HEH HEH InY[]A\A] ff. fHWHt&HOHBHH HHBHgHG HOHWHAHH H HAHG Hg D HGH9p0ÐHѽ# H@ Hon 1 1H# H@ HFH HF H ff. H t~ ff. fAWAVAUATIUSHHH-# H9o HsH~pI$X HCH HJ1H~:H9BtYHt.H9B tMHt"H9B(tQHtA J9Dt>IL9uI$ 1A$ H[]A\A]A^A_HH9tHDHH9uHi# L|$ LL Ln IHtHLLn HHlL`HXI9bf. HH9aHDLH9tH Hl @ HX HtbHJ1H~V H;rtK1HtC H;r t81Ht0 H;r(t%1Ht H9tt HH9u1ø H9tH H/lff. uAUATUSHHHh Hu H 1 H[]A\A]1Ll$IH$1LLH tHD$HxH? ~H;=# tff. UHSHHHm# H9FuGHVHt=HL$HHmHbk1Ht 1H|$ H[] HHH*kf AVIAUIATIUSWH% i = h H-a = & MkH=-# jHjH@( LhH HHXM H# L` HpHh0H@ HRH HPHyfHnH H7fH:"@Hq[]A\A]A^f D H- J!j j16M$jH=k# .jHjILp8H@( LhH.HXM2I$(H- = if H-ij @ H-) @ USHHG iHH.# HHHH9Fu.HVHt$Hͻ# HHH9E tIH[]6 f D HHt$Ht$HHuH=H5H[] H[]Mff. fUHSHHH# H9Fu/HVHt%H6# HHH9C tJH[] HHt$KHt$HHuH襮H蝮H[] H[]鵕 D UHSHQHHH=r# HtHX(Hh0Z[] @ AUIATIUH1SH6 HhHA @ Hݶ# HKH@ H@H HCHrfHnH HfH:"CHJHtnHE LHk$E111HLuHD$Ht<H|$sHD$HCHgHC HH[]A\A]HugggfSHW HtK @tBH # HpH@ HRH HPHyfHnH H7fH:"@Hq[ D AVAUIATIUSH H^H_(H_ HHHH HHHH<+%hH gL4(Ht;f H]# H@ HoAF 9 HrH1LHHI|$( uKI$ Mfu*H# RuMI [L]A\A]A^f I$f MnMfA$ LmL@uGH=H6 f]H=6 HW HHtZ HtHCH=6 U`dI^볃 P H` DžP 5 1ɉP I$N AVIAUIATUHSHHHG x J H# H9F) HL$蟘IH H{ u"HE @ IF @9 I_ LS Iz AB LLAJIRIr ? LS IRIr AJ HAz H- HHHHK(HH(H LpH : HCHHH : HCIjIR1H[]A\A]A^ D HH HH H;# uH} @ H# HKH@ H@H HCHrfHnH HfH:"CHJHH H H;y# uI~ f. H|$L9tMH7: HS(HH HS J LB Hz P IH: MNtHCHt H/j Hm HEHP01+ HL$LHH]IH c H! H9 % HE @ H H9s A % IF fFf D HRHHHnL.Lv D HC HH@HHHHpQbLS / KdH: ILtHC N4Ht4HCH/H: fHGP0 bJHP: HcɃDd @rHCHCMAH=$: HT@qHC(L4HC HWH: HHHSHCHQHhHPLHTMaHa AWAVAUIATIUH- SHFL6% u%L=v# 1LHHu`Wa = A * H-21 = t= 'aL=!# 1L/HHaH- A @ HϮ# HKH@ H@H HCHrfHnH HfH:"CHJM I$LLcE111HLmHD$H H|$kHD$HCHN`HC Lk(Hk0HH[]A\A]A^A_ @ H- u<H-t u&H-g H-q }MF_____SHHHH=w# HtHX([ff. @ SHH Ht$(HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H\_H$ H$ HD$HD$ D$0 HD$*H H $/ HT$HJHHL$ HHPH HT$H< HrHt$H2HHt8HqH9~iHrHHt8 HqH9~SHrHHt$HrHHt8(H9~4H HrIHH>HH>HtHH9uH>Jt D H# HpH@ HRH HPHyfHnH H7fH:"@HqH [ D H|$֍J $H47HHpHt/ H r4$HHH Hl/v-HT$HJHHL$ HHP(H:H 7$HHH(H 1 / H|$LGH?LD$HH|HH9@J$BH# HpH@ HRH HPHyfHnH H7fH:"@HqHT$HJHHL$ HHP HbփH47HHtH H9'9f H Ht$(HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ $ HD$HD$ D$0 HD$Hts$/wxHt$JHHHP/ HHHpHP H|# H@ HRH HyfHnH7HPH fH:"@HqH D HT$HHH HT$HHHH HT$H Ht$(HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ $ HD$HD$ D$0 HD$Ht[$/w`HL$HHHpHPHT# H@ HRH HyfHnH7HPH fH:"@HqH D HT$Hff. ff. ATUSHH w HΧ# HcHHDH []A\ÐHH t7II<tF d H Z??D` Xh []A\ÿ 6 HYX뢿 Ht?h XYf D H USHH9YHH H< YHH H{# HkH HCu'H# @u H HH[] H H݀@uDH=S6 qOH=6 Hbt HHteq HtHEH= 6 `RHk붿 XHHPXX AUATUSH(HWH HYL,HHHD$ HD$ I] H;5# H H=S# VHHXf1HhHHP@(H@ H& HC8 Im HT$Ht$H7 Ld$MIX1Hk0HC(H I] H(H[]A\A]H{ _H=# H9{WHS0H\$Ht Hz tHH(H[]A\A]Ht$ VHt$HH fHkHH\ C(HC HHC8Hs Im HT$Ht$HY HD$HuHD$HHP0fHnfH:"C(HtHZ(HX0 H](VYW H H HuH uH# H9G3WH>H0HtH Wff. H "WH# HOH@ H@H HGHrfHnH HfH:"GHJfHOHHu G H? HK 1A 1HyH HL I H I H L!H AqHI9 HyH HH H L!H AqHI9 HyH HH H L!H Aq HI9r^HyHtnHH H L!H AIHI9r7HrKH HH H H!H ȋLHH H9sH HH D IHH9HGËGtHHHIff. O HH ISILXLW 1 A4HIL9tvOILH!mA<tHHHHDL!A<tHHH HDL!pI HuS~ fA4BHII9u[ CfA<BtHHHHDL!fA<BtHHHDL!닃XI B뉃 _TA<u"A4HII9[à ~WTHHHHDL!A<t 8TIc & D SHOHHWHAHH H HAHG HgHHtH/t"H{HtH/t H{ HSH[!HGP0HGP0ff. @ HGHH HHH HHWHHSH# H@ HJ ~!H=W$ H)Ɖ %h$ H=9$ H)%P$ AWAVAUATUSH H_H|$t$hHT$XHL$`DD$l ^T1H L$ H|$0Ha6 f8 SD$hD`AIcHk 1Hct$h9|Hk1H L~H Ht$(E1MkHD$PLl$EIJ8HӋD$hA9H LELl$N; u IcHD$PL$ LHLHkHHD$ HkD$(H L9t.H-# H M9tLL'H9ouHF M9uL9t$& |$h Ht$L^! HD$pL$ fHnHD$)D$pL+f HHWHHx HIpRHL9uLd$pHD$I9 R QfInL$ )$ M9 H\$ L5# L1H~ IGH HH~ L} M I9 MIl$M$$IGL9tHX H HrH~=L9rtHt1L9r tHt%L9r(tHt L9tmHH9uH;Ú# WH;# VEL I MAGBIIL] -IH\$ E1H$ I9 fInMc)$ cf D H0HHHVHH1H HVHPH$ H HPHH$ HPL(uHHH H2 H$ L9uLL H$ L9tf D H`H L9uLL0 H$ L9t HHHHL9uHt$L L$ 1LM9t H HL9uILl$ Ld$MHHD$8 fHnfH:" )L$@S IVI>HHHIFHGH:H HGIFIT$H IFH*Il$M&L$ HD$ LI9^ LM}@ 3QIEH H" IELHD$Hx` @QIm L$ MM9>HD$ I9 In@ PIFH H IFHHD$Hx` VPIox LL;$ L$ HD$ LI9tyHLu@ OIEH HtAIELHD$Hx` JPIm L$ ML9]LLISIELP0L|$pE1HD$I9MHD$8@M<&OLl$pHD$I9vNHt$H|$X |$h HD$Hx` MHD$XHtHt$8H0HD$`HtL HkD$(Ht$PH ofD$@L Hŧ6 f8 MH L[]A\A]A^A_IGHP0yHHAH HD$1HhHB H H3 LoLL$ LL H Lt$L9HkD$(H fL9 H} H # H9E L9 H/H9G L9q H} HH9E L9W H/H9G I9A H} H9E% I9* H/H9GtyI9 H} HH9Et]I9 H/H9GtQI9 H} HH9Et5L9 H/H9Gu'HL9 HU H9Euf. HHH< HU(LeLHHT$ D1 HT$ HHJLH;$ JA"IELP0H 1L9tfH HL9uHp = HHHXHkD$(1Hp 1H L9t @ H HL9uHh Lt$11H HH uHV H H HhHH@HHPHHH HL9 AVAUATIUHSH HH9tS HBHJHH HHBHH9uL- HCH{LH HH9ufInIL- A$H] H9u7|HCH{HL HCL HHCHH9tMIHHCHHuHHHIIT$HH H HCLHHII\$LH9uH]I$$[]A\A]A^ AWIAVAUL- ATIUHSHH_L9tU IGH<HtLՅuHy1H[]A\A]A^A_ HH Hu4IFtHIFHxIGL4MtIF @tfH H9uA % uLff. AWIAVAUL-P ATIUHSHH_M9uYHx=LtMtIF @tHH H IFtHIFHy1H[]A\A]A^A_ D HHxLt I~H LAׅuHCHtI~H LAׅuHCHtI>HtuLAׅuHHzI~H%LAׅaHUH|Hu @ H1 H9u!A % HL @ HG @u1HH HuHGtHHG1ÐH H9u % uHH|$H|$tHGtHHG1H HG @u1HH HuHGtHHG1ÐHI H9u % uHH|$H|$tHGtHHG1H H % ATIUHSHHHG@ H{H HH9u(HG @uCH{ HtbH[]A\ D LՅuIH{ Ht>HLH[]A\f D HH Hu,HGtHHGH{ Hu 1H[]A\ D H)H9uN % ueH8H2HՅ%H{ HtHH9]4H|$H|$ AVAUATUHSHG Hx Lp& HW(IH9 H HM~;H xH9uCHl(1 @ Le MtID$ @uqHHL9u1[]A\A]A^f Ll(E1 I} Ht HӅuIIM9tI} HuIIM9uf HH Hu4ID$vHHHID$I9Ed HH9 A$ % u)H HM!H ^H9uNH\(1fH{H H;H HHL9uLd(LE1 HtrHt7I|$Ht#HӅI<$Ht HӅ|A II|$Ht#HӅ[I<$Ht HӅEIII|$Ht#HӅ&I<$Ht HӅIIM9I|$Ht#HӅI<$Ht HӅI|$ IIHt#HӅI<$Ht HӅI|$ Ht$HӅI|$Ht HӅoI|$8Ht$HӅXI|$0Ht HӅAIIHM91)HHI9 M HGH:H9) Ht HӅIID$(HxHt HӅIID$(HxHt HӅIID$(HxHt HӅxIlID$(Hx Ht HӅSIGID$(Hx(Ht HӅ.I"ID$(Hx0Ht HӅ IA ID$(J<Ht HӅIM9uHt IID$(HxHt cIID$(HxHt >tIhID$(HxHt OICID$(Hx Ht *I ID$(Hx(Ht IID$(Hx0Ht I ID$(H<Ht HI9uL]HHt H HH9uHG @u1 H HH Hu HGtHHG1f HyH9u uHH|$H|$tHGtHHG1Hff. HHHu1ÐH H9u H ATIUHSHHH @HՅ @H{H?[LH]A\HG @u1HHH Hu8HGu1HÐHWu7HHuHHG1H HaH9u] u빐HHHHHQH HAHGHVH HGHGHHwHFHGHHGgHt$H<$H<$Ht$CFff. AVAUL-E# ATUSL9o HGHH HoHJ LgM ID$ @ HtuLc M ID$ @ HtPLc(MtqID$ @ Ht/A NtMtIIF @ II9u D HKHSHAHH H HAHcHC []A\A]A^ D HH H L9uI|$ , D HH H L9uI|$ J D HH H L9uI|$ |fHOHPHH HHPHG Hg[]A\A]A^ÐHH9 A$ % ID$9HH HuvL9I~ HH9 A$ % MID$1HH9u`A$ % CID$HgH9u'A % @IFaL8LLLf D HGATUSHH= w%H;# HcHHDH []A\f D H HE1H HH<tF H Eu}H@ HHHP ?p?H<*tY덿 vH<Eu=H@ HHHP ?p HHH t_A bA AԉMc?L`PHHHHP m H;H@ X E1Hui;d;ATIUHHSHH wE111HH5CHD$H1;H|$MAH\$LHHH+t H []A\HSD$ HR0D$ AVAUATUSL7M;H# HI9F};MnHM;I>c;I9K Hm I~ tLI9 M$I|$H:HCI9 I|$ H:HCI9 I|$(H:HCI9 I|$0H;HCI9 I|$8H,:HCI9~sI|$@H&:HCI9~\I|$HH :HCI9~EI|$PH:HCI9~.I|$XH9Lc M9~K|H9IM9HL IH H:I9|Le LJ;1[]A\A]A^L)KTH Hs-Ht LxH# H H HE 1HHLHH1HHk9ff. UH8HSH1HH0 H9 vHH9 @tBH"# HrH@ H@H HBHyfHnH H7fH:"BHqfHB B@ B B0HtHZHHH[] HBHu29HHu+9ff. SHHHupH{HtHC H/tCH{ H 9H{(HtHC( H/tH{8Hu9H{0Hu1[HGP0HGP01HC0Ew1Hs8w1HS8+wf HGAVAUATUSHH= w)H# HcHHDH []A\A]A^f D H?H=w[]A\A]A^ @ HHHHIII<IMIIELA HtHyAMcH HP L`??HpH*McDvZf UHSHH 1H7HhHH u Hz# RuH HH[]HE H@uDH=U6 s'H= 6 HdL HHtgI HtHEH= 6 b*Hkf. H9u D HX HtNHJ1H~ H;rt1HtH;r t?HtH;r(t3Ht H;tt!HH9u1H H7H9u ff. SH HG 7Hs|# HH9Fu"HVHtHL$vbHD$H [ HHt$;QHHl7Ht$HL$H<bHD$H [ÐATIUHHSHEH@HH_79HHW7HLH H߉i []A\fAUATUHSHHVLgHt$ X7HHH|$X:I$ H6HP Ld$H9u&1HLHF I,$t H[]A\A] @ HLHLD$ D$Ґ1 ff. AWAVAUATUSH(HFHo M8IHIIH m7HHHE IH7ID$I$H H M8H IE M} uL M T MI?tHh Hy H Me LHAƅ MuaHm H+ H(D[]A\A]A^A_ D H H9 ID$IuH9& It$(LL覥 AI,$uLt fM}MHh Hy# H|$H9C HSH6HH$ cH$Hu I<M9 I Hs EOAWMWDH9 Aw H9t7Aw H9t(Aw H9tHcA42H9u D D9 ։HcHLD E\BA9~fHADBD9}RHAt)HAtrA9~2)HLDXHHcE A9f. AOH/t>E1 7HH} I IM4HtH/uHGP0 @ AWHc҃ADAOf D H MH A f D HX H HJH~IH;BHt9H;B Ht)H;B(Ht H;DHH9uLF5 h3f AJ @ IuHHHHHH(HH HHHLM| L\$I{ L~rH1HAK cAK LHICHHHD$HHML Hu AoKHD$IfoC ) $fACH H|$LB HH 1I}IEM2LHѾAEHvt# H8 2LLLA3H H HHt8I H AIEHH5 HPHw# H81Z A|HH H1H9H; ]How# HUHH8M1H5 1A !H ) AVAUIATIH H@v# H@ D1苏 % LrH@I9`# u!H9h# uLp# H LA\A]A^ HT$ Ht$H<$ IċD$ W2Ht$H<$Ht# H9Fu~ yH~d tH<$DHt$ 1% H@IHh# `# Lp# HHh# H/WHGP0K @ AWAVAUATUHSHH(Hs# HT$H9F LfI LX M1IMnHBIM 1L|$IDH HG 1LLHYHD$HuUHt# H@ Hx` HL9uIHPHD$ 1IHt1H([]A\A]A^A_ IHQHL$ IHuIVHD$LR0HD$H([]A\A]A^A_ HGIH0f D HD$ 1o0f HHG 0HL$XHD$H Hs# H@ H@`ff. fAUATUSHH t H[]A\A]0v# 0LP P Hpv# Ml$M~ 1I|]0HI9uH @ HW uCH 1Ht2x Hf D HwHHHHHB(HB HHHHfHGff. H/t$ @ QIH5o# H /I@Zff. USHH/HH/HWHHBpHtH@HtH[]HBhHuw H; q# /Hq# HT$HHH_ /H|$Ho/H;=qr# ]/H H|$HhHH[]Hx tHEHP`Ha/H S/Ho# HH0 0 HH!/HH[]~ Hn# HRH5g H81 1냐UHSHH(Ho# H9Fu?HVHt5HL$HHUHt0Ht.HD$Ht$H H([] @ HDHHu1Hm# H9EtGHp# HHn P} HHt HH HHD$gHD$HuHo 1 H HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ H$ HD$HD$ D$0 HD$ H f UHSHAPH-tHtD Z[]f D ATU S0"HH-x@H@ Ho# H HCu1HZk# @u)H kH[]A\ÐH@ @ H I܀@uEH=6 H=6 L< IHt9 HtID$H=6 Lc H Ht$(HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ H1$ HD$HD$ D$0 HD$ H ff. fUSH1H8H|$i H*,,oHt$H|$D$HSHT$ Hu1 H8[]f. AH1 H8[]ff. 11uI I A @8 [t= +DAA1+MIM ) (k+uCOHH D ]teY)t^~[tH @ A+(u;f D {t߀]t%u$OHH@8FÐ{tȀ}uHf. AWAAVAUATUHSHH(HHzH} <:~wB<9 H U HcHf z& / HSL2M_ HE xNtIH(L[]A\A]A^A_ @ <,H H+<(,) 2H(EHH[H]) A\A]A^A_ f D HCHPHSL0Ml[* /wYHSHc:H([]A\A]A^A_C= HSCH([]A\A]A^A_ HCHPHSHc8 /( HSHE L"8#)MQ LyHH(L[]A\A]A^A_ HSHBHCi / HSH:f. /z HSHƉ H42/q HʉH H:HE H9H Hc?H([]A\A]A^A_ /I HS:H([]A\A]A^A_5r /I ЃHCL HE 8#X M)L^HH(L[]A\A]A^A_ } H$H~(I('IH(L9$$ DHHIH +DHHHD$H*HLL裰` LIO`H|$E`뒋/ ЃHC H|$ D$ ( I/ ЃHCH8H([]A\A]A^A_; /~ ЃHCH8H([]A\A]A^A_/c ЃHC8Ӌ/} ЃHCL HE 8#&Mj(LHH(L[]A\A]A^A_D HSHBHCkHCHPHSH0HSHBHCHSHBHCHSHBHCHE 8}0(HHE HCHPHSL Ah# IHIMaHHE E&/w%HSH2Mp'HyHSHBHCHCHPHS.HCHPHS|HCHPHS8lH([]A\A]A^A_HCHPHS HCHPHS}%u'(f D AWAVAUATUSHH(IAm HIHE輢HH} H H HNH{1聚HRf# HKLH@ H@H HCHrfHnH HLfH:"CHJDaH HCH DLL<H(HC HtyDLLH!(HC(HtXDLLH (HC0Ht7A DLLLD$LD$HtgJDIL9uf D I$D:8uOEtHI$HH[]A\A]A^A_ H!e# HH H D88t 'D''r'`'f SHq'HHt E111[1$Hm'H[ ff. @ ATL%d# UHSI$0 H'I$p HH IH'HH股HH'L`HtH Hx1ZH[]A\fHH'HWH - HOHu GH D HtH 1HËGHպ LApHH EHHH L II L9 HtcAp II L II L9usHyHtKAHII L II L9uOHHr(LII L II I9t*HcH(HHyy H?H9 Hc# H5 H8薏 HHكH_# H5 H8l f. USHHb# H@ H@H HtTHS H H`# H HCuSHl^# @uKH HCH[] D$HH%D$ @ H H݀@ueH=r6 D$ H=tr6 H/ D$HHt, D$HtHEH=kr6 D$ D$HHk ATUHHG ?%HH3%LgHIt$L;g }HGJ,1HwH]A\H|$ $H|$HGJ,1ATIUSHG HH9}mHHI+T$HHlHHH)H9rHtTHH<$I|$H4 f H$ID$I\$Il$ 1[]A\ HH9It$I|$1% HV$1HkHff. SH@H9$Hӌ$ HT H $ HH9 Ht H@HHH[9 f jc# HSH {H$ ?HHrH9thHBHHJHtH@[fJ(9J,sHRHVHrf. HHrJ(H H@HHH[HuH HD$ 11HD$HD$ HD$(HD$0HD$8HD$HH H=H3HHT$HD$ab# ff. Ht H!AVAUATIUHSH@ (b# n HH6 IHH1H HHF HH"% HH- H H%? D9t _$L9rJ H[H9T L ID$H= x A|$H;$ ?HHJH9D LrIHBH LHHr HHH1uPu3u HL[RH@L[]A\A]A^ fHt D tA9 EM7!H$ HH=$ H9 M HIEH@[]A\A]A^ B(9B,s0HBHAHH H@I[L]A\A]A^ D HHJz(H IHL IHt H@LH[]A\A]A^HD$ 11HD$HD$ HD$(HD$0HD$8HD$HH H=H3HHT$HD$IT$_# H sf D QH HG 11 HH S1Z AWAVAUATAUSH HO LoH;5U\# H|$0HL$8HOHL$ HG HG HG H E1LE1LD$ LL=Z# ISL9$ HLL$ E19f D @tCHQHn H I M9~DJHRJ H9 H;i[# tH;Y# utQ 1 @IM9E1H;wY# uEH t:H$ EtWH$ H;IY# 2 A H;Z# HS_ H$ EuM HD$L$ HDŽ$ HDŽ$ L$ DŽ$ HD$p HD$xH$ H_ E1E H|$?HD$= HD$`HD$(Ll$@Lt$HDd$TL|$XIMwI ML9- H ^ H$ I7IH9$ HWHFH H vH H 9 IGH9 Lt$pIwILt$L$ HH IGH9 IwIL$ HH w IG H9 IwI HT$$ HH| Mw( I9 IvHT$I>$ HHF IHI9r f D HT$pHH MWA MLMI9 H ] H$ It$I<$H9 HWHFIMHe H vH H 9 LH HrI7I9 LBI v)IIxIN L M9p Hg IH8I?HHPI9sWIWHxIHPHPI9s>IWHxHIHPIWH9s!H H8HHHzHHH9rf D H|$ t0HD$ HH9s#HHHHHHHV f D H\$`H94 HD$(M,H9HNIHD$I9Z HD$pH\$hHD$f LMe HT$L)HLM4I6$ HH) LuInML9 LHT$LH)HH\ H3$ HH uHkLH9srHHT$LH)HLt I6$ HH uInIL9s8LHT$LH)HH\ H3$ HHt uHkL9rɐL9s&IELH)HH HH)I| ՕH|$ Le HD$II9H\$h$ HD$ H L$ IH$ HH$ DŽ$ E H)\$(D Ll$@Lt$HDd$TL|$X> Mn HD$0Hx H NU# Et H|$ H$ L9 HD$0HL$HhLpHHHL$8LhHH HT HtHH H[]A\A]A^A_HT$pHH Lt$HLl$@Dd$TL|$XM 1 @ HG IHG HG Hp H|$^11L$ HDŽ$ H$ HD$L$ $ HD$p HD$xL$ HD$0Hx w H T# IM HD$ L)IT HL"H9s)HBHH)HH HkH)H<H~Le IMD1IIAoAoIf:f:A HA@L9uHHHH)@MIH8I8HHVv1;H@1H1*HD$H< Hl$pHİ H Iu L HH}H|$ IuLw HCHBL|$I IuLO HCH<I IuL, HCHI Iu L HC HItkIu(L HC(HItLIu0L HC0HIt- It L HHS HD$HH9uLl$ IHL$ HqHHHH$ H w HĨ 1HL$xL$ H$ L$ $ HD$p H$ EHD$H< LIT>HH2HHHpHJH9rIT=LHH2HHHpHJH9rvH|$ H P# ~G1f D I<H/tJHH9l$H|$ HD$0Hx E]dHD$0Hx sHGHP0HD$H9|ID$IiH9 IT$I4$HBH~H DBH( vH# HG D9It$IiH9MD$IpH AxH RH H 9pM\$II9[LMHJIpH A@H5 RH" H 9III9rHvE1'H1H@L PH|$x1HcHH HrHH+$ HHHHHރH9~DH9~HH~:pHcHH9 ~$H|$p H$ H)H)빍PHL$ HcH HcЃHH $ HL4 IH4 H4 HHT$ HD$(IHI9hHv11HA HR11HngHD$ Ll$ IHHHH$ HD$p H$ H8 1L$ H$ HD$L$ HD$xH$ M*H|$H KM# ]HD$0Hx 1t)HcHHHHH H9 Hl$pH H$ j1t)HcHHHHH H9 c H H?$ 1t)HcHHHHH H9 }HHc HyGI1HHH H?HHD$`HD$AHR1d1HInI{ >IKH|$ HAzHl$ E1E1ɿ A @ H D @ HRH 1H@II9 JL9z Hz HRH;BEt.H;J# @ HRHH 1H@IJHRN L9B I{ 2 ISH;B6E^H;J# 0H;H# D<R A )1"H;H# uxR A e1^EH H$ H L9HQ H$ H$ $H;G# H H5 HH$ H S HDH$ EH_ H$ HHAMI{ H;pI# uwHQ1H@HxA HL$JHRH1H@HHAMHEHH H|$ ~A17H;0G# uQ A EvHj H$ 1cHD$H< |HH Iu LW HH4 Q1H$ N1HHD$ITLHH2HHHpHJH9r Hl$p^1HD$(H\$`H9HNIHD$HD$H< LEFHD$H< MY USHHoH^F H9HHNը C @" G H0 t7@tH0蛊tH []HH脊u1H9H[] ff. H HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ HE# H$ HE1H@ HT$HT$ HT$HHH$ D$0 H f. AUATIUSHHH. HH : Ll$Eq LL$E1 LR HH HL$H| HEH H@8HD H 1HH1HLHg H|$ H H;H/ H|$ H{H/ H|$~yH{H/ H|$~cH{H/ H|$~MH{ H/ H|$~7H{(H/ H|$~!A J<H/ IL9d$fL9 HHH[]A\A]HH?E1HL3. HH|$ HGP0KLD$ Ll HHp HGP0HGP0HHP utHE q mHGP0HGP0HGP0HGP0HHHLE1[1]1A\A]t H{ HHHHPE1LQ H f ME1 AWMAVAUIATI1UDSHHH|$HH $3H H $sHL9 oLt$ LD$ HALl$Ll$LHD$0Ld$H:I$H LLHdID$H LLHID$H LLsHYID$H LLNHID$ H LL)HID$(A Ht/LLL $L $H KIL9u @ HD$8 I HHL[]A\A]A^A_A A A A A H< H $uIHH $Lt$ Lo L$ HALl$Ll$LHD$0FHe UHSHHHHHC t+H@8HHt HLHHH[H1] HXHHHH?[]* ff. fAUATIUSHHHHHH?HHt*H= <# I4$H9u Ht!H9^t HH[]A\A]-H=;# H9u1HHH[]A\A]1 ATHI1UHSH0 H9 HH @tBH?# HKH@ H@H HCHrfHnH HfH:"CHJfHC@HC Cfo5 HC(Hǃ C0MtLH2 uH[]A\HHu1H1.6ff. AWAVAUATIUSHH(HVH5Q=# H9 H=:# H9 HX H HHH H9p Ht?H9p Ht/H9p( Ht A J9tz IL9uH~LH9xb Ht<H9x R Ht,H9x(B Ht H9|, HH9u H; ;# H HH HEH HHtcLhL;-x<# H$ IExHHHH HLD H<$H/uHGP0f H Q=# L@ I|$` H$ Hm H@ H@`HH([]A\A]A^A_ @ HSHsOHH HH9u D L9t HSHu1H([]A\A]A^A_ID$H H4IL$ H IH9 Ls(Ml$(HK LHu|M|$ HSL9 HsfHnfH:"H9 Hy" HIHH9 HU HtHIU HUIUHEHP01L-_$ Hy ,f D HH;k Ls(HHLH0L9tHtHPL tǃIT$LHHd uID$AD$1fHnHYflAD$HHL%s^$ HtWHt(IHtL9tHINLL^ HInHU HtL9tHHMLL5 HHHU HtL9tHHMLL HHHU HtL9tHHMLL HULuHHtL9tHINLL IVHtL9tHINLL IV HtL9tHIN(LLr In0Hf1]1HD$HCH&IT$IkL$ HHH9 L|$Lt$IHl$MLLHHD HT$H4$L t H75# LH02 VL2 IH0H<$0ID$LHH& `f f SHH_H Ht,HHtLHPH HtOH;z6# tFHH[H|$œ u H5# HSH5 y H81e 1H|$H[* H5# HRH5y H816 H1/f. SHG HH=l7# HHg8# H@ HpHHXH@ HRH HPHyfHnH H7fH:"@Hq[fHHG Ht H HD$ HD$ff. @ H7# SH@ H{` u[HI3# HH00 tH[0 f HWHt5HGH;B} HTHHGHH HG H*t 1H @ HHBHP01H AWAVIAUIATUHSH8HHG IME1M!LIp HH](H9HSH HBHSHu[L#MG HMHqM H}H@HuHWHUHL+LsH9> 1H8[]A\A]A^A_ D L9t+HLDHH9uIKMDI!P D L#M9 H 5# I9D$S HE(I$LL HL$LD$LT$HD$ LT$LD$HHL$H H1# H9GRH54# 1H9H/1 I,$ H9t:HE H|$ H9}(L9#!~ M M92Im IELP0 @ HP H8HH[]A\A]A^A_ ID$HL$(LT$LD$LT$P0T$LT$LD$HL$(?L',KI9ELLHL$LD$LT$ LT$LD$HL$.mHuM/MwHL$(T$LD$LT$ HL$(T$LD$LT$I,$)ZI,$RID$LP0BAWIAVAUATLg@USH Lo Ho(H@ Hv8H H? Hv HH9sHH;t IHT$ILhHHmL1HT$HHIHLrI_(IMw IGI9G HI9r8f D HHt!HpHL!HHHH: u6H HrHI9sIL9 1HĘ []A\A]A^A_f D LG M9 Hz Hz Hz0 Hz@ HzP Hz` Hzp H H IHII|L!HHHH: -LG M9riHz 0 Hz ; Hz0 9 Hz@ 7 HzP 5 Hz` 3 Hzp 1 H , H ' II H<I|8L!HHHH: LO M9riHz Hz Hz0 Hz@ HzP Hz` Hzp H H Ie @ yHH<HH|:HLiH H0H@HPH`HpHH L9 HGH9GLD$1 HLIHA HMIG Io(IGIGMHS$ IM9)IH9tHtIOLHLD$s LD$HGS$ 1 LIIIG LMg(IGI9GA |IqfSHOHHWHAHH H HAHG HgHHu H[透H/uHGP0SHHHG`HtH[HH[H1AUATUSHHHwL-P/# HHuI H9 HSH HBHKHH HHBHSHHcHC H9B0m M@ M]A$ 1k HA$ HHxpHHzHe H/ HMHtKHzHD H/ HHt*H:HtH/ HrH|Huf D I@ HPHCH HHH{H H H;=I-# H H<H{H Mt&A$ I$ A$ t~ H[]A\A] D HHGP0HSH%H9B0E1 HCH@ MuI@ HCH HCH HyX[]A\A]t f D AWAVAUATUSHXH HGI IHHF ^ H/ H9 J H9t HvHu1HX[]A\A]A^A_ LGI} M I}( H;w OuwLY HHI H/tRIG(I_ HIEIGHk\: HI} H[\: IGeI ZLvMl 맸 H HH HHHH9a IG H H HHH9 IE Lp1HD$HHD$@HD$HD$0HD$HD$8HD$HD$HHD$ E IE L9pLD$HL$LHT$Ht$ 5 Hl$8Ld$0HT$@HE I$uFHE LHLI$wI,$AtfHm zHEDD$(HP0DD$(aHLHT$(1 AHE HT$(LHI$LvAI,$uID$DD$(LP0DD$(L" HHH HI!ML0HHu) I.tmID$L HHtf HL諷IH LHLaqHm uD$HEHP0I.L$uIFL$LP0L$|L HJ H@HHH1HHH LHpHLnHLضIH-YTfU SHHHH O HHHVUUUUUUUHHH?H)O HHHl2 HhH# Hs Hx o oNHoV P o^0X0of@`@onPhPov`p`HVpHPpH HH| HS LWz LHA M~+I11fI Ht)HH HLHL9uH[]HHHLL9uH HHHO HHkHl0 HhH eLHHWM~LA IbB AWAVAUATUSHHHWLw(Lg H" HOHBHHH HOHBHHgHG H9A0 L- '# I@ H 10 M MtI,$tkI@ HPHc( OwH5## H9sufH( H¨ Ht! H t H[]A\A]A^A_ÐL I@ HPHc( O~HKH@ Hu D HOHH9A0L-$&# 1M*ID$E1HD$K<Ht4 IHD$I9|AFLH)V^L aI@ HCH HCH $H[]A\A]A^A_Am AUATIUS HO LoH H1M~: H{ Ht H/ H{(Ht H/ HHL9uH&%# H@ A|$HPu3Hc O'A|$ t H L0 H[]A\A] H=aP$ HL[]A\A]%nP$ f D HGP0g @ HGP0j @ MjH1H{(HtH/t+H{0HtH/t,HHL9u5f. HGP0 HGP0 H HuH"# H H!## H ff. UHSHARH## H@ H@ u*H Hu7H c HH1ɉX[]项 H E1AY[]H AX[]阐 ATUSHHHu HH H Hd L$ 1J,#H95 IًLCIIIA9 I9 M ItxItcItNIt9It$ItAI9 AI9 AI9n AI9 AI9 AI91 AI9 I9srAI9_ A9 AP9 AP9b AP 9C AP9 AP9 API 9s HH H < Z@* HB0IJ<#H9; IL$Hv+IIIrIIIL9 LL9 3@0s@ps@ps @pHsH9 s@ps@ps@ps @pHs H9 s @ps$@p s(@p s,@p Hs0H9szs0@p s4@p s8@ps<@pHs@H9sUs@L@@psD@psH@psL@pHsPH9s,DHIEHDNEHDNEHDNEHH9rHHHHHHH9sC HKH9s6KHHKH9s'sHK @pH9sH1HH@pH9r[H]A\ < `@HrH8IHIJ #H9 LCL1HL9HBHL9LHBHH9sHHfNH/ fo oIoSo[0Iffff8+oS ff8+fo y fffg It\H{@A ooWMIog0IH@fff8+oWffff8+ffgBM9uIILNHH@KL)M9 ~ MIIA~A~RA~Zfff8+A~Rfpfff8+~ fpfffgfpfB@HMHH7A0wApwApw Ap ց l Mց nց ^ց aNց >H RHց ց ց eH# H5S^ H81艪 1Kց 'HIE1Hc= 'Hk8H # H H []A\H # H W H W HBH @HBHHHL?G DOIHHL DOHL DOHL I@>f D @ SHHGHLHtHH[ O Hu @t8HG0 x3Hk8H# H H9tH HD$HD$HGHƃH# HHkPH ff. UHSHHHHHHHsHFpHtH@HtHHHH[]HVhHt HGHH`Ht H u Hz( uH=\ : Z[]HG# H0 HHYHH[]C @ Htbq AUATUSAPH HGH HOH H( Hl H9 udHG H@HHHH9|JHH111HH|HCH{ HEtHZZH[]A\A]:HHI HHtV^[]A\A] HG LhLhLb IH H=# HHAD$Hs(LH)HHH)HHS fHnfI:"E HCHEHjI: HHEH[I: 1HIHL9}HS(HHtHH{ HX AWAVAUATUSHH_H IgV/'HE1IO'=I녱y7JTHJHAxH6HHt\IILH IIL9uHc/'H1øK*\LHHEH[]A\A]A^A_f IgV/'ff. @ AVAUATUSH HG H# HH9FubHVHtXH# fHL$HH@ 1LspLc`HCpLkhC`LLLHc HD$H []A\A]A^HHt$DHHeHt$HG`fHHGhHHGpH1HGpG`ff. ATUSHHHu8H`HkhHs`LcpHShHCp HuGHuZMuhH[]A\ @ H# H9Au^H`HkhHs`LcpHShHKpHtf D H/uHGP0f Hm uHEHP0HL[]A\ HHT$H4$ H{`H4$1HT$HkhLcpHs`HShHKpHAff. H?H;=# SHu HuHnHH@H [H# IHHHH@ [HfAWAVAUATUSHHHFHL$L M& IHHIMPHH" MuqC E1PS LHLA׃C Hm Ht+M9 HLH1[]A\A]A^A_ HEHT$HP0HT$fIE u~IUHHD$I}I4dV IHC PS ZH5hW H I> I.TIFHT$LP0HT$;MHHH]# HV H01 H1[]A\A]A^A_ G PW ~1P蚨 ZAUIATIUSHHH.# H@ H;=# H8 H LLHH1HHWHH L@L9 I( Ht(Hf H9uNI|$ t&Hg\ I98 PHH[]A\A] @ MtIE tI} u D LLHЅyH 1HFHH#HLUWO~H# HKH1Hr H017~ XfH HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ $ HD$HD$ HD$HGD$0 HGHWHE1IH H fAWAAVE1AUE1ATIDULLASD˃Hh HD$X HD$`HD$PLD$8A@M<:} ~C<; <| EuVL# DC <e AIE1 E x<(u <)uEA D Iu HD$ EHL$8EX A* n IcH9 McL9& HD$8H H$` L\$(Ll$PE1H|$Lt$HHL$\$LMIHՀ8| HD$H8(K| L HLA LSLD$L$ a Y^H HD$HIHD$8L9uHL$ t <(<|@!p@@@u:D$\G A Hh D[]A\A]A^A_ EEDI&HI# uxf D HHD$8'f. E LD$ E1t E1PEVAyAoHLd$PL\$HHt$8ATh L$p L$ []HL\$u"D\$\E ?1E1HD$ Hc$ LD$ LHH$ L AMcHL$0LHT$(Ht$L\$LD$CHD$PHxt$D$\ LD$L\$HT$(HL$0 IcH9H|$ AH e H HELhn E9H Un LEH ` Mt;RELH5ZT PH* # H81؛ AYAZH|$P AH > L H # Ht$ H8: H|$P}FH|$ uAH H HELm E9VELm GI1H$ L\$($ H\$0LD$ HT$0LHID L\ A,HLLHD$HH$ HD$0ISh LL$L$ e _AXHu8HD$HIHHD$8L9BEAA L\$(IW @ ATIIAUHV1S1H H$ HD$ HD$HT$BH<:tT <;$ <| L# A <e H1HT$BH<:uE1LD$E A H H\$Ht$ LSh L$0 LD$0 ZYHu|$ H []A\ftQ!<(tx<)Hf D DDHA;I11E11 Hc|$ HT$$MHH H! j HcHH?HD$H^D$ HD# H5P H87 H|$ã ff. ULMSHHHLL$8HD$8(t-Ht$HAQLL$@Z Y^HuCHD$H1H[]HHt$HD$AQMIt$83b _AXHuHD$H1҉U f AWAVAUIATULSHXL6L$ E AC<8oHH IHcAMFHAV!0 & /w*HSHH8M$1HX[]A\A]A^A_ @ HCHPHSH H8AF<*<# / ЃHCHAz2IE Ht$HLLL$LD$T LL$HIzHCH;D$HLD$L3BH# A˾ H\P LL$H81LD$D\$ә D\$LD$LL$/ ЃHCA~#HV AZCIE LHt$HHT$LD$ HT$HHH9 =H;D$HLD$v /U HSHt$HLLD$L2H DD$HHELD$ H Hr H A / HSLLD$L2M LD$HHlHLD$_HIILD$EM./ HSLLD$H7b f. LD$zu聓H N/g HSIEH A} L+/; HSLLD$H<G LD$H$ HH= s/ HSIEH MA} HI} AU F@ I0 AE H/ HSLLD$HsF LD$HH H= H= f/M HSLLD$Hc LD$HHy H// HSLLD$HE LD$HHI Hp/ HSLLD$H ` f. LD$zVZ(/ ЃHCA~*HMF HLLL$LT$LD$袕 LL$5C HLL$S! LL$LT$H ?LD$IcBPHIARHHH/x ЃHCLLD$H衲 LD$E 1;D/ ЃHCA~*H;HT$HHLLL$LD$HL$貗 LL$HHA~#HL$LD$ E / ȃHC H MFH/X ЃHCIUH |L({/ ЃHCHIELD$ Le\ LD$H7/ ЃHCHIELD$ LH LD$H @ / HSHƉ H42/ HʉH IUMFHX Ht HPH~9H;pt]Ht-H9p tQHt!H9p(tEHt H9tt3HH9uH~LHLHX[]A\A]A^A_z f. L)7 HCHPHSH0HBHCM @ HSHBHCHSHBHCHSHBHCVHSHBHCHSHBHCHSHBHCHSHBHCfHSHBHCHSHBHC HSHBHC聍H_HUkH7[HyKHHCHPHS HCHPHSHCHPHS9HCHHHKH9HD$LD$ ;HT$H9&LD$HCHPHSgLHH=w L$E6 /wnȃHC HAZIE |Ht$HLHT$F HT$HHHD$HHMFHCHPHS HCHHHK돃/ HCrщ3H Eo/wmHL;-8 # Hu AzIE Ht$HLLL$HL$i LL$HaHL$HHD$HHMFaHCHPHSHCHHHCH EuH9H Hu/ HSHƉ L<2/ HʉHLL$LLT$HALL$LT$= yMFԊHSlH " H5xE H8 + 3AE uHCHPHSCIHHCHPHSHCHPHSHSH" H5D H8* LD$HCHH@HCHCHHHCL: @ L^IMHSIE1KDLHXHAtIM9uL[LHAIff. SHH HtOHK(HS Hx HuQHx( uWH H IAHuBMu L MuzH9u'[H" HK(HS Hx HtH9uH9H(HDH[H LII9 tjHMu L MuvI9u taH xIL9k tHHVH HLIMtM2L M"H uIL9tM` HHG G @t! t HtHGHG tEHG0HH8 u Ht$H<$ t;H<$Ht$G @Ht u HG0HHG8빨 tHGH먄u1HG0HG @ AWIAVAUIATUSH8HcFIH= H= K H= H_`H- Hn HI 1E1HD$HD$,D$ HD$Iw0HT$LgHHug|$,H9\$ I8E9wtHt D$ LDL#H8L[]A\A]A^A_ H= HHb H@H;u" HF(IO0H9H0 H; '6 H$ H '6 H L Z'6 H$ Mf D HPhH8Ht#H9uIHPhIzH8IHu I IH HcPH ( H P H IE`H H_ HH8 R H&6 H HcRH H H IM`H H@ HH: 3 H H]&6 HF Hc@H= H= H= 2 IM`H- HtHH9 t H HH &6 HHt`L%6 HcQH H z H IM`H HtHH9 tHuDHIJIHuH9t/Ht*Ht.H9n0t(D$ nHh%6 1HMgHuHF(IH9xuIX HNH HPH~H;Ht@HtH;H t4HtH;H(t(HtA J;LtIL9unfHn0H_hH- HqH;" t>H;5" z D$ MgLH IMPH HVHh H9BuI8 H9uI8 QLH kIEPH [HH_pH- H H_PH- HmH-" LH= IMPH- IEhH IMhH 9H LIEpH IMhH- fIMpH L a#6 MAIMpH- 8IMpH IMhH ~IExH9yH-&" LH9*H HuIMPH 8H"6 Hzff. @ E1 ff. HG SIHW(IHH/ HW HZH H9~ J LZ Hz tpHHHLHz H HHRHyHMtnI MtqIMuq [HI0H9~I{ * H9# D 1[ @ H@HII{ IKI;ISHHMuMuf D Mt I8 HHHzH9~Hz t HHAHH H9~Hz H9 1kH`H9GVHH H)HIIHO ILHHL; HyHHPIKH9I{( HIHHH9c1HIH911 D SHH|HHtNH@H Ht4H HKH9uH; " H[酵 D HH[HHHH[ AUIATIUHSH(HH?H I$0 Hv<H9 1L<HHDA$ @ H=i" HKH@ H@H HCHrfHnH HfH:"CHJH I} HG HTImH;-" H|$Hl$ H|$H7H HHT$HKHE HHSH H{HkHH{ HC H H(H[]A\A]1LHH/H<H=Z" fHD$ HD$ H@ H@8HxHHw HL$HT$ Hl$H;-" 1|UHSHHLFA IX H7 HPH~IH;h Ht9H;h Ht)H;h( Ht H;l HH9uHa" HT$HH_ %? HX H HPHQH;xtMHAH;x t=H1H;x(t-H! H;ltHH9uf HHHIHL[]f I HI HH9tH Hu%LH9tH Hu!fATUSHFLg I$ HHHlHY H9u11 Ht []A\ÐHuHH~& 1f. AWAVAUATIUSHH(Lo MHF / H~ MX M) IGHD$HqID$A I9GJ HD$IH$KDH HE H" H9C HSH H $HHHl$Hu1H" H@ Hx` HD$II9| D HUHE H HHE HtIIt$L9 H= H9uRH;5c" H H$ Hm H HI/ H(H[]A\A]A^A_1 D LHf D HHH"HL$H|$A I9G HL$II9 K9DuHD$I9sIGLP0aH5 H9cHE HH4HR0)HUH" HH_ S* uMX M[VQLff. HHLGHFHHR HX HtwHJH~9L;BtMHt-L9B tAHt!L;B(t5Ht L;Dt#HH9uHPLNM@HHx(Gm11H1HI9tH Hu SHOHHWHAHH H HAHG HgHHtH/t/H{HtH/t)H{ HtH/t#HCH[H@ HGP0HGP0HGP0f H" IHHHH@ HAWAVAUATUHSHHHILI?H(HC H@8L$M MudHR I9\ H" H@ HC0@0eH1E1MHE 1HH(HH[]A\A]A^A_駺 Ix tLD$L輝 IHL|$LHHH?LAMoIM I>H/ I I~H/ I~lI~H/ I~XI~H/ ItDI~ H/ It0I~(H/ It I<H/ HI9uH=$ Iv$ I/t 1L 1HAIIGLP0HGP0)HGP05HGP0=HGP0EH(IHLHH[]A\A]A^A_HGP0+HGP03HWHD$R0HD$6ff. @ UIHSHHu" H@ HuAI?MurC PS ~NHUHBHt=B MH}1ЃC H[]HT$HHH蝑 LD$)1H5* H=| t1HLD$z HHtHH" LD$HHg2 H01R H1wff. USHHHWH HBHOHH HHBHWHHgHG H9B0 H@" H@ Hk 1 H{( HC@uSH{HtH/t\H{ Hu}HFHt! H t~ H[]f D H{8HtH/uHGP0HGP0 HWHH9B0,yH@ HCH HCH X[]- y D UHHSHH HE11H1jHH HE H" H9Cu/HSHt%HHL$HHl$H+t6HH[]HiHHKHHL$HlHl$HCHHP0H AWfAVAUATIUH- SHH HDŽ$ )D$PDŽ$ )D$`)D$p Ƅ$ o HdL$0HD$xHCHD$@A$ L<%uaf. <%tCHuHL)uƄ$ H|$PLV IL<%uAD$I\$<0 H5" E1 II<.A kS<lR <z< 11E1{ <c <@l <% H|$P% %N F D CHEHt$pH\$PH $ HD$P u&HH;sm n HHoHHĘ H[]A\A]A^A_HHHо 1E1{ J H H! j T$0/ ЃHD$@T$0HLd$H5I 1Lb LcD$<XS<xUH|$PLLj H f A<"HcD HD$0/ HD$8H|$PLHPHT$8H0Lu i @ D$0/ HD$8H|$PLHPHT$8H0Lr *n D SHAS0LcH HIgfffffff0IHcI)LI?IHL)I9SKD L,AHv I0HcI)LILH?HH)L9SKD L,AH I0HcI)LI?IHL)I9jSKD LKL,AHtDI0HcI)LI?IHL)L9'AQKD IL,AHuL HT$@LD$0H2H|$PLOs HT$@LD$0H2H|$PL q ofH<%\ HH<%7f. HT$0/ ЃHD$@T$00 ,H|$PJ +T$0/ ЃHD$@T$0H8 IHH|$PLLHHr LT$0/o ЃHD$@T$0H8O% IHH|$PLLHq !LOhT$0/ HD$@J։L$0H40/ HȉT$0H H|$PLLHq T$0<u <xP E / ЃHD$@T$0Ld$H5 1LLcM9LMMM9IM|$d~& HD$hH+D$pH9 M9 M9T H|$PLL TbƄ$ JnF/ ЃHD$@T$0HLd$H5? 1L(LcAHD$8HPHT$8AT$I\$A H5" IH H0LcHD$8HPHT$8nM)AHt$pH|$PLLD$0 H`Lt$pLD$HD$8HPHT$8HD$8HPHT$8M)Ht$pH|$P0 LLD${ HLl$pLD$t/ ЃHD$@T$0HLd$H5m> 1LLc/ ЃHD$@T$0Ld$H5 1LLcE z ui/wTЃHD$@T$0Ld$H5= 1LcLc|HD$8HPHT$8MHD$8HPHT$8rHD$8HPHT$8몃/wcЃHD$@T$0HLd$H5}= 1LLc/w?ЃHD$@T$0HLd$H5@= 1LLcHD$8HPHT$8HD$8HPHT$8H|$P LD$)L LD$WHD$8HPHT$8ЍH HHHH H11A THt1HHD$PH" H W H W HD$8HPHT$8gHD$8HPHT$8gHD$8HHHD$8H2<luEsNw(HH1 E1 E11 1Y/w/ЃHD$@T$0HLd$H5; 1L?LcXHD$8HPHT$8/w/ЃHD$@T$0HLd$H5k; 1LLcHD$8HPHT$8 @ ATIUSHHm H? H {~vaHCH+C H9|TCuvHS HCHH @ HtA$@ HS HHS 1[]A\ D Hf HHI ECt HS HM,LHH4HsLHH9( HMT$E1L)HHHHL9IBHHL9IB1LH<L9M<f<NHf. I$HIT,HT(HPHH)I)HHHHI<$ HHHH:H9H HthHtVHtDHt2Ht HtI|$ HzI<4H<2HI<4H<2HI<4H<2HI<4H<2HI<4H<2HI<4H<2HH9QI<4HNH<2I|4H|2I|4H|2I| Hq8H| I| H| I| H| I| (H| (I| 0H| 0H9HWH; Hf. {4 wHL H1C5HH HS H A$AT,T(HS }AT,fT(HS iDHHfDODHfDODHfDODHfDOHCHS HI<,HLLLLH9HMT$E1L)HHHHL9IBHLL9IBI1I H9A H D UHSHH H H-HHY @ @xHr0HHH IHM IIxHHL9 H HtlHtYHtFHt3Ht Ht HM HNHL H HHL H HHL H HHL H HHL H HHL H HL9seHL HxH HLHLHLHLHL=HG8HL>HL=HL>HL= HL> HL=(HL>(HL=0HL>0L9rf H<H1uJu-uHH[]f D HH[] 4f4Ht D tHk8H" H H @ SHw H Ht-5 H uHHH;sth^ HH[6Ht 1HHtH5" H W H W H[f H HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H" H$ HH@ HT$HT$ HT$HHH$ D$0 vH ff. fAVIAUATIHUHSHHI" L@ I<$HT$HD$ H\$HtOt[HCHH? t[H@8HHtNLLH1HLHHH|$HH/t@HH[]A\A]A^HCIHU uHMLHH?L謻HGP0뷐AWAVAUIATIUHSHLI H" I9 { H " I9D$i LLZHH H H@ H$ A A 9 HMHHL$ HELHh H HL$HH H IE HM 1H[]A\A]A^A_f D H H $H @ H$ E1A fHW]H H8H HLH|$aRH|$HP H/ H " H@ Hx` E I] H []A\A]A^A_ LH]IE 1 fH\HtH8Htdf D H trHUHHIE H+H\ 1 D H`\HWH8HKH<$ uI H I] 1A tE1H \HtH8E1HHUHHH$HIE :\1.H IE &\HH\1 Hw" IWLH59 H81\ LH 1[ Hi" H@ Hx` _"H[1f D AVAUATIUSHH?HH" L@ HP HHHGIHrH9u|MHsH}& HH AE PAU < ID$(H@HX H} HH+ AM QAU H[]A\A]A^f. HX H HJH~OH;BaHt?H;B QHt/H;B(AHt H;D+HH9uf D L 1jHSHD$HR0AE PHD$EHH HH9_ HHtHHs" H5 H81Z H1H5 L` ID$(H@Hwr H HPH f. H ATUSHHMt@HH It3HAH It%HAH It H<HHI9uMugH HH HC1HHH H9 k HI H( C HGH9tvH0 L[]A\IAH~N N I;HHsJ|HH`J|HHM MHIH9u2H/HEfHnHDfH:"( Hw" HmH8 YE1Qff. fAWIAVIAUIATMUSH Hn0H0 LL$ULuDH\$HcH H+ H8 H)HH9 HH0 IEL+HE HCIEHk HCM3 H|$H E1LHHWHG HGfDGH|$ H1HL$Im0HL$MHcE8U@LcڋU0 ML9LNE1M~NH1H\$HsHIt<HqHsPIt.HqHsXIt H<H\$H|HHL9u @ M9m H|$ HcU8L9 I9 M@s HD$HĈ []A\A]A^A_ HcE8U@MLcڋU0*HL$(L\$0LL$HL$(HINU0L\$0MHt$ LL$LHLHcE8L9LNM)f I}8H HOHH)L9 I9 H!1H9H\$ LLONI8 i L@I9H\$ M0NI: & L@I9H\$ M0NI: H\$HH4H9H|H HH9uHD$H@HD$HVJLL$8LD$HLl$0HD$(1Ld$@IHD$J|HD$(N,HaHG PLE`Hc]<MPL9 I4H H9 LKM9}`J K;|@ HSI9~DHPI;| HSI9~,HPI;| ( HCL9}I;| HL9| L\$xHL$XH|$PLT$pLD$hLL$`K H|$PHL$XL\$x H LL$`M9g H|$H HH|$HLL\$P Im L\$PIL9d$'HHD$ HH9 L)IL9d${LL$8Ll$0Ld$@OI MH HMIMI9H\$Lt$E1IMHH|H u-IF`I}@HtHDGH*H HDHHL9|LLt$M ~ @ I9< JLHT$HL)' HL\$@HL$8LD$0LL$(Ht$Ht$LL$(HLD$0HL$8L\$@HT$H H~@H:HxHt3HzHx Ht%HzHx(Ht LLTHH9uHn" HxH@ HRH HPLVfHnL I:fH:"@H~Ht$ JHcE@E0I](Iu8H1HH9 Hv E1HHAH=k{ 11l IM HH=c 0IH]& HHW& HDVEH] MPHY" HLUL c ATLEH0H[ 1. IH HIHu IGLP0Hm Ht$L' 1HD$ I)IH OI M0LDI LDH?LT$p L\$`J HL$XK4H H|$PHL$XL\$`O HI9JLd$PLd$hHl$`HLt$XMMIt HG 0 HL9|HMLd$PMHl$`Lt$XLHL$^ HL$HHD$ߵULIm0HL(HE Hh IEHFIEHFMIH" H H H11H\$J|H twII9uHSMM(LD$ HHL CHFH}HH=B$ A H)1i IzH|$H|H H/HLl$0}< Ld$ II](H" IM(MLHM H01+, H\$ H9\$HD$(H<H/oHHl$LHLt$(MLl$0MH| H/HL9|MMHLt$(Ll$0Hl$CHMLd$PMHl$`Lt$XH HD$ HH9 \Ld$ Ll$0I(L@飳H\$PLt$X,L$L Ld$ Ll$0IH HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ $ HD$HD$ HD$HGD$0 HGHWHIA HH ff. @ H1" SH@ Hǀ@ HķHKHH` Hq` H[ÐAUATUSHGHIHHHWLoXL C H{(lL6AD$tHu H[]A\A]L LAHCH9u H}M H LLht鹽f. AWIAVAUATUSH HGHH;G OHPHW QW Ãō@〃SdH HcH L0 HIW8H;BHRL,L;-"" Ll$h IE AoH L[]A\A]A^A_L HcHL) HHA HH> HD$hIHE H|$hzzLl$ht MI8L,[v AoUf. L8 HH=H1) HD$hIH=LH( HH IE H @ Ht@tT.fT( D dI8L|ZP+ L` HcHHD$hIŅU MHLHIEHLHIE HLdHƼIE(HLEHIE0HL&HIE8HkLHiIE@HLLHJIEHH-LH+IEPH IDHH9LHu L Hc4 HL& HH4E1N D I8LX HT.HMHHHT(HL IH=?Hu >Z<1设 HD$hIąںI8u HHy MǺLd$hMuE1Lt$AHL9l$ LsHHLHD$. HT$H蔰HD$ @ E1L1L\$h Hl$XD$D L HD$HL D$@A L IŃLu D$8 LHD$ H LHD$0H8LHD$(HLnHD$HLXHD$HLBHD$HL,IHwLIHZL HD$P~LHHG LHHHD$D$ Ll$pLH$ HD$pD$8Lt$x$ HD$ HT$8H$ D$PL$ $ HD$0H$ H$ HD$(H$ HD$H$ HD$H$ D$D$ D$H$ D$@$ 5 HT$8NL@ HT$8HHD$hI0 Ht$ HHD$8HH Ht$0HtHHD$ HH4 Ht$(HtHHD$ HHe HL$HtHHD$ HH_ Ht$HtHHD$HHY HL$HtHHD$HHS Mt I.] Mt I,$f Ht Hm p HQH*GHBHP08L " IM% Ll IH=bH:HL" HHlHp L B HD$hH= Ll$hLL@~ IA L HH=HL! HH E11?L HH 5IŅ:LH} I'L t" IML " IML譂 f.u zoQIŅLHb} IL HH=xL IH-H%HH9LHIHHHŃHD$HUEHHT$A IHMHT$IUE1\$LH9 L A= L = DADHL 3" IMLHL| HD$hIT.T(.HFHT$8HP0HT$8]HFHT$ HP0HT$ HAHT$ HP0HT$ HFHT$HP0HT$HAHT$HP0HT$IFHT$LP0HT$ID$HT$LP0HT$HEHT$HP0HT$wHFHT$ HP0HT$ I8{ HD$XH$E1LLT$h D$D 4IG8HL$XH@HH8IE L(RHT$8c>HIJ\$1Ll$E1I݉L8 = L$A9u<AkAE9uˉډLLl$ATLLgz IHډA<tu Ll$hIG8H@HH8I$L 芨 酴L, ~ fH~f.\$zߵL f.D$f(ztfHn- IŅ.յ齵Ll$c\$Z\$Q镸θGf D AWIAVAUATUSH H =p A` A AWHA T$ A=p 7 HH&1A` A A HA =p eAW`" LEw H AG`Ew L IHt'A I9] EoA Lt HA A EoHq Eo`Ed Iw HY IHH~mH@HM HHt\ID$HMHHHtIID$HMHHHt6ID$HMHHHt# H| It$H<HcH9HYI$MG A H IL$H1HH>HtlHqHxH6HHtSHqHmH6HHt:HqH|H6HHt! L M:M HLH9uLrX HHM $M 1IL$H H H1H~~LAL_EUIMcK Ht]LAL_IXMcK HtDLAL_IXEEMcK Ht'A HYG\ McJ,H_IJ,L9uEl2HI9[A A HH[]A\A]A^A_MHJ4 LH HI H蟍 IHVE1HA A D$ AG1mA DJff. SHֶHXHCH@(H@ H@ [f D HHGHH;G ڶHPHW H D HH HɶH% HH HÐAWIAVAUATUSHH B p 1W` PEwA =p 5Ic_A9 IcIcIWH8 < AG`A_ A9_ HcH81 AG`A_A9_ IWA Hڃ:8 AG`A Ew E;w IOIcA Hс: Eg`EwEPA =p ӿA_A9 IcIcIOH8 Ao`AW A;Wi HA :1 A_`Ew PA =p A_A9 IcIcIOHف8d : E_`AWE& A9W( HA :8@ EW`EwE PA =p A_A9@ IcIcIWH ځ9 3 Eg`AGE A9G HA 88 Ao`A Ewl E;w IWIcH8m E_`EwEE;w IOIcA Hс: EG`EwE.PA =p ?EoE9[DIWHcAH4ʋnvt$Hʃ8t?A EoA Ew1҃A HHH[]A\A]A^A_Hx HHVH5 uL`% HtL裊 HH{ L He L HO L H9A PA =p A` پAG D$(HHE1A` HD$0 A yl$Dt$IH\$ LP =p d{` 7k AyH53 H.v H H] HH H9H {` I~ H Hh H~ HHD$8R H{ 4 HHHL$8H(LxHH L9d$0 CKID$( L IcWIGHЃ81A PEwA =p A` CLA_È HH A` A_&L耊 HA HQA` A EwzL IcOIWA Hʃ:8fHA PEwA =p ˾A` LAo HH A` AoL HHD vLE IcOIWA Hʃ:1hA PEwA =p gA` EgE;g"IWIcA HDh@D$ d L< Ht L* Hz A` Eg:d L H Lt HH Lۿ H : Lſ A` HD$ L荴 HHu AwIs HHt$DH LMG D` DL$ LD$踑 LD$HHHDAPATDL$0DD$ ^_HH uA HAEwA p A` AoA;oIWHcA HpDht$ Lþ H Lb^ HH L虾 H Lw HH" Lo H : LY A` HD$L! IH۶L- A` HD$öAwI r HHt$P LH MO T$0L$(LL$ 3 LL$ HHIAQL$0QT$@RLAUDL$(HL$8 H HH L IcOIWA Hʃ:8LԽ wIcWIGA HЃ88 L蠽 IcOIWA Hʁ: \PEwA =p $A` EgE;g IWIcA HDh@D$d L覼 HtCL HHt3 L脼 Ht!LW HHtL H A` Egų LB HJLQ HH6 L H L HH L A` IAwIo H۱DH @ Aw DLHHPDD$ A]HXH A FL OIcGL IcGHcL» ԲHcIc_GL覻 ̳HcIc_L芻 IcWIGHЁ8m A EwPA =p 6A` EgE;gbIWIcA Hp@t$D$ܱm L荺 Ht=He L$ Ht$LG HHtL HHv A` Egjm L/ Hn H{e L HQ L HH= L HH) L A` I L# A` HD$ AwIm HڸHL$VHHP Aw R@ LPDL$0DD$( H HH鄸Lƹ IcOIWA Hʁ: lPEwA =p lA` MA_A;_һIWHcA HhD` Lи HlL HHX L覸 HBLu IH.L A` HD$AwItl HDH @ EHT$Aw LHPJ AYAZHH阺L HM8MW DhDD`@X<H8LH0L@(HPHpHx ASARAUATSQH H0HH%rAwIHD$k H HT$IO DH D` HHHL$DL$m| HL$DL$HH,QHDHATDD$1 HXYHILl$Dt$A H\$ A D$(AGMC AO`7 Iw LHT$L$E HT$HI1L$HcI9~H<IrH<HLT$A L藶 H"AwIj HLT$DH HD@ QAw L$LT H LH ^_HHCL3 HD@DHPDH8HH HpHxAw APD@@AP@<IP H HH<RAwIi HWP H1Aw HR1ҋ@ PDL$0DD$( H HH駳Ht$0LHT$(HHH4 HD$0o9H#HT$(IPARAUATSQH H0H`A` Eg58 L Ht(d L Ht L HA` Egc8 LǴ H d L豴 H L HH L致 H : Lq A` HD$w L9 HHc AwIPh HHt$DH LMG D` DL$ LD$d LD$DHHHAPATDL$0DD$ HN LH A]HXH,HA A L HHr L膳 A` Z Ln HD LX H.L' HHAwI>g H-DH @ Aw 1DHHPDD$d AXAYHHVA AW`EgA A` EwĢ鿢r9z鎰A` PA =p .H ~ LAoHe Ht#L y Ht LH HA` AoHLee HHtHLx Ht; L Ht) L Ht1 L CA Ew1tA` Eg*m L蜱 HH\ L/ HLN HHֱL: HH±LF A` IL A` IAwI%e H^RP LHAw HRL@ PDL$0DD$(O Hp H LH HH nA` AoJ8 L藰 HM L聰 H7L P HH# LW H LFi HH L- Hʨ: L A` HD$Lߤ IHL A` HD$AwIc HkHt$P LH MO T$0L$(LL$ LL$ HHIAQL$0QT$@RLAUDL$(HL$8N H H LH HH:~e٧Ǥff. AUATUHSHHXHFHHV H)H9HHH^HX[]A\A]ÐH 7 ATAUSHӋjH9u7;jtQHRHcH8ĵ A9ĉk[]A\ H։k[H]D9A\Hٮ pHcSHCHЃ8bf. USHHNHHHu-Ht(H" H@HH# H H[] H 1H HHtHx HHr HHH1u1ut H[]Ð f Ht D t H" Hh# Hh# Tf D AWAVAUATUSH8 H{HGfHnIHHD$HG8fH:"$ H$ HO8HHFDHN0$ % HD$0 G PW W HN5 HD$H HD$C@HS HIHJ HL$8HJC@HL$(H HS8HL$@HKHL4HD$LbRHL$ HL$ ff $ HLcLc8MT$JDHHnH AT$IMIHD$HL$ ff $ I HHD$(HcLc8IAT$HL$HDH fIHD$ f $ II HLcLc8MT$JDHHE|$H MT$IVIJDHHH AT$IMIFHD$HL$ ff $ I HHD$Lc8M|$@dm HD$AMIHL$ ff $ HHD$ InILc8I)I$ Ds@ H5 f8 F AE {D Vj Lc0HLL$ L IcT$@HIlHAD$@HcIFLc8IVHHtHDHt H.j E|$MT$JDHH H AT$IMIFHD$HL$ ff $ HHcLc8MT$HDHH@H5H AT$IMIHD$HL$ ff $ I HHsLc8MT$H Ɗ" H9N HSH9J Hv AL$ A|$9~ HR 9J J HAL$HHHT(HtvHD$HL$II MtH IVAT$ ff $ I HDHL$0HcҋIM<IW ' fA*L= A H|$HcMbIHHcIFLc8IHM|$H|HDHt H/Cj HD$AMIHL$ ff $ HM~MT$Lc8LT$HIGL LT$HHk IHD$IAT$HL$M ff $ I HHD$Lc8Hc@dMdlvL HD$A$IHL$ ff $ HHD$AT$Lc8II HL$ ff $ II HAD$Lc8MT$fy fAD$E1)HI< AH|$0 FD% DHM<m DHi" I9Gg HcLLT$HHH)ƀ$ r IcHL$0LH? I/LT$Hr HcM4օ~\I>H/]m tJI~H/r ~7I~H/w ~$A K<H/ } ID9 AMcKHLrHU HD$Mb@d HD$ARIHD$0 HL$ ff $ HLc8MT$E1)HI< AH|$0 FD% DDHM<HD$0DD+@HSLc8MT$H i" H9JoHR AL$9J ]J HAL$HHHT(H6HD$HL$II MtH IVAT$ ff $ I HILc8MT$M&L;%" od L;%1" e HcI,$HD$IM$jHL$A$ ff $ HAD$Lc8MT$f fAD$)HI ƉHHHI<HuH#" H9G, HD$ARMbIHL$ ff $ HIVLc8MT$At$HJ9 ID$HL$IH fHnHD$fH:"AT$ AFff $ I IHI~ILc8M|$H/ s HD$AT$MIHL$ ff $ HILc8MT$M&L;%s" hb L;%" d HcI,$HD$IM$jHL$A$ ff $ HIvLc8MT$AT$M~H " H9NI9O}LFIHHkIHOHYAGNAl$IE1HH9ID$AIɃH.r I/x D) !Pb fՃg HL$IHcL$PHD$A$ ff $ H1Lc8MT$)HcI< T L$HM~H " I9OnIOy`AE HiMT$HAM փ INILT$PHHL$pHL$pAE LT$PHH)uHALT$pHP0LT$pI/4 D|$HAMcO4InHQP HD$@dHD$AT$IMHL$ ff $ HLc8MT$H " )HcI<HcIH9JZHD$AT$IHL$ ff $ I HIULc8MT$H E1)HcI< ABT= HcI4H @" H9NAL$9 HN0T$P9Q8HL$pLLT$H* LT$HHH O HcT$PHL$pHHM b r# ItHEHH9a I HEHI@HEPI@HEX~'I@HE`t I4HtHH9 @ AL9}&)H|H1LD$(H HLD$(AGHL$ HIH)H I~Lc8MT$At$HO9 HWHAt$HHHIVH/g HD$AT$ IHL$ ff $ I HLcLc8MT$JDHHȫAT$HL$(IH IHcAT$HDHL$H fIFHD$ f $ II HAD$MT$Lc8LT$Hfw fAD$HD$8MfHcHtLLT$HHHL I,$Z IFHD$MbIARHt$ ff $ HAD$Lc8MT$fO LT$HfAD$M~MfILLeI/LT$HHk I,$a InH2L HD$ARMbIHt$ ff $ HM~Lc8MT$I~Hz~" I9W`H9WVAGYGLT$pH|$H\ H|$HLT$pIFHH/^ I/^ LLT$HIf HLT$HoK HD$AT$IHL$ ff $ I HIVLc8MT$At$HJ9 Hz Hh At$ 9q |ID$HL$IH fHnHD$fH:"AT$ AFff $ I IHHC HLc8IL$ HrHxTxPHFHcH HDH~fHV GHHHTH~OHV(GHHHTH~8HV0GHHHTH~! LDHHcI LDH9HD$IIHt$ ff $ HMT$Lc8LT$HM~MfHcIH g" LLI/LT$HH[] I,$i] InHqI HD$ARMbIHL$ ff $ HLc8MT$)HcI4H> H }" HcMI8H9OHGHWH HIHH/e HD$AT$IHL$ ff $ I H1Lc8MT$)H5>~" HcI< L$pHcM<I9wMOAy MT$L$PHcLT$`IHI,HAQL$PLT$`HD$H~vH} H/g tcH}H/k ~PH}H/u ~=LT$`A Ld$PMIމJ| H/s ID9Ld$PLT$`LD$pHL$HHHD HLpI/ HrG HD$@dHD$AT$IMHL$ ff $ HAD$MT$Lc8LT$Hf҉ fAD$HD$8HcH$ HDŽ$ HtInH让L$ LT$HMF M~Z IF Hm c LHD$ARI.MbHt$MI ff $ HILc8MT$HcIM<IoI;o ` IGHL$HHD$HAT$IoMI ff $ HI~ Lc8MT$cIVH=y" I9~NHJM|$HHH/H*i HD$AT$InMIHL$I ff $ H1Lc8MT$)HcI< @ƍT5 t$pHcM<H {" I9OMO(Ay HcMIwI9p| MT$jL)LT$`HcHLD$PM4LAQLD$PLT$`HD$H~tI>H/i tbI~H/p ~OI~H/N ~<LT$P LD$`H\$xHI<H/ H9LT$PLD$`H\$xI( b D$pHM4HD$HIFI/| H|$H D HD$@dTHD$AT$IMHL$ ff $ HHcIVLc8HH|HTHt H/X AD$IVM|$INHH|HTHt H/wW HD$AT$IMHt$I ff $ HHD$(HcLc8IVE|$MT$HDH IJDHH6H AT$IMIFHD$HL$ ff $ I HI~Lc8MT$At$HO9 AT$HHHIVH/u HD$AT$ IHL$ ff $ I HE1Lc8MT$)HcI< ABt= HcI փHTv" H@ HvH9` dIvInMT$MFH@ H;nV AWH'u" HcM4H IFH.NV Hm sd H)I HD$AT$IMHL$ ff $ HM~Lc8MT$IvHv" I9WH9VLLT$pHt$H袋 Ht$HLT$pIFHH.] I/L ̠# 8] IH@ HD$AT$IHt$ ff $ I HHcLc8HD$IMdlHt$A$ ff $ HIULc8MT$H 1H5 w" )HcI< D| L$HDHcIH9rAL$9 xLB0E9x8LD$xeEL$E9DL$`QHLLT$PHT$p, LT$PHH? DHT$pDL$`LD$xHHEI "U AwJ ItHEHH9eT HHEHHAHEPHAHEXA~%HAHE`At H4HtHHA9Ic@8A9 Hz8DIcD)HcHTHHTHAW9~jHcD)HcHtHHtHAW9~IHcD)HcHtHHtHAw9~(HcLT ID)HcHTHIR@9uAPL9~#H|H1HL$()H HL$(D$HHt$ HHH)8 I~Lc8MT$Hq" H9WHHG M~H IFHGH IH/uR0HD$AT$MIHL$ ff $ I HLc8M|$I~1MfII99jR Hp" H IFH/ I,$HD$AMIHt$ ff $ HI~Lc8MT$M~H q" H9OH5n" I9wHyWI9WlIGIH,HE H/Fd InI/HU HD$AT$ IHL$ ff $ I HINLc8MT$At$HQ9 HQHAD$IvM~LHH4M Q BЃH@|@rH) HD$AT$ MIHL$ ff $ I HII>Lc8M|$H;=p" tHcM<oH/wr HD$AMIHL$ ff $ HHD$Ht$Lc8IAT$ ff $ I HII>Lc8M|$H;=-p" P HcHD$H/M$oHt$IA$ ff $ HM~Lc8MT$INHo" I9W=H9Q3HLLT$pHL$H' HL$HLT$pIFHH)Z I/Z IHc: HD$AT$IHt$ ff $ I HHt$ IFInCLc8H)H$ C@Hr}5 f8 Ȉ H$ $ AE IE8H8 H[]A\A]A^A_AL$Lc8MT$fs ALT$HfAD$M~MfILL LT$HIFHI/P I,$P HQ9 HD$ARMbIHL$ ff $ HMT$Lc8MfLT$HL4I,$LT$HHY IFH8 HD$AMIHt$ ff $ HM~Lc8MT$MfIt$IIGH@hHs H@8Hs LT$pLHt$HHt$HLT$pH.[ I/ 88 9ZN H"k" H AMIID$HD$MԉHL$ ff $ HI~Lc8MT$H5i" H9wQHWAL$HR 9J ;J A ILED$ILHT(HHIVH/>HD$AT$ IHt$ ff $ I H1Lc8MT$)HcI< @ƍT5 t$HH fk" M~H@ HIL9h rInMT$LT$pHL LT$pHH6 LT$pHD$HHM4INI/Hm AN H6 HD$AT$IMHt$ ff $ HMT$Lc8LT$HLc8AT$IHcH|$IƉfH IHD$ f $ II HHD$(HcHL$IAT$Lc8HDHD$0HD$f f $ I HIVLc8IHcIHINHL$HHD$AT$ ff $ I HLc8MT$HcLT$HFLT$HHH 5 "L IvHINHtEtlIvHI~HtEQ IvHINHtuES I~HcIFIH|utIHcH@I~H|sHHD$HMIAH|$ ff $ HLc8MT$)HcI<M~H j" I9OIVIO(IwH9ryAE HIMT$pAu v H_S H9J HLT$pHT$HTS HT$HAE HLT$pH*v HcM4INI/5H3 HD$@dHD$AT$IMHL$ ff $ HM~Lc8MT$IvHh" I9WH9VIGHPH)K HVHJHK HHAGHFHHGH= J GHg" HHHlHE InH. K I/<R IHD$AT$IHL$ ff $ I HA|$Lc8MT$INH_e" |$HI~H9WH9QHLT$`HL$PH|$p LT$`A1 H|$pAD$IIl$HL$PH/fD$`5Y H)$t |$HD)! I T$`f҃t BHt$IHLdE HD$A$ ff $ HAD$Lc8MT$f#p LT$HfAD$lAT$Lc8IH|$IщfH 1Lc8MT$)HcI< H|$0 L$HDL )DHcM<IW 11M M DDMT$DL$p)LT$PHL$0HHcLI,HADL$pLT$PHD$0E~wH} H/#[ AtcH}H/Gn A~OH}H/wo A~;Ll$pA MH\$PDJ| H/@o ID9MH\$PLl$pI/:D$HHLt HD$0IFH/ HD$@dHD$AT$IHD$0 H|$M ff $ HM~Lc8MT$IvIVH `" I9OLLT$HI豫I/LT$H/ HD$AT$IHt$ ff $ I HIVLc8MT$A|$HJ9 <AD$INM~HH8HHSf H*ơHD$AT$ MIHL$ ff $ I HIVLc8MT$At$HJ9 IL$H HHI A|$ 9y ID$HL$IH fHnHD$fH:"AT$ AFff $ I IHLc8MT$LcPHHcM<I HL$HMH LT$H, LT$HHH{ H|$HMH\$pLP H|$HIMH\$pH1- HD$AI<$IHt$Mt$M ff $ H1Lc8MT$)HcI< @ƍT5 t$pH5Ec" HcM<I9w8Iw(~ 'HcI<IOH|$HH9O MT$j)H|$0 LT$PHM4HF1HcLЅLT$PHD$0~]I>H/Ou ~KI~H/ u ~8 Ll$PMH\$`HI<H/h H9MH\$`Ll$PH|$HHHD$PHH[ D$pHM4HD$0IFI/z H|$0 + HD$@dԌHD$AT$IHD$0 H|$M ff $ HIVLc8MT$M~H ]" H9JI9OBA\GLT$pHT$HHT$HLT$pIFHI/N H* N IH* HD$AT$IHL$ ff $ I HM~Lc8MT$H [" I9OIVLLT$pHHT$HHT$HLT$pINHHg H H*g HiI/g HD$Ht$IIAT$ ff $ I HLc8MT$U L1LT$pIL}H}LH|$HQ H|$HLT$pIH/ x I/w LeM) HD$AMIHL$ ff $ HLc8MT$HcLT$H LT$HHH,) JG HD$IMIAHt$ ff $ I HLc8MT$M~Lc8MT$IVIvH=]" I98H Y" H9J'I AOH9JHBIHH8H0H/` I/v H*HD$AT$IHt$ ff $ I HIFAoFI}H Lc8HD$HIFMT$fI:fI~HD$pVH$ LLLT$p I/LT$pe d Ht$HAMIH$ H|$HHD$f f $ HH [" Lc8MT$IVH@ HIH9p M~Iw IOIFInHD$HHAI;O O IIH,I/IGu H*oHD$AT$IH|$ ff $ I HLc8Ht$IHMdDHD$A$ ff $ HIMT$Lc8M<$HHI<L" I,$LT$HD & HD$AMIHt$ ff $ HHcLc8M|$H,H}Hk HVW H}HHEHHt H/ޕHD$AMIHt$ ff $ HLc8MT$)HcI<HcM<փH5[" I9wIw(~IVINIH9zAE LFMT$pAu ` LT$`HHHL$PHT$pAHT$pAE HL$PLT$`HD$HH*m` H)F HL$HHM4INI/|H$ HD$@dDHD$AT$IMHL$ ff $ HM~L;=W" Lc8MT$-S HD$AT$IMI/HL$I ff $ HLc8I~MT$1HsLT$pMfH|$H*| H|$HLT$pIH/H`r @t IFMfIGH@Xl @ \ 1Y HD$AM<$Mt$H|$MI ff $ HLc8MT$I H|$8LCL%T" D$HHHlM9`kHCHD$pL9`XHV" H9EsLeIeLHLLT$PL$ L;LT$PHYq Ha= H$ HP= H HcT$HHt$Mb IIHHD$LrAR ff $ HM~Lc8MT$IVH >U" I9OH9JHLLT$pIHT$Hѐ HT$HLT$pIFI/u LHT$pLT$HMHT$pLT$HH*Q I~ ! HD$AT$IHt$ ff $ I H1Lc8MT$)HcI< @D|= |$pH=V" DHcI4Ht$HH9~HVz DMT$H|$0 LT$PHI,HBxf H~Ic1HELT$PHD$0~jH} H/f A~VH}H/Uf A~BH}H/f A~.H\$PA LJ| H/wf IE9IH\$PD$pHt$HH|$0HHD H8LpHHD$pHHpH& HD$@d(HD$AT$IHD$0 Ht$M ff $ HI~Lc8MT$L=iS" L9?HcH;W2IC UHGHcH HItauHcH HINtKuHcH HINt5uHcH HINt IN HcHH4HHqsH/BM4vC AW0HD$AT$IHt$ ff $ I HMT$Lc8LT$HAD$Lc8MT$fle LT$HfAD$HD$8M~HcIM&HtLLI,$LT$Hd I/ڔS HD$ARMbIH|$ ff $ HIVLc8MT$M~H P" H9JI9OwBAXGLT$pHT$H}HT$HLT$pIFHI/; LHT$pLT$H@8 HT$pLT$HH*: IH HD$AT$IHL$ ff $ I HIM>Lc8MT$L;=P" {h L;=!P" B LLT$H I/LT$HAA A MHD$A$IHL$ ff $ HMT$Lc8LT$HI~Lc8MT$AL$L_A9 HOH Ht$8LA HcLLAT$I;PAH Mx HAx HHLL9 HRHHIVH/HD$AT$ IH|$ ff $ I HI~Lc8MT$M~H P" H9O>H5WO" I9w-H"WI9WIlIHE H/InI/8 IGLIP0HD$AT$ H|$ ff $ I HAL$I~Lc8MT$IVL$HH M" H9OH9JuOBE1f/A1f/f.ȍqt$PFAD$IH/Il$fD$pZ; HT$`.5 HT$`H*K; L$P T$HD)!: D$pf sHL$IHLdE HD$A$ ff $ HHD$8IMT$1Lc8HcM&HtLT$HLUI,$LT$H/ HD$AMIHL$ ff $ HI~ Lc8MT$HL" I9VHT$pM~MT$LT$HLē I/LT$HHT$pHX H*g IInH) HD$@dzHD$AT$IMHt$ ff $ HLcLc8MT$JDHHvH AT$IMIHD$HL$ ff $ I HAD$Lc8MT$f Q LT$pfAD$M~InIM&LHL71LT$pD$HI,$F Hm MI/TF |$H HD$ARMbIH|$ ff $ HMT$Lc8LT$HJLc8MT$8 MfInM|$I8 tb b HJ" I9G5 LH4 HD$IT$MIAH|$M ff $ HHD$8H{HcILc8MT$HtI.HHbH" H9GLT$HH` 諒Hm LT$HA\ E HD$AMIHL$ ff $ HIExIVLc8IM|$H8HH)E H/ E HGMP0HD$AIH|$ ff $ HHcLLc8MT$H LT$pH)HNJ" H W LT$pHHD$H 8A I~MfH/u HWR0LT$p I~M~H/uHWLT$pR0LT$pJG I~IFHD$pH/uHGLT$PP0LT$P^ I~MfH/uHWLT$PR0LT$PD}Q LMI|$IH/uHGP0AsIHD$HAIHL$I$HD$Mf f $ HMT$Lc8LT$H Lc8M~MT$LLT$HMfInL LT$H8pLLLT$H I/LT$HX X AH|$MIHG" H fIFHD$ f $ HM~L;=F" Lc8MT$= L;=^G" fW LLT$H LT$H= HcHD$H|$IM$jA$ ff $ HIMT$Lc8M& LT$HHI<LLT$HI,$G HD$AMIH|$ ff $ HLc8MT$V< MfIFH=fD" HD$HI9|$M~IFIHD$pIGLH;gF" I< Lt$pLLLD$ LT$`L LT$`HIHD$PHID2 I/Z2 M< I,$< ID$LT$pLP0HD$HHLT$pHhLp. HD$@dDuHD$AMIHt$ ff $ HI~Lc8MT$H5C" H9wRHWAL$HR 9J <J A ILED$ILL|(MIIF H/zHD$AT$M>IHt$ ff $ II HIUxLc8IL$IFH2Hb@ IvHt$IH IHHD$AT$I ff $ I HH3MT$Lc8LT$HHF0@0% U H=@" LT$HHHj|Ht$ LHUPH)HC@HH H Hr HHHHEKƅ HDž AE {D I( H[0HGI9M M0 HcS@H$ HHlHC@)HD$8H{HcLc8MT$HlHoqL%?A" L9gLT$HHM HLT$HH: H AMIIHD$HL$ ff $ I HMT$Lc8M~L%C" LT$HLI$xb OPLT$HHHZwI$b LLT$H)PLT$HH wIFI/vM$@ HE wP H@8HD HeP 111HLT$H1HLHrHm LT$HI&vHELT$HHP0MLT$Hy HD$AM&IHt$M ff $ I HHcIVLc8IHDHM|$HxHPH= HD$AMIHt$ ff $ HMT$Lc8MfLT$HL I,$LT$HHH IFH HD$AMIHt$ ff $ HIM>Lc8MT$L;=K@" W L;=@" W LLT$H I/LT$HA&wENW HHM$HD$@d HD$A$IHL$ ff $ HM~Lc8MT$At$IW9 ,IOHL$HHH|$8LA HcLLAT$I;PAH MX HAx fpHHLL9 ʳHzHInIFHD$pHjH/uHGP0HD$HHx mHp9 HL$HHHAI/Hxp9 mHD$AT$ IHt$Lt$p ff $ I H M~MT$Lc8IMfLT$HLLV I/LT$HI,$sU V HD$AMIH|$ ff $ HH{ Lc8M|$G4ftfG4f_S HD$@dML EyHD$A$IHt$ ff $ HMT$Lc8MfLT$HLV I,$LT$HN O AHL$MIH=" H fIFHD$ f $ HAD$Lc8MT$f4 H|$8LCH i;" HcLD$pL|HSH9J9qHJ y +qLHHL$H@k H5qHL$HLD$pHnJ H= <rHHD$HIk rHT$HAD$7 fAT$A$5 fAD$HD$IHt$ f $ A $HI~ Lc8MT$L=<" M9~InMT$LT$HHuHm LT$HHuHD$pHEHP0HT$pLT$HI/IIVH HD$@dHD$AT$IMH|$ ff $ HIVLc8MT$INH5u;" H9r˯H9qA|$w DLJ9THH*HLILT$pHL$H HL$HLT$pH)FM J|H HD$AT$IH|$ ff $ I HAD$L=>L Lc8H|$If AIHHI~Lc8MT$HS8" H9WѮHcH;OĮIM HGHcDMH4HI6t{IcDEH4HIvEtcIcDMH4HIvEtKIcDEH4HIvEt3IcL Iv(IMN EtLcHNI LFsAM4H/P HD$AT$IHL$ ff $ I HIULc8MT$H AoFA|$fH~HR9 L AT$A9 IW0I0 BLrDHcH H>< I8 H)HH9'< HL I0 IOIE1IL} HHMIOHU H¶ HMHE E@HE( HU8fDEDEH< HD$ I)L HIC@AE Lc8PH]0HH$ AU LH5 L G Am AE {D X6 H$ $ 1IE8I~Lc8MT$HW 9At$9 (Il$E1HE MFH/irHD$H|$I.IAT$ ff $ I IHII>Lc8M|$H;==9" N HD$AT$MIH/H|$ ff $ HIVIvLc8IMT$HLT$HI<ILT$H HD$AT$IMH|$ ff $ HHL$@LHC H)H9 [Hk8H Lc8L=G H)A$HȉA<E? HD$f8 -v$ tOI}HHtFA}, u?LLt$ IuXLAHL)HC@x0 HcS@C@M4օZrLc8A$Ht$AfIHHInLc8MT$LT$HH : Hm LT$HIbZMfMc HD$AMIHL$ ff $ HMT$Lc8MfInLT$HLqI,$LT$HIuID$LP0LT$HM8aHD$AM~MH|$I ff $ HInLc8MT$LT$HHB Hm LT$HI> MfMq HD$AMIH|$ ff $ HIMT$Lc8M<$HHI<L LT$HXI,$uID$LT$HLP0LT$HHD$AMIHL$ ff $ HLcLc8MT$IGH|H^E1LdH/uHGLT$HP0LT$HHD$AMIHL$ ff $ HLc8MT$1҃>6 IvILLT$菺 LT$HCHHD$ q I}` n{EtHC Hc HP H9C8r-H{(LT$HuH) LT$HHt LT$I}HHX1HL$0 H{Lc8MT$H,tH0" H9GLT$HH3" H\ H7q LT$HHuJI}` 9LT$HHI#H{HHzI,$LT$HmHD$AMIH|$ ff $ HHD$8ILc8HcMT$M&H{HtLT$HLnzI,$LT$Hn{HD$AMIHt$ ff $ HMT$Lc8LT$pLc8MT$LMfH{2" LT$HIH N LT$HHH(pLLT$H I,$LT$HHoHHm pHD$AMIHL$ ff $ H@MT$M~Lc8MfLD LLT$HHM4M LT$Hh^I/5 HD$AMIHt$ ff $ HH{ Lc8M|$G4ftfG4f4 HHM$HD$@dnAD$Lc8MT$f3 fAD$M~HcMfM4ĉLLT$HML LT$HIF HIuIGLT$HLP0LT$HHD$ARMbIH|$ ff $ HHD$8Lc8HcLIvMT$HTLT$Ho LT$HINHIE HD$Ht$IIAT$M ff $ HHD$8HcLc8IH{MT$M>HDMfLT$pHD$HH/" Hh \LT$pHHpIEHkH; =pH/ pLLT$po LT$pAoHD HsH|$HHLLT$p LT$pHI,$ rI/fqInHHD$AMIHt$ ff $ HInLc8MT$HUH;," frH;V*" t-HLT$HgHm LT$HIrMfM.HD$AMIHt$ ff $ HInLc8MT$LT$HHLe LT$HHIt H(\cI~E11LT$HH$ L$ H L$ H$ L$ { LT$HHoIHD$MIAH|$ ff $ I HLc8IVMT$LIvLT$H# LT$HHIHD$IAT$HL$M ff $ I HLc8I~MT$LT$H' LT$HHH衧LT$HHIHD$MIAH|$ ff $ I HII>Lc8M|$H;=F-" 9 H/9 MHD$A$IHt$ ff $ HHC H{LcMT$Lc8H@`LT$HJtH=)" H9GVNLT$HHVI}` JDHH@HNH IHD$MIAHL$ ff $ I HLc8MT$HMfLT$HI" LT$HdHsHzdLLLT$H)I 1H߉}$ I,$LT$HfRHD$AMIH|$ ff $ HMT$Lc8M~HcMfMFIFLLLT$PLLD$pHD$Hp LD$pLT$PHI(cI,$7cHuI}` / H-D+" HE InI/]_HD$AMIHL$Lt$H ff $ HIFLc8MT$H y)" H9HKUHcH;H>UHxLT$HHcI4Hfk LT$HHII~IFH/THLӅ9 HxDuLxH/UE*9 HxDuLxH/TE 9 HxDuLxH/TE8 HxDuLxH/TE8 IIAH/uTHD$8H{HcLc8MT$HlHmHLT$H@ LT$HPmHD$AMIHt$ ff $ HH{H%" MT$Lc8LT$HH9GH(" H] f LT$HHfH IHD$MIAH|$ ff $ I HIFLc8IL$H@ / H3'" H IIIHD$H|$ ff $ I HIFLc8IL$H@ @N< H&" H IIIHD$Ht$ ff $ I HLc8MT$t7LT$HI<HG fag HL$@LT$HAHC8InMvLT$MfLI$ LLLHIHCHLT$HD$ Ht$@LH)HDxLK II(HQHA H4H( y ?@ A90 HH)HH xHJ J J JC4 JHx JHyσ?@ A9" HH)H(_ HvIMT$Lc8M<$HHI<Lw I,$LT$HOyHD$AMIHt$ ff $ HIMT$Lc8M<$HHI<L LT$HHHP= H(\I,$!= HD$AMIHL$ ff $ HLc8MT$1LT$H2 LT$HHIH\$H1M8 HI4ƅuLHt$pR Ht$pH. 4 Lc8MT$HC@ HC H HC H H$ $ IE8<I,$HD$AMIHL$ ff $ HI,$HD$AMIHL$ ff $ HHFH=r HH0H9] H@ H gHT$HH93 H=BO# \O# E|$HT$HMT$JDHH1 ]f HD$AT$IIHt$ ff $ HIEH mIG0LT$H@0QLL$01McHcLLM4L`XLT$HHAD$HHM4HD$ IH$ LS8HD$0 I)AE IHDs@HZ0HAM ~- @ LLT$H I,$LT$HA8 LEHcHD$Ht$IM$jA$ ff $ HHGMP0HD$AIHL$ ff $ HLLT$H` I,$LT$HA HcHD$HL$IM$jA$ ff $ HAoUHAoX]Xt 1Aod dhH9uЃiHI4HtHWAL9StLT$HU I/LT$H IH1 @ I}` II/ IGLLT$HHcIP0LT$HHD$H|$M$j A$ff $ HIGLT$HLP0LT$H錢ID$LT$HLP0LT$H}MfUHGHL$HP0HD$AT$MH|$Lt$HI ff $ HHLD$`LT$pHL$PHt$H蕟 LT$pLD$` SHt$HHL$PAGHX " HM4HIVH.HFHL$pHLT$HP0HL$pLT$H鏩 D H " 鑭I( H)N o)DmHoquXt 1 o| |hH9uDAHH4HtH郫HWH { HB0H9& H@ HpH9 HH=MJ# gJ# Ic@8@˫ID$LT$HLP0HInLT$H!f. H/ 8 HD$AMIH|$ ff $ HHH " 顱LT$p1HHT$H )HcL$PHD$@dHD$A$IH|$ ff $ HIGLT$HLP0LT$HID$LT$HLP0HLT$Hٯ%f D HT$HHE|$HT$HMT$JDHHQ HD$IMIAH|$ ff $ I HHWHD$HLT$0R0LT$0HD$HɒHD$AT$IIHL$ ff $ HHEHL$pHLT$HP0HL$pLT$H霱H?Ht$pLT$HH=X1 ҬHt$pLT$HIFHH.tgI/ IHQ LLT$pHt$H Ht$HLT$pH$ HIGH3Fy H0 InH.uLT$HH=hG# G# LT$HIGLP0驪HH9C ʃ?@/ D9) D@HxD?A@ HGA9 WՃ?@ Hʃ?@ Ht$ D$IcQLHHHH HL9 I~MfHu-L9 I~MfHuL9 I|$IHtH/MuHGHT$P0HT$ID$LT$HLP0ELT$HE?Af. I@HL$HLP0HL$HHuLHT$pLT$HALT$HHT$p OIGHL$MIHHD$A ff $ HH" LLT$HH0 LT$HI}HHQLLT$HI I/LT$HHcHD$H|$IM$jA$ ff $ HH|$pLLHLT$P[H$ LT$PHCH }IH" H9P IW LT$pLT$pHH|NHD$HI7LT$PH|$pHy`H|$pLT$Pf3 I"HD$HIwIWLT$PH|$pHH H7`H|$pLT$PMI Lt$pIMLl$PAHH\$`HHD$HI4 HH_2 HL9uMHLt$pDH\$`Ll$Py @ L C# LT$pH=C# LL$HC# I/LL$HLT$pȢLT$HI9LC# LT$H魢IcLD$0HLL I/LT$H;IWHD$HLLT$0R0HD$HLT$0IH驮HWHD$HLT$0R0LT$0HD$H OQ0HD$Ht$IAT$ ff $ I HHELT$HHP0LT$HH*HLT$H: LT$HHD$AT$ IH|$ ff $ I HHLLT$HZ I/LT$HHH Ht Hm d H f D I@LT$PLP0D$pLT$PHM4HD$HIFI/͝P HrI~HINH<ƍE HD$HMIAHL$ ff $ HIIT$H T HB0H9 H@ HI H9 H=)A# L@A# LT$HHE|$HT$HMT$JDHHJKf D HGH5ݐ HP0H94) H@ H L$`LT$PH9) HH=@# @# L$`LT$PIWH ~ HB0H9i H@ Hs LT$HH9R H=N@# Le@# LT$HLT$HH=/@# LF@# LT$HKH|$pLT$PHGP0I/LT$PIGLT$pLP0LT$pHLT$HI/LT$HnLT$HH=?# L?# LT$HOHGP0HD$AT$MHt$I ff $ HHD$AT$IIH|$ ff $ HH*H ID$LT$HLP0HInLT$H.M1IM|$dH" LT$HLI/LT$H H>IIL ># HD$xH=># T$`L$PDD$pLL$H># I/LL$HDD$pL$PT$`HD$xHD$`I9LT$PL$pDD$H^># HD$`T$PL$pDD$H鳌HWHD$HLT$0R0LT$0HD$H7VHQH5 HB0H9n H@ HLT$pH9W H==# H=# LT$pHMT$ IE`fH$ H$ H$ LH$ IEhAE`H$ IEpIEp H$ 9 H$ H , H$ ۽ H$ H, H/OM[Q HEHL$pHLT$HP0HL$pLT$HH)ooT LHT$pLT$Hn HT$pLT$HH*HLT$HM LT$H̱I~H/EI~DeIVH/+ E) H|$HH\$pMH`EI.鿘HNH=6 HA0H9) H@ H +T$pLT$HH9( H=<# <# LT$HT$p黣HGH5 HP0H9% H@ HL$`LT$PH9O% HH=;# ;# L$`LT$PH/HD$AT$IH|$ ff $ I HIGLT$HLP0ELT$HJE<HM$BHD$@d*@f D I/HM$BHD$@d HD$A$IH|$ ff $ HHGH5 HP0H9 H@ HLD$`LT$PH9u HH=j:# :# LT$PLD$`ƕ#xAA?D @Hx!Hx@AA?D @H D Hσ? @ HH.JAA?D ǃ@JAA?D ǀ@HJDAHEA?D A@f D LT$pHLT$pʴG? ը@ HGYH9? OHGH9& OHGH9 OHGH9 OHGH9 HH9uv L 8# PHWIHD$HLT$0R0D9LT$0HD$HׂHL$pUHL$p鷦v鰛y!AA?D @@y"AA?D @@H"yHAA?D @@H9IcALHL$ H,L9szI~MfHt H/! L9sHI~MfHt H/& L9s,I~MfHt H/ L9sI|$IHuIFH)HHHkIH|$ LH)H$ C@9H5 f8 ]t9H`HWHNHLLT$pHL$`HT$PVLT$p:HL$`IGIHT$PH,I/: @ HD$AT$IMI/HL$I ff $ HLt$HE1HD$HLxH@HD$pIGH;* " HL$HLLqH 8LLT$P=CHm LT$PI M3-II/ HD$AMIHL$ ff $ HH? @H? @HHH? @HD$HHhLpHU~H|$8HcLHTI~ LT$HXHD$HL$I f $ A $HfAD$HGDL$PLT$pP0DL$PLT$pA I}` LT$HH{HtLT$HH H IHD$MIAHt$ ff $ I HHD$HAMIHt$IHD$f f $ I HM~IVLT$PInH}ILHT$pH|$H趽 H|$HHT$pLT$PIH/" I/D>HWH*M=HOH5 HQ0H9 H@ H H9 HH=3# 3# HGH5y HP0H9 H@ HnLD$`LT$PH9g HH=A3# [3# LD$`LT$P鯎AH5% " )HcI<ADHcI<H9wv HW0J0 X r@M D H F" H@ HIH 2 H|$0 & HO8R8H щT$p)A9@A9AD L$H Un F@T$pL$HAD$A9fAL$A$5 fAD$HD$IH|$ f $ A $HHGH5 HP0H9 H@ HL$`LT$PH9 HH=1# 1# L$`LT$P"IGLT$pLP0LT$p铹H" H@ H 9Gȸ 'ID$LT$pLP0LT$p2H|$HcMbIH fA HAJHD$AMIHt$ ff $ HL;=" HcHD$Ht$IM$jA$ ff $ HH5" H|$IHIvH IHHD$AT$I ff $ I HH/AHGMP0HD$AIH|$ ff $ HHLT$HI~ LT$HTH|$HLT$PHGP0D$pLT$PHM4HD$0IFI/CHC H{8H H)HHcHIIE`fLH$ H$ H$ IEhH$ MfAE`MH$ IEpH$ 1IEp H$ H3CLT$HLLT$HHHσ? @HHσ? @HH)H(H`HMFHI~ILƍEC HHk0HLH$ HW HEHHD$ HC H|$ HH HpH HD$@HC8HL$8LPHcC@Ht$(C@L4.MM)HL$0A)LLT$HHI<HI</ LT$HHD$HL$I f $ A $HI}` H{LT$HHL9gC.LT$HHsCH IGH9P I HHI H9QugHI9u IcLLT$p4 LT$pHH6HD$HI7LT$PH|$pHHH|$pLT$Pj61H5C LLT$pz LT$pIGIN@ ;I{Q0HD$Ht$IAT$ ff $ I HHWLGHcHI MHH/xLT$HP0LT$HxIVIvLzL;= ! L;=! L;=~! HY " LHe HH:H" H9B AD$H 9Gȸ fAD$HD$IHt$ f $ A $HID$LT$HLIP0LT$HHD$HL$A Mԉff $ HA <HB0p0@ x<x@ c<@N<x8{<A a<AD$HHT$Hf ]<HT$H= <H5! H@ HvH 9fAD$I A$5 H Q! H9NtH=:! H9~t{ID$AMHL$IG8HD$fM|$MI f $ H1Hl$0 IVIH5A w9$ Q9H- 5 f8 b9HCHHD$ &LHT$pLT$H)D$P LT$HHT$pHfoD$PHcBLIW0PH}X1H1 91HGMP0HD$AIHL$ ff $ HHD$pIGLLT$HP0HLT$HHT$pHEHT$pHLT$HP0HT$pLT$HyINHAH;>! HAHcH9 HMA$fAD$5 HD$HL$I f $ A $HH/HGHT$HP0HT$H鍙IGLT$HLP0LT$H IWHD$pLR0HD$pLT$HH;! uHcոH9QOLu NWHGу? ̀@HHGHT$HP0I/HT$H#LL`H@IG@INIFHQH;J! tpH;! A$fAD$5 HD$HL$I f $ A $HLT$PL$`L$`LT$PLT$PL$`~H5! H9puHxwPH;QrLf Lt$HLT$HLLT$HfAT$IvI~rt HcL} Art uЃ HWH;V H;! H;! HWH HlHVHxZH] A$fAD$fAD$5 HD$H|$I f $ A $Hsts tkA$kHH~ 9Gȸ fAD$H;! uЍUwȺ f \HH;HcLL AID$LT$HLP0HInLT$H`LT$PLD$`VLD$`LT$PLT$PLD$`; LLT$pHt$Ha SqH! HHL 1H5 f8 iz1IGLT$pLP0H|$H LT$p|NHBHL$PHLT$pP0HL$PLT$ppH5; LLD$`HT$PHL$pLT$H豌 LT$HHL$pHT$PLD$`f=wHD$@d$ t4LLt$ HLL)HC@ HcS@C@M4օ% H 5 f8 HEHP0LT$HLt$peHGHP09HMH\$`Ll$PYIGLT$pLP0D$HLT$pHHM4InrI,$uID$LT$pLP0LT$pLt$HHcHL$IH$ HM$*IFHD$A$ ff $ HLt$HM鬷IGHL$HLP0HL$HFHBHL$HHP0HL$H LI}` IHhuHLT$ LT$Hm ) L'ID$fInIDfH:"A( Hw3N Md$M8 ڱHGDL$PLT$pP0DL$PLT$pAÃLT$HHH6! LH0 LT$HL Q0HD$Ht$IAT$ ff $ I HIGHT$pLLT$HP0HT$pLT$HH*%IvI~w* H ? udA$zHD$Ht$I f $ A $HHGP0鴐HGDL$PLT$pP0DL$PLT$pAj預HNH9Ou H; ! tWH; J! t8H; ! t*H 9Gȸ fAD$M A$fAD$5 7AD$<}t ufHL$ H;4HNH9OuH; ! tH; Y! tcHNH9OUH; ! rH; &! 6 [ID$LT$HLIP0LT$HHD$InHL$AR Mbff $ HH! I9@ (I@ x HD$H'H|$HLHL$p~ IH'HL$pH= 'H %&H|$HD$p H d'T$pEHH HH HL ID$0 HGP0E111HLLT$H韯HGP0H/HHM$HD$@d9LT$PLD$`^yLD$`LT$PLT$PLD$`CyH5V5 C@Ht$H50 Ht$aHGP0HHGP0HGP0H^ϋHD$A A)Mc@dMIHD$A$IH|$ ff $ HHL$8HcI~LHT LT$HHD$HL$I f $ A $HH53 LHL$PHT$pLT$Hu LT$HHT$pHL$PӈHD$pHBHLT$HP0HL$pLT$HHEHP0LT$P8HcHD$Ht$IHM$* A$ff $ HHFL$pHP0L$pIHHD$AM'MwH|$MI ff $ HIIHIGLT$HLP0LT$HlAHL$MIH! H fIFHD$ f $ HID$LT$HLP0LT$H6AHt$MIH0! H fIFHD$ f $ H= q H=F! ) LT$HHH&1f@H Hx@@J H|$ LHUPHH)HHC@HH H OHLT$H^LT$H飲IGLT$HLP0LT$HSHL$0Ht$HD+QH~HcuHGLT$PP0ALT$PәHGLT$PP0ALT$Pb鳙HELT$HHP0LT$H>HGP0}HGLT$PP0ALT$PEnLLT$H蝜 LT$H HcHM$*HD$A$IH|$ ff $ HID$LT$HLP0LT$HIHcHMFLsH|$8M~HcLT$PHtIH;=! tW H$ H|$HHt$pV H|$HD E`0Ht$pLT$P wh H tTAD$H 9Gȸ fAD$HD$IHL$ f $ A $Ht<HHLLA A LT$Hb LT$H@r5 H$ ILP(HpMJ n/AB}/I p/fEL$ED$A$II/uIGLP0LT$HM LT$PL$`oL$`LT$PLT$PL$`o^ 闬H\$HMHM4ƅHD$AM&MH|$I ff $ I HHQ0qIT$ID$IIWp@H! HGLT$PP0LT$PɊHGLT$PP0LT$P闊Ld$pM鼡Z H$ Ht$pLT$H Ht$pLT$HH$ LT$PL$`znL$`LT$PLT$PL$`anHMIEIGLT$LP0LT$,I$H-.! ID$LT$HLP0ELT$H*ID$LT$HLP0LT$HsR0CõMI/HHM$HD$@dHD$A$IH|$ ff $ HHD$AT$MI/Ht$I ff $ HH/!HHM$HD$@d$HD$A$IHt$ ff $ HH! H! HD$AT$MI/HL$I ff $ HHOH5Ud HA0H94 H@ H JH9 HH='# A# oHGH5d HP0H98 H@ HLD$`LT$PH9 HH=# # LD$`LT$PZo lID$LT$HLP0LT$HH-! LLT$Hu LT$tKID$H u<LB LT$u+L ID$Hu LHG> HH1R LT$I,$C HLT$HT$pznHHEHAsHAHEPAssHzH/\ HzDeLsH/4 E H|$HH\$pMHM逅I HEH"dI@HEPc dH=! 踞 LT$HHHR H! H@ D E 1Hu@vT$pHLT$HЋT$pLT$HyIGT$pLLT$HP0T$pLT$Hy HGP0LT$PLD$`bmLD$`LT$PLT$PLD$`GmI~H/> I~IAH/ , %H pMHLt$pDH\$`Ll$P H c!(A%a%M* AUATUSHH.HHH9.AH!.HH /H! HkH HCu<H! @u4H HCEuD+ HH[]A\A] H I݀@uDH=s4 葍H=:4 L育 IHt腯 HtIEH==4 耐Lk W;Wt HOHcH;0t 1f D WHH<$t$ 8 H<$.HcOHGt$ HH90t1HÃWf D AWIAVAUATUSH8H Hl$ Ld$(HLH D E.A9(.A< u5 IcGAoAGH I_9 Ld$ L,DH\$(MI)Aa Am MT.HAI# E H@! H@HH# HE HPHU IW ImLrIV IVHHE HrI;V i IFH,IvHm I H AUH A H9 HE~ )M I9 AuA)A9OX fnEe f:"fAEAGA<i-1H8[]A\A]A^A_ D M 1LDL$DD$HH -HDD$DL$t?Hx HIr LHH1A Ab AH IG ImLpIF #.IVHE HrI9V LDL$HT$DD$E?,HT$IFDD$DL$H,Hm lf. HEDL$HDD$P0DD$DL$> @ E;w8IG(IcH Hi^ H9Ht$HHDD$HL$DD$KHL$i# HyHT$HDD$ HL$i( Hy HT$HDD$HL$i8 Hy0HT$HdDD$HL$iH Hy@HT$H5DD$HL$iXtkHyPHT$H DD$dHL$ihLI`t<I9HT$HDD$LL$DD$,LL$AiIu f D @ fHA Ak H)! Hh# Hh# ] D λM} AuAA;OX{ @ AW\Aif. Dt- HDD$IcDt$HB~HHn)EgDD$IGDE9 IcD)L5 # H, tyt:HDD$I>0 # DD$HI_H<+ (AHHDD$I>0 # DD$HI_H<+ 'AHHDD$I>0 F # DD$HI_H<+ 'AHD9d$ @ HDD$I>0 # HI_H<+ \'DD$AD$LmI>LD$Aĺ0 DD$ # DD$HI_H|+ HDD$I>AH0 # HI_H<+ &D$J\+I>0 D`N # DD$HI_J|+ &Dd$ImAD9d$D$AGIcG D H9yEkEGHEIE1EGHBTQ&IcGAoI_9t$Ld$ L,A H\$(MI)5&(%ff. 1 ff. AWAVAUATUHSHH8L5! HI@ HHD$HGxH HD$H(HGL HPI$ G Hx ~LhIE > L- ! HCIE (L! M9p ] I p HL HL$(Ip HLT$L|$(LT$M` HCI M9^ I ^ H HL$(I^ H詿HT$(HQ HJH(! H9 HRHk'f. HH= ! HT$蛋HT$H'HXH\$fHpHPHa! @8HX L`(Hh0H@H LhPH@X H@` LxhH@p HPxǀ I@ HRH HPHyfHnH H7fH:"@HqH8[]A\A]A^A_ D HX H+ HNHH9FHH9F HH9F(H H9DHH9uf HCIE & D I^ HHt$̬HH Ht$HL$( Mp LT$L蜬HHt#LHL$(H製L|$(LT$MHD$Lx`MuTHC D&LJ! H HH9H|$ H&{%&f ARHD&HHփuAYQ &uAX { uYB} %ff. fAWIAVAUATIUHSHH H H HG8 Z E1D$IGIc IG8 L $ IWHJIOI;?(R9 (E EA IG8 L AŃ 6 - A tIGH(HIG8A# AG@ \ Av EAAF A_ A A A.- pHIcHDB A'z A"p LA\ DƉ$Ye 4$6z t!IGHPIWI;'@9&DA[ A[ A{ A]$ A w'DH i QDH Q QHHQ1 D&IW8%HU IWI$YN H HH []A\A]A^A_ tL AŃuA ](A( A)p&A 'HcA A ( ) DH/P JH 0 HD IW8%HU IWI$0f. ABa AU AR AFu L AD߃AvAEЃ vA_ A A+ IGHPIWI; %@A9$ IG8HE IGI$I_8H)H l A0 LvK AŅu$. D߃E" JW H DLN :$A~ IGHPIWI;b$@D9B$IG8HE IGI$ f. IG8 ALJ E1E11L L L Lz H Li ^ LX LG S tY f. L$" $ tA)݉Af d" \"t8IWHJIOI;<#R9 # # E EE&IcWTHA9\X E9 ]"f. Lh AŃ t LO AŃ t @ ALJ $RA CIG8HE IGHI$A ALJ $ [ f D A Z$HcʃE A A Iw8I+ A H 6d A QDH L Q A HcA A [Z A]P ] f D A M @ c|!E9 !AGTHA A\XE A @ LH $ H $AŃ߃X O B A_ A0 HIcMwDB A. D߃E JI # A f D L Hc8 IH DX . t!IGHPIWI; @9 IG8 HE IGI$f D A L1A I I b D9M t!IWHJIOI; R9 A D D9uH\ 1L AW@ t" Au D9uIG8 HE IGI$I H!$ xA p;a H5 U HA !&" H5 H7 A QA PAWT HcA;\X}bQA PAWT HcA;\X}?A HcAGT A9\X QHA AWTHcA9\X E9 W< AXAL1A D$D$ $LA AŃ'"$T$ t$ D U BU EuU. R{ F1 $Lt$ T$ AŃ':"T$t$ )<$D 7 B EuU RD FnE1Һ D$LT$ L$W AŃ"'t$T$ L1. A 1D$ E1D$ 1$A$ H A1$ E1T$T$ sL H $_tBHHcDBLH $ H $HcHIDPuH 1 A_4LH $[ H $LD$G 4$DA7 Ã6uDL% \$IG8HE IGI$LA D9 A A |$D & U RA111D$ E1L$4$-E11A D $LZ HcIH DXLIA AŅCHcL Í@Ճ L LHcH DPL@ AŅ{} A}/$ 1IG8HE IGt$ D uRlAT$EA A U R?A1111A <$qHHcHDB"G1o| ALJ !L H. AE11Ҿ D,$$ 1DE11ҹ D$1LH $ H $HcHIDP 0 LH $_ H $_AL A0LH $9 H $AA_uLH $ H $HcHIDPuL ƃ.7IG84 HE IGI$LH $ H $_BЃMLH $ H $Aō@ЃvA_WHIcDBHL- 9LH $` H $_BЃLH $9 H $Aō@ЃvA_HIcDBH, L H $HcHIDPtW01E1$6 E11E1D $ED RE)1i=ff. fHG HGf. H UHSHHHu5 H H)H! H H H[] D H 7H t|8 HP HH9r H HtP @f HP0H = HtM xL fLi D HpH9wHHH#8uxHxH9 HH#pubHpH9 HH#xuLHx H9 H#Pu9HP(H9 HH#p u HHH9rtHH#Bt HL HHHLHKHHH[]f D H! HHHH H o HH9 HM L L=HPHHHH)H! H W H W ff. @ AVAUATUSHH HoLgL9t4HH+H==HEHCE H []A\A]A^f {@ uzH{HHuy HHt>L`H{8 uH+ LcH L1HH)?HmHiLd I9uHCC@ HCbH HH{8 uC H Hl$H H^ gH{s01IHSH1HD$) HHt&{ DHD$HCHCH;Xx uHCH;C=x uFH u"HSt HuLc{@ LHkHkHH HHHf uHH5S] H=<] } f. QHG Hx H;w}HDZH! H5' H8 1ZfHW\DOX A9DG`HEWdWHO HHq Hw8HHv Hw@HHv }HHHpHw _HpPHRLVA @HH9~2LPM%MRA LPMMRA LMMRA LP0MMRA H@hHH@ HAH=qH GH F HtaF! tHHtRF" <Ht@F# <Ht.H A <AIcH9| ED91ɉHÉE1D9yAVAUATUSH |HH H[]A\A]A^H /! IIH1IT H9Ju`HH9u H4|HHtCE1KKt H`IL9tH覇 HHuE1<7ff. AWAVAUATUHSHH xH} H} Lm@MeLHH O| IGHH 7! H9XL4 K|5 zI IGH|H9XrK|5zI IHRH9XHK|5zI IGH'H9X K|5kzI IGHH9XK|5@zItbIGHH9XK|5M|$zIt6Od5I$HH9XLIIyIu @ H}81 @ LmHMeLHH O| IGHH Ǻ! H9XN4 K|5 {yI IGHH9XK|5PyI IHH9X}K|5&yI IGH\H9XRK|5xI IGH1H9X'K|5xItbIGH H9X K|5M|$xIt6Od5I$HH9XLIIrxIu @ Hɺ! H@ H@ HE L%ͷ! LpI|$(III|$ HH+mHHE1I$ LsLc H\! J HMHHEPH HQAH7 p @@ H 1@ @E1E1H DX!EA@A B AH DX"EA@A L AHtiDX#EA@A < AHtCLp A A G EA@A AAMcI9| HU fHHSpHUHHSxHUHH US0U(SHHU0HH HU8HHSHU@HHS HHK`H oMXHChHEhK8H HC( C4HE sXHHDC\Hp L DKL{PDSTHǃ Hǃ HrRHDLIDHHHHSH1A8# Ml HH[]A\A]A^A_ Ht@ A tDfADHU fL LHHSpHUHHSxHUHH US0U(SHHU0HH HU8HHSHU@HHS 1HHK`H oUXHChHEhS8H HC(1HCPHCXH ) C4HE H DKLHHHp HSHs HfAx H A<HHcH9|,@uDE111A E1 A 1E AAI$&@ A DADE AAE AAE AALu01 Ld$^#HD$Mn Hx HHcI;FZ HT$IHB HrI)IGH9 HcHwLxx <v < BE1ǃ?@g @k й H?w}HcH<CIVHcH9}^A| KHcH9 A| ~ KHcH9 A| xgHcH9~A| xVHcH9|؉H?@@z?d < < H~LH9HH+D$LHpP 5Ll$M'HE L%! Lm0LpI|$(III|$ HHfHH6H 1H u H |HLO HD$J|8 HhLH @AAAˉAI@uhH= 4 '\H=4 L IHt~ HtID$H=4 _IBDAkAA?AD pLcJff. USHHHȲ! H@ HG t,H@8HHt HHH[H1] H?HIHHHH[]遜AUIH?ATIUHSHHI! H@ C HK ~2HMHAHtBA H}LLЃC H[]A\A]H5 HHT$7F HT$t1f. Hѱ! H@ H@H ATIUHSH(HH} HH=dHtL`HHHiH[]A\[]A\UR D SHHHOxH+tH[HSD$ HR0D$ ff. AVAUATIUSHFLo jI HHH;! uJ 1P I$Ht []A\A]A^ H! H@ []A\H@`A]A^HH(H H9u11rP HtMI$ I$HuL-f! L57! I6I@ Hx`G tFT 1d @ L5 ! L-*! I6I@ Hx`F HH 댃"fAWAVAUATUSHHFLo H IILa9HH HEHE L Mt@H LLHAHm H HH[]A\A]A^A_f D LL8HH HCHL Hm Mt1LHAH+tyH @ LL8HH H H@L LLu8HHuHLLAHH9HEHP0rHSHD$HR0HD$nHEHP0 HA! IVLH5 H81; 1Hf. ATAUHn;ntHNHcH;t415HH4$T$ H4$ HcNHFT$ H;u̸ A9ĉnH]A\fHGH ff. fH HGH@pHt Hx 1ff. UHHHGHu?HHtH H9uHG @uQ1H] D HHH] HHPHtHx8 ~H tHT$HH<$H<$HT$tHH HuHGtHHG1HH9u % u1oH<$H<$ff. AWL=WAVIAUIATL%" UHS1HHW Hw(HHHH9 H8HKHt L9 H9sHxHKL9tHuyH9\Hx HKHtL9ubH9|EHx0HHtL9uNH@H9|*H8HHHt L9 HH9}f 1H[]A\A]A^A_ HM9u@HG @/HH HuSHGtHHGIV f. HAՅuIV Iv(f H9}vf D HH9u % uH|$Iv(H|$UHSHHo HX H( C HGH9tH0 H[]H/HEfHnHDfH:"( Hw~ HmH8 ĐUHSHH_(H E@~+1ېHcH|HHtH/t=9]@H}(H H}H% H} H/t1H} H/tH[]HGP0 HGH@0H[]HGP0HHG( H&HH_HCHP0}@ RkHcW@HC0HHH H HCCuHSPHc HH H9ChrxH{`HtKEt HW Hc HH H9G8HG(HuWQ HH HC1HK`H{ uHbZH[]VQHChf D HIIHHHH9 HH " H9tHu|HPH9|cLVI9tMu^HPH9|LLV I9tMu^HPH9|5LV0I9tMuPHPH@H9|HH9tHu?HHH9}HI5HHHI I1 H HH0HHBI H9~1HI f. AWIAVAUATUSH P =p G` LA_ IHt8AoA;o IWHcH8 tAoA;otjIWHcH8t~A` A A_> BA p L: IH A A_1A PVL,IcWIGHHՃ8uIw Ao;Q HHH@L A PA HH[]A\A]A^A_LIcWIGHЃ8 A PA =p A` AG D$2IHAG`1A D$ LHtPL HHt@I9u)MLHT$J4 EHBHT$IAGIHD$랋D$Iw HAGP IH HcD$H9~I4IVD$H4LLLLA A HH' LA` LH1R<f D AWIAVAUATUSHH P =p Dg`E+ A_A;_ IWLcJ, JH@(Ht48 J H@Ht 8 5 H@HuA9_ H*Ao`H@L$ D$$A HA =p AoA;o HcLHp@t$D$! IH EW`A AoEfPA =p 'EoD9 AIOIcH8 AEO`EoEL$ IA M A`Ao PA =p ' 5IHRl$Aw`A HA =p Le^ IH AOA;O IHcA H<ǍF? A D$AGH=G" L^" AO`AoA L u IH@ E AW`AoA E A_A $ Lv HH EG`A_EjA9_ IGJ8 A` A_ LH5A A` A_ L % A` A_ LJHH A` A_[ L ] A` A_ = L 4 A` A_d L A` A_U L觼HH? A` A_" LHH2 A` A_( L j A` A_ L iK A_1 H L- A @ PHhAWA A HHH[]A\A]A^A_A > L讻HLm~ IHL9 A` HD$AwI|o HH MG L Lh L$0LD$(m LD$(L$0HHASLAPQ UDL$8DD$0HT$(詐 H LHHR HHEA AwIn HgH MO HD@ T$$t$ 4 HH AAGD$Mu A q f A` LZ IHO AOA9OD IwHcH4A > A D$ AGEw`EIw HHL$H HD$(HHC HL$IcH9 LA L蚋 IH1 L: L芹A` HD$AwI}m H}Ht$MG Lh Dh LD$0藋 LD$0ELHAPUDD$(L$ H|$8蓋 HXZH A It HWAH4LJ IHL越 HH AwIl H DH @ Aw HLPDD$(L$ A6a A]A^HH7 A \ALT$Eo@o T$HI LCT$HA A LH A A L\ IcWIGHЁ8 A A_PA =p 0A` McgE;g IGJDpDh LvHJLep A` I4AwIZk HH MO DDD@ L Hk A HA LAO;H AO\$(IHD$0 L$LpA A LPA =p n A` LGV HH HA \$(A D$AGHKLŶCDEoA PA =p A` gEgE;gIWIcHDp@D$ LHY Lx IHE A PA =p )A` AG< LD$萵H D$AG1HD$A A` BT$A AwI[i T$H DH D@ ARDAw L$LHt$ A[A\HA HA PA =p P A` A / AOPA L$8Lc=p E;gW IGJH@L$D$ L脴H A PA =p A` A PA =p X L HD$(HGA PA =p M A` 5 AG D$)IH AG`E1A D$0 L跳Hl D$Iw LAGJB IH4 T$0HcI9& LfHt$(LLA . E IHAEAwIA Cg HH MO LD@ T$t$迋 HHA HAwA;w MGHcA I<? Hً\$(DL)AO LMcgIWJLJ, H@(H;KAwIrf HHsH P MG t$$|$ HH&AwA L9t$0C AGKT ID$3A L$8A` AOPA =p AGD$A;GHcD$IWHH@L$D$< L萱Hx A PA =p A` AG D$(IHEG`E1A E\$0LIDL HH D$(Iw L\$0l$0LAG? IHDD$0IcI9 LA L IH L螰H Lm HD$(Hp AwId H DH Iw LDp DL$0Ht$蛘 Ht$I|$VAVDL$@DD$(L$ Ht$8蔜 ^_H!A HōQA A PA =p IA` 1McgE;gIGJD`DhL IHAwIc HH MO DDD@ Lt HA HDAwI_c HH;H P MG t$$|$ HHA PA =p A` EgE;gIWIcHDp@D$[ LîHL IHLH5 AwIb HH MO DLD@ T$j HXA H)AwIDb HHyH P MG t$$|$ HH,Lh3AOA PA =p A` McgE;g~IGJDhDp L蕭H9LTp IH%A PA =p A` AG LD$<H Lo IH A A` L\$BT$A AwI` T$HvL\$DH DDD@ PLAw L ZYHLA HLjo HD$H A` Eg LkHAwIe` HyD@ DH V1Aw L$D1 _AXH]A HI IUAH #L9AGKID$(A PA =p A` pMcgE;g.IGJDhD` L莫HLMA IHAwIt_ HSMO H LD@ LωL$DD$LL$E LL$DD$HL$HDDbF H>A HLHD$8\~ AwHT$8A PA =p A` IcoA;ovIGHD`h L腪HDLD@ IH0AwIk^ HMO H LDp LωL$LL$D LL$L$HHEDq HHA Ll IHLs A` iAwIHD$] H(HT$APLLH Aw Q@ 1PDL$8DD$0, H LHH 1 HH A @It IL$H4Lv HHM9 AGKT ID$KD$A` AG< LHA PA =p A` YAG D$IHE1A` A '\$(LLn HH D$\$(IAGM'AW`Iw LT$6 IHT$HcI9 L A LHLԂ IHAwI[ HtDH Iw LDp DL$(Ht$ Ht$1VLAVDL$8DD$(L$ ZYHnM9AGJ\ ID$It IL$H4 D$E1AG PA =p YLEo$ HHA` EoL HHt LܦH;A` Eoh Li HHt L触HiA` EoL$ Ht&Lz_ HHt LeHA` EoL$ HtL8 HH A` EoPL_ HHtLe H% A A` A A_1H\$0LHT$HHH4 HD$0)Hk HT$IMLHT$J4 )H{HT$IAHً\$(L LCHH LcM,LcE(LHcM$HcU ASPH! H01\ A]A^HHHNA AG` Lv HH>$ LcM,LcE(LHcM$HcU PHk PHC! H01 AYAZHH LHA AG` jA [Q>]\$(ff. fHG HG f. AUATUSHH H IHHt!H H9 HG @0 H` HHX H HI9 HG @ LP M IE @. L MtIE @ Hp H 1H []A\A]ÐHAԅRHAԅuHP H%HAԅuH HtHAԅt @ HH H HG5LP HHGM- HH H HGHHG HH H IEHIE HH HuTIEHIEL M H!H9 Wf D HH9ulA uW D HH9uw fHH9 A ",H HL[]A\A]LЅ'H|$H|$rH|$H|$TLP MH-I9HLAԅLЅ ATUHSHHHۃ! H9FuVLfItLHG tvLHL$HHiHHtNHt@HL$Ht6HLH[]A\ HwXIHtHE uH贃 H[]A\m HGHyHH@ H9uH=߯" %" f ff. H(HcG;GtWHOHH@(H ;0t'H@Hts;0tH@Htf;0t H@HtY90uHH@OH H(H|$HT$t$蹟H|$HcOHGt$HT$HH@(Hu1f. ATUSHHG HL$HHIDhHHt+Ht HL$HtHHH[]A\ LP H[]A\ @ ATUSHHG;G HOHcH,у} <HuCHF H H IHoEH{ 0 )$ Hfo$ L`@ @ H[]A\f D cHcKHSH,Hȃ} Yff. fSLO HI HLAIMA HHH! M\ L9 H5 8 HoHH58 HwHw(H AA AD Hw N LF H~ HfHLH8 H/ H+ 1[f D 2 M PL9Zf IMHIITH! M\ I9 IiI HITH! M L9I8IHITH!f D fA PAI HAy HkfHI1IxI A@H/HGP0HCHP0SM PI9J)JM PB Mc L9 AO Mc 룃 Mc 1LF H<DNDɉHcA<8H9tHHA9~DPHHcE8N @ SHOHHWHAHH H HAHgH` HG uG H{0H/t H{ H/t H{(H/tH[HGP0HGP0HGP0诜 Hf. AWAVAUATUSHH P =p DO`E k9k HSHcHDhDpH1 IHuHs`k5H IH k1҃ HH[]A\A]A^A_þ H贙HtHIHt1HH50 tsH{M HH\DH @ E Iws LDPM _AXHH Z H&H6H5 IH" HH 1HH50 sH{L HHDDH @ s D ELLP葯 HXYHRHHSHcŃ{` HDhDpH AUATIHUSHH(HE111HH<HD$H H@ @ H|$:ID$ H\$HhHE .H%HLmHPIuHL;m })HUJ HuHHt3H(H[]A\A] HHEJ H+uHCHP0H(H[]A\A]I|$P H= z8IHI|$PHt$ HD$H\$$ HHrLrH H} Hl$f AWAVAUATUSHH( P =p ]DoD9oj HSIcHHh(Ht} V HmHuDl$ H麗 DH5 $ DkP =p s`P DcD;cHSIcHHHDxL$(IH< C`DcfHIH D[`DcEAHIH{ DC`DcE HIH K`DcHH IHtpD{H, D{Ht[C` D9|$ }lD|$ L D EHmC H(H[]A\A]A^A_ D DcP S`bt$ s빋 L$ K @ C;C HKHcHу:HL\$CIHHH5+ isH{iH H2DH @ EL\$Ivs PL$(LH ZYH {` # S9T$ )T$ H{ HHH HD$H H躓HHH5* sH{G HbDH @ s LE PL$(Ht$ L A\A^H {` 2HH HtHڿ HD$H54* /HL$N HHXH/ {` HD$A HÒH+HH5) sH{F HkHt$DH HK @ H HVHvHt$QLEPL$(Ht$ k ^_HH襒*Dk}HL\$臒HcKHSL\$HHȃ:M1dXff. @ ATUSHLJ HHtHC H/ H{HtHC H/ H{hHtHCh H/ H{8H H{@H H{PHtHCP H/ H{XH H{HHuSH{pH H-u! H{ L W H W Lc H/t9H{(H W Lc(H/t,[1]A\ D HCH H/uHGP0HGP0HGP0HGP0bHGP0HGP0HGP0 1Hs8 l1HCp lA1HSXk1HK@k AVAUATLcUHSHHWJH@(Htk;tGH@Ht^;t:H@HtQ;t-H@HtD;t H@Ht7;tH@Ht*9uf D UHHP1H[]A\A]A^ Lu MnIEHp I9u r7IuIEtqIuHu HHMJHHJ(HHHB(Ivܿ HL$% HL$HH`IEH@Hp HrHBFHUMn7f. HE112 AVAAUATUHSHLo I]HCHP H9rJHSHC HSHu~D0ULcHHPHUJHJ(HHHB(1H[]A\A]A^ÿ HL$t$ % t$HL$HHHCH@Hx HzHBI]yIUyxf D SH0 H1H\H9uW貼HtK @tBHer! HpH@ HRH HPHyfHnH H7fH:"@Hq[[ff. fUHHSHHH_HCHH9rHSHCt_HSHuPH[]ø Ht$H9HCH# HHHCHt$H@HHrHBH]HUSH0 H1HLH9uW袻HtK @tBHUq! HpH@ HRH HPHyfHnH H7fH:"@Hq[[ff. f![wH HcH 6 1=5Ã=6 EÃ=6 $ EÃ= 1>D@3Ã* =6 & EÃ=6 ( E1=2 Ã= >P<6 ! EÃ=tw>6 " EÃ=6 EÃ=6 * EÃ/tE=6 ' EÃ=6 ) EÃ=6 + Eø# ø ø ø/ ø% f. AWAVAUATUSHHH P =p G`K k9k HCLcHJDhD`3IH D{`kE^;k H{J8X DS`kE;k H{J8Z s`k;kK H{J8Y d C`kB;k HCJ8* C`kN Hd IHt4 HHL[]A\A]A^A_ D C`kV;k HCJ8 C`k;k^ HCJ8 r C`k;k HCJ8 s`kQ;k H{J84 k$HHcSHCHЃ8fkH IH H3HcSHCHЃ8f D kP =p VC` CH߉$ H $D[`C EP =p $9S T$HsHcʋ H 9tVt$ S`sJ 4${` sHV= H IǍV @ SP =p mDS`E SH߉T$肼 HHu(T$DK`SEH~ HH5 S ;S H{Hc H4>IωSPBHq,HcSH{HHׁ:X Dōus: IHDH D@ ASDs H=>j! D1B ]A\H IyHHcSH{HHׁ:Z ōusb: IHDH D@ WDs H=@i! D1A AXAYH IHsLHcSH{HHׁ:Y ōus9 IHDH D@ PDs H=j! D1A ZYHm I} IǍVlps9 IHDH D@ PDs H=nj! D1@ ZYHb IH蓅8HcSHCHЃ8 kP =p {` CH߉$1u H IǍVH HcSH{HH׃:4gHHcSHCHЃ8 kP =p {` |sP t$04$=p }$;CHc$HSHp@t$ D$ HH P =p n{` CH߉D$8ۡ HD$HE D$8C1HD$ {` s HqH] sH{l7 HfnL$ f:"L$fn@ f:"@ HC foHt$flHH$)T$ w HD$HH{ Ht$軤 HH^H<$0 HT$<H,HT$Ht$ fo\$ HPHpX IǍVHHL$SHL$@$D$HS4 HK{` ${` C P =p <C$;CzHc$HSHH@L$D$ H܁HH HD$0HHe HD$ Hx H蚁HbsH{5 HfnH fnD$0 f:"H f:"D$H{ fl)$HHE HD$0fo$HAHD$ A HA PI${` C HH P =p {` CH߉$ H ${` CUHbC Ht H耀H ${` CH/C Ht HMH D$0{` C tP =p <S;SbHcHSHp@4$D$ HH H)q HD$H HH sH{3 Hcfn$fnH 0 f:"H f:"D$H{ fl)$HHt$fo$ IHp@ V HH5 H$7L$ t$0{` sP =p mC$;CFHc$HSHp@t$D$ H~H H衟 HD$ H H+ HD$8Hn H`~HX sH{[2 HH|$ DH @ Hws H?PL$ DD$(HT$H AZA[HHb PI H}H4 H}HL E1UP =p C H߉D$}}HtH HlD${` CM HI}Ht# H7}H3 ) _$ S`C t$0{` suP =p BC$;CHc$HSHp@t$D$ H|HmH HD$0HWH HD$ HA HC|H+sH{>0 HfnH fnD$0 f:"H f:"D$H{ fl)$UHH HD$0fo$HAHD$ A HA PIY D AWAVAUATUSH8HFLw $ HIHII tLwHHK HEHE L M" H , MA tYMl$MtOID$Lh H4^! H9C-HL HtsID HtiH H D L0HtEL(Mt=IE HLCH Im H^! H@ Hx` 0M IT$LHAHu $5Ht Hm H+ H8[]A\A]A^A_f D E1 7 IT$LHAHu4$tH'_! H8 t 1fH Im rLH$ H$] @ Hu$t 1V D HI L-^! IV1HH5y I} P H-]! Iu H@ Hx`u tH@ fHt$HL$(HP`HT$HPh@`HT$ HPpH@p HT$(H@ HT$ Iu H|$ H|$ HP u?HH u8HH ,H|$ LH H|$ H@ HL$(HHt$HE11Lh HH$W H$HH$B H$f H BH BHH Df f wf D UHSHH HHWHvH9u Hu(F} HH[]B fHX H HHH~?H;PtHt3H;P tHt'H9P(tHt H;TtHH9uf D Hp zH1HH5 H= XHu(WHHZ[]HH HH9"ff. wH; BH* BHz HHf%Yw H% 8ø6 f D AWAVAUATUSHH P =p G` kA;k HSHcHH@(H~ 8{ g H@Hu{` P =p IH{` S;S> HKHcHD0A[jkIE ;k] HKHcH 9 kA {` Hs L HHM~SH@IU HItBHEIUHPIt0HEIUHPIt IL HUAH IcL9|L貑 HH HH H{ DH f D PHhS HH[]A\A]A^A_à LH $SNIHHkH $HH;k0 HKHcH 9tMkA LH $SIHH $S A HHI;S HsHcLA8t9SHSL Dc1 QSI9 MD HHs SHsHcSHCHHAH@(H&HlsSHTsSH߉$LL$4s${KLL$wH" C` MLLD$J4 L $}L $LD$Ht SIeM D HHNH~$FHo HcH HH H H HHuHGHH5 HPH'W! H81 1f Hs9X;Hc9X2H9A[(H9^1H9AZH9X HV! HHHe D 11 H AVAUUSHH9HH HHHnLpMHUJ 2H9M HMHUfHFH@H~ Iu#HBHB HHBHH[]A]A^fIN1HJD2 HHHBHHBHH[]A]A^f D HnHUHJH9M rA cHFyA A Ht$I9ICH HHPHt$HEHJ *ff. AWHAVAUATU1SH HFH6fo H$ H|$H\L$ HL$xH\$1H\$HH\$`D$hHw E1Ht$ 1D\$,LT$8HT$0L4IFHH Dx H5U! HH HD$P H+ 't "E111LyT$(Lt$ H $' H9H $T$(Lht$ D D9IvDID98 } u\ LΓH ED 11LL HH H L|$PM E2 Hy # H|$` HL$`HH9l$ tHD$0Dd$,H@LT$8E HL$H|$Ht$`L]' HĘ []A\A]A^A_ID$,A9L|$PM EgH|$HHV H|$H j(EG H|$LLLj HHD$Ht$HL$Hx 芠(HD$L$1DH D@ AJARPHD$p H|$X( ZY0Ll$`HL H|$` M H!E111H=k J3w Hc HHH '"HA EAHAAE AuA DID9DDLyD9LhD9DL ) H8 ut LLHHL$HHL$X1LLn HHHt$XHx|H (H HD$xhEIHT$PLl$`VE1t$ K LAAVt$PH|$0a H 6MH|$HHL 8Ht H|$ 1EL|$PMHt1GHFH McN McF IcNIcVWPHM! H|$ H01R AXAYL|$`qL|$`gf. UHSHH HHGHvH9u&H}(1G HH1[]ޔf D HX H HyH~?H;AtHt3H;A tHt'H9A(tHtA J;DtIL9u D HHT$ HT$hqHRH % &HMHH1[]6HHH[]HH H,H9f. ATIIUHSHH N! H@ HI?Iu;C PS ~rHUHBHtaI4$B H}ЃC H[]A\HLD$ HHt+HLD$HvJ! HH H01ʸ HD1H5 H w1 IH1 UH P =p O`1 o;o HWHcH8tjW`ox;o HWHcH8 tCG`o_;o HWHcH8t o H1]f WH]H|$hH|$FHcOHGHHʃ8RH|$PhH|$!HcOHGHHʃ8 HH|$ hH|$HcOHGHHʃ8>WAWIAVAUATUSHhHoIE1MHHD$HqAHt$ / HT$HBHD$H: HJIHL$Hz HPHT$H9 ILI J< Ld$IHHT$M L( Ll$0 @ PT$H< / HT$HBHD$H: _ HrIHt$Hz HPHT$H> HHHL$H: IHP Hx HT$&HIHT$Hz u @ HL$H< IT$/N D$H< = ID$/q HT$HBHD$H: HJIHL$Hz LMF Ll$0HELl$0M > H@8HD H, 1LH1HLH M9+ IHhL[]A\A]A^A_ILM Ll$0I~Ll$0 M H< M>/ HKHHqHsH IL9~ HKH< HqHsH I HHL9}ZHKHqHsH IL>HHL9}=HKHHqHsH IL>L9} HKHqHsH I HL9u @ HE LE1LHH?L2M9LHD$ـHD$ Hs HIHHL9} MD>/ HKHHqHsH IL9ZHL$HAHD$H9 HqIHt$Hy LM) Ll$0SPT$H< CIgHs HIHHL9 I|>/v$HKHHqHsH HL92HsH HHL9 /vUHKHqHsH I HL9aIMtnLl$0Ll$0IԸ MIrHs HI HL9IM2MLl$01M2I1Ll$0! D AWAVAUATUSH(H H HG L`ID$ HHM|$HIIHPIwHM;|$ IT$J It$HH HEHP x u{HE! H@ Hx` .Mf fHnfAnU fnMfA:"U I\$f:"MHCflHP0H9 HSHCIT$HRHuO @H H([]A\A]A^A_L ID$J H+/HCHP0 IT$ @H 몿 )D$) $, fo $foD$HHNHCH@HHP0BAWAVIAUATUSH( P =p S` E~E9~ INIcHXhL# IHt+EnE;n INIcH8 Gf Av`E~L IH E~E1 D A H(L[]A\A]A^A_L_INIcA~` HXhOL_IcNIFHȃ8 [A pA =p A~` AF D$"xH$HHD$ AF`E1D$LQ_ IHt!L9d$ H$NAFID$ϋD$Iv LAF$HH?HcD$I9~H4$D$H<HrH<H<$HT$){A L$^A~` }AvI~ HHDH HT$LLD` M~ D $賗 D $HHZPEAW Ϙ ZYIH! Ht$H<$LD$HHH4 HD$H1H$LD$f. USHHHA! H@ HOALA Ht AHHH[H1] D HuAHHH[H1]Hz tff. AWAVAUATUSHH P =p DG`E k;k HSHcL$ HHB(Ht 8 H@Hu9kC`DrDz :twS`k H IHt<LẒ H HL[]A\A]A^A_f k PL` SA틃 kP =p {` 1 HǑHHHD$ sH{E ^ IH|D@ Hߺ D` HL$Hk DD$Hl DD$HH9QE DUD ^_IHLẒ DH H/[HcCHSHHL$ HB(H#3f AWAVIAUATUSH8 P =p D_`E A^A;^ IVHcH, HH@(Ht48 H@Ht 8 } H@HuA9^ H*EV`D`DhE6LIH A~`A^{LIH+ AV`A A^PA =p E~D9AIFMcLJD`h裺H AF`E~E9~ IFJ8G AF`E~9E9~ IFJ8 AF`E~ E9~ IVA J: A A^1fH麓 LA k @ PHhAVA If HL HHA HL :A A H8H[]A\A]A^A_þ LWH4LIH$H 1LH5AvI~ HHPDH H$ED LHpE Av P AXAYHH LaWHLpX H$H L6WH1LH5A<{AvI~ HHDH @ Av DE LPHt$m Y^HH)yDAFA PA =p }A~` AFL$HD$H $A~` AF8LH $AF1H$A A~` O L&VH9AvI~ HDH D@ ARAv H|$D A[A\HHFA (DLAF6HH$ LUH $HsLUIcvIVHH:SLUwIcvIVHH:TrLUaIcNIVA HIσ: RAPE~A =p A~` A ANPA L$=p hLHD$H A D$E1AFA A~` j LoTHuEA LTIcFIVHH, HH@(H!1AvI~( H?DH D@ RAv DL S Y^HH A PA =p A~` AF D$lHHME1A~` A ,LHT$(LL$ LD$ T LD$LL$ HHT$(Ij D$AFM E^`E Iv LHT$D\$ LD$HT$HILD$D\$ IcI9{ H<IqAH<A PA =p 3A~` AF D$kIHAF`1A H<$D$ LrRH D$Iv H<$AFIH HcD$ H9$ L!oHt$LLA A IHk LQA~` ^NM9 AFN ID$F LHD$QHT$HWI~ H H$HKHtnA HLL$ZnA LUQA~` HT$Ht$L H$HMHHT$J4 L\$(LD$ LL$HT$HLL$LD$ HL\$(LHH]H$I9t5H$IL ANHH$L$ It IOD$ H4@MLHL$J4 HHL$Il}f USHHH LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ HC (HkH$ $ HD$HD$ HD$0 HD$ H $/ HD$HPH HT$HSH H} HD$HHH0HL$H H| H>HrH9~SHpH| H>HrH9~>HpHL (HHt$HpHH9~ H HHHtHHH1H9u H []f Ht$H{P$H H9Htʃ/v-HD$HPH HT$HS H H! @ HH{ H $H:Ht/v,HD$HPH HT$HS(H HPHHK($H H51ɺ /v6Ht$H~H6H|$H|HH>H9~$vH|HH H9 H9f D AWHAVAUATUSHQw_H \L HcH LfLo oF MImHEHP0H9U r3HUHEtHUHu_ L`X@ H[]A\A]A^A_ÿ )$ fo$HHHEH@HH0HJHBImIU L`X@ bf. HH9|jH9~Hu HH$ HGHL ILDH9H HERHVH5 HH-! H81S Y^1H H.HL s APILDH9H 9 VHDH[-! HH5a H81 AY1AZL @ H HcH yvtHÍNtHcHȋ yvuߍNtHcHȋ2~vuHy D AVfAnfnAUfA:"USH(f:"L$PLt$XflHHAՅI^HHCHP0H9r8HSHC HSHuj HhHpDh@ H([]A]A^ÿ Ht$)$ fo$Ht$HH[HCH@HH0HJHBAI^IV HhHpDh@ fAWAVAUATUSHH P =p :W` k9k;HSHcHD`DhHcHʃ:t k 1 D H߉C IHtHj IHt HIHtsH{HfnH fAnH{ 0 f:"H fA:"fl)$H6fo$ LpLx@ H[]A\A]A^A_Ã{` H HuӉk1ff. AUATUSHH P =p O` HDcrIH S`DcNH HHuFC`DcD;ct|HSIcH8tN Dc HH[]A\A]ú HHHIH LDH߉CIHtxHHHcKHSHHȃ:l UHSHH HHGHvH9u&HU(HBH Hr HH[]f D HX HtaHJH~CH;BtHt7H;B tHt+H;B(tHt H;DtHH9uf. H roHH H H9QHHZ[]ff. fAWIAVAUATUSH( P =p ` A_A9_} IWHcHhD`L IH A PA =p Aw` Eo_HHfAO`A KpA =p AwA9w IHcHǃ8 A A Eo D H=V" HV" A A A`A_3L IHt"AGA;G IHcH׃: AG`A_L HHuA_A A H(H[]A\A]A^A_LE]IWHcA` HhD`hTLH$qEH$MIcIGHH8 A L6E IcWIHH׃: pAwHH I_ D@ LDp HD$c D$HHRD SE_ Y^HHA LH$AwO H$HT A EoHA q A` !AwA;w! IHcHǃ8 . A EoA A Eo`EIw LHT$L$7HT$HH L$IcL9}H<HqAH<HH $<`A L7CA` dAwI/HHH $D@ LLDh I_ HD$| D$HHXAQEDS } AZA[HH{ LH$CH$AwLH$Aw H$HA H H$HD$hH$HvHL$H$ HHD$ EoHHA L$pA =p A` NAGA;G IHcH4> t2A A EoMA LHT$AGLD$ LD$HT$HItA H $H9L$tFH$EoL HH$.LHT$LD$ALD$HT$"AG:HL$HHT$LL$HHH4 HD$HT$H LL$Huff. AWAVAUATUSHH P =p FDG`E k;k: HSHcL$ HHB(Ht8N thH@Hu9k C`DjDzg:tiS`kH IHukLN H PL` S HL[]A\A]A^A_AH߉k IHOsH{IH)DH D@ Q s LDD聋 ^_IHLN DHp eH?HcCHSHHL$ HB(H @ AWAVAUATUSHH P =p *` k9k HSHcHDpDhHIHtKS;S HKHcH85 kE1 HL[]A\A]A^A_ @ kE1 H>eHSHcŋs`HDpDh_H}>qHcKHCHHʃ85bH߉S IHsH{HD@ DH Hߺ LHk DD$ DL$DL$DD$ HHPLDDU袛 H HH ZYIHH# I׃ @ AWAVAUIATUSH8 P =p DO`E E}E;}W IUIcH HHB(H 8K H@Ht 8K H@HuE9}/IEE AU`HXhE L IHt%AUA;U IMHcH8 AM`E}Y L IHtHK DLA A H8L[]A\A]A^A_ÐPL`A AUf A Zj?A T AU`E}LT IHuE}LK DLqA XL;ſIcMIEHHʁ8 LAU HD$H L:HLIHAuI}IH"DH @ Au LALPH|$f ^_IH$ÿL:dIcEIUIH HH@(HA þPA =p ʾAE1LH56 D$= L HD$H A 1E A PA =p A}` GEuE;uIUIcHp@t$D$LI HD$ H A}` EuL$ HH A}` EuLQ HHA fnfA:"fAօ D$A}` AE L IHt L8HA A AU`A E}SlPA =p 0LIH A A AU`E}A E Lt$A HT$L uWAEIMHHx t@HT$IcN$LLcJ,LcB(IcV PH PH! H01Q` IXZM]辨HA AE` A E11 LmLIHL fLHAA .ff. @ AWAVAUATUSHH8 P =p VDG`E D{D;{ HSIcH, HHB(H 8S N H@Ht 8S 9 H@HuD9{HC{`H(hDhH$ IH P =p s` DcOHH}K` /p =p )s9s H{HcHǁ8> 0 Dcf D H=F" HF" C`D{q HJ IHtbLS DH详 @ PL` S H8L[]A\A]A^A_ D jDj @ D{E1HH$5H$Hc{HCHH8> tG Hr5rHcCHSIH, HH@(HHH$sO H$H: DcH q {` %C;C H{HcH4>> # A DcDc`EHs LHT$L $HT$HHL $IcL9 HH $PD sH{AA IHfnH $fn@ Lf:"@ fA:"HLc foHfl)$lm HHSL0 IHýfo $ @ HhX H<HqAH<-HH$C H$H H H$HD$H$HýHL$H$ HHD$ DcHH L $p =p _{` GC;C H{HcH4>> tR DcM$HH$2H$C E1HHT$(CLL$ LL$ HT$(HIt H $H9L$tEH$DcLHH$HHT$(LL$ I2LL$ HT$(.CHL$HHT$ LT$(HHH4 HD$襵HT$ HPLT$(Hv靻鷼AWAVAUATUSHH8 P =p DG`E D{D;{ HSIcH, HHB(H 8T f H@Ht 8T Q H@HuD9{HC{`H(hDhH$ IH P =p ټs` DcIHHּK` p =p s9s H{HcHǁ8? 0 Dcf D H=@" H@" C`D{j HJ IHtbLT DHϠ H8L[]A\A]A^A_f D PL` S jDj @ D{E1HH$/H$Hc{HCHH8? tG H/ȼHcCHSIH, HH@(HHH$sO H$H DcH q X{` [C;C H{HcH4>? A DcDc`E Hs LHT$L $HT$HHL $IcL9}H<HqAH<HH $ KD sH{AA IHfnH $fn@ Lf:"@ fA:"HLc foHfl)$~g HHL0 IHbfo $ @ HhX HH$C H$Hj H H$HD$>H$H HL$H$ HHD$ DcHH L $p =p {` C;C H{HcH4>? tR DcM+HH$,H$C E1HHT$(CLL$ LL$ HT$(HIt H $H9L$tEH$DcLHH$HHT$(LL$ p,LL$ HT$(CHL$HHT$ LT$(HHH4 HD$̯HT$ HLT$(Hv AWIAVAUATUSH8 P =p Do`E EwE;w IWIcH HHB(Ht 8U H@HuE9wAG`jDb(:E ` E_`A EwEPA =p .A_A9GDIWHcHxDh<$Lv HHj A PA =p dEW`E AG D$ CIHEO`A EHD$ HD$ BA p EG`E PAOA =p A;O IwHcHƃ8 A A`AOm PA =p A p = AWA;Wj IwHcH4ƃ> A Aw`AOPA =p +A;OR IwHcHƃ8 A AW`AO PA =p $A;O IwHcHƃ8 A E_`AOEl PA =p ҿA;O IwHcHƃ8 * A EW`AOE PA =p A;O IwHcHƃ8 A EO`AOE PA =p $A9On IwHcHƁ8E A EG`AOE` PA =p sA;O< IwHcHƁ8 A A`AO, PA =p ZA;O IwHcHƁ8F A Aw`AO PA =p A;O^ IWHcH8F 'LAO HH I HHFA H|$A H9|$ HD$AIHA |$ HD$; PHXA AWA H8H[]A\A]A^A_fAW`A_ L HHt0HU DLA A f A A EwE1HٺU DL賖A Y @ EEFLEGIHAwItHHBDH D@ SDAw L d ]A\HHtLL$,%L$,ٹAW/LL$,h%L$,IcwIGHH4> zH~BAGH AGd H5p L$,zKL$,;A LL$,j L$,HH I L$,H L$,HHcLL$,$L$,AWLL$,$L$,SAWLL$,u$L$,?AW LL$,T$L$,AWOLL$,3$L$,AWLL$,$L$,nAW]L#ȵAOLL$,#L$,AWsL#}IcGIWHIH HB(HE LL$,AW#L$,HL L$,HHI L$,HH LL$,AW L$,HHI i L$,HHLL$,AWA L$,HHI # L$,HHLL$,AW L$,HHOI L$,HHN LL$,AW!L$,HL L$,HHI } L$,HHbLL$,AWU L$,HHII 7 L$,HHuLL$,AW L$,HHI L$,HHbTLL$,AW L$,HHI L$,HH bH|$HT$ HHLH4 HD$衤HHT$ IA u)$(駴 ff. AWAVAUATUSHH P =p DwD9w HSIcHHh(Ht} b HmHuEHb DHwq DsP =p aDK`E DcD;cHSIcHHpDxt$(IH s`DcH H S` { SA9 Dk EHmC HH[]A\A]A^A_ D S;S HKHcH8\HL\$S IH=sH{}H;DH @ ELL\$s PL$LMJ _AXHR {` SD9 @ HAK K`Dc u\Dk HG eDsHL\$) ^HcKHCL\$HHʃ8X 1pf. AWAVAUATUSHH P =p DwD9w HSIcHHh(Ht} c HmHuEHc DHnj DsP =p DK`E DcD;cEHSIcHHpDxt$(IH s`DcwHU H S` { SA9 Dk EHmC HH[]A\A]A^A_ D S;S HKHcH8 \HL\$S IH=sH{H͵DH @ ELL\$s PL$LG _AXH {` SD9 @ HAK K`Dc u\Dk HDsHL\$yHcKHCL\$HHʃ8 X 1f. AVAUIATUHSHHH0HXL%lL9F HG @e LsM8 IF @g LsM IF @ LshM IF @c H{8H H{@H9 H{PHL%5lM9$ HG @C Ls M IF @ H{XH H{HL%kH< H{pL%kH H{(Ht!HkI9 HG @ 1H[]A\A]A^ HAՅuH{HHAՅuH{HHAՅuH{hH HAՅuH{8H H{@H H{PH鶳 D HAՅ^H{ HHAՅCH{XH H{HH% H{pH H{(H M9HHL[]A\A]A^f D HH H HGHHG HH H HGLsHHGMwJfHH H IFH{XHIFHjjA D HH H HGLs HHGM fHH H IFHIFLshMH{8H L%[iM9 fHAՅ D HH H IF}HIFLsMu7fHH H IFH{8HIFHyJil! D M9u3.iM9u+if HA HA HYiH9 % { H)iH9H A % HhH93 % HhH9 A % & HhH9 A % T HihH9 % H9hH9 A % , L% gM9u$gVfHA D HALH|$H|$xH|$H|$LH|$H|$<LcL魮雮֮ff. AWAVAUATUSHH P =p DwD9w HSIcHHh(Ht} d HmHuEHd DHw DsP =p DK`E DcD;c\HSIcHHpDxt$(IH s`DcH H S` { SA9 Dk EHmC HH[]A\A]A^A_ D S;S HKHcH8\HL\$SE IH=sH{}HDH @ ELL\$s PL$LM> _AXH {` SD9 @ HAK K`Dc u\Dk HGDsHL\$)HcKHCL\$HHʃ8X 1f. ATIUHSHHHHt HcH9uzHG @ H{HurH{ H} H{(H HOcH9uZHG @ H[0HtHC @ 1H[]A\ @ HՅuH{HtLՅt LՅuH{0HtHLH[]A\HH HurHG=HHG0HH HuqHGXH[0HHGHLXHH HucHC@HHC13HIcH9up % oH%cH9uZ % pHcH9uD % u1LՅvH|$H|$H|$H|$H)ff. ATIUHSHHHH/H{aH9u6HG @uKH[Ht HC @u\1H[]A\ HՅuH{HtHLH[]A\HH Hu;HGtH[HHGHuHH Hu4HCtHHC1HaH9u6 % uNHaH9u$ % u1DH|$H|$HAWAVAUATUSHH P =p DwD9w HSIcHHh(Ht} e HmHuEHe DH}x DsP =p `Dc`E DcD;cHSIcHHpDxt$(IHL DK`DcEHIHu{s`DcH H S` SA9 HAfEHmC HH[]A\A]A^A_ D S;S HKHcH8"eHL\$S] IHFsH{HDH @ ELL\$s PL$LU8 _AXHV {` 1; S;S HKHcH8!HL\$S IHusH{տHũDH @ LEL\$s PL$L7 AZA[Hi {` OSD9n Dky K`DcP DkOH Ds HL\$v HcKHCL\$HHʃ8!HHD$? HcKHCL\$HHʃ8"ouSHH=] 0HtOHXHtHH HpH@ HRH HyfHnH7HPH fH:"@Hq[f. AWAVAUATUSHH P =p DwD9w HSIcHHh(Ht} f HmHuEHf DHyu DsP =p eDc`E DcD;clHSIcHHpDxt$(IH DK`DcE}HIH? s`DcH0 H S` SA9 HAf D EHmC HH[]A\A]A^A_ D S;S HKHcH8<HL\$S IH sH{mHʧDH @ LEL\$s PL$L=4 AZA[Hn {` SD9 Dk)f D S;S HKHcH8HL\$S IHsH{譻HDH @ ELL\$s PL$L}3 _AXH( {` A 1{ K`Dc uDkUH`Ds HL\$d#HcKHCL\$HHʃ8BHHD$-HcKHCL\$HHʃ8qxff. AUIATIUSHHH H@ HæE H?HڍHM ~:IL$HAHtIA uI|$LЃE H[]A\A]L1ЃE H5- HHT$~ HT$t1f D AWAVAUATUSHH P =p DwD9wI HSIcHHh(Ht} g n HmHuEHg DH7ug DsP =p WDc`E DcD;cHSIcHHpDxt$(IH DK`DcEMHIH s`DcHIH4 C`Dc~HIHY DK`DcE#HIH, s`Dc H H S` SA9 Dk EHmC HH[]A\A]A^A_ D S;S< HKHcH8HL\$S IHsH{護HDH @ LEL\$s PL$L}/ AZA[H {` 1: S;S HKHcH8HL\$SE IHhsH{HJDH @ LEL\$s PL$L. AZA[H {` PSD9e HA D S;Sf HKHcH8/HL\$S IHsH{EH9DH @ LEL\$s PL$L. ZYHߤ {` J @ S;Sk HKHcH8HL\$S IHsH{襵HcDH @ ELL\$s PL$Lu- _AXH {` S;S] HKHcH81HL\$SM IHsH{HDH @ ELL\$s PL$L, H߾ HM Hnb _AXHq {` = @ K`DcP DkYH DsHHD$ ȡHcKHCL\$HHʃ8HHD$q ǢHcKHCL\$HHʃ8/(wHHD$: cHcKHCL\$HHʃ819HL\$ HcKHCL\$HHʃ8rHHD$ HcKHCL\$HHʃ8`rYff. fSHHHHvH;HT$M2x-H|$HtHs H H[H H 锢 AWAVAUATUSHH P =p DO`ET k;k HSHcL$ HHB(Ht 8h T H@Hu9kâC`DjDr:> K`k9k HCJ 8 D{`kE^9k HCJ 8 {` kP =p A9kĢHSIcHHDpDh IHt S;Sd HKHcH8#x S`D{ H IH HHߺh 1n HL[]A\A]A^A_ËPL` S AH߉kIHǠsH{ϰIHD@ DH V s DDLD; _AXIHeLh Hm Jf kE1f H߉CpIH&sH{(IH(DH D@ PDs DLֿ M; IXZM]f. H߉C IHsH{踯IHDH D@ ASDs DLֿ : A]A^IH鶡HHcKHSHHȃ:AHHcKHSHHȃ: >?Hu؞HcKHCHHʃ8#H߉SIHnsH{ϮHDH @ s D LELP& Y^IH HoHcCHSHHL$ HB(H off. @ UHBHSHHHH>HvHu1HT$?-uHCH H[] @ HD$H[] @ H[]ff. fAWAVAUATUSHH P =p sO` k;kl HSHcL$ HHB(Ht 8j ~ H@Hu9kIC`DjDr:7ttS`koHF IHtNLj Hi HL[]A\A]A^A_ PL` S k AH߉k HH&sH{菬IHSfnH fAnH{ 0 f:"H fA:"fl)$jHHtfo$ Hh@ HD HDY IH 饟HjuHcCHSHHL$ HB(H|Ȟ @ AWAVAUATUSHH8 P =p dDwD9wA HSIcHHh(Ht} k f HmHuEHk DHgn DsP =p zDK`E DcD;c HSIcHHpDxt$ (IHt S;S HKHcH8 s`Dc_HHHD$ C`Dc&HHH DK`DcEHIHK s`Dc֟H kH S` [ SA9 HAf. EHmC H8H[]A\A]A^A_ D K;K HsHcHƃ88HHT$K% D[`HEC;CHT$ HsHcLA8D@DChHfnD$ E1H{ fnH f:"H fA:"flHtLaHI0 HL$ HT$)D$igHfoD$HT$ HL$ L`@ DS`HPHH E 1f D H(L\$HIsH{蛨HHK DH LL\$(D` HDL$HL$L HL$DL$HL\$(HQ1ELATL$0 ZYHH {` F @ S;S HKHcH8 HL\$S HD$Ht HH^sH{赧HDH @ E L\$s PL$0Ht$Lc _AXH {` SD95f. DkAHL\$HcKHCL\$HHʃ8<HL\$SITHH KH{ȃiHL\$HNj0DFA DH @ ELHrs PL$0_AXHF @ K`DcP DkYH$DsHHD$'HcsHCHT$HH8FHHD$YhHcKHCL\$HHʃ8 qq HcHNj0DFAvqHcHϋ0DFAvHyHHL$HT$YHc{HsHT$HL$LHA8錛ff. fATIUHSLFHHwLWHs(L[H]A\ ff. AUATUSHH^nHߝFHtToH HcHfH;HHHu=H[]A\A]H H9B4H; փuH; t1H;HYuH;1HHtZff. @ AWH?AVAUIATUSHHHk L@ H!IHwHII$L@L9 IvI|$wHH H AG PAW IE(H@H H I<$H9 נHGH|$ HHH|$ LD$ HD$ HD$( HD$0 AG H+tEHuYHH[]A\A]A^A_L2LL< 1HHHSHD$HR0HHD$tHHD$`HD$H} ՟HK<R HH韟H5 L2g 1B SHH H9FN HAHVHH[% D G tË tPG ÐHHPH; tfH; * H;e ! HuoHP(R u?H HPHz t*R FH 9Gȸ fN1HZ H8 H98 t tHAt,u'H;, ? H; ( H; / H kB 5 vH;7 A t@7.Q H u H M H@ HRH;` tI 듃HH H@ HRH;h L L\P RHl H@ ~AtHWO H9p q C y ATIUHS H H9 HY I$HHt9H@H H u"H th[]A\H; tFH; tH5"8 H tU1HD H9 e1 I$HC(1҃xH; t>1H; TzH= HX H9]댺 Q G = D AWAVIAUATUSHHG AʼnAAA@VLgH H{0LI9HHIF^t"DHHD[]A\A]A^A_ D L9rI9Eff. AVAUATUSHH0G;GD HOHcL,A} ImCHE H _ HS{h HHe K HHCHC L`ID$ HE Mt$HPIvHU M;t$ }uIT$J,It$HE HtLc AoEI\$HCHP0H9 HSHC& HSH HhH@ @ H0[]A\A]A^LkID$J,Hm uHEHP0rHcKHSL,HA} IT$w )$~ fo$HHHCH@HH0HJHBI\$'Hx IHu._tHHU u L{I LHpV?f D AWAVAUATUSHH8 P =p O` k9k HSHcHDxD`Hcȋ Hʁ:J tk1 H8[]A\A]A^A_ÃCF p ˝{` C D$AB p kHDkM IHΜ{` DkH$T IH{` DkXH2N IH H| HH$ Hy} {` I L$L11H IH4 {` HHH臨IHsH{诙HǜD@ DH Hk M PDDLULN ZYHdz{` DkHT IH {` DkH| IHuI D$E1CHD $DD$ 0 DD$D $HIYvE1111H IHs H| {` I[M111Hf IH 際f USHQ P =p ͣ{` Hߋk&Hu"{` k< HHuk Q Z[]ff. U1HSHHm H; t H[] D H(t$H{HGhHt#H@HtHHH[]HPHR0HuHύ X[]_ ff. @ AVAUATUHSHGHHvHH`H HcL,H9u9M0 L5a E1f D HHAL9 []A\A]A^ D HN`H3 L$M9& Mp MuL5 HX H HJH H;B H H;B H" H;B( HG H;D HH9uL5 *fI. Mt+HHAL9IHPIHu&IFLP0IH D L51 IHIL L5 @ L5 @ MtL5 H H`H9uHHAL5 L9s0IFLP0/L5 #L5 5H9LHF`H?HcL$M/L5` L5T ff. @ AVAUATUSHG w HHϢHF 2 } H- H W H9 H W H9 LmLsHL)L9C K|5 @tyU @ 9B芑IH E1M1H1Hy E1M1HLLc [L]A\A]A^H[]A\A]A^G HtB EU @qt EQ Ǹ @HPH H5". H81xQ E1]HPH H5, H81TQ fAWAVAUATUSHH B p DG`E PDc =p 5 5HHqE{` oE1A P =p [s` S;S HKHcH88 K`S K;K HsHcHƁ8 S DsM H=! HE1$! Dc HL[]A\A]A^A_ÉЃ H߉$C$H黠H߉$8$fHcsHCHH8 FH߉T$K@}T$HH$ HrT$HޠH HHD$HW HHLC Ht$1H<$ HH M9 Ds JT I H߉$P$HcsHKH H980{` cHL H Hu DsMKD{`E>Hs LkIHݞIcI9H= (HL IVAH MHH$J4 %`HH$H#Ӟ骟HG t A1RHPH5E) H H81M Y @ MZ AWHAVAUATUHSHH(R A҉A@AE @ Lh0D_ DDA A@ Lg0E9 E EHLILMHs6 HtA 1H([]A\A]A^A_ IHJDHD HCHH)HI)HHrI:HqIȺ HIH8H9sH HtgHtUHtCHt1Ht Ht Iz HxI<H<HI<H<HI<H<HI<H<HI<H<HI<H<HL9I HrH ILHLILHLIL2HV8HL0IL2HL0IL2 HL0 IL2(HL0(IL20HL00L9r LgHE9UAAAB : A@LgHEH<L@@ HL(0H0IN LH)HL1L9 HHv2IIMCJ HHLH9 HH9 HH D HHfDBD@fDBD@fDBD@fDBL9rHHFH H<1HL9fGH LhH AD fD _ AAD D D AD$u E AA|$ E A@HOHH<HL- @ŝ@{HTHHHIHIMJ HH)HLL9rQLRE1HpM9IBHH9HHHM9IBH144GHH4H9rd1f83IHAAH L1HHof80fsf80 GDGHH9uLHL HJA<I)I9t@~IMf80fs Mf80fA $fAD$A IJJDfD DBfD@DBfD@RfPHL(HHH"@HAHHILLHAHH1E1JA@HOHL@@ LL(0H0ILLJ< HL)HM L9s%HHFAFAFAFMA1H M9HBHBI I1H4H944HLL(HHHpLhHEAAE E fA@SH0L LL- @1@NLHHHILLMJ< HL)HM L9 HMA1HM9HBHBI IH9HHQAu E A@HOHHH<H @c@LHTHHHIHIJ4HH)HILL9 A DYIHHL DYHL DYHL IBHHFAFAFAF A@H0L H< @@HT8HHHIHLN LH)HLL9s%9HH@~y@~y@~y@~LBH1HM9HBHBI 1HL9 $LZLE1LHM9IBHM9IBHH9HHfAAUATUHSHH~ H HH98 əH H9( 7 H0 H 1HH9 HH @tBH HKH@ H@H HCHrfHnH HfH:"CHJHCH H Hh HhH HhLe II<HɘFd L@ H HUHwtHfH @@ Hm @0Ht HHH0H9uHHt HcH HCHH[]A\A]f H HtH@ HtH@ HtH@ HtH@ HtH@( HtH@0 HtH@8 HrH@@ H ` H HcH9|>f Hum 陗H HUH5 H81=B 1HH[]A\A] D HHhG HC HB t Hz . VHH1ff. fAWAVAUATUSHH P =p O` DcD;c HSIcHH@(Ht 8 | H@Hu{` H HHtt H {` ua H DtKH麉 DH? HH[]A\A]A^A_ @ PHhS σ Dcu51H HcSHCHIH@(H 0髗8 @ AWAVAUATUHSH8 P =p XDW`E DmD9mlHUIcHD`@D$( P =p Hn HH H~o HH HH HË H =p ؝}` P HDu|H DuE1D }` A@ uH}UHwDH Dp Lm H M H1D $ AUD1AVDL$HHDD$8h AXAYH՜ H8[]A\A]A^A_à }` DmHX HH Dm1빉 H4 IH LHHL$DL$ LHH$ HL$H<$ HD$DL$I/LLDL$,L\$ HL$ZHL$E1HsHxIHHL$LIJ LD$LD$HL$L\$ DL$,M9H1D $̤ AULDAVDL$HDD$8HT$ ^_uH}HH HHDp L} $ IH:HH HHu"<H`H1? AWDLAVDL$HHDD$8萤 ZYH* 鞛f D AWAVAUATUSHH P =p HW`# k9k( HCLcJDjDrHcHȁ8= U C`kR;k HCJ8= t&k1ҋ HH[]A\A]A^A_ÉH߉C9{` IusH{4~HHԛfnH fAnH{ 0 f:"H fA:"fl)$J<HHwfo$ L`@ \H.HcKHSHHȁ:= ,OH|HCLc{` JDjDrOS;SH'SHC< H߉S.HHIH{sH{}HH^fnH fAnH{ 0 f:"H fA:"fl)$+;HHfo$ Lx@ =+fH~ t3QHGHH9( 1HH98 wZ1HuHB tHz uf D UHSH(HGHx HHH H9C ҚH: H9Fu6HVHt,HL$H=HD$HH H+t'H([]HHt$Ht$HHu^HSHD$HR0HD$ AUATUSHH P =p ?` k9ktCHCHcHDbDjHcHȃ8tp k1҃ HH[]A\A]Hk3HCHcՃ{` HDbDj-S;SuH6%SHC넃H߉SwIHvsH{zHHDH D@ PDs D Ld Y^HHH_ Hʃ+9ff. fUSHHHG H H:HHHTH HHHHH HuHHH6HqHtwHuHHHvHqHtaHuHHHvHqHtKHuHHHvHq Ht5HuHHHv Hq(Ht HuH|HpH<HH9uH[]HX[]= ff. fSHWHHt&HOHBHH HHBHgHG HCH* H{H9t5HHH HK0H;uHHC(HSHu4HS0Hu5fC(HuHCH[H@ Y1HCHS0HP0HB(ŐATUSHH P =p W` HDc HHt C;C HKHcHу: C`DcHU HHt2C;C HKHcHу::t11҃{` u HcH8tbDc1 D H[]A\ÃC{` uًk;kuHHT$H4$ \HcKHCH4$HT$Hȃ8ukH~ HuH-HcKHSHHȃ: : H߉C){` HHH! H8鵝HH4$gHcSHKH4$HHу::1c AWAVAUATUSHH( P =p O` DcD9c HSIcHDhDpH#HHu!Dc H(1[]A\A]A^A_ D P =p FS` D{D;{ HSIcH8 ޜDH߉C谄HH B C`aKH{ȃHHNjDBA fn@ fAnf:"@ HEfA:"H{ fofHnflfH:")$)\$H= ( 3Hfod$fo,$H@ h V H([]A\A]A^A_ÍQtHcHNjDBAvOtKfn@ fAnf:"@ HEfA:"H{ fofHnflfH:")4$)|$HPݛQtHcHDAAvuHyHHSIcă{` HDhDp齛H HcKHSHHȃ: P6 USHHHHH[] @ AUATUHSHHDg E A@tLkHL9t 1H[]A\A]A H{0LHff. AWAVAUATUSHH P =p {` Dk]HH`Dc`ECHlH HE SA A H߉T$ DT$ HItM9 Nl SIщSHs LRMIH 1M~HL IEAH IcL9|HL[ HH[]A\A]A^A_DkHs 1LIHu鸟MHJ4 +BH-HKf. UHSHHHGH@@HCHHE11H1aHHtHHƲH+t HHH[]HHD$. HD$ff. @ AWAVAUATUSHH P =p DO`E DkD9k5HKIcDHD`hHc H 9t#Dk1҉ HH[]A\A]A^A_fSP =p DC`Ec HD{m IHt S;S HKHcH8 D{E1f D {` s;s H{HcHǃ8t <sTpHHDH D@ Ps D L* Y^HHH HʃH`HcKHCHHʃ8 ;H߉S" {` H LHzIHH$HcCH{HHǃ8" SJܠff. AUATUSHH P =p DG`E5 k9ktdHCHcHDbDjHcHȃ8 C`kH HHtw HH[]A\A] @ HjHCHcՋ{`HDbDjcS;SwH$SHC[k1ҋ H߉SIH>sH{1nHHDH D@ RDs D L Y^HHudOfAWAVAUATUSHH P =p ̨Dg`E HDkzIH S`Dk H;|HHt`DsD;st5HSIcH85tF Ds HH[]A\A]A^A_H茹HcSHCHЃ85uDk L뵋 ŧP =p E1HT$ HL\$t( Hl$H{` Dku{` Ds&HC{HHt5 H^H {` DsHHH0{` Ds1HH5' 4 t&HHHt HH1DsHD$Hl$ DHH( 靦ATIH5 UHSHH HêHj)HH[HL]A\ff. @ AT11IUHS;HHt H[]A\ D Hq H0H H@ Hx`G2 t[LH]A\ AWAVIAUATIUSH(? Il$HE H 2 H H9d Hd H HL$Hd HH|$H H@ Hx` Il$HE ĬL- L9p H p H L|$Hp LHoHl$HHE zMd$HE ID$ L9P{ v H`{ He LLHH{ Ld$M: I$H L蒪IH H^H Im Az E E H` LOHH| H@H@hH H@8H LHH+A HI AH8A LHH5 1& I,$ Hm H(1[]A\A]A^A_Ld LlHH HL$LHp HHt$lHt$HHL|$L:LH{ LlHHVLLL}Ld$M5ID$LP0;HEHP07HCHP0IELP0w< H(L[]A\A]A^A_2 H LHH5 H81% Hݘ LHH5 H81v% LH!t Ox HHGH @ H H?IIH@ HW0B0H1HHYf AWE1AVAUATIUSH MH|$H|$HLL$8LL$0H) Lt$`1H LIպ ILH$ LDŽ$ p LH\$@H\$L|$@L9sZ D HSHT$<\t{9t$t H$ H|$hHJH$ L$p H\$L|$@L9rH|$8H[ H|$0HC LHĨ []A\A]A^A_LD$HHL)HHL$XL9 LSLT$DKAA<n$ H5 HcHufWH\$L9d4Ht$h|$p H$ HBH$ L|$@H5 A 1|$,HD$L9w |$,DRA wETHT$,HD$Auǁ q 9T$ts3L| L|$@@DRA ҍTH$ Ht$h|$pHHH$ H L|$@H} uHU D|$pHt$h\ DL$H$ DH4$HCHH$ HD$ L$9L$tHT$H4$DHH$ L|$@{Aу0T$,M9s?CHЀw3HKTHL$T$,L9s CHЀwHDH\$D$,L$, vH} u HD$HHE 9L$t L" f L|$@Ht$h|$p H$ HBH$ L|$@Ht$h|$p H$ HBH$ L|$@Ht$h|$p\ H$ HBH$ W L|$@SH5U A H5_ A Ht$h|$p" H$ HBH$ L|$@Ht$h|$p' H$ HBH$ L|$@H=3 M9{{H{HHHD$L9إ8}uHH)HD$,HD$HkH3 L$1HT$,PL$JL$,9L$tW H$ Ht$h|$pHBH$ L|$@Ht$h|$p H$ HBH$ L|$@Ht$h|$p H$ HBH$ L|$@Ht$h|$p H$ HBH$ x L|$@tHt$h|$p H$ HBH$ G L|$@CDRAP ҍTH5_ Mt I $L6 x~L|$@HD$HI)HLH$ L)HT$PLH$ HD$8RHAVHT$(RHT$HRHT$pRH$ RHA LL$pLD$x H0H|$`Ht襇H|$8Ht薇H|$0Ht臇1H$ Ht$h|$pHBH$ . L|$@*OEHtE1LH H W H W H5X |$,L @L|$@f. H H?AVAUATUSHL@ HIHwIHIE L@L9uDMHusAD$ PAT$ ~DHC(H@HtPI} 1AD$ []A\A]A^LCuLHK y铤H5 L<# |u9 HUSHHHG HH)H9hHƋC0H+9BH {4 HHFHIHHHH9|H)HC(H9HMƉH'[HHH E @ C HU0{5 HS CHEHC1H[]f H{(H9HMZHHHu鑣f D H{DCH9 {4 t HHFHIHHHH9|H)HC(H9HMA9 {5 HH{ HH"H+ C HUH{5 HS 11҉C1HS A9YHHLC HE111HH;H+ H+}C u逢C xlD9DHC`YHHGLC HE111HNH;覃C5 #ff. H5 @ AUATUSHHH HHt H/ H{ Ht H/ H{`Ht H/ H{hHt H/ H{pHt H/ H{xHt H/ H Ht H/ H Ht H/ H{(Ht H/ H HuCH H H f{4 H=! HH[]A\A]%Ŷ! PH tHGP0HGP0HGP0HGP0HGP0HGP0HGP0 HGP0*HGP01H-3 YDnf SHHHCH z;HHB HHpHXH@ HRH HPHyfHnH H7fH:"@Hq[ D u Ãuf VÉ f HHTH5t f. ATIHUHS:H3I$H;-I HH;-4 L`ID$HCHC0H;-! H;- HC tP1HC(H= HKH@ H@H HCHrfHnH HfH:"CHJH[]A\H5 1HHC(Heff. fSHOHHWHAHH H HAHG HgHHtH/t H[ZHGP0ATUHSH*HcIH DPtHHcI$HDPu_t[]A\HHcI$HDPlf D USHHoHB HUHH9W! HG H}(H HU J LBHr Hz HHHHL9 H~ - oHS0fH:fH~HE HHHC HC(HS0HHH8 HxHX H @H/ H+ Hx } H[] @ H@HHL9}?H~ l oFHS0fH:fH~HdNHHI9 1HHC}1)$^ Htfo$@xHWH$R0H+H$THSH$HR0H$=HPHNI9~H~ tbHHH9zHu HA H)HRN IHHHH HS0It0 fHnfH:"HiHH I9H~ I98Hl H5U H8U HC1HH$>H$nHPHNI9H~( t HHqHH0L9H~ tI9PHHI9m饡ATFISHwHM HcH @ &߃ACЃ _ 鹢 AWIHAVIAUAATAULSH[KHHE: HCH H/ HELuA HCH Hu HELuAV HCH HW HELuD$ At5HCH H D$ IID$ A9uD$ LHAu=KHI` H+u HCHP0 H[]A\A]A^A_ HwHPIcHELuH9H)H E HP1D$ o1IT$ cKI` u-H- H0AʡDD$ DL1H| ? |$ ~UI>H/l$ ID$ D$ D$ HpIAH4HI6HH+u HCHP01ff. AVAUATUSHH H HD3HDHD$D(A0tkEߢHc A?HAFըޢLd$1Lg HHxUHD$8 u\E u6 H[]A\A]A^ @ Ld$H1L& HHy} u11H E " HD$8 tA1AJt!1H~ f.KO zh LH~ f.)O f(zWf脲 Vff. @ H1 H@ H;wu HHH S tH ! u4Cըt< HHx&H[H& HHx-uHH므-u H?H9t6H " @ HGH@hHt H@8HtP \ Zff. AVAUATIUSHHHBH; tiH[0 HH9 E PU 7 LkM HSI9T$u8 E H[]A\A]A^ HLH[]A\A]A^! LHUuItRHS I;T$tLH5uIt2A JTI;T$}LH rIM9u1bHC HHi IHաH5& HjLLn E LH/vHH^- H߉D$ vD$ H5 H _ff. fUISHڡH O 0] H5V~ A 0} H9 E OLWD LA9 LcA ILWHO H9}AYQ ILWHO H9}YAY ILWHO<H9}3AE' IHAJIA 9| LMuOPf D P"Df 1MtI8HH[] @ GLO߀Xt5OtYB <0 MtM1HnH5| G<HA EH5| G<gHA u H=Q J9s.MuIA9|MH " IHH OLW 9|H P J9rH5{ G<HA@ wAAI<0t鴞HH QP J97,H 5P J9ILWAYHO,H9I͞HfAVAUATIUHS1H9]~lH|L9tP L IHt\Hv I9FE1L;5z AI.t-HEt[D]A\A]A^ÐA []DA\A]A^E1LQ Af USHH9t=p HHtVHAv H9E,1H;-y Hm t(H[] u H[]Ãu1H ff. fAWAVAUATUSHHz L@ HʟHHAE LcHPAU HVHGH9 H Ht7DHHH;wv tAE H[]A\A]A^A_ÐH( HSH Ht(Hz IcHHߋH;*v uH( AuH9mHw H AR H9AH8x H52 LW ՞HSHEH9)f D HX H HqH~9H9AtuHt-H9A tiHt!H9A(t]Ht H9DtKHH9uH HL=Ou E1DHHL9I/tEH H4HMy IcHHߋL=t L9zLA HEH HuHH9tH HuL{ tHEHSH 7 LJ L@Ht LJH H01 1H1 H$ 1ff. @ ATUHSHPH1ۃ} L%! ~" D HEHcI<$H4! 9]H}1蠯H}pH; 舯[H]A\|ff. HG O HF > USHH ~~ H96 E LKE1L;Nu_C ~ 8uC F @ H0@ @ H0IHGE1A1D9uHt H H[] H!u H9 u y!Hu H H[]f D uH`t H H[] D u{x D HHIQHYr H HH@ #HvHԃ!&t"Uw]Hst H 4t(Hs H @\H[HHHt$`u Ht$S AVAUATIUHSH Lu(AAA@@ EĞLm0H$ HA0 HL9It$HL@ E H HH H\p H H LcM9) H{(C HT pHSH@tHS0uB" HH[]A\A]A^ÃuwfBb H}8Ht L9H0 HHa鯝E\LmHAH HHHHHA0 1BiHCH @uGH=3 H=Ƀ3 HA HHt> HtHEH=̃3 HkC HSHHS(LHS@HSH $y @HS0H9BgC 1HS(@eHS0 |ۜzf. AVAUATIUSHH HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H r fH@ H$ $ HD$HD$ H}`LmhD$0 LupHD$HEp E`HuGMuRMuqHHBHHtHLH H+t>H 1[]A\A]A^ @ H/uHGP0몐Im uIELP0 D HCHP0LthfATUHSHGHHHH9}HPHSH41[]A\HHCL$HH9t+HcHCHsHCHVL#HSH,H茥HCHH=Hs1 HTHHH9SH@HH#! HH ! HH9 Ht H@HHH[if s HSH {H>! ?HHrH9t\HBHHJHtH@[fJ(9J,sHRHVHrHHrJ(1HH@HHH[$HuH 1HD$1HD$ HL$HL$ HL$(HL$0HL$8HH H=H3HHT$HD$r ATUHSHHHH HH ? H 0 H{ # Hg HS H? H+ H H H HH9 < u D E1H ~ 1H-IH HHLH I,$t H[]A\ø @ 1 @ IT$D$LR0D$H[]A\ø 노 { q g ] S IHt$H|$HE1H } 1,IH:1ܗff. AWAVAUATIUHSHHF #LnL9}Hu"M9BHHH[]A\A]A^A_ I9LOM9M MM@UA9XHEH+E L9}MtLHt;Hu H} M9|)H} E1M1HMLm 1H[]A\A]A^A_鯗ff. ATUHSF HLfMt6@t9{~ vRHs HCH)L9|BH;E1M1HϫLc 1[]A\tY E9Ss @ H; tLH Hs 란{4 uC5HHE H+& Lc 땺 f AWAVAUATIUHSHHHPHF @H ID$xHE Hk L8MtI9u\H@H< I9t M HtHE @ 1HHHHHL[]A\A]A^A_SIHE @u0111L`SHH HIaLHL9 1MMD$L1 HH LH* HE1 @OH H? ID$xHj L8MI9IH7111LR1HZ HKL8MuHHT$`HT$H9.I9L|$ u t$I$LHT$P HI`HT$gf HQi HH@ Hx` f H@ AUATUSHHH HFHH HWH @ C @6 + @ HX Ht}HPH~;H;XtEHt/H;X t9Ht#H;X(t-Ht H;\tHH9uf1H[]A\A] H []A\A]HJ H_H9tH HukHE1&IM9}JtHuI1 @ Hg fH@ HH`HHHhHHHpH H@p @`ff. Hg HHHH@ H @ AWIAVIAUIATUHSHG($ Me MI H ID$ t5A$ @t*HK @u<HL H H+trHMe I m(H[]A\A]A^A_ D Hf LHH@ HL$ tHL$tI9BI D H Qg HNHSH$HR0H$w. @ UHSHHtJH;5g tAHF HH HC @HH[] @ Hf H@ HE tH@8HD Hu HE111HOHHu111HH1HH%6H1I- H鐓ff. @ USHHHe Ht$H@ HG t7H@8HHt*Ht$1H HH1H5H[]HT$HHE1 8OH[]ÐATIUHSHHHHD$ H$ HuHtH/ts5HHHI1LLD$H 7" H f H+t:HD$H1H}PHEPHH$Hu 1鴓HGP0HCHP0間ff. fH LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ HHG HuJHHt`A H$ I$ HD$HD$ D$0 HD$3 H HF .H%HufAWAVAUATIUSH H|$H$ HHt$: HT$XH$LD$ DL$HHD$pHD$x 謣H$HG H1HD$(I$Ha E1ۀ8 ; 8 cAkHcIHtj8 JAkHcIHtQ8 1AkHcIHt88 AkHcIHt 8 HcIHu ) HD$H|$ Lp~ L9 E1 A1ۉl$Ld$0DEA$ AMHL$8<|o AÔHJHL$XA{BA<$ HAHD$X96D$$E L9APƀ91EAMt9 E9 M;DT$|E} HĈ []A\A]A^A_ÐPƀړғD$EGL9}HD$H|HΑLt$pD\$LHt$XH$ LT$@HD$PIAVh L$XHT$0L$ U^_HLT$@D\$L HC9D$ HT$XHA<|<$EA9HHD$0H|$D\$@L$H4$zL$D\$@H H<D9 Ld$0IcH|$( H DHMuH H HD$(H\ HT$(H5 H81\H|$p z D H; H$GH$HHD$(I$1HE111+<$ ALd$0Ml$MHT$X @ ;wHH| MDEHcL9 1IcH\$`H|$`M,ALd$hH|$1LHiH|$hHG xLEA9 H2H$qH$HuH|$hAԄ`~H$ Lt$pD $IH|$PHt$XIHLT$@AVh L$XHT$0L$ vSZYHD $: E1LT$@D4$HHL$HD $HD$pHHD$D $D$| H|$ HL$Lpu%L9 HT$XE1H|$pAtHD$LxK7H9|^HT$XrID$A H 8 ID$HT 8 + HcIH. AtLH5 H S HDM7ILL 9 H|$( H uH= H H|$(PHY AH5= RHT$8H81mH$ A]A^H|$( H L HD$(HyY HHL$(H5 H81H|$p^ 6M,H|$Iu GvH9H %H4 HcIHAA HL$8DHT$PHƃIHL$(Hc L 9DMA飍fH[ HHHH@ HaDUfSHH[ H@ Hx`HXh@`HhpH@p HuHu&Hu3H[]f. H/uHGP0H+uHCHP0XH[]SR SHOHHWHAHH H HAHG HgHHHtHCH H/t0H{PHtHCP H/t"H,HCH[H@ HGP0HGP0f SHHHHt 1HSHQH{PHt 1HCPQH[ff. SHHtGH7Z H jHHt,H H+t xH[HSD$ HR0D$ Z1f D HY HHH@ H AVAUATUHSHHHRH;sY H9uH[]A\A]A^f D HF HX H HJ1H~ H;ZtHt5H;Z tHt)H;Z( Ht H;\ HH9u1gH40 IH9xHC tkH5s LkDLkE1M9uJTHLt*AD$ H H5H9u IHpX HH{ eIH&H5 LCLHAD$ LHZOHH H߉D$ =OD$ a @ AWfAVAUATUHSHL%W I$@ Lp`Lxh@`LhpH@p HG H=yS pLpDHc˔HH!H@ LLLH@ " C. fC,C( I$@ #@H}( uHkH](HH[]A\A]A^A_ff. fHHt2HSH)HH_H9HH9_| H_H[HH|$ H|$ATUSHHo G Ho$H) H3HtS1HqIH-Hx HHr HHH1ubuOuAHL[]A\f G$H=V H@HL# I$HL[]A\fH룋 L'GID$ H)t71Ld$HH;_tH|$H Ld$Zju HHbH11[]A\HHH[]A\ f D AWfAVAUATUSHHL=\U I@ HWL``Lhh@`HhpLr8H@p HB H I)H HP H9G H=/U *HH HG HH H_Dw G$ I@ HOH@H HGHrfHnH HLfH:"GHJI@ HLHE=Hul1H[]A\A]A^A_H=T H9}LHP H9C;hHHtGHE HoHH H_Dw G$A)H<K1 @ HVHB HR8H )Ě @ HHH;5dT tHS H9FHG(HHw(Hu1HHJ QHH;5T tHS H9FHG(HHw(Hu1ZHoJff. fHFH u @1HN1H9}*HTLBA @܍H1ff. USHHHWH HBHOHH HHBHWHHgHG H9B0 H`R H@ H 1 H{ HugH{H H/t1HHt H t~]H[]HGP0HWH H9B0fHH@ HCH HCH HoX[]5 鴌H;=P tH;=P t H;= R u1fHHWHB`Ht/H@HHt&H H9uj1H H~ HÐHBpHt'H Ht H(^ H9u+HG D fHBhHtH Ht @ Hf. 9HGÐHHVH~H ff. fAWIAVAUIATIUSHHL5zP I@ HIhi Hn HH@ l IEHLpI HL|$Ht$IUHrhHLHLHHstHHT$MLHeHH+_ H H;-P Hm t$1HH[]A\A]A^A_ HtAED$HEHP0 @ HL HxHLH9iH HtgHtUHtCHt1Ht Ht LB LFL LHL LHL LHL LHL LHL LHH9L HyLLD LDLD LDLD:HO8LD>LD:LD>LD: LD> LD:(LD>(LD:0LD>0H9r~HCHP0J HHL$&HHHL$L8H@IuHMHT$HHLH;cHT$HHD$H9"H}HIWLHHu"?Ht1H HuHHLLHq H @ UHSHHH;HtHP tE H H[]1ɉM H HuH HSHHX[]AWAVAUIATIUSHHHHILqI?HD$HT$HHsHHT$LLLbHHHH[]A\A]A^A_N< LD$LH$蓁HHH$H@HsLD$IOHPHHLLLaHHD$H9tHHff. HAWAVAUATUSHXLiH|$ L)LD$H9ʎI|IHIHHHM L:IHM~J Hx1HK IOLmH@ H@H IGHrfHnH HfH:"AGHJH~zIH IE H~iIFH HEHtWIFH HEHtEIFH HE Ht3IF H HE(Ht! IHHTHH9uf D HD$@Lt$8E1LHt$HLHH$HD$H UX HD$@H LHL$LHPL HT$8H HA IGIT H$LT$MULT$ HD$@HL$LHPL# HT$8H HIG IT H$LLT$ULT$ HD$@HL$A Ll$H\$(LMHPL# HT$8H HIG(IT ILMH$E1HHTt5HD$@HPL# HT$8H HKDHD$LJTILH\$(Ll$M MtBHD$L8HXL[]A\A]A^A_HjI LmH L H1HF H|$ H E1H0Cv I_J|IO@L9H肁L:@E1wfAVAUATUSH H HSHH9B0HH H@ H 1 HC0H9CtcE1H{Hn H{ H HGMu/Ht! H t []A\A]A^Lk?ǀ{u7H{0E1LcPLsPHt E1Lk0??H{HHO {p _H{xHtE1LSxH/ {p;H HtE1L H/ {pH HtE1L H/ {pH Ht1H H/tW{pLsxA IcIH8Ht 1HH/tVAD9kp41HSC>HGP0HGP0HGP09HGP0WHGP0H@ HCH HCH gE1L[H=[]A\A]A^5 1HC = D ATUSHHt"H;5G tHoH[H]A\HHH[]A\ H1F H?AVAUATUHSL@ H) IHHHGIHrH9uPMI4 AE PAU HE(H@H HsH;AE []A\A]A^fHX HtkHJH~KH;BtHt?H;B tHt3H9B(yHt# H;DcHH9uf. H @1~HH HˉH9 H5 LL uHE(H@H.15 HHtHHA H5* H81HH;1| @ HH9 Et&H~*A< H H+ Mu=7 A A H1 HHE1HH)tiHtVHtHHt:Ht(HtH 8 H8 H8 H8tzH8trH8tjHH9tM8t]HPH8 tRH8tJHB8JtAHB8Jt8HB8Jt/HB8Jt&HB8Jt HBH9uLHHڬ IM9tHH9H| 8tH0L 7H~ IA8 t L9rII)E1HH|$ӁIHtH|$I)pHcAH/u ARHHHИ AVAUATUSHHH HVHB`HtCH t9H A H08 HH H H H[]A\A]A^ H;/C Ld$Hl$HL$LH7 Ll$LsHLLLu HH~H|$ ItL9t~H ~HHHt$HD$1HLHHHLHH9uH H[]A\A]A^H{Hs HA H H H@ H9CqHH AVAUIATIUS H HHHHt0H+t[H]A\A]A^f D HCHP0[H]A\A]A^fH@ L@ I~`HtHA H0tL9 Mu5HH, H HHrfHjID$H LLHH1藫 BfHBSHG tHHH[ D HP`Ht H Hu HPH< H5a H811HHtH@H;n@ tHP ˈH< H5U H81CH16r @ HxH;w} HDH PH> H5 H8$l 1ZAWAVAUIATIU1SHI9m IEH HL9t_ LHIHtxH: I9GHE1L;=,> AI/t_H+t4HEtHD[]A\A]A^A_ÐI,$t A ސE1 HCHP0ID$LP0H+tAL; HCHP0ff. fHGHJHHHHPH Ht/H- H9uHtH;5> tH H HHUHSHH H;5> Ht~H=#> &HtfH= H H@ HpHE HhHHH(HXH@ HRH HPHyfHnH H7fH:"@HqH[]HE Hf. USHHaHH== HHWHG= H H@ HpHE HhHHH(HXH@ HRH HPHyfHnH H7fH:"@HqH[]f SHOHHWHAHH H HAHgH HG HH/t H{HtH/t H[U D HGP0 HGP0H[0AVHO< AUATIUSHL@ H?HHHwIHE L@L9uBM,AE PAU ~JID$(H@HtUH} HSHuAE []A\A]A^LuLL ÿH5>~ L 鮈ff. @ HHwH Hp H9/ HIL+@ HHHHH DDD+Du7LNH DDD+Du I FDF+Dt H/ H Z McHcHf. M H9 H8HWH D H99 HHQHf D #H Y HcH D H H Y HcH @ My H8 H8HW| D H Y HcH D M@M5f. {H pY HcH D H6 H @ H aY AHcMcH SHOHHWHAHH H HAHG HgHHuH{(Ht0H["}0ff. 1H D HGH_H ff. ff. AVIAUATIUHSHFHH;9; t3H;(: t*H;: t=H8 LHHH@ []A\A]A^\ELHH[]A\A]A^ LjM~Et ff. fHa8 HHHH@ H @ AUIATIUHSHHHF t%HP8H4HtHHH[]A\A] L Mt=AD$ PAT$ ~XHHLAAD$ HHL[H]1A\A] HHH|4 Hz LH01Т H1[]A\A]H5z LLD$ LD$u @ AWAVAUATIHUHSHH(LiMt Ix Lu"H(LHL[1]A\A]A^A_ LD$LHIHc L|$LHHH?LAMoIM I>H/ I I~H/ ItpI~H/ It\I~H/ ItHI~ H/ It4I~(H/ It I<H/ HI9u @ H=b! Ivb! I/t*H(LHH[1]A\A]A^A_kHGP01IGLP0HGP01HGP09HGP0AHGP0IHGP0QHWHD$R0HD$TH(1[]A\A]A^A_SH_. HrHuH[HXff. AWAVAUATUSHH&H/IHHHHE qHF `} ~ H4 H W H9 H9 LsLmHL)L9VHO<.o u H R3 H9K{ 8rdt @@ LLG I<$MAZHL[E1]1A\A]A^A_sHT+HI $X[]A\A]A^A_{ @@tW9LB IHJE1M1H1HsE1M1HLLsH*M<$놺 @t< E@ k EV Wf D H?u HuG uH1 H9G1 ATUHHLgHIt$L;g }%HGJ,H3 HwHHQHH]A\H|$H|$HGJ,HP3 HHff. @ HATfUHHSHpH 3 fo HD$Ht$0HL$ HO|OO: HD$0HT$1LD$(D$EH\$ H\$(D$a L$5D$Qr H|$ H9 H1 L@ HGH@`H$ H 1~HHtyH|$(H9 H\$HL$HsH u_ ZAHH t:uH/ H Hp[]A\fHi0 1I|$` {1E1L;c}JtHF AHHL$H$( tÅH$HL$u'IHt$H$ H$ 1dH/ H TH- H LH0] 14ff. @ AVAUATIUHSH IH H? HHtL H; H{HtLHm H; H{ HtLHG nH; H{(HtLH! HH;~oH{0HtLH &H;~MH{8HtLH A !H|HtLH ߘAIcH;|MuH Hy 鵘 @ AWH1fAVIHO|OO: AUMATIUH1SHHhH\$H / L|$ Ht$ HH|$(H|$%fT$P, H\$H\$)D$0)D$@s1HL$HLD$LLD$Q nt~H|$H9thH. L@ HGH@`HtoH te1IHt8H|$H9u9HD$M4$IE H$HE Hh[]A\A]A^A_E1I` t1Ht$ u1H* H4 LH0[ 1ff. fAWAVAUATIUHSHH ~ HEH9 M HsH)I9E H U AAA [@" H0K D ,@ H0E A BL% Aud9t1H[]A\A]A^A_ @ L~JD= B< F;1A9uE9{HIH| HHpAE;19uL~K<Aul| AtAurF{HHE@I8Au*BLe Au9t 1710HHBL L~K<Au|E A$F | HIĸ LHHEHy H HHMxH'ݕAWAVAUATUSHHBPS;S U?IwgH LK HHcHLoMݖE11IE H9m I|$HHQ uHH< CC H[]A\A]A^A_HH[ ѕI|$HHcMl$ E11M 1H9 CuI|$(HtHH vsHH _Mt$ME11IH9 IcI|H˖HH AIcHHH0 HH ݔI|$HH ŔMt$MME11IH9 IcI|H[HH AIcHHtH I|$HPHHy =:LwE111MtIH9 Ml$E11M_ 1H9% I|$ HHMd$(E11Mu61H9IcI|H5HH AIcI$LwM\E11IH9 IcI|HFHH& AIcLoMϒE11IE H9 Ml$MߒE11IE H9IcI|HԒHHib AIcHH ҒI|$HH 鵒LoMJE11IE H9IcI|HHH AIcHH UMt$MגE11IH9) IcI|HHH AIcHH/ CuI|$HH I|$HHH 鱑HH I|$HHH zwHH cM|$M͒E11IH9BIcMdMfI<$HH I|$H| Ml$M1E1IE H9t IcI|HmHHD AIcHH7 I|$HH?Mt$ E11M 1H9 CkI|$(H]鱐LwM E11IH9 IcI|HߑHH AIcIcI|HIHH% AIcIU 7IcIDHHxHH 0 AIcIU IcI|HHH } AIcIIcI|HˏHH T AIcMl$ME11IU H9 IcI|HWHHv AIcMt$E11M 1H9eMl$E11M 1H9~Md$ E11Mu61H9IcI|HxHHQ AIcI$IcI|HHHz AIcIcIcI|HHH4 AIcIU IMl$1E1Mu61H9IcI|HNHHI AIcIU IcI|HɎHH - AIcVHH qzAIc Md$E11Mu61H9RIcI|HHH AIcI$IcI|H6HHi AIcMl$ E11MuL1H9I|$H" ÌIcI|HHH= AIcIU 鍌鈌郌~LwE111MtIH9iMt$ME11IH9cMt$E11M, 1H9 Ml$ 1E1M)1H9HH ЋI|$HH Mt$E111MtIH9oMl$ 1E1Mu1H9$wIU lgb]XSNID?:50+IcI|HfHHtAIcIf uÃuVË AWAVAUATUSHXJAB;B A?HI H? IHcH @ uoHH5 L$N{L$8ABAB HX[]A\A]A^A_HLL$cҎH{L$H ABHAJHX []A\A]A^A_ HLL$L$u HLL$_LkL$M I} I}HtLLL$L$ I} I}HtLLL$L$I} ~bI} HtLLL$ZL$ōA LIcI;E }#I|HtHL' AIf D HkHqH} fHEHt HxLLL$L$GH} 3HEHt HxLLL$L$A LIcH9E IHLLL$lیL$HLL$KLkL$ME11IE H93 HSHKH^HHT H|LL$ {QLwE111MtIH9 IcI|HLLL$L$M AIcHLL$yH{H$LaЋHCHSL$8LxC2 Lj }H< HcHHLL$hH{H$LP{HCHSL$y8p:gHrHxL$@LHHr L$<HLL$qHsCL$r H, L$H~HLH 靊Lo111Mu#%LLL$L$ HcIU H9HcI|Hu$LoM11IE H9mHcI|HRLLL$L$HcHHtLL$nL$" H{HtLLL$JL$ H{HLo1LMu2f I|H=HLfHcI;E |ILwM&E11/IcI|HtLLL$L$ AIcIH9LkMن11!LLL$nL$ HcIU H9HcI|Hu鞆HLL$} H{H$LHHHLL$ULkL$Mφ11IU H9rHcI|HÆLLL$ L$) HcHLL$xH{H$L`χH{.HLL$?LkL$M11IU H9HcI|HLLL$U L$s HcLoMK11IU H9yHcI|H LLL$L$? HcHLL$H{H$LgֆLkL$ME11IU H9HcI|H9LLL$} L$ HcHLL$hLk111L$MtIU H9HcI|HLLL$ L$* HcHH A u%H5K I9tLZu A MIMML M L݁ A tH A H5 H9 'Zu A ^MwMt/LL$]V L$HH1 HIH9& LLL$K L$L$LHLLL$)ML$IG t`IE tSI tLI} ~ELL$o LI IL$HH 1HL9H H LLL$ L$PLLL$ L$8IG t]IE tPI tII} tBLL$ LI L$H= I H)L9+ LLL$ L$LLL$ L$LLL$V L$LLL$A L$nLLL$ L$V{H{L$ƴ HVHxH:nBH HH=j4 HcHu<IG 9LZM I1H9~KIL9HIGHrH LL$Z L$zHHzLLT$L $9HwL $LT$1E1H(E1Ll$L\$ Ld$L$H\$0HAO `@NIw0MGM1IM9~'LsIT$%uI9~_%^M9 LLL? IH AM H|$L`WAQAAt$1L AZA[H? HHJH HDIGHD$L91 HD$ H H HL$H9^HD$ MT$E1MHlL9t$u LL IVAč@wH q2 HcHAD$MIփ 4 AA.AD$v Aa Au- EK 1ҋM DM(DHDE$t$E,PpF HD$(ZYH HHJH HD AI"AAH'L\$ HLd$H\$0L$MS~IH9D$s K(ML$S$DC,F HHL$ HABHL$苜HIJDl$8IHHL$(1ɉ˃ k L9t$ LLI AHD$(I9 AD$L$-HDH}HxHL$ AI} gI \LL$ LI IL$HII MwMzLL$O L$HH| HIH9iHB LHHHG] L$H 9Ll$GLD 1H|$H CH|$HHL9LIHg H|$H]~VALt$A1I _AXHH,L$Ll$GLH 1DD$(H|$|BH|$DD$(HHE\2HLDl$8IcI|H |LLL$L$tcAIc B HABHX }}{{|||||||||L$ }|||L$L$L$|f D HX m}11H|$0LD$(HD$(HGH|$0HL$8 HD$@ HXff. fAWAVAUATUSH Ht$HT$XLD$P~HfoOL$dHDŽ$ )$ Ƅ$ )$p )$ HBDŽ$ HdH$ H$ H$ H$H$ HD$(H$ HD$@HD$|HD$ H$ HD$8H$ HD$0HD$xHD$H$p HD$$ Ht$ HT$0LL$8LD$HL$PHt$HH|$@ [] H$ H$ D$|H9 H$ H|$ k D\$|E H$ H9$ D$xD$ H$P H$ L$0 HIID$hLt$XH$ H$ H$ ZY L$ I H|$ |H|$LZ IH|H$ L$ HD$HHLHH AŃ E D|$`EuzID$1H; H$ H $ Hi HHKLCLH|$E1ЅAI,$ H E H$p H. 1 D$dLD$PHT$XHt$H<$HHH x 8{HEE1HH$P L$X H$` ID$H;3 = D H; Z HHKLCLH|$E1pFAI,$/ID$LP0 H$p H$ Hx $ HDŽ$p u"HH;stӓHHzHHĸ H[]A\A]A^A_H$ H9$ !Ƅ$ 4APt$ HT$0LL$8LD$HL$PHt$HH|$@ AYAZ/H$ H$ D$|H9t% H$ H$p q |$| Qt$ HT$0LL$8LD$HL$PHt$HH|$@F ^_H$ H$ D$|H9t H$ H$p yAru.L HH/ } xLIAs Aau=LN HƄ$ H$ H9$ Ƅ$ MwH;* H- H$ H9$ *Ƅ$ Lx IHH|$X wH|$XH8LIMHt1HH$p HY H W H W H; H H( H W L W LLJ HH H$p H誙vLH$ Lw HtGLHHD$hAH|$hIMt%LMHt$HLK HML|HfLE1BH I,$MEIELP06L$ Iu?Lv HtLHHD$h虒H|$hI CI,$ML_ uLLl I\v11H$p f AWfIAVAUATUSHHFH$ H AH A@LI A HWL9I LHIHH)E1 Le HZH]IAD$ @@ @! El0AE HZ Le HHHH]IAD$ AAAA x @ El40AEtZH~L9 Le H_H]IAD$ AAAA w@ El<0AEWfHnI9fH:"A}t A{uuLe M9 AD$ @w v@X CD40D9| IfHnM"fI:"AB A f1A I Le A@HELUL!HAHuHI9T El$ L~L}EAAA A A@P A\40:+ v!} HQ HH[]A\A]A^A_Ã! HqLmLI9tHZHLLL$H]LD$H$ LL$L9LD$AtH$HLLzL}u LD$}s: sf w[m {tM9; HVHUA A ID$0A@m B 8:O ! LyLmf D HqLmM A MxMH]L9'tH} LcLeG t -t@J D 0{? }tGLL9|sffHnMLe 1fI:"M9_M"AB9 D I^I_!}uLvYHHI9 L^L]MA A qsA@tjID$0 0:tOw(!u@HqLLm[ {uZs}w[ {=sLrHqLmID$HA, A qID$HA@r plH$ I ^ qHWH@rZ{LHBHA!t4}H H5Y H8Y+ 1ID$H 0LmLyILmID$HA{ A V A@rID$HB xaA A . A@qID$H p,HH LL\$8HT$0LL$(LD$ HL$L$Ht$ L\$8HT$0LL$(LD$ HL$L$Ht$[ HuL9qLLL$(LD$ HL$L$Ht$ Ht$L$]HL$LD$ LL$(0HHuAuU < Ml$H@pEl} ID$HD,8Aut pMl$H@oEl} LLL$8LD$0HL$(L\$ LT$H$Ht$ Ht$H$LT$L\$ AHL$(LD$0LL$8JHLLL$0LD$(HL$ L\$L$HT$蔛 LL$0LD$(HL$ L\$AL$HT$SHg ID$HD,8ID$HB0u4 oIt$H@oBv{ILuM"AB'LLLL$8LD$0HL$(L\$ LT$HT$)$ޚ LL$8LD$0HL$(L\$ LT$fo$HT$ID$HD,+ p It$H@1nD,VLL$8LD$0HL$(L\$ LT$HT$)$I9~?HL X HT$fo$}LT$L\$ AHL$(LD$0LL$8FH H5 H8' 1 LLHT$(LL$ LD$H $LT$ٙ LT$H $LD$LL$ HT$(LHt$0LL$(LD$ HL$L$Ht$蕙 Ht$L$HL$LD$ LL$(HwHLLL$0LD$(HL$ L\$L$HT$K HT$L$L\$HL$ ALD$(LL$0UllUmZm_mmmmff. G u m@t$D70Ãu" mHWH@mrHH7願 AVAUATIUHSHH~ mHtIMtOE @tdDsIM)A~vHs HCH)L9 H;E1MLH9Lk 1m @ H;MuHHH[]A\A]A^黌 mDsIM)A9s HLHR A9s=M#mLHiRmHs H;E1MLHg8Lk [A'D붐Hu,H;WtHtsG @t# W @!mH9u4m lHHDHIIHHuH/ uH ll AWIAVAUATUSHHHHl$PH9 HKLSH;IIIIHKI9IQLKI9 H I H@ Hx` o HSHCH9 Ht&M t3V H9lHcEPUI H[]A\A]A^A_HcEE PUI LHKLSH;IIIIHKI9IQLKL9L @ H;E1L5q L- L=MR D_ Lg0DD\$$DD$ DD$<$ |$ k|$ A ЃADE AFHL@u%I H9 H@ Hx` kp A HH)HIL9F Mk HIL9XMItHSHC I8HM ]H9E gDg HNEAAA A HG0A@ B.M[DH9MrA A HG0A@ BD. [ ILM9uL9H9jA A jA@ HG0B0.tg[tbIH H5q L$H81#L$I KHGH[Au^A A@iHGHH:LDA A iHGHA@iBp`HGHRHH$ H$ei<$uFD$ !i@liHGHHpAu[A tgA@hHGHBPPH踒 = 7WHGH(HGH L舒 H$z H$hhh iff. fH&iSHHWHZhHViHCHIiHhHl H9u H;ws HGHH H[ H[H HXW HD H8ܳ 1 AWAVIAUATUSHHwHoH9| H[]A\A]A^A_L~L/HHL$LILHL$.ulA L)Ly/IFLLHL$HCNHL$. [ LsL9LqI$HQ H9Qbch[u]1AL)LyLsL9 IFLLHL$HCHL$]uLq1M9|%I$}Hth1hLslLLHL$ HL$HcHxH H)HHH9 Hk IHM9I $HH H5܀ H81~I$HL$Ygff. 鶂f D AUATUSHHH- L@ 73 Ml$g].H$H$H9EP L;m0 LI H HCHxX 5gH@ U JM ~zH@XH:8 H9uUE111HHt$Q8 t{H\$E Ht?HC f{ ;gHH[]A\A] D HЃE HHu1H5 H uHCjH>gfE 1Zf @ ATUSHH H@ =3 Lef$-HD$HD$H9CPuL;c0u HH[]A\H1[]A\f D 3 u1AW1AVAUATUSHQm 3 HG8HhHt&}Et HU Hc HH H9E8!gL5S 3 A AIAA AtA M~MfL%O M9fH52 L^ fH52 L^ fHSfHU(HuHVHHt=DH=,b 1mIMt$1LHLյLIJMe V2 1Z[]A\A]A^A_ AWAVAUATUHSHXG ;fLo { @] H}0H|$AAM A HD$A 1HD$ HD$ IHIIM\ AtVHD$" > ' \ : ~ HD$LxM9 @ A" wpLHGփ HHH9 eAOHMW" m n H xf w2H 눐'J \x t׃~ L9gd ] D LHGփ HHH9 MzHM9 E1L9AH|$ v DH{~IHdA' AD$ AA c@V It$0HAV D D E` E1M1H L +HXL[]A\A]A^A_ D ' \tx~w~L9Sc MzHM9 v X HۃHH H HǸ }A9̸ DBHhHǸ A9̸ DBHkIt$HHAAJ D D E E1MLd$HH\$ @ A F;LUE9 A\ A A l A A A A~w6Au D.L D IM9uLd$HA! fDnD謌 DϹ\ HD1_H}EH|$H}AH|$H}H|$A DDHM HL$8|$,HEHD$ H|$0HT$@A _ DϹu L^H T$,H HT$^HH|$0 :HT$Dw^HH|$@ :HT$D^^H HT$8B L^Hl$ H\ DH.^n L!^Au6F{LUE98H\ DH]DL]hFE1MA A' A1DH{D\$qD\$HI_H\ DH]t Lz]DHDg]H}HH|$H|$ E1A" xDHD$ HHD$ H4HD$ HHD$ HAw HD$OD- A 1IIIHI1HD$HD$: LIG MAIH9^HLL9a"v v' \s LA ~vc H HHF MIIm H HHCMAI9 {HD$E1A' Hϻ LjQA D9DC:1L|$A 1HT$1IIIHT$<A ALIGA HɃHH9!]HHL9E A" vA'Q A\3 A Lй A~vD A A HHHFA HHH XA HA HHFA HɃH DH\ YLҹx LUYH! DAH HUHYH LB Y6HA ?HD$ xHD$ eHD$A HDLҹU MYH D H HT$/YDH HT$YDH HT$XDHLE HT$8XT$,H HT$ XHH|$0 :HUDXHH|$@ :HUDH XH LB XDϹx LlXL I HT$TXI HT$B BXHl$HA9DBHA HD$ H H\ DHWr LWUfD fD ^HD$A HJHE9EBH H |HD$ HbH}H~Yff. AWAVAUATUHSHHHHXL9u'H H9CYHXH[]A\A]A^A_tPLAs Hj<LD$ 1l ZY |$@sZYD$ Lk |$ jYD$$i T$=: HL$(HD$8I9+ H! H( H8 IDeM)>4 M@ ME1T$C EA9ACAԨ@k A9s(1LHHL$DL$tHL$DL$A9DBE9 HtDHHP Dd$MuZMtHu H} DLLLFA Hu LHu MtH} M1H腰 KD5 HE $HX[]A\A]A^A_Hu H} DL@ I9~dHt^HxI9LO1MIIH9DeLE1>t^ E1MC @t=A~wdEE1E1HHr$]HEH+E H9EE1E1W EvHEH+E H9eWE1E1L HHII)H EH: H5kq H8 $H H5 q H8 H H: tH5qp H53p @ AVAUATUSGHHGH;GLZ>H H HcHLfMtTE11I9$~IIcHIt Z\AIcHv FXCHP SH[]A\A]A^HuH\ uEZEDHO HvPE@PDM<DE8a A[A\YHUE1Lb0MtIcI;$ HULb E1MtIcI;$$ HUHM(HH舋 Le M EDHuH1HPE@PDM<DE8 AYAZp HuHʌ TZHmHA H} 6 HuH^ZH} HuH?YH} Hu H YH} Hu(HYH} Hu0HYA IcH;E HtHwYAHv %WLmMtsE11I9E ~hIcHItwXAIcHvHT DWHCHPCHP H茒 THmHE1IcH;E HtHWAHv mTHuH NTLmM Hm H)E1IcH;E HtH.VAHvHk UHuHHN UEDHO HvPE@PDE8DM<O _AXULeM: E11I9$+ IcHIt UAIcLfMD LeMD LeM Hm H$E11H9E IcHHtWAIcHnHE11H9E IcHHt UAIcLfM E11I9$ IcHItj UAIcHv RHuH URLfMC11I9$5HcHItD RWHcHnHE11H9E IcHHth !TAIcHvN VLmM HmHE1IcH;E HtHQALfA<$R HwIT$H8 HRU Rt7AD$,HK HEL$$ED$ It$PAD$(P A^ZQH} R HuH TSHuHH] gQHvG SHuHH* RHv SLuMPE11IH9oIcHIlHu ڙ PHuH HmH 1E1H;E IcHHtPAIcՋEDHO HvPE@PDM<DE8 ^_OHUE1Lb0MtIcI;$ HULb E1MtIcI;$_ HUHM(HH迄 : Lm M EDHuH1HPE@PDM<DE8Iz ZY HCHuH߀HH !RLeM] 11I;$O HcHItRPHcLnMvOE11IU H9IcHsH{8MtL HrP PEDHK LHPE@PDM<DE89 AZA[fPM<U8LHDMDDE@ OAIcjLnM8NE11IU H92IcHsH{8MtLi HR xREDHK LHPE@PDM<DE8 AXAYRM<U8LHDMDDE@ PAIcjLnM E11I;E IcHIt\ ~RAIcItH WMALeM Le(M EDHuH HPE@PDM<DE8w Y^_ HELm Lc8HC8Mt*11 HcHItZNHcI9E Lc8H蚊 NLeM11I9$HcHItMHcE1IcI;$ ItH OAItHtH gPAE1IcI;$ItH QAE11I9$IcHItZOAIcH衉 !NAD$,EL$$ HED$ It$HKPAD$(P8 A\A]vKE11I9$(IcHIDHp +KAIcItHtH KAqL KItH~ MA!E1IcI;E cItHP %LALeM11I;$HcHItyJHcE11I9$HIcHIt蘈 JAIcAIcH JE11I9E IcHItLAIcE11I9$IcHItg<NAIcE11I9E IcHIt7NAIcJHv ?LHuH LLmE11Mt I9E Le MX LQLWLLLnE11Mt I9E LLmMu5LmMtaE11I9E ~VIcHIt. LAIcE11I9E LIcHItLLAIcJLe ML MUSH H HC MH H H9Xo u:Hho Ht-HL$HPo H}HD$H H H[]HPo H5HHwMHL$HH8HD$HuXMH_. HH Ht,H)HH5iHD$HtH|$衋HD$|H H H bL AWAVAUATUSHHOHAGH;GLM>H H@ HcH ~V,F(DN$DF HOHv R PH _AXL}u#HCp@uH}H5 ( CHCH H[]A\A]A^A_Hv/ELHuH CHHKHH []A\A]A^A_ D HvuLf D HvKLeM I<$ ~{It$HKI<$~_It$HKI<$~CIt$ HvKA IcI;$} ItHRhKA @ HmHH} HEHtHpH9KH} HEHtHpHKA IcH9E {HDHKHpHJAR P HvJHmHdE11H9E UIcHHt_uJAIcHvE[JHuH1BJHv1JHuHJLf11MI9$HcHItIHcLfM11HcI9$HcHItuILfM\11I9$NHcHItXnIHcLf1Mu HcI;$ItHu(IHvHt IHuHHHLnM<IE11$IcItHtHHAIcIU H9LeMj11HcI9$THcHIt^usHHFE1L`0MtIcI;$ HEL` E1Mt IcI;$ E,H1HPE(PH DM$DE HP `m AZA[ HuHy GHuHGH GHv|GHH5< b GHuHtHiGHCHHxL 5GH HNE1LFH( HHf{ 7GH HNE1LFH Hv GHuHFLfM11I9$HcHItFHcHj HNLNLFHP IHH5; K FHuHWmFHCHHCHH(HH5F; CFHuHH5; #FHCxT FxL HuH HuHEH HNE1LFH qE,HK HPE(PH_ DM$DE H_ ZYOEH\:mEItHEAItH+AEA3EEHC LeLxMl$IM HC H@N4A~L t H{8LL EIAF@#FH{8LLv EAD$,ED$ HLEL$$HK PAD$(P _AXEAL$$AT$ LHEL$,ED$( _EAD$,EL$$LLED$ HPAD$(PI Y^"(D#D D t H` H P5ZH,ff. AWAVAUIATUHSH8H|$H8DD$DL$ HFLuIIF EH I9D$ IT$H L|$(LLL H|$(H L T$(m LcL HEP CIHtEHLL@ VEIm I,$tp H8[]A\A]A^A_LHHH; Hi H@ Hx` DLcLEP`HH HJDID$LP0IELP0XH}(LiaVDHD$LHx(EHHts^ I LBHH]DHD$HLHx(# DHӹHG H5p HD$H:# HD$s`DNHtCLDff. H9 UHSHH oD~ LM1L;KuRM DC D@@8u2 td@tOH}0A tOA@t%Hs0IH[] D HsHIH}HA uHsHH}HCfAWAVAUATUSHHHt>HGH t.F C@o F0_t HHHIHL[]A\A]A^A_þ H_uLkHLuIu_uIuH_t1A L. HY; HuE1LH_ M9CHM)KL5 H9CE S @@IC @!CHyIHB@ B@BIT$0B_MLH L HxB1IvMHL HFBIHFH u GBHVH@2Bh1H^ Yf. H(Ht$ 2 T$ uH(H H57 HD$H: HD$ H HBHG tsHGHuGHf D OHt@HtE1HH1Hr\DDII M MI I9u|Lf GHE1ɺ Ht$C~Ht$HHuLHzHx$HHEeHD$螵HD$Qy H?H9tщHH@HuGHAA Ht'A ff. @ AUHBATIUHSHHH L.HuvH w HD$ ImH;-{ tiHExHDLHHt{HL$LLnHteHt HD$HHEHHH[]A\A] @ H]f. IUHu당 HH= VD1ff. @ H0 t AWAVAUATU1SHHHWHcH Ht 9 k 8 DHcHHuL#L$$MD+k HcOIHDHcS HCE1Lt$L<-K<IyHD$HDLyHD$KDD9fInŸ fH:"62 H /2 C0H[]A\A]A^A_Ã( @ AVAUATUSHH HFI FH~ H L-ʻ E1Ic cEHH HEH H Hl}HKH9ulH; 4 FHH}HH LHUHm H H HC EM H[]A\A]A^HHHHI@ Lg`MEHCH8R HHH H01& |HH;= @EH;=I u H[]A\A]A^ HEHP0RL- I W M W MIc #DHHI@ H` bM.EDLH;= DH;= iL-! E1HE HHE ;4 ff. AUATUSHHH- L@ W2 Ml$=E}H$H$H9EP: L;m00 Li H0 HCH;M H DH@ U JM H H H9 H@XHIDH& H9uuE111HHt$= H\$E Ht[HC 4D{ DHH[]A\A] D { CHHH[]A\A]HHÃE Hu1HHH5.P HL uHC HTCE 1}DC HGH@XHDH8 H9u$HE111Ht$N t HD$H1f HE111Ht$ t HD$H1 AWAVAUATUSHhHt$8HT$HL$ LD$@HFHGI FHGIILHH?HD$(MIH H ~ILH?LHH)I|H$H H$E1l$0ISZ/D LHXII, CDHw HLMHH Ht]Ht,AI~H H HH HIH i ʚ;)AHH H HH HIH i ʚ;)щOHH H HH HIH i ʚ;)щOI9 HwH H HH HIH Di ʚ;D)OH H HH HIH Di ʚ;D)OOH H HH HIH Di ʚ;D)ONH~ H H HH HIH Di ʚ;D)NI9Gt5L Hi҃K H'i ʚ;)A =ɚ; HH O H@ 2 HGH|$HD$DH|$HD$XHD$XH;CPHD$H;C0AILIl$0ML IvEBTHH Ht$L< v3cH ~ I' v' I9sI m H|$ c H|$ X 9 LHHxC@ aC@ CHE0N8H|$ L|$ME1~ Hl$0LT$HL$CDI HHH#4)0AMHH#HH#HH#ALI#ELI#ELI#DHH#ALI#G<AEE)D| DEED)G<EE@E)G<EEEE)G<AEEE)D<EEID)D< E@D))@HH HH HL HL HL HH HL fHnHD$ffAM I9LT$HLL|$HHl$0IL)IBIzHHH#4)0AR vu¾HH#<)Iz0ABcvOIzHH#DED)0AR v(HHH#DED)0Ѓ w|$( n H $HHD$HH H4$H=1 K H|$ H|$ . HD$8H(1Hh[]A\A]A^A_CTHIH$Iz@HHH#4)0AR JIH|$ tHD$Lx HD$x8 Ht$HFH+F L9 H|$ HD$HH p n >@T H0Ht$1HV LLzH$DeH|$ Mc@ 3 1HD$H $G-HHD$HHH|$ MGH|$9 L>!,S?H H@ Ht$(H@Dx LH)E~ IcH9<H|$ ^HD$x8vHt$HFH+F I9yH H@ H@x ~$ȾZ HcI@HHH9v>Lc HHI|H$H ;HD$ HD$x8) ;G=H\$@H|$ LH3WHH;HD$@1L MH$DTHD$H9;1H HIHkLD1H0DA w|$( V;H $HHD$HHu1H|$ LHD$@L8HH ;@@HHH;H\$1HC LHHI1H$H\$DTH9G;H۸ HIHkHD1H0fDA wH$H HD$H|$( ;H $HHH|$ w;;':HG <z f. AWAVAUATUSH8H|$H HHH H|$ <HG >G =LO@ HD$H Ha Ll$ E1E1IM @ 9BM LLL)H9C LIMttAD$ A2E 1Ҩ IL9~MNl IE AE <I} @u E9BMe LL)H9a< @ T$LL$xIHk T$LL$ AG <AW @ MW0AAM HD$ E1E1H Dt$E1E IABIL9~rJD Mt E HHHtLHH <@ H0HtHsc HtA g IIL9H|$ t HD$HHSH\$HH H8L[]A\A]A^A_ HIrHI HLILLH)H)HHHrHA HH|$ HyL0HL6I9`H HthHtVHtDHt2Ht HtLpA LvN4 N4&IN4 N4&IN4 N4&IN4 N4&IN4 N4&IN4 N4&H|$ II9J I|$J &JL JL&JL JL&HL8Lg8HL>HL8HL>HL8 HL> HL8(HL>(HL80HL>0H|$ I9jf D T$HIH Ht$IAJHHHA DADL>H˧ I9G8I+HPHR0 MWHEw AAM*HD$P T8@9H0HD$HA DfAD1LL$;uLL$HIH|$萟E1LHt$I H7 H W L W ^ YHHHHMLL$ D$E1E1H\$LHD$H) H HtGLd Ht |$ MD$M! LE11LLLD$(HZLD$(MLd Ht |$ MD$M LE11LLLD$(HLD$(MLd Ht |$ MD$M LE11LLLD$(HLD$(MH9\$f L\ Ht |$ MkM9 LLLcE1M1LMqLN\ Mt |$ MkM LLE1M1LI\$M.L\ Ht |$ MkM LLE1M1LI\$ML\ Ht|$ u7MkMtLE1M1LLI\$MH9\$Ll$ HT$LE11LL\$(MML\$(Ll$ HT$LE11LMMZHH9\$Ll$ HT$LE11LMM!Ll$ HT$LE11LMMLd$ HT$LE11LL\$(MML\$(-Ll$ HT$LE11LL\$(MML\$(@Ll$ HT$LE11LL\$(MMtL\$(QHHHW LH5E= H811H|$ 45ATUSHHHY5HHH?He5HtH;RHHF5uH H H[]A\H f. AWE1E1AVIAUATIUHSHH Hl IT$H75H9HOH9 H9MHOI)HIH)LH IMT$It I@ II H HD$PHD$PHD$H$M) HI4H)LHt$@I<HH|$HHD$8 ID$ J *H9 HHHTHHH)L9 H HHL$0H<LD$(Q4I|$H4 L\$ LT$HT$3BLT$L\$ HI4HT$LD$(HL$0ML$I\$IT$ M~zIH4HH I)HItYIFH 4H HuID)I~9IFHtH ID1I~! I4HtHH4HI9ufHH H4$H H<Ht H/K Ht^H$H|Ht H/K Ht@H$H|Ht H/ HYHt H$H<Ht H/ HsHt$1H94$ MuHĘ []A\A]A^A_f D I/uIGLP0f D HL\$(HL$ LT$LD$lIT$ID$ L\$(HL$ J *LT$LD$H9W H|$PH|$H<$Ir-ISH<$MHIHHH L9M MylIT$9HH9iI\$ML$ D H9M2H5 HPW IHh2L@H@ q MwRM IT$LHL$ LD$J4*HT$>1HT$ML$LD$HL$ H)HUI4LLL$I< LL$LD$HL$ ,MK HĘ L[]A\A]A^A_ HGHL$P0HL$MHGHL$P0HL$I|$1L\$(LT$HL$ LD$>LT$L\$(HI0HL$ LD$1HGHL$P0HL$`HGP0uHSHLH(MT$MHE11XMwH<$ HLHL$ LT$LD$L\$;H$H/LT$Ht$PL\$LD$HL$ Ht$ILoH HtHtiHtSHt=Ht'HtHPH4$ HVH8H4$H>HH8H4$H>HH8H4$H>HH8H4$H>HH8H4$H>HH8H4$H>HL9 L|$IH8HwI?HT8IT?HT8IT?HT0H~8IT7HT0IT7HT0 IT7 HT0(IT7(HT00IT70L9rL|$L|$L<$ff. AWAVAUATUSHHF 0~ HH/HG J C ?/U AAAAAEAE9 L{LeM9 ?/@< H0 N @ H0I A] u A I| J;H9c 8 0 HSH9 8K HSH9 8K HSH9L 8K HSH9f 8K HSH9` 8K HSH9] 8 HH9u1 HHI&f D E9 AE M. I I C DU MD$L B|%L)JMDHA8 It~MA IL @8r It_MA IL @8C It@HD$A A BL LHH B8| R IM9uHD$ HE1H LD$ B8<6 BLIIL O\ I9~I1IE9 HD$D$ AY E1LHLH肭 HE9t\A,u A ,@If D LHH1Ht H)1HH[]A\A]A^A_MAIeM9(BLIIL MII9I J D8uID}F8|uIA FD= F89uIM9uHH)1HH[]A\A]A^A_HL$Io1&E1LHLH蹮 H1MA1MA1I"1I1MAM)1HH * AuuHL> HkIcI/u u I;*} FL%LMD$ L)JHA8/ADMHLL H1HPHC H5o H81$HDLDDD$L9 HHtDD$AM )AiƁ )ff. USVHoHt?1HGHOHOHO HHx H| HHHtHuHZ1[]ff. @ SHHzH 7H9sc:teHGH9sV:WtZHGH9sH:WtLHGH9s::Wt>HGH9s,:Wt0HGH9s :Wt"HCH9s@88tHH9uH[HH)[HOHHHtHH)[ff. HH=V UUSHH9wr5HG HWH)H~%WHOu@@,HC HHC 1H[]É HF)SHKHC tu f,AH뽉,AWAVAUATIUH1SH Ht$81HT$@Ht$hAHD$ H7+^SIH +1HD$0H*1HD$Hs)1HD$H)}@ HD$xL|$pH$H$ Ll$hHD$(f H}H$E1LL*0 Ht$(H|$p#$ HH\$x> H] tj :HHV HLHD$~HT$(H* H|$ Hj B HL ?9(H|$8HtH MtHL }D HH HLHD$HT$(HwD$LE@p u H|$Ht$ HH'>HD$8Ht H|$H HHZ'H|$0L HH<'1HD$(H"'L4$E1HE0IcH;PX H|$Ht$(L4$X HHu 觉}@ E1 L$ hHD$HC H$ L$ H$L$ L$ f D H$E1LLL軜c H$ L$ HuH$ H|$H M&tHT$HL 3&H|$H r& HHttH|$!XIH&L=YH$ IH Hu%LcH[H|$@Ht$ HHt ?D$L L/H|$ %H|$HD$(HD$H|$0HD$HtHH|$HtD$LHĨ []A\A]A^A_H|$Ƈ}@L E@E1LmL$ L$ L$ D$PH$ HD$H$ L$ L$ H$ D H $HT$E1LLњH$ LD$ HE IFH$ ( H H9C1 HSH# LLHtH$ L_D$ E0 H H HHHlHHL$Hm HEHP0 H@H|$L4QIH H|$;IHW%H|$0%HH(%HLLL-$H|$(L HH$LLHڅAFHu]AHRbHH"LLHWsH$ HBHP0H|$ H i"MHH1 H|$H_ H MPH|$0L HHg"#HD$8H,H|$H HH;" H H|$H_ * "MH HH HLHD$HT$!H艄MHH|$@H !Hߍ H5 HD$H:軹 HD$H\$xHH! HH: HLHD$DHT$!HHL4 HD$8HHH HH HLHD$HT$!LLsH$ HHO zH!HD$8HtLH ! HLL`p!LvH|$8 !H|$8H ) ^! HH HLHD$HT$ !H詂MHH|$@H H H50 HD$XH: HD$XH H5 H8÷ IFH$ .T H H5 HD$PH:芷 HD$P|$P Lc2 - ( # L4$| ATUHSHLGH5 I9uJLcH I9t+ID$xH HHHtFHH[]A\RHSHuIL4uH5م I9 H} t []A\ff. UHSHHHH5I H9 Hy H9Cu/HSHt%HH H H8Hu 1H[]H<]HHuk H w H@HHm肀 ff. AUATUSHHH(HVHB`HtkH taH- Hu GH H H@ Hx` HSHBH9 HSHH H([]A\A]f D H; Ld$Hl$HL$LHB Ll$H{HLLD HH~.Iu4HT$Ht$H HSHH HH^1u7gH HZ LKL@1Ht$H|$I HHI HH9uHh!Hۇ H} HXW H 1 AWAVAUIATIUHSH(IT$ III!LIv HI\$(H9HCH HCIHCHu H; uH(H[]A\A]A^A_ D H9 H L9tH H9A ID$(HHL LL$HL$H$W HL$LL$H)tY H<$I9|$(7H9 .hIT$ f. HL9=IO4Ot7I!HQD$ HLL$HL$R0D$ LL$HL$|I9E;HLLL$H $ H $LL$1 H;ws HGHH PH HXW Hw H8G 1Zff. ATL IUSLGHM9tH5O I90 HkH{ H9t>HExH8 HHHt2HLHt"H8 []A\ @ HSHuH볃 @ ATUSHH D HGH9 H H HH)H O S @ HLd0< @Ł B Eo H I 4HI9 A8,$ ID$H9 A:l$ ID$H9 A:l$ ID$H9 A:l$~ ID$H9 A:l$tiID$H9 A:l$tTID$H9 :tBHH9uHH []A\< Ձ g LE d* <fL)HtHH []A\ HL HHHtHL)HtHH}1HpHgH^HUHLLD DLh< H( m \ ff. USH( HOH9HHN| H HH H9 H9 O H)@7 H\70H H]OHj P 3 @x HH0HHH IH IIpHHL9 Ht~HtgHtUHtCHt1Ht Ht HS HQH;H9HH;H9HH;H9HH;H9HH;H9HH;H9HL9saH;HwH9HT;HT9HT;HT9HT3H~8HT1HT3HT1HT3 HT1 HT3(HT1(HT30HT10L9rf D H49H1@uI@u+uH([] H([]f. f Ht D @t H H9G HHHHH_HHH H H)H H H DDHGHH(HDH[]H4HI H W H W H([]sz ATUHSHGHH@`Ht?H Hux #L%| L9t9[]A\L%| L9uL wL%| x HHL9uLvHuH{Hk []A\8 ff. UHSHHH HHHuHtH/t 1H[]HGP0fUSHHHWH HBHOHH HHBHWHHgHG H9B0uuH~ H@ H 1nH߉ @HCH@ H t~UH[]HWHDH9B0tHHCHH@ Z[]H@ HCH HCH Y[] f SILNHH5| I9t Ly M9u LH"?HH[LuAVH} AUATIUSHL@ H?HHHwIHE L@L9u<AE PAU ~LID$(H@Ht:H} HSHuLAE []A\A]A^LuLL,: y1H5տ L uID$(H@Hu1ff. @ ATUHHHSH H HxcHHH H HtuHuvH; x} HHC #HH H []A\PE1Lz 11HD$Pj j蠉 H HHHHuH } H;IHHLHD$gsHT$HH; | X1HQ eHYHRE1Lz 1HD$Pj j H HHfHHff. AWIIAVAUATUSHXHc IM9 A@ / AS M{IXAՉAAt$EI9? D96 U @Y I{0H|$ @ Ip0Ht$ D9t$ A) @ @ H$ L $I9INHH )L $HI7 M. H$ L\$8HCLLH$ H|$HD$ Ld$@Dt$0Lt$ L|$(IH 1 EC>H)MA J?MDID8U ItzANA MIM Mh8MDItVANIM M`8MDIt;HD$HA A C &LHI C:&B IM9uHD$H @ A IM Hx9E1f. B:V BLMILt NTI9~H<$ L|$(IL\$8Dt$0 HD$H|$LLT$(H)H芣LT$(HHH$H c IBH HHIBD9t${ HXL[]A\A]A^A_E A A H L $I9INHxH, HD$ ('IHL $E1D4$1M1ALL\$M9 Is IM9tHT$F;,u2 D J D8 uItqFlE8nt5BLMII MALDII9] It*HD$HA C.B8) IM9u MCLN$IHG H<$H HELd$L,HHH$H9D$@HD$Ht$(HT$H)H<H9f. HD$ T$O&IHML $ MU DDl$ILLd$11I<D8/ HhL9 E:l HhL9 E:l HhI9 E:l HhI9 E:l HhL9 E:l HhI9~wE:l HhI9~cE:lo HhL9}OE:l[ Hh I9~;E:l G Hh L9}'E8l 3 Hh L9}E:,, HL9|LAH I9|GH|$LLT$H)H $HLT$HH H $H k IBH HHMHD$ H t I9CIBIL U1Hs I9S}"IBILIZ2HcH/u u H< EA AT H)L[DJ IMMD8MDIHHT$0H)LT$L\$(H $ LT$T$0HHn H $L\$(H F IBH4HEHL9H9}}AS < M{@] L Mk0 L $I9INHx>#IHN11ML $" L\$HL$$II9 AD H\u Iހ< t[LsM9~RAD ~ H5u < t7LsM9}.CD5 !Hu < tIM9|f. M9 I^L9|( @ HI9~AD Ht < tMu I9- HK|5 L)fIH H ID$L4H$HH9ML$$LL9}YAD HJt < M HL9uI,<_ Mk MXM)MIMbxHHY LjiH$H$Ld$H9D$@L|$(Dt$0II L $9!IHL $H@ILL\$Hp I9CID$IMLeLMHD$HM9LHLT$LT$HLT$hLT$H$pHLjLuhi IgLT$8L$L\$0HL$(HD$oL$Ht$T$8HL$(L\$0HT$0LT$L\$(H $hT$0L\$(LT$H $SA IHLH|$H H|$HIHQo I9CYEA AE1H|$ L$ĨL$nILI| L$H)褚L$HHQI lIBJ IIxHH|$ D9t$Ht$ |$DHLD$L $ L $LD$HHD$ A5AC @OA@ H L $I9INHxHj HD$ ( IH L $E1D4$1M1ALL\$M9I IM9tHT$fF;,rul LHL$HL$b L$HL$HLT$H $fLT$H $YI{HH|$ L\$D4$IH? I9|>HT$LL$H)H< L$HHBH IBH,HIZs 1I1ML $MD4$HIML\$M9t<HD$HT$ LHH)IA H<H|$(- H|$(HH HML\$D4$LMtJH\$LL$H)H< L$HH I IBH HHIBH Dl I9[LIBIL H!l I9SHEI L/Dt$0IMPtuA!L HJL $1D4$M1IIL\$(M9t<HD$HT$ LHH|- H)IA HH|$ H|$HHygHML\$(D4$LM H|$LL$H)HHs L$HHI KIBH HHIBYHHD$3 HHt#I ?IFJHD$IH MD4$VH j I9[`IBIL f AWAVAUATIUSDHHHt$HT$ HL$(DD$cH$ D 1H<$ A D$<< 111HT$Hl$E1HD$Ll$81fHLH肴H- HH)H$II9 C#D$8HuH$MIIA 11L"HIHC#D$8ItnIt411LHIHC#TD$811L讳HYIHC# D$811LzH%HH$M~MI9) C#11LD$86Hv IHC#11LD$8HMwHC#t11LD$8βHyMwHC# ;A H|$ t$HD$HL$E H1HH[]A\A]A^A_1H|$ HHD$H|$ H<$ Hl$tEtHD$A Hl$E1Ll$8+HLH HtJHH)IE1L94$OC#D$8Hu11LƱHtHkfaff. SHHH HGH9CHC HW LO(H9 HHI4 HtL% L9 LPI9 MD H5 I9tMuiLPL9 MD I9tMuML@L9 IL 0H9tHuOHH9|oHHI H9tHu;HH9}O LHPHS HHk(IH [L D HHHK H9}1HCp^1[LHHC HHC LSHG HH=h HHf H@ HpHHXH@ HRH HPHyfHnH H7fH:"@Hq[fAVAUIATUSHWHoH0 HBHOHH HHBHWHHgHG H9B0 H:f L@ M!A 1 I A I](H L% f D H;L9txHtsHH/tyHHuI](IE@H9tH= H3 IEL@ Mt#A I A t []A\A]A^ D Hw HGP0{HWHH9B0M M%E1LԂ IE@H9HSH@ IEH IEL c[]A\A]A^t @ HWHt5HGH;B} HRHHHGHH D HG H*t 1H @ HHBHP01H HtH1HH9HHH=Ə %Џ HG(HuH ÐHG0HuH ÐHG0Hw0Hff. AUIATUSHL'ID$ HHID$H9t\HXI<$HtPHv!LIE HHWH_ PuHHE H]D HE1H[]A\A]HPc Hh# Hh# HLoZHEI @ueH=s2 H=s2 L0 IHt- HtID$H=s2 IE HE HXD H@\LefHGff. HGff. HG HGf. UX HSHH芚H;#_ tH[]XHHߺX [H ]pI AWAVAUATIUSHHHL$ q HD$HX L[ IHD Ht IEHD$HG HcLt$81H$HcHD$HD$H)= IEH ID$ HO` H9C HSH LLHIFH|$8L t$8 HH $H H9 HD$ IEL}LJ ID$ H_ H9CD HSH6 LLHEH|$8L蓡T$8 HH4$H H9Y HD$N IoH9l$LWHD$HH[]A\A]A^A_IEH ID$ H_ H9CH HSH: LLHEH|$8L|$8 z HH4$H H9 HD$ HH9l$:OH3HH LLHDH|$8THp3HH LLHuDH|$8H4` H5] HD$(H: HD$(HH H9$ H|$ IHt H|$HHHD$ 蛦 LHGVH9l$EqH2HHT LLHCH|$8H_ H5 HD$(H:_ HD$(HH H9$JHJ_ H5s HD$(H:& HD$(HH H9$i~ ff. AUIATAUHSHHUH;Z t H[]A\A]XLDHH[]A\A]9E f SHOHHWHAHH H HAHG HgHHu H[鐽H/uHGP0AUATUSHHc HGH O H]H IHtNH;]J 11Ld$HH$ f HD$IUH HHE11LHguHL[]A\A]f HHt$ T$ u HH uHH] H5a H8q ff. ATUSHHG HFH H~ H HtVHFHHx]HHHHH?H4 HH)HHH)HH)ʉL$ H[]A\H\ HH HH l HT$ HZ IHtcHLHSH H9B' 11H D$ HHz tHW H5f H8/ 1W ~ff. AT1ɺ UHSH H;X t[]A\HSHLbhlRMID$@HuID$HHH[]A\ff. @ AVAUATUSHHHHVH;{W H;Z u H9 H5 IH HhH H{ Lk HEIIH<1J< 3HMD$HCLs HkA { IT$H H2J H<HH7H HrHHtH HrHHtH HrHHtHt|Hr HHt HtiHr(HHt(HtVHr0HHt0HtCHr8HHt8Ht0Hr@HHt@H t H HH HH9u I,$M HY HHQHH[]A\A]A^ Ht$ IH H@H|$ L HHHkH)H9|hH{ Q HtXHHHH<wH< oHaHCHk # @ LcIt$L9c HCJ,HsLAHHuH\X H@ Hx` HsH9s Im IELP0HyLJOH1[]A\A]A^ LAP0It- H~MD$HCA IT$H]HNHVX HHQ[HjWHCJ, H4(HIOHkHR H8/ AWHHNIAVHHAUHATUSH LpHLhhoD8HX8K.L`@HPHG0fH~)$PHcH9Hu E1LAG0HLE> H H L M I) KtMELHLLL$R@ HHI9IG(LL$ fo $LL$PLd$X)L$`I9R HD$P1I1HMHD$ H foT$PHD$pAo_Ht$`HHD$H4$)T$p)\$PY H I M/1E1 D HD$PLH0HD$`H8A8 HHtWHT$`HBHHD$`HD$pHHHL$pHHD$xHuoHH I9 E1f HT$PHBHHD$PHD$pHHHL$pHHD$xHu@III8 M9}x1>HT$hHJHHL$hHHHL$xHoHT$XHJHHL$XHHHL$xH1HT$ H|$M11 G LcHĈ L[]A\A]A^A_I1ILd$PLLE1I)HD$`LM/H0; HH H4$H|$身 H, HD$PLd$`E1HLH0L> IHtdH$H|$11HD$(I LD$(HT$xJ HD$pHtHHT$xHT$hILd$`HtHHT$hL) Ht$ H|$ILD$( I HLD$(IIM/fo$$LL$@Ld$H)d$PH9E fol$PH,)l$`HD$hHl$`H{ HD$P11IHIHD$ E HD$@AowHD$(IG)t$pHD$8HH|$X HD$P HD$(InH HHD$@HD$HH HD$`Lt$@LHH$ H Hm ILt$IE1E1fHD$@LH0HD$PH8A8 HHtOHT$@HBHHD$@HD$`HHHL$`HHD$hHulIH* M9 E1두HT$PHBHHD$PHD$`HHHL$`HHD$hHuEHIH M9 E1AHT$HHJHHL$HHHHL$hHrHT$XHJHHL$XHHHL$hHHT$ H|$I11C HT$xH HD$pH HT$XILd$PH I)IL M#II1IHT$(LEHLI)HD$PM7H0v8 IHHH)0 Ht$ H<$Ml$+F I HD$@HT$8LLMD$H0t: IHLL)HD$0 LHT$hL)HHD$`H" HT$XHD$PH LD$0HT$ H<$B I MJ Ht$H<$yE H HH|$0ILM7RH$H|$1I1E HT$PHD$xH HT$pH He E1HT$hH)HHD$`H HT$HHD$@H HT$H<$Iع E M LwHHT$XHHT$hLt$ H<$ILH)HkHD HD$`HT$hHH HT$PHHE15MI8HHD$H IG HHD$XHHD$hxHHT$XdHHT$xAHHT$H HHT$hLE1HH<$ HT$p1H)I@ HT$XHHHL$PH HHD$XH H*-1JHLL 8E1LE1{LLzL 9 HH0HG 5HGHx>tHuWHH11HrLHH H HH H9u!HHN H5 H8y HHM H5) H8y AWIAVAUATAUSHHHGH IILHOD= E\ ILLD$裥LD$HH H{ Lu M~ J H}1LD$ƀLD$M# CDJT HH ?JI s DHH H ?J Il s DHH H ?J IG s$DHH H ?J$I" s(DHH H ?J(I s,DHH H ?J,I s0DHH H ?J0I s4DHH H ?J4I s8DHH H ?J8I tms<DHH H ?J<I tLs@DHH H ?J@I t+ tDHH H ?LHI9uEtBDLHIHH DDHPEt%IFHvcHH[]A\A]A^A_f Ht,|HH M: IHUIFHwM 1E1HE D ELIFH= wHm uH>AF.HPHDHHHGH= GHI HHHlHE +f D ILuHHtytHQtHH9) LLD$KHH LD$E1H?H=wGH[]A\A]A^A_M1HHUItIFHpELH[]A\A]A^A_< H AUATUSHHGH;jE t H; H uHHHH[]A\A]IZHHtH r HH?HH{H H@ L%=E I4$HiA tI4$LHfu @ H ff. @ SHF0HpDpLHc:H @KHS0HpHPHHS H@ H@0 H@8 HHP HS(HHP(HG H@ HRH HPHyfHnH H7fH:"@Hq[ff. fHG tHF tH D H HWHNHHrHwdHqHwZ@HHH)HGH= w$HG HcHHDH f H?H=w< Hx HHx!5 Hx RH'' HtHXH' HH f AUHATUSH. H IH@L D xyu4LAHHtDHH+uHCHP0tLL=H%E H H[]A\A]L.=IHfHyD H qff. HH SE111HHT$ t HD$H[H\$H; 7F t He Ht1HHD$<ff. @ U8 H SHH=p p HHHEhHH]hHH[]ff. @ AWIAVLwPAUIATAUSHHHD H@ H GK< c Hv H[E Hc HHH˘ HE8H@H HExHC8HC0HExE CK HEDLHH Hv{K ItmHC8HExHC8 Hǃ M {KuSMe H[]A\A]A^A_ H5H;5D H,f. CKf. L;%aD HD H9CRM I,$tVH{0Hu CKLݘIE cE11HC0:CKL賘IMe :HID$LP0H{0HuCKL|1Iu H> H8 HC H9CtTH{0HyCKL71IU W1B TH{0HICKLMe 1H=> H8-H{0HCKL̗E1ME H1@ H9Gu AMAH{0HCKLxMe 1HCH;? H;B H& H HEHA H5 H81P(H{0HTCKL1IM 2 AUATIUHSHH8o fp)$ LopL Hfo$HIEHЉhPC vK wRHS Hr-S/w4H Hr H[]A\A] D ID$8ǀ mIHID$8LHPpLj1Lhp P Aytff. AWAVAUATUSHHHc@ HL$L@ IEHD$HAHGH | HE;EE E H{ HHLI:HH[ H@ H$H9 IEHHD$ H? HH{ KPIHH? LH )PHH HD$H|$H/ I/ J HD$H H$H9t}HK L{M~T1A L. H謹HH HE I.tFHm t3HHH[]A\A]A^A_ @ EtL{EtMHEHP0IFLP0HOD$Q0D$IOD$LQ0D$I/IGLP0EHH1 HHE1111HHH$C5H$I. Hm HL蹎 1H= HT$0HH(s 藌jH|$0Hd HE I.IFLP0I}` hH)> H$MUHJg2 H=*\ LT$ E HD$(5 H=j HD$5 H=` H4 H$LLHLL$H5 HDHIHDMPLDH 1US AYAZE1LT$ LD$E HK2 f8 H< I E1LI H 1 HHK2 f8 9E HI.zPIVH$LR0H$JH HE H&< HHr OIH< H$I9[M H; HHH{ HH IFI H$H9tIH; HЖ <LHH L HHA2E INHHUH$HR0H$Sx2HD$E1HHL$H L H; HH 1 HD$ 1Ht$0H ~ H: fI:"H )D$0chHH1c== LT$ td2 v1LT$ HD$H5dd2 uHT$L-Cd2 H)I LHD$ 6B LH+= d2 HD$ B L > H57 HPc2 LD$(APD H; HL$ H81DHD$8ZYLHc2 pH<$1cf D ATIUHSHHwEHu[H ]A\ I$H;D: tHB [H ]A\X& 1ҹ HH= "u[1]A\fATUSHHHtC ;C$tFPS []A\ D H=d ( d HCHC C$ PS LcMk(K,$MHHC$(HrL)HCJ< Hr H1HHC PS b @ ATUSHH HT$PHL$XLD$`LL$ht=)D$p)$ )$ )$ )$ )$ )$ )$ H 8 L@ HHHT$HHD$ gfHl$HH$ HL$ HHD$(HD$@D$ D$$0 HD$0t HLHm t H []A\1LHm uHUHD$HR0HD$͐SHOHHWHAHH H HAHgH HG jH(7 HOH@ H@H HGHrfHnH HfH:"GHJ0 HKHSHAHH H HAH7 HcHC H9C {K H{G0 HC H/tDH{ HtHC H/t6H{(HtHC( H/t(H{0H0 H[HGP0HGP0HGP0H{@H {Kn$ HC@Hj z AWAVAUATAUSHHG Ho@S Y HS0A H H >7 < ulE HEE14<1 u HhHHLH[]A\A]A^A_3HEL9|t*<1 tHEL9|4<1 tHL9}HteB< u9E HEA |E1EtHEL9qH 6 [A Ht=B2< tII9uA 1E21HE1Hy E E1A AAL{HE1At5I9}'DLLǃw`H5 <8 tHEHL9|"DHLǃwH5 <8 uHr, tI @ USHHH? HoH H Ht> @tGu/H @tHKHHhH+H1H[]1HAWIIIHAVAUI!ATUH`L 3 M@ HGHoHD$(H MLMD H Lt$0HHD$0MH IIIEHE H@8HD H HH9j I@ HE0I?@0 L1HJf1HLHM9 H`]A\A]A^A_ MoIGHvIHE H@8HD Ht HVH9 I@ HE0I!@0xH1He1HLH(MoH`]A\A]A^A_f D HE $ H@8HD H H֙H9y I@ HE0HL$(@0HE1A 10eHL1HH`]A\A]A^A_H< LL$LD$HL$eIHHL$HD$(Lt$0LD$LL$HIE L0 H IELIHHE LLMHH?L?LHMHH?LHT$(E1 HLs LHD$hHD$LLH1HHL _LLLH1HHLi Ht$(1ɺ H1HHLC ff. USRHoH Ht%H @tGuH @tHKX[] @ HSHWHHB`HH@0H}H H9uzHWHBHwQGHº HH)HH w H/ HcHHDH [ú?H)Hw$[ZS H HSHHP[[[ f D UMHSHHHHHC t`H@8HHtSH H9ucH. H?IH@ HC0@0H1HDb1HHHH[]HXHHHH?[M]BLH1H K ~ATUSHH H. H9Gt^HT$Ht$H|$HCHt @0.H1+ HH$HT$Ht$H|$H []A\LG@Mtv D SHWHHBHwQGHº HH)HH w HN- HcHHDH [ú?H)Hw [鍽R HtHSHHP[[P AWIAVAUATUSHxH8oF8 > HO IHcHlHHIFIH Iv1LL5 MnM IFH I8HGpE1HXH_pD Hx[]A\A]A^A_HFHHvLH(S $1LeH9}I9P IFLHt& HA$ Hv+ > L IG8fv L TK IHxL1[]A\A]A^A_o= HHvP@Hh > s @H < Lt E IFAV8H 9P 1҉L| IFH) u S LJ I8IyI8HmI8IaHMHHME1HL LK uIvL aD LI LIG8E1] LHPpLjLLhpD 2 IG81IvHPpHZ LHXp IVH H,$11HH9E HcLHtHcHvH) L Iv H L Hn(LH@ LEF8H IvL L #IW8IFHzHH HBHH+ H ( LHp 0 HPo L/ IG8LHp6 Ht L/ Iv L " wIG8fvH BP H5 ) L6 V S LG < L _ LH H LG G LG 1HL WH IvL 6 INIV L-J HL: Iv L. HF H" HxLL[]A\A]A^A_n HFHL(1I9IFLHlH' HH T5 H5' L=5 IG8HM l LHP(3 Le LMIL$Mi 1A . LIHD LL- HBHxL1[]A\A]A^A_& LE H^oS K Hs L)$,- fo$ IG8L Iv ANA H}H HcHHFHuH(Ic~ǥHHHL3 =H H8XHHu1H9 IVHTHHHTHH^H11H9HcLHtL HcI8II8II8HH$HMMHHIG8E11LHPpLj1҉ LLhp E Iv1HL- xI8I^HGpL`1Lgp H 1E1H9 IcLHt,-AIcE1 L)$LD$@C 1HT$@L[u Ht$@fo$H1Lv HD$@LHP+ MH^HvH> x Hs Ln( oA~ IG8xIGIvL ` IG8e LHP(H# H\ 50 IG8HsHxH|aHHHL%1 iH< LhB A~ RIG AIG8x31 )$H|$@LB +1HT$@Ls HD$@fo$HHPL&* HFpa A I8HHIv HL=+ J LhA IvH IF Lo@ IG8 [ IG8E1HPpHZHXpD HvE1LL\$Pr g I8IHR IFHbH(HDHME1HL$ H 8 IcILd$1I)Hl$(IADl$4MH$IW8L9. IFHlHE op(H$ H9 1HD$@H H} Hu fLH9\$ |$XE1 HT$@LT$PHT$D$H HD$@LE1MIHL@LH|$@L9} HLMIIH} % H$H9 HMHtH\$81E1HH9* H\$8IG8fvHT$L ' HE Ht$Lo@(IG8 HHxL []A\A]A^A_G1 HxL1[]A\A]A^A_o Hcоz L+I8o[ HsHxL []A\A]A^A_& 맸 렸 뙸 뒸 닸 넸 z p f \ R HH8 -HL=0 nI81HGpL` InLgpH1E1H9E IcLHt!"AIcH8 fI8IHQH,$IG8fvLL % I8I^ 1HGpL`oxLgp H HGp1HhHop ,HpL+ wo] @H < I oN L< 71 H) c LtIG8HK_ LHP(* uhHsL)$ x LIo8HHZ) HKHU(Lj ) fo$il HsL)$z KHsLf 7 x L x Lr L; fo$IG@A9F8~ I~HtH5 ywHL) HIG8INHP(H l L( p H~{IF11L`M,$Lo!L*5 IG8m LHP(^( /It$ LHID4$," HH9}IFLdI $멾 L: Lk: `A(L F L6: +I8Aof8 L IvL# UI8HGpoxHh1HopIn H H $HGpE1HHHOpD 1ۅKAon8 L9 H5 L( x LDl$4Ld$HHl$(EY HGpE1L` LgpD H|$P$ $H} HED@ H8 I8HI8HI8IIHHMHHL IG8E1Hپ LHPpHjHD MF Hhp$9 IFH IVHt4H $11HH9~ HcLHtVWHcH $Ljn IG8In hxH LL) IG81fvHPpHZLꉸ LHXp # Lr7 E11Hھ L58 I^ Ht)11H9~ HcLHt{|HcIG81Ҿw LhxUIG81LHPpLjLhp m -IG81HPpLbL`p u)Hs L I~ ( HsL HsL HG LHL$8J4 WHL$8IE1L _ Lt EHLa 2wDHK H5 H81肣 x LK31jHx8H_ <q Hcо L x L H_ L #b L5 [1A 1Ҿ. LLL$H $HH#HH $LL$ LL xH l LH W ! [L 1Ҿ L1Ҿ L1E1H9~!IcLHtefAIcI8H} H1-IH: HLA L$V $T L3 Hx E1HAA!Ht$1L HD$PHu1LH 1;H8 LLZ > c Lj c LP< L2 I8*IFHL$ HH\Hop( L2 HsH HkHf 11H9E X HcLHtHcHxHG c Lu L2 L $HL$% LU. LLL$A LHL$L$HH"HT$HH4$LHEIHIG8LL$Hx( L$HHLL$m LLD$L $%LD$LHL $ LL L 1 I8fv H|$@1E1IcH;E }-HtL*+A' I8L1H $MHM1MIH9~ HcLHtHcLH $MMMIIcLHtAIc11I9E HcLItfgHcI8AIG I8I8HI8IHHM HIvL 2 L}/ IG81E1HLHPpHZHډ HXp'0 LL 3 L / mH5 L V L AL. ,IvLG IV1E1Ht L4$IHHH9HLL4$IG8fvHھL IG81ɾ6 LHPphxLbIV L`poz 1. Mf Mu IG8HPpHj1Hhp 11I9$~HcLIt9:Hc-(# M 4ff. SHHHG8oN o )$ HS8fo$ H[Ð> AWHf0 AVAUATUHSHH(HcHVHvH([]A\A]A^A_f f D Hv H([]A\A]A^A_HvG LcHSL{A<$ A|$ ID$8u%HpHEH$H@Hx H$ Hj H E1Ms N4)ILHH 1H~Ht>` HH9u1L9j It$H(HE8Ao\$ LH H$ H$IL$Hﾠ HP(B HSH H: HrHH$H$H: HrHH$H:] Hr HrH$ HcH;4 HtHL$ H$H$L$ 8DnHv{ 1AuuHsHZ HcҾ HHv8Le8HL Cu[HKIT$(j H W Arv Asg AaX% u?Hs Hp CHE8HK_ HHP( HKIT$(` HS LcA $w H AoD$ HE8 H ) HE8oS H HsHKHSH(H[1]A\A]A^A_ , i \HsHHHCH H HI HCHHppHCHpy HvCHsH/KA H9, HcHFLf A $w H k+ H{Lc_ Hs 1H D,LHHHsH4DH' FLfQ r Pg 1A jA L ZYFLf6 VA A 1j g L _AXLnMu1E1I} I9E IcHIt`AIcHvH| =HsHF H} HsH Hcо HHFHL0E11E1/HSMl$J| H H $ HMl$MM9|H LLHHH)k ~E HLH8E1~AAoIH2L{MIE1HXL9 KtHZLDH H}8HHU8IHJpHAHBp1 LnL` LH IHDC Hٺ HH HT aH57 H HIIEHQHHE8HPPIU H2HHPXIUH,HHP`HsHRHE8H @H: S H$ H< HHE8HLhIE \ HPLHH^ LH gHG8H x@ HvH* FH#2 'Hv} SBLH 4H# H AW j LNLFHPT * ZYH V1Hj LCLKHS Y* _AXH8hIHH}8SIHrHs1HH YHsHELH/ 2HE8HsHHPpLjLhpE1D aHE8E1HPpLbL`pD jHG8Hz@ SxHvE H" H5z H 1Hh lHvAQA A j h 1[ AZA[CHG8HOH R@ n@@HsHf 1Ҿ HH5 HX H H AS vLNLFHS Q( []H AT j LNLFHT &( A]A^^HvW x Hڿ=HsHE1E1MM/ILHH WM H; sA$fY6N A541Hcоz H s ܸ ո θ Ǹ 빸 벸 뫸 뤸 띸 떸 M H}8oc L L H荾 L HuITH: HuH(L[]A\A]A^A_` 32LkMjIU H HUMt311I9~*HcH$IDHp2$HcLLHb M/ItHLH5 HP H5 7 }E11Ҿi H2Ml$LHHH)L\ oEt H\ A 1H3 H5 HvEu1Ҿi H舼 HCHJ40 HVMl$_H$$M 11HcI9$HcHItuY ID$H; %H; L@A H5 L~H5y L~H5 L I9M9L ALL A11H4 HH(L[]A\A]A^A_] H}8NIHmE1HCM9 JtHHHCHBt /H}8HHHH HE8E1Ҿc HHPpLj LhpD p H HE8E1HPpHZHXpD $L% M$ W I$ W L oLHE8 HI$ HP( J1Ҿg Hй3E1b JtHE8HoN o )$HU8fo$ HmIHCHL; | H= H#wJtHl c HR x Hո8HCHBt Lo H4 IMf11I9$S H H1H@ h Hu1AWAVAUATUSHHL.M1H[]A\A]A^A_HE1NtI6HtJ H~ PID$HD$IM9}-N|I7HtI>ϼ IID$HD$Ld$M9z HHGH; b HHHHvff. @ AWAVAUATIUSHH(HG8Lx( HxHH47HHID$8H L@I@ L5D L9s HSH Ll$LHL9H|$H L9t$R H @H HcH ID$8HJ@ U Lx0{IG R L9sK HSH= LLHH|$HU L]8IŋD$ MLLصH+ H([]A\A]A^A_fID$8H P@M Vm upAZ HL H+HU HAtuHH(DL[]A\A]A^A_>f D H5n HyR-ID$8uA[ HLo H+H HE1H<HHt#LLHEH|$H HA H@ Hx` MoLpIHHHL=cI.qIFLP0bAt t Aa Ab E1E1HCHT$HP0HT$HLD$NLD$HHHCHP0 ID$8Lx8u&H A x@ DDID$8Lx@ՅA A DEH5m HP)H H5; HD$H:j! HD$H H? HcHHK H5t; H8,! fSHOHHWHAHH H HAHG HgHHtH/t H[ THGP0AUATUHSHHHG H H9FuHHVHt>Ld$HHLH|$Ht2L4IċD$ueHL[]A\A]HrHHuHLeL/nIHjHHH:LLH H55: H8 ff. F(9 uHV HJV,9B)fn f~ 9ЉMȉ |fn f8=f~ fAWAVAHAUATIUHSHHG8HxH91HHHE HU H9CuWHSHtMHHL$HUH|$HtD2IH+tMHLDL[]A\A]A^A_阰HHHur~HiLmLlIHrHHHc9nL{HCHP0rff. @ AVAUATUHSH, HHHE8Lp IF rH@ H9CumHSHtcLd$LHL=H|$Ht[L 2t$Ią H+ M:HLHd []A\A]A^mHHHu @ H H@ Hx` MfLskIHHHL)8Im jIELP0[HCHP0VH1 H5Z7 H8 1ff. fH LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H`HG OHuGHAHt]H$ E1I$ HD$HD$ D$0 HD$FH HF HHu D AWAVIAUATUSHHH;5 tcH;5 tZHH IHH{0HH7II9u5IFH;d t;H; HHL[]A\A]A^A_IMHtH LMnE1M9}KlHHKH?H HH9Pt0H9uHIHHKLHD$HD$HH I~HZ!IH1Ml$HD$8HD$(HHD$0HD$HD$8HD$.Ht$0HHHHT H9GtNI} IHT$Ht$HL uL LH HfLI_ HG H HD$H|$ AWAVAUATUSHH8H;=( t1H-' H9t%HwH;5/ H;5 u H;5w u HHH8[]A\A]A^A_ H;5 { H;5 n HG H9{ H;5G H;5: 9 LgL HHM H{*HHEI H{ HHE ItH{(HHE(ItcH{0H|HE0ItGH{8H`HE8It+A J|H=JDIM9u @ 1HH AHm HUHD$HR0HD$m ff.z ff.z Hsf HH8 1[]A\A]A^A_CAGff.ztHHfT fV f/vHHHH8 1[]A\A]A^A_=f~ ŷ ~ͷ f.fTfVzt=ff/RHsHH~ fTfV f/(fTfVf/vf/HsH H;5 H1HD$(N HHhL`L|$Lt$ Ll$(H|$ H8I$ILLLHq uH HIjMHL 1?LHD$BHD$ HG tHF t @ H H @ HHFHHJHqHw`HpHwVRHHH<HGH= w H~ HcHHDH D H?H=wVy @ HxHHHx HxH& & HHH HtHXHF f D SHHHHHsHFpHH@HH1H[ff. AWAVAUATUHSHH_H @ HOH^ HwHAL5HH HHAHG HgL9s0 H 8 L@ MA$ 1 A$ L9s0: L M9u0u M M9u0tH Hx E1HAH I HHT$X Hx HT$< E0 L{0M9 Hz t L M}0M9uI} M M}0M9t H}H LuH]M Hh HE H{ I>Ht H/# H{~sI~Ht H/ H{~YI~Ht H/4 H{~?I~Ht H/& H{~% I<Ht H/ HH;C| AFLH= H) H]A @ Ha A I9s H@ HH9I H= H H+ Mt&A$ I$ A$ t H[]A\A]A^A_ H tI H]A @8Hw HMH@ H@H HEHrfHnH HfH:"EHJHHT$蒞m3HA &H HT$AHx Lz0M9jf I IHx H"pfHA D I9 H@ HH9b H= H y LHHT$XC M HT$M}0M9f. HCHP0/L5iL9s0f. HHHT$B HT$rHGP0HAHGP0HHpHHH8H1HHGP0HGP0HWHD$R0HD$H XI JH]H HHH;H- H"?1H]HUH@ HEH HEH H[]A\A]A^A_h* H Hx HuFL5HB0L9t-H] t HH[]A\A]A^A_H G @ AWAVAUATUSH8HHGH HH/HHH8HuH8[]A\A]A^A_H HD$ HHE1H@0IHuHT$Ht$ H|$(yIum1HkHHS] HtH; ~ HH HHT$Ht$ H|$(H8[]A\A]A^A_魅 HD$H8HIK<$E1HT$Ht$ H|$(IHM9}KH{HfHnL{0fH:"HxHHLHAD1HIHCL I]L9}HsHtH; HHLf. HGH Ht H8 1fHHHHff. HG8 D D ATfnfAnUHf:"fA:"SfoщflHH8)$ LgpL裦 HHID$HЉ@ StUfo $XC v] wcH Hr?S/wEH Hr' H[]A\AL$4fo$$`C wHE8ǀ IHHE8LHPpLb1L`p ʥ' AUHBATIUHSHH(HH6HF ~ ;HSHB z H%A|$ HH(L[]A\A] H{HT$Ht$Ht$HT$HHtAHHT$Ht$zHHD$cHL$Ht$HT$Ht A|$ x%\jHgAf H H@ H@8H@HtH@AWAVAUATIUHSH HL$O ( @F HG0HD$F y @ r M|$0@ c @@ HZ0ALm@H\$PAA@E։\$(HzDT$8\$<I\$H|$L9 H|$ o I9 HH|$AAA i @AA D$D D$0 D$09BЉT$HH9\$\ D9T$( D$4 A @+ AD$ @ M H H I h AHD$MLKA| I)؈L$@JH@8 LL$ H|$ AO IIL Lt$ I@8MDLt$ ItaAOHH IF@8LDItEHT$X A A LHH A8< HT$ HH9uHT$Xf. HE11M LL$`DT$X @ @:< LIILɃY HDI9}DT$XM IIHD$D$<A9 ?HD$D$< D$@ HH)H9 HD$HLU Hct$8Ht$(D t$HD\$XOD\$XHHD$ 6Ht$ F n@ HF0HD$HH HD$H% H|$ Lp D\$LMMj HSHT$ |$HP ZYHD\$IH HL$(H|$HHD$Ht$HIM HD$(D\$`LMH|$ARL)MIHLT$`SL4|$HL AZA[HLT$XD\$`f L9~6Ht$(IH|$HM)LT$HIIMLT$HLHHH|$L HD$(D\$`LMH|$ARL)MIHLT$`SL4|$HL4 AXAYHLT$XD\$` I9}6Ht$(IH|$HM)LT$HIIMLT$HLHHLHD$Hz HD\$`HD$HLLd$XIILLt$(HD$SHATLD$hLH)L|$HMILz ^_H H9~6HLD$Ht$HH)H\$(IHMILD$HILLHl$J HD$HoD\$`II f A LD$H|$HLLDT$@D\$ { D\$ DT$@HD$H|$ Dd$4E H H9E } HE HHE Hl$ HD$ HĈ []A\A]A^A_ LL$DT$@I D:u LT$ IY ELE8Ob LLL$`IIH LAHDHI9y @ :AM-Ht$E1HLHH) HtZHtLHt:Ht(HtH : H: H: H: H:t}H:tuHH9uhLL$ |$@I HPH: tFH:t>HB:Jt5HB:Jt,HB:Jt#HB:JtHB:JtHBH9:uH|$II9HH9sI LL$`DT$XHD$pHD$h HT$xHD$hA8 HT$ HHD$hH9uHD$pHT$xLL$`DT$X 1E1HD$M9 \$D9\$0s E D$@) Dt$4E Dl$<EH|$P5 HD$pHT$xDT$XLL$`LT$hL9T$ HL$II9uHL$ H:HHT$ LJI)HL H W H W HD$ |$@ KHHD$HH |$( E'H|$DLDA D\$\ D\$HHx|$<HD$PF D0t$HLD\$uHD$ HHE111HMH_E D\$ @m HE0Ht$ Hn= H HDED1Hl$: HAH9 QA9t'H H9 HHH9 A9u߈HH\$(HD$LL)Ht$HHHIHHHH\$HHA D$D @@D$0 D$< EƉD$01HD$HGHHD$AD$ bLD$H|$HLLDT$@D\$ Ju D\$ DT$@HD$E\$D9\$0E1D$<D$4D$@H\$ C @H[ HD$ HxHH4Hy = EH<HHIH\$ E111HH&H~Hl$ HD$(Ht$E1MD\$IHHD$X1IHLIH\$(HD$LLL\$pH)MHUAT|$HHHLD$xLT$p ZYHLT$`LD$hL\$pv H9~,Ht$(HH|$HH)IHMIHHILHT$(H\$HJ, Ht$PHL$XIHH\$HIICL\$ID\$2H~HDH)H,E HT$Ht$PDD\$ r 1D$< HD$P|$@HֻD\$ HD$HH)H9HL)HH|$H9M|$Hr @ 0 HD$ HHHD$HH2H|$ H\$(Ht$E1HD$Hl$HILT$LvLIHLH\$X1Ht$PHLI6 Ht$(ML$8LLLD$IHHD$XM)HLHA D$D :|$( |$(^D$D A HĈ H[]A\A]A^A_ |$('|$< D0Ef|$( E'JD9T$(D\$4DMMj LHt$ HT$ DT$0` _AXHHD$XDT$ D\$4D$<A9 t$HLD\$(蠚HD$ Hʹ1D\$(T$<T$4T$@Ht$ F R@Lv0LcT$8HT$XLMHt$IHLHIHL$IHt$PILHHHL$HLHl$<HD\$HHt$LHPH)MU|$HHLLD$8V AXAYHLD$(D\$HHHt$PHL$HHLHD0E'L7Ժ HD$ HxHH4v = R+I9 HGHHD$"L|$(LDHD\$4DT$ Hn IH4AD\$4DT$ D$4 _M D$D Aú wLD$H|$HLLDT$@D\$ DT$@D\$ HD$FHcI/u uHDHt$ALKMAD I)J D$@H8p|$@LL$ L$@pLD$H|$E1HLLDT$@D\$ V! D\$ DT$@I#L9l$/IEHD$!O HH,ED2Hl$ HBH9 D;bH,D; H9eHHH9uEHZHH\$PALm@AA@E։\$(HzDT$8\$<I\$H|$I9PHHH|$(H9߷D$D |$( |$( EAÉD$DdHD$ HHHt$HHHt$(H|$HLL)HHHHHHHHDfD2EHl$tMHBH9t<JA9t#H H9HHH9t0A9ufHE\ETELL\$ID\$#D\$`IIEE1xEf HHt H 6HH9uHG @u1 H HH HuHGtHHG1HR7H9u % uHH|$H|$tHGtHHG1HÐAW AVAUATUSHHx HS8H$ H|$HD$HH1HBp@4uFfv tH5 H|$0r/ H\$S HvfHS8HBhA 1I HD$(IH Az IB1HP },H(9t`B= R1|܃wAJ4G9ƾHx uH@HfHLH 0uLtAJ4 @ MMdH\$(H5 ŅHH H5 th HB0LxHB8HR@H@LrB8F,2DHcHTIH19 " H$ 1HD$HD$xHD$ H$ H$ HD$HD$HL$HT$ Ht$Lx8I8Å% A HD$LHx E' HD$HP8HB8H@^( E-& HD$H|$H HP811fn fp $ 2H$ HZ 12H$ H1 12H$ HHD$($ H$ HD$H@8HP0HJHP8H@@H@B19 HD$(HHtd HcV ~PHFHHH f D g H(H9t#P ~ G H(H9u HvHuLHD$A)1Hl$pDl$\H@8HX H$ H{sHD$PH+ L|$PLd$ Ll$Lt$Df D H$ HT$p HT$xH=H H9z IOHHE1LLLHuL$ L L $ M DŽ$ Aw a E1 @ / AD9C IOIcA\$HH,Du9 HcHD,E x A= H AMcGAh pb~c wIcL Au iA AUHT$PDd ' IHH.qLAAٷHc1E Lf Hk(IGAL A9! Aw AO4 LD$A om( 3& ^( 郷f LD$A p?( z0( koP߷f. AE4HT$PDd % IHնH pLA¸AHc1LL Hk(IGApL A9E Aw L2 ML L MeHD$H@8HXhHtH/ +HHuHc$ HsIHy( H$ MAH=# @( IIPIHHBH B4 x( u I@HBL@(IHcB ~HHRHH4f D H = Hcɋ H(H9uM9pL豴H$ H {( HCHtx( n H@HuHR2 H*1 HkHtH1 HmHu1H f HʋB HJ~ HH4HBH4 Hu΅a% HD$H- H@8HXhH f C ~;HHHCH ЋP = wHcҋT HHuHD$H@8HXhHHtQHPHt DJ Ee H HufC4u"HkHtDc E~H 2 L HHuH$ HD$P1HPIH Icq ~HIAH4Lf. dtH(L9t"0 up9LH(L9u MIMuwHHHcH9" fvL g DG E LWfo~YIcIRH H4, fnJfnf:"J H(f:"BflH9t yH(H9uf. G4uHWz(uHRz _ AMcKI4ҋJ wHcA HH+H|$HW8D p NLHHcH I<ɋO H@H p Aȅu E E1x uLMAy MA~$c H= HcHI H HcHAtE(HU M,HE Aw A8Ax19}uIPH9UtHU E )oA8eA@9E0 I@H9E^HE E )3t vHJA(uIIA(YHVz(NHRz @B7LaL. MA|$(AHD$Hx8uIHͲE1E;t$ LρHIc AHk(IEHk(HIt$Hb HD$HP8HZhHB HC, H H@, H HC, H H@, H HC, Hq H@, H B, HHHuHH< lHH°HD$S,H@8H @H 2 ; HO1C,1H H9$ H|$8Af. HyHqHcO Do,HGD HoH HD$@DHt$0H| II H L I(M9twAA^E>1҉D - =B (AG 9LM DA H5 HD~ ASA/uI(M9uHt$0HD$@AAHHtP,D9}c D`,HNHH9L$8H|$8DTHD$(H `4H@H_ `4H@H `4H@HH `4H@Ht `4H@Hj HP`4 Htb4HRHuHH< IH H<Ht$(1E1AH8H Z D I4$N4HFID$HhLxH}u HE Hc L4Dž 1LLE HcHM4AP~ P = wHcҋ Iv9] E4 HE@4 HxIHEH4IGI9<LDHt$(f D HcV ~'HFHH @ 8W% H(H9uHvHuH$ H H( H[HuH$ HH HCc4Ht `4H@HuL% f C K4t_HHHCH ЋP { G P b = wHcA H[HuH$ HD$H@8L@hH E1HL 2 fHcG HW H1L E @ ZE$1 ADE1 AD H(I9t HcYAH(tL9u D DW0HAHlL L% L= M l$@E1LMHDl$8f HcH x0 L@HD$0H LM4LL) IcE HȃYa EH1A 1DA A AED= AA McJ, G Aj I(M9 f D IcE HȃY EH1A 1DA A AED= u AA McJ, G A IcH(Mh(ME HȃY EM1A 1DA A AED= AA McJ, G AW ME(M9HD$0IH H Dl$8MHE l$@L|$(L5[ AG ) L$ $ E11 t AE9g IcIxHIGL,EM AY AEIc1A= \ 1= 1= HH?D3HMcHI9 D$ HcI|p D)Ӄ D fSHHG#HG H AHD HH) 1HE9g MMHD$Lt$(H Ld$HH@8 $ E~ E1EYY N1 T1 1 AL& kAE9n IcHIFH4HcY~l$(ALI LH& AALDIl$(HD$HP8HBhHD$(HH HH8H|$(Hr HH H8H|$(H HH` HH HH HuHL$(wH H5 HD$0H: HT$xH[ H9BHD$0HR HT$x A\ E9\IcIHk(I)1A9 Hk(HAdt ' @ IcAHH?ZH 3HLcI9 $ HcI|p )1OuH0ɀɐfO6f^HɐfOF MvML$ Lt$(M 1ɃL%Y Mf D Eu E}0E 1F AVA1 AD@1 @E1 AǃAA9] ~5HcHIEL4I9No IcYAE|A;] |̐MmMcHyH$ Hc$ H2J Lt$HL) BH$ Hc$ HI"HLLt) Hc$ Lt$HHLILHA) ٢HC8E11Lt$`L\$pL`(H$ L\$hI|$+HHu7鷤f D H$ LDL$`EZ HT$xHHTHL$HT$ E1LHt$ҷuH|$LH\$`( ^Ll$Iu8I} ADžAH|$PHD$hHHHt$hLO( IE8Hc\$\HpXHHt$0HpPH@`Ht$8HD$@;HD$pIHԢH1HHE1L$ IE8HL$E1HT$ Ht$L`0LJ H$ Ht$xIIE8McHx8HT$xHHKT`BD# MHEI0EHA,/sD͉)D)A9MAXY/ EH1A 1A DA AED9ȸ DD$8D$8I(M9/ID߃ H DKH LH ID߃ H D DL$X IVL$XDr,9L9~cB,HD$0HHHD$0AGHL$0AIVIvB46E4 H|$0Ht$8G H|$0HbIVHt$8H HBIIJ4;] HQR4Q PHQB4S1ɉL-1El$l$HAH$ HD$HL$HT$ Ht$Hh8H}8NR 1l$HDl$HH$ Ll$HL$HT$ Ht$Mm8I}@9 IUMLl$~$ H|$0fH:"L$hIE fHnHD$fH:")$ ID$~D$`D$ HfI:"Lt$HDH$ H$ H$ A$ )$0 fnL$@$( D$8)$@ f:"H$P fnH$ f:"LflH$h $X x+Ht$pL$ tHD$pLH$H {HD$(H|$`HtwH|$hHthH|$pHtYHtHLHD$(HD$0DHtH|$HD IcINDYgHA@4< H(H9 DL$XB IVL$XDr,9LcS9FH?H9H4?H|$HHCpHc$ IcU L$ 4IHA$ I| AYAEfD ;AA'H9NJb4 6A L$X> IVL$XDr,9Lc]9PHcAID߃ H D1E4HE@4IVB4u>H|$0 H|$0HIVIH ? HBIWIFH4AIVHփwJ4 HHU HH4;E1Ҁ`4DP HRHPH}?S H@H.fA8Ax19}&IPH9U HUE )w '1[ p1HO 11HA@4< LsHz1:1CE1HE|B8AHA4<9 )A4H6 I@@0A@ HD$( HBHø HT$Pd D HHAE;g }SIcIWHk(HH;=^ 0u:Nw2HcHk(HʋJE 1Ƀ9҃ 裚Aw L8 L AD$HHk(HCo@HE@ H$ HD$HD)HT$xHHITD k Hø HD$( H$ HMLd$0E1I\$8HLE9~'s;IH(HT$P HJDHt$H|$L\$8Ld$0 ~HD$PL$ HHHA HD$PHHp1 HtrHt^HtJHt6Ht"HtL9. L9, HL9, HL9, HL9, HL9, HL9, HH9t}L9, HPHL9,| HL9,n HBL9l_ HBL9lP HBL9l A HBL9l(2 HBL9l0# HBH9uHɖH|$PLHL$0c?HL$0L$ LHL$0HL$01L L , A9~Hk(HA E d Aw MI0Ht$xtIH8H$ LHHcAE1ۀc4D[ NH}0Ht$x&H} H$ HDD)HT$xHHITD @< 6 HA@4< Hø }HA@4< fHT$H|$(1$ fvDŽ$ D$ $ QHL$( AD)E11DoIcHk(DD9& H(DLAc LA A9DLDAA8[Ax19}g)E A1) E1ɹ HT$1DH$ fAn L|$(HMj DŽ$ K fpLH$ fք$ B1 HT$fvH$ L$ DŽ$ A EG Lk(\$0EEg ExTIwN,AE c9 AFDHHk(H˃D9}%DHP(A A} A Dd$0Aw HR0D$8 BHcD;HHD$01HL$89~IcH|$0pH41E1\$8fvLt$@AMDAD9~\Ht$0HcËPt扔$ H|$(fDHT$$ DŽ$ $ 0 fv6 AH|$0D\$8MLt$@9 G AI(#AD$4AU4 IUAE4C HHk(HCo`bLhID$Al$(AE( IEMl$p~钔H9H exL|$8|$@A}o QHcHk(D9}"|$@ ynH(D|>A tZA}tAtL|$8Dd$0Aw x멾 H|$P1 H$ HHFlD|$@D;|>t럃}HcL|$8Hk(H:A}uWDH} jDxKD9pHcHk(9~4<>}u Dd>ExE9IA9@H(A}tfnH oPHHf:"H$fnD$@ AE f:"@ LRflL BEg HAl$@sHcHk(HD;pJAAV3E c H} HG1E0A@9EAA@9E4HEE H@HE IcL$0H[HHKL$01HA9H1$:cuBDHHDDD H(A919tu~HA9HcHk(H H(yGd,L d IcA\$Lż H H5 HD$0H:u HT$xHD$0HHTHc tHcD@Hk(Hc DFH4HcP鮍Ml 钍鍍鈍 AWIHAVAUIATUHSH(LgM$ LI9u LsM H L I9tA$ H I9$ t2HUHE uH Ht; HH8H A$ C MT HMI9u Lu1H([]A\A]A^A_ LLAՅtf HuHUHHMHh HzH9L1M9 HH HT$LHAՅzHT$HzHuH~H HT$LAՅFHT$HzHuH~H HT$LAՅHT$HzHuH~H HT$LAՅHT$HzYHEHx HtHT$LAHT$Hz)HEHx(HtHT$LAHT$yHzHE D HEH<Ht"HT$LHL$AHL$HT$/HH9Jf. HH H HFtHHFHH;JsHEH4HtHF @tf D tgH(LLH[L]A\A]A^A_ HI9u\GSf. HHz*HI9uDLt9 LAՅ# D Hz LLAՅ8f. HzfH~ H HCHH HMHI9 E1A HL$LLD$AՅ~LD$HL$HIH(M9yuHAH| HuIH(M9uH=iH9 % HuHHHHHJ(HJ HHHHyu,HAH| Ht HL$xHL$HI y0u,HA8H| Ht HL$<HL$HnIyXu,HA`H| Ht HL$ HL$Hd2I u/H H| Ht HL$ HL$H"IO u/H H| Ht HL$| HL$HI u/H H| Ht HL$: HL$HlH I yu6HAH| Ht(HL$Ht$Ht$HL$HLHH(I9uqHL$HHT$Ht$HL$HT$Ht$ D G ATHUHSHGHHЋ@ƃn@t= t1[]A\HjE4tu 19~Hk(HMHy ~ E1D9e ~5HxWHIc AHk(HCHk(HHuŀK41fATIUHSHHHHUH+H9u6HG @uKH[Ht HC @u\1H[]A\ HՅuH{HtHLH[]A\HH Hu;HGtH[HHGHuHH Hu4HCtHHC1HH9u6 % uNH`H9u$ % u1DH|$H|$HHG AUH֒ ATUSHH_ H9u H[]A\A]HG Ho(1HQ5 H HO(HHOH65 HGHuXH[]A\A]sLkE1J| Ht 1JT IM9|EHH)/ff. D_ IE U1Ҿ1SH_IcHf HH(H9tD8 Apt@9tLcoHOH(NAoXAXLPMP H9u[]AI D9txESA9~0DP@D9uHH(H9tD1ɉO Ex&9cMQMtAz t-MRA9rufnH fnf:"H$f:"@ fl@@MRff. HHHu p tnHHAHuH=Ɵ B tJHH HBH4ȋH v!= w(Hcɋ r HRHuHFx tPHFHRHuHpHt~ t HqHwHFHtx t HA^HpHtHH@ HGHt D SHwHH fHC[f 1G4uHOW 19~HHk(|1 x1ø fH6H? D [~m\T) H= HcH1 D 5~<t= D f. f. 2+ygZ wrH r HcHC~D 1H@ uq HH% H 0 HH%H HR% H% Ã6E D f11ø )ÃÉ ÉЉ1D ÍFk1Ã)1@ff. @ ATAUHSHH@HcSHHwJHcH9? uH| AD$[ M DK,DE$DU AD)E M A9 O D)~WA P ЃȀCHHS@CHHL CHHS@CHHDD ECHC, []A\ @ D9p ȀCHHS@CHHL CHf D w cfCHHS@uK,CHHH| )# Ҹ ?( CHHK@U CHH+UHL ? } CHHK@CHWHHL ?wm}$HK@CHCHWHHD ?wEKHC,f. у?@ / H Ѓ?@ H h D Ѓ?@ wOH HH{@#HcCHHS@uH| AD$CH$?Hq @AH ?H?@@q?߃?Hq @AH ?H?@@q?{߃?Hp @HH ?{H?@@p?\)T ?w HH?@A?w)HσAt A9gCHHK@CHHH| x H?w )BCHEC,A)CD ىH?@Jff. ff. AUIATUHSHHHGhH HGpH L% I$ m ~HH H@H H HGIMH9 L;-K HLHHHthH@ HI|ML;-' IE L!LHD$k|HD$HH[]A\A]mHuUHH8 L Hy鱀HHLHUH8 uL%τ HHH9Iff. HGHPhHuH@p1HuH: u1H8 ff. fATIUHSH>辖HLH}0HHHCTH+Ht=H(H9u []A\H[ H9EuHm HE I<$3{I,$HCHP0뷐HHGH@hHt H Ht a ff. HGff. AUHATUSHNJHIH@Ll$H H=H9t" H1H+t\ tcE11L1L2>H\$ HuLXzsH3H# H H[]A\A]HCHP0y~LzHr H HD1Hm AtE~tLHHuHEHP0H; E tHs3 HZHyM~ AUATUSHAULghMtPI$HtH HuL-ĭ @ It$Hԭ LI} H M$$I} H MuH;Ht E1L#)yH{Ht 1HkyH{Ht E1L[ yH{ Ht E1LS xH{(Ht E1LK(xH{0Ht E1LC0xH{@Ht 1Hs@xH{8Ht 1HK8xH{HHt 1HSHxXH[]A\A]uM$$HM#ff. @ AQH;ws-Hu HV1AXHGHHH8H x1ZHT H5 H8u ZUHHH50 SH7H ~HPHH@ t/HsH/H+tH[]HSHD$HR0HD$Hsf D UHHH5 SHX7HHt&HPH@ t5HsHH+t HHH[]HSHD$HR0HD$Hs @ AWAVIAUATUSHH_xHkHExH}HIH I^HkHExH,HIH I^ HkHExH~HHH I^`L{IGxHs~HHH M IWHBxH}LIHteIV(HJHAxHf}HHHt=AF8A3F<A3F@A3F0HL1L1H1H1L1H1H }H[]A\A]A^A_}|||||ff. @ HWHtLHGH;B}/T0HHGH H)HS~ H H 1PHOHou1^1 HG AWAVAUIATUSHHF > LHNHAL9MLN1M~_ItH|H9tG H $H $HH HZy H9G}H/ H;=| u D HL9uH JcHL9}At\A HDItH|H[]A\A]A^A_f D L9u8H4| HHQHH[]A\A]A^A_ H{ HHQL9udH|{ HHL9~A}L9}7}H{ HHHxy H HL$H<$4 HL$H<$ 1u|HCy H ff. AWIIE1AVAUATUDSHH_H EA 1H l$ 1111Lk D EdE EIL L9 DA L9t HLzLfHHM9W A,$AHILzI M92 DfAHILzI M9 AHDfLzH M9 AH؈FHH{ L9 l$ HHS L9r @ A?EEA?EA IL DA L9A?E EA< EDAAt`EDAAtSEDAAtFEDAAt9EDAAt,EDAAt ADA l$ AAul$ DAv<L9 HAHLzLfHZHLL HLLHH9l$ A tbL9 IcHHEu}E1L9s)DHLl$ 1HLLHL1H[]A\A]A^A_I1Mt L9 AHEt&HA #III DApHy H5$ H8ޥ JtEH~111E1LkC|E AIL M9 L9 ILj HzHIL9b D>DqIHzIA L9= D~DqIHzIA L9 H DqD~HzIA L9 Dq؈FHzHAv L9 A HHAwE1HDLIL9I?DA?AA IL M9?tAuvL9sVIAHzHIAvHrHiH`DA(L) A9H x H5 H8 L9sHHH( @ ATUHSHH HWHD$pHD$ H H H H L% L9 HGHW fHHT$`HVHD$pHXD HDŽ$ H$ $ $ H H|$hHD$x HH H H< L9 HCfHS HH\$HD$ HC HT$HD$0HD$pHD$( HD$X HD$8D$HHY HT$ H HH)H9wHH # 1\HH HD$pHL$`H< HS!HL$C HD$ H H1Hs!HtHtHs)HH)HH)HHr&LHPI HILH9 H|$pt>H|$hHt4HWH HI H@H+ HD$h H/> H|$ t>H|$Ht4HWH H H@H HD$ H/ Hİ H[]A\Ð HS1@2ELfL6fHS HHH 1ɨt tDfDHt4@4HHD$ HL$HxH1H2HtHtHrHH)HH)HHLHPI HILH9H HtgHtUHtCHt1Ht Ht LA LFL9L>HL9L>HL9L>HL9L>HL9L>HL9L>HL9L9HGL>LD9LD>LD9LD>LDHx8LDLDLDLD LD LD(LD(LD0LD0L91Ht$HЅr HD$pHHfHr H9S]tH|$hHHcIL IIpL HH L9" H<2H1Ht$`ЅsHSH HL%n HRH5 1I<$ H( H9u|Ho01HD$H/:HWR0.HW( H9udHo01HT$hH/HWR0Hq Hh# Hh# 12LLHH|$Ht$H|$sH|$Ht$`H|$H ,q H9]rHE HH HtgHtUHtCHt1Ht Ht LI LJL 1L 2HL 1L 2HL 1L 2HL 1L 2HL 1L 2HL 1L 2HL9SL 1H~L 2LL1LL2LL1LL2LL9Hw8LL:LL9LL:LL9 LL: LL9(LL:(LL90LL:0L9L%"m HEI<$H5 HHHCHP11H HtgHtUHtCHt1Ht Ht LA LFL9L>HL9L>HL9L>HL9L>HL9L>HL9L>HL9ZL9HGL>LD9LD>LD9LD>LDHx8LDLDLDLD LD LD(LD(LD0LD0L9L%l HRH5 1I<$pff. HHOH H H H H H9 HGHO Hp H~HHHFF HF u;HF( F$ uCHF0 HF8 tCf1F@HHs F$ HF(t D HFHF8 HF0uHFHF8f D HHj HQH5 H81~Hk H5 H8胚 HAHA HHHP H @ HARHpHAuAusHpHtHAH s HDAtHpHHA1H8D@ H@ HP(@$ Hp0HH8At f@@1ZHPHP8H1k H5 H8躙 Z D SHHHHt'HWH HtXH@HuHC H/t'H[fH 9# H9u Ho0HC H/uHB0H[H|$HH|$1HCH/uHW D AWAVAUATUHSHHH8H HW H+oH"oL3E1E1HudL HHnHpDHx D H+It(MnH;-ul , H8L[]A\A]A^A_HCHP0A L{M IG fnA &nIt<H{AŅ H yk LHh "AątpA +E1LQILT$1HA PL HD$Pj jMx H LT$HHmL0E1E1I5IH L蜨mH{FAŅmE1LHLHaIvmHmUSHHHOj H9GuHHH[]Hdj HH^ wHHuHuTXH[]s H;% HHHt1HC uHPHf H5 H81HZ1v AUATUSHHQmHAH\7 E1 A1H8 HH9lHH HHH7IHlH 11Ev 11HA Ht)H HH A HHHH A u HHH9 t ATHHIxHHHH~ALHP[ HGH HL[]A\A] CHLKHH A AAHH A w{AAHH A wFHIYH9OHH A vЃH %?ADHxf D ЃH %?ADH ЃH %?ADHk @ ЃH %?ADH611HpAXHHCH= I(uL\CHdg HHLDI Ht A| HHtH IPHHHtA| HItH9uo A 1118 HHH)H9;@H.H 8WuH 8uHH9u@ 1 HWЃH %?ADHq Ht)Hj HH A HHHH A L HHH9ug! D CHLKHH A AAHH A w{AAHH A wFHIYH9HH A vЃH %?ADHxf D ЃH %?ADH ЃH %?ADHk @ ЃH %?ADH6ЃH %?ADHHHH9H7E11A Hg H Ht\Ht% A HHHHHHHHH A ' IHHHHHH A IHI9 t ATHH7CILSHHHHH A ABHHHHH A ABHHHHH A wVIIZI9THHHHH A BЃH %?ADH(ЃH %?ADH듉ЃH %?ADHPЃH %?ADH HЃH %?ADHЃH %?ADH_HO@- A A1E11Ae8 Ht\Ht% A HHHHHHHHH A B IHHHHHH A _ IHI9 CILSHHHHH A ABHHHHH A ABHHHHH A wVIIZI9HHHHH A BЃH %?ADH(ЃH %?ADH듉ЃH %?ADHPЃH %?ADH ЃH %?ADH<ЃH %?ADHAA ЃH %?ADH @u;HAA @_ 贸IHTc |A A &ЃH %?ADHfHOHHHHHH~ |HrtHt | Hzt Hx HpHHt| HtH9uH D HHtHWHJHv f S_HHSH v[H/uSH^ HcHHDH [fAVAUATAUHSHGH HF H9tqBLvLo M9u'F 8G t6t(H ] H []A\A]A^ D 11A9tHb] LHv H @1҅у~!~&RbH-] HHQH뛅 H\ HHQH{M9LINH~`G N )uHv H ɡtCEuxAaAuPy迫 )aHKZ H AaaEu M9];a.FM9 8ff. @ AWAVI1AUATUSHH ] H@ HD$E H'bIH@ H@8H@H. HhH! HE H^ H`IHaID$ 9 Hèh LH0IH]aj LMIj HH5y L1HXZHt H+tKH|$L膯HH Hm tOI,$tTMtI/tVIm t[HH[]A\A]A^A_HCHP0H|$L1HHu`HEHP0ID$LP0IGLP0IELP0E1111H={w . IH`HH^ H= 1HH`Hh LkIH`` @ AVHHAUATUSHH@H HjHe Hx`Ho`L'HN H_H HH;`LoM H`LwM H2 H Ht$ `ID$ U LH I& LLHLH@[]A\A]A^LiIImRA H1LC HD$Pj jJg H HH`_L H LLoM*LwMtLE1-MIH Ht$ 葚|$ I_LME1$II\E1E1E1LLHL%E1E1E11E1LMIHZ H5 LMIH8 H^^^ UHSRH HtHH[膑HuH}8PXH[]mff. fUHSHH^0H0 KLsDHcH HtfH8 H)HH9sSHE1H0 HUH(HHPHUHX Hö HPH@ H@H@( HX8fD@DH[] H|^HU0Hu1KLH(HHpHuHP H¶ Hp1HpH@Hx(HP8f@D AWAVAUIATUSH F F = 6aIHaH;=}X 2 HPS H98`H;=XX c H;=;V H;=V ~8`H~0H`I> HGH, H9 HGLHHH!HWHHtTL;pu?HXIEI;E HPIU rHcL Am HĈ []A\A]A^A_H HuI}0 HH_IL &`IFH;AW < H;T @ H;S o H;]V k H;HU A}8 AF @ I~ IUIM Q H9 HBZIEAF I^ "]@\IEI0I9E HPHLIUL Am f D IFH;T 1E11H;AV Ht$0Ln|$0 H H HH IUI;U HBiIE@*LH rH;T s A}8InIUIE d H W H9o HB)IEIUI;U ^HBIE@*H I~LHI~ LHI~(LHI~0LHI~8LHI~@LoHI~HLYHo I|LH9H9uOH9 HBzIEIUI;U [HBsIEIvI~ L9 1AF ekH;sP 4^H;P ]H O H9 H;1R H;P LS]V HH,_IUI;U _HBcIEIc~8L Ic~<L Ic~@L Ic~DL Ic~0L LHI~L I~ L I~`LI~hLI~pLI~xLI LIc~HLE I LI~(LHIHVH;V ZHBIENAH2 H5AX L)C HHYA}8IUIE ~ AF ZH9YHBuIEHuH} LM H5I H9ZHBaIEAF Iv Z@YI~0L HVH;V "ZHBIEFHVH;V "ZHBIETLH0rA}8IUIE /\H9\HBgIEAFL{ =A}8IUIE WH9pWHByIELl Lz L Lz LDL LDL L\ IUs1Iu HT$(IUH9WH9WHB>IEMfI8YLL LHH YHD$(E1Hl$0HD$HD$ H$YAu8H|$ 蒶 HWHT$ HHD$ 1蠥H|$HD$GHD$H;WHSJ:IH$Ht$HL uH1t"WHCLHHHx H|$ oI9HF} L 7IE#HVH;V !WHBIE.A LԼ IUH9UHBAIE L蛼 /UIEH9u Lx tIUHB(IEHULH L9 NIU8 L IUf. I1L^ 1L _ H fL GA0A4HA41 fAtlAE1HcfD WtAAE1HcfD Wt.QE1HcfD GЃt11Hcf4O9uf D HHcL9y HcL9aHGff. SHHHHVH;V tcHBHF@:HSH;S HBHC*HSH;S HBHCHHHSH;S tEHBHCHHH[H|$ H覺 HL$tHCHPHSz HHL$x tHSHBHCHD$H띾 HHL$I HL$cHCHPHSHHI HHL$ HL$ HCHPHS(HGHHHH!HWHHtH9puH D HH AUIATIUSH HS@HYHHC H H9 LHHHMLeHPLmHCHHxOfH*Hx_fH*^/Y wtHSHH!HHHU H(1H[]A\A] D HփfHH H*XHyHHfHH H*XLHIHO XHMHCof. HH AWAVIAUIATUSHH H<YHKK L%J I$@ H@H( M-YH Hǀ( HeF @u|L{H HHS IE LkILsI$@ H@H HCHJfHnH L9fH:"CLzHH[]A\A]A^A_HDXHC @ugHL{H=oZ1 HT$H=1Z1 Hy HT$HHtw HT$HtHEH=*Z1 HT$hHT$L{LH=6J HT$tHHFHT$Lxf. H ATUHSHJHt<HB IHH)H: WH9lHs @uFHt @uDH][]A\HHHD7HyHHD1H)LH)HHHʋD7D1D7fD1H)H4 tH}LHÐAWAVAUATUHSHH( XHVHB`HtMH tCHF HH0HH H H(H[]A\A]A^A_Z D H;H v Ll$Ld$HHL$LL [WL|$LsLLLL HH~SHt$Hu2IuL9tVHHdIH(L[]A\A]A^A_ IuMHH6IHBG H W L W H豴 IwH HsK ȉ DsV H0 HIHbV@ AAA ,V@taMh0LT$E1LHDx&LLD߉I脼LT$L9uH6C HRH5 H81E1MhHHHA <t<A DDH1E1HD%9UD9U AWAVAUIATIUHSHHH L5F L9 H{H L9 L=E I@ HD$HGH@`H8 H * 15H H{I$L9tNI@ HGH@`H H 1H IE 1H[]A\A]A^A_fH H} HHIʐ1H{I$L9tL=D w D H HE HTH H{H9t5L9HyHHL$Hy` tAH{` F4H HE L9H#A H|$H H0Wq H A Hi HH06q @ USHH D H@ H;=D t*HGH@`Ht9H t/H1HtH H[]H}` u"HH~@ H HH0p 1HH H9 LLMx L9+H* H:H#f. I8HH H HH9}6H)HH HHHH LOH9 1f D Hx~H>HHx/H9u D HHIHxE1LHHyHHn1H1bHyHIHI9}L)HHHHHLOLLMxL9L MHH)ILyLLOHHxI D AWAVAUATUHSHH 1L%{zL- fHH;]j HEH4HtHE0L>Ht H~L9 Ht H/ HE8H HEHL9 H=m L5m n MtIH$HE0Ht IL9` Ht H/ HE8H HEHLL9& H=m m H<$ )H$HH H$HE0Ht H~L9 Ht H/ HE8H HEHL9 I>Sm H<$ HGH4$P0H4$H4$H~H4$HGP05I7H}UHHEHHH[]A\A]A^A_HGHt$P0Ht$^Ht$H~Ht$VH4$H4$sHt$Ht$)L<$HH4$#f D USHHH? H@ HOHWHhHAHH H HAHG HgH H/t1H{H/t?H{H/tMH( uLH( H[] D HGP0H{H/u HGP0H{H/u HGP0XH[] ff. H#OR6fAWAVAUATUSHH PH> HH@ L`I$ Q HmyLhLsHH LHH OOHHI wLl$M H|$L|$I$ LHHt H L5HH[]A\A]A^A_H I$ IH A NI$ L` HH LRHH H;> t]H@ NH{NM9tSI$ HL4NL49ϳ 1%HI4M9UH< HH5 H81L1t4ENf. HGH@`HtH 1ÐATUSHGHH tHHH[]A\H< H0d IIHRH LH3H+SH}H uR SHHGHV T T Hy ~ y6H9u1H[HH[3Ht$y< Ht$t~ xuTpTcTf. USHO DF D ; @ LO0A z A@ LF0HoH^H9HHǸu$<u_HLL¸ynH[]À H< I 1I H9tRA4A H9t < 1H9t'A4A@H9tt H []1H9yD jLFH-<I SI9tA A9S6LOHA SSLOH<?S<u$II9{AA9SHLLpS-SHSLGHA xSH1HHIH9HOH9HLL;P9 AH@At H9SSH)H|H'u HHֺ AWHμ AVIAUL- ATAUSHHHHD$0 IDHD$( HD$HG TLI_ H|$8H-[9 HU H EtHJ LLL$(LD$01L H # LHH TI~ H|$( $TH|$8IHSH9 H9D$0 E1E1IGL HH H|$0HuHIMu&MIHIH Mt D LDLLD$5LD$HHSH3 H9GRH/` 1H;=@7 u)H+ I(HI@LP09f D Im I.MIFLD$LP0LD$4fH@ Hx` MSIm tQLI/t8HHH[]A\A]A^A_f D H D$LR0D$Yf D IGLP0 @ IELP0HCLD$HP0LD$IELD$LP0I.LD$w%Ht$1LD$8H߹ 2Q1HD$0LD$H|$Z LD$H|$QQAU1fHATUSHHH H-.7 HD$8Ht$PHL$@HO|OO: HD$PLD$HHrfind HD$U1HT$]HT$(D$eHD$0 Hl$@Hl$HƄ$ D$q v` H|$@H9tHt$0D H|$HH9 Ht$(HT$0HF H~ TQ{ AH H HPHH w'Hy5 HHHDH HĘ []A\A]E1HxIH1AăH uHcH H Eu*HhHPH?H JuHA AIcHt$8t<Ht$(HL$8HT$0HF HPH1 H5 H8161=uPf. AWHAVAUATIUSH8w AL$ AAAAAAEE9 H_IIIT$H9 M% HL)H9 @ pP@ MM0 @ ID$0HD$H E9 E A` K<1AE @PAD$ @PH H H Ht$HD$LJH)MD&DD JDHE8 I HL$ IHH A8l IthHL$ IHH D8R ItEHD$ A HD$ LHL$H D8D$ HL9uHD$f D L1H D8 LIIL H\H9}HE9" H8H[]A\A]A^A_As HK<6HT$MLHDT$D\$XH D\$DT$HID$HHD$H3 D EHD$MMA A E H LHI9LA:$ I\$H9 A:T$ I\$H9 A:T$h I\$H9 A:T$O I\$H9 A:T$6 I\$H9 A8T$ I\$H9 : HH9uHHt$DDDD$,LL$ D\$(HT$DT$ HD$H+MDD$,DT$HT$D\$(ELL$ Ar K<1AE @MAD$ @MH HHT$IHA DT$D\$D\$DT$HHLMyHLHeHL)HLL)HLLIIL HHH92HXf H D:!uItULl$EmD8l uIt>HL$A HD$HL$HD$B )B8 (u IM9uHD$M9cHLAH|$gHAueK<6LHHHT$IHA DT$D\$d D\$DT$HHKhKHZLLMyI)MyMyH&H&H HH HHH Mx]H-A AtA KEHLH HLHI HLHMMH JHؿ HHgAu7HLE~ I HL HAZAt}DHL HaHHcH/u HHHT$IHA DT$D\$L D\$DT$HI J6ff. @ ATUSHH v]HH t<II<IHH萅HtT??Xh MtD` []A\ÿ aHLXH, HcHHDH Lfoff. AU ATUHSHHfdH;( t H[]A\A]fHSH(LbhHULjht:Mt I|$HtHHH[]A\A] Mt I}HtHHHPHR0HuH{H X[]A\A]) f HG UHSHHF HGHHPHwtHVHJHwf~HCHHHGH= w(H6+ HcHHDH H[] H?H=wSH[]ff D HHU HSH3UHD$yHtH|$ HD$H' H H[]H[] Hl' H AWAVAUATUSHHxHGH<$HD$X HHD$P HHD$H HHHFHD$@ IILHI9 H9 $ HF H H$H@IIIIHHD$HCHHHIH<H豂IH*KHPM~H H 7 HtA H9 $ H|$ ' LcLt$0IH-) MHD$ H)HHLl H 1HD$(IH$B\H@ HGH|$HD$K1 JfH|$HD$hHD$hH;EPuHD$H;E0u 9JHD$ I9a LML1L)HHH HtYHt)AEMFIHLAHA?H EADIHHLHAH A?DOADIHHLHAH A?DOM9 D A7HOIHHwHЉH ?APHHwHЉH ?WAPHy HHqHЉH ?QAPHHHЉH ?WM9nH\$(I Ht%?IIL9d$ Lt$0IVHHHHH~A\HH HxL[]A\A]A^A_ID HHL1HHH9 $xH$H\$L|H~H H-' Mf H$ IIGLt$(HD$ MMIA^I$@ LHGHD$>I1 HH|$ddHD$`HD$`I9D$Pu HD$I;D$0uH|$M7>HHEMLHHIDI ?A}M9sNL E DHHHLLAH A?DOIL9rHD$ L)HIDMW H$IH$IH9D$Lt$(IV]HtE\HxE HHHHHINPHH4$LHIH9 $[H XHD- L9+ MH<$HL$PHT$XIL,' FH9 $ HL$@HT$HLH' FJ|% }IHFHD$XHt$HHHt$HD$ [IHbFIpLHMt$J H M<H/ Ht APAIpMkIT$LH)tH H1LHHD$PHt$@LD$8LT$0HLL$(Ht$HD$LD$8HHEHHHPLL$(LT$0H H Ht EAD$HMLH Mt$LL$0LD$(M)IM)LL& HA LD$(LLHT$0IH& H|$( Ll$ Ht$L HHEL H|$ 1HT$PHT$XH9 $ Ht$H|$ IHIEH|$ H|$ 1LHHD$@HD$HHH L HyDHKLHSL) H[ LCI~ HH ETHOEtHH9PLʉׁ?H 8P1AALHn" HH LH MAL$LALHM?HE IHkI4HsQu<H# HMHLLHILHHHHHM1>|HMH~1HHHLH)HHH1HHMAHAALALIpILLLILHHHHIpHT$XHD$PHT$HHD$@HH H$H@IILHHCIILHK|% yHH\BLpH@HH2 HtE LyIH=BE1L@Lt$H\$MLLl$j HtMoH<$LHT$(HALXHHHT$(M)HD$ HuHD$L)MH<L& H|$ M HD$HL$J L9HtIOIH HZHLHHLHHHHL LL;1 E1DMELE1LMDHHH1HL HI: AUIATUHSHHGIILHHFHHHHL9 I|$xHH H, AEE ?JH AM M ȉ ?J H AM M ȉ ?J HtgAM$M$ȉ ?J$HtJAM(M(ȉ ?J(Ht- Att ?tHH9u D I9 H Ht HF ?yH{L9 F ?y H{L9 F ?y H{L9 F$ ?y$H{L9}kF( ?y(H{L9}QF, ?y,H{L9}7F0H ?q0L9} D ?LHL9uBDHJHHHHH~DTHpEtHH[]A\A] @ HtDLHxEt6HHHHHHHrH[]A\A]f D M~)11HHtEDDHwEtHH9u11ۉDZH{uHH>ILp1y>f Uh HSHHTH;C tH[]HHuH{Hǟ X[] ff. HGH L>HF ;>HOHAHv & 0 HvHFHwBWHHH!HBH= w%zH HcHHDH f. H?H=w H fAUATIUSQA]HoH~ HH0 跪 H~hI1ۃ Ht7HtI|$Ht H/ I|Ht H/ HI|Ht H/ HI9uoLz ZH[]A\A]HGP0 HI|HtH/tMI| HtH/t4I|(HtH/tHI9tI|HtH/uHGP0HGP0HGP0HGP0OHGP0+X[]A\A]HGP0fHGH;e uSH$ H@ H@ c& H HWH f. HH=fE %E @ f. H H@ H@ c# H HWH HH=E % E AUATIUHSHH;HHH?Hh;HtHu HL[]A\A]Q1ff. fAUATUSHH(HFH6 OH9u<Cw H @ HcHff/ H_ H H([]A\A]HX Hs HqH~GH9QtHt;H9Q tHt/H9Q(tHt# H9TwHH9uf. H f(fT % f. H fHCf/z wwAHa f H$? HcH f. H @ f/1f/ѐHus 3 ff.z1f/E1H HL$z L$HI9H0wLHL$m L$, HL$4 L$HI9A H0vH|$f(L$JHcD$ L9 I9L$ T x*= U H HL$ L$HI%9H0HI HcfW ,A^ %A HH|$f(5\fI~D$% IHtDffInf. HLG8HcLH IHL Hx, f; fvHL$HHEfHMH nHH HH9% H IH8H. L LHH7 H HHh 7B HIH7 Lff. HWHH?HҺ Df D ATUHSHHLfL;%' tEID$xH9HHHt5HH~Ht%H8 H[]A\f D HVHuH{H5 H9t XuH H8自t>H= HHHtHH H߉D$ D$ x ATIUHSHHwBH~ I$H;% u[H ]A\zHB \8[H ]A\+1ҹ HH= u[1]A\f. AWAAVIAUATUSHHW ;8C @|$ @o M~LcMn0 t @7HS0< J"1H9tw HHHJH9t`JHHHJH H9tJJHHHJH H9t4JHHH H9t! HHHH H9u A M |$ AM HH 1A LHD $uD $H I AMHHv 1A LH5D $HS Iu AMHHb 1A LHD $H? I AMHH 1A LH赋D $H A I CL HH 1A LHDL$ L $eL $DL$ HxsIM9uMef <Z J41 06E1IM9||$LLMHr:IHLLL[]A\A]A^A_'E1EtA A 1A LHL $贊L $HxA E1ۃ|$uKCD] Hs1A LHDL$ L $lL $DL$ HvIM9uCt HY1A LHDL$ L $!L $DL$ H+IM9uMnHM~Lc 44444 @ AUATUSHHG P5HIHHH H H@ H@ U H tLl$HLL$E1L L= @ L9t E L9 H HHx2t=E1HAu.tQHHDŽtA Ll$Lf |$uug|$tu`|$fuYD$<_ D$ HT$ <8 z u`HHL1[]A\A] @ L9t@HP _L9t4H6H5J LP HHL[]A\A]s7 HHL| HH L@A s3HH[]A\A]HT$<8S<1u#z6uz uHHL1[]A\A]~ <3uz2uz uHHL1[]A\A]N H5a LOO?H5 L8Ot=H5U L%Ot*H5J LOtH5B LNHHL[]A\A] 1H k2xT a2Ht8HFHHtHyHH HHtk_H*H% HHtH USHX HG 2G 2@ HoH_0H9 Hu3Ht.H H@HH# H HX []f D Ht11H&H-2HtHP HHHHX []HK Hh# Hh# H8 uz 1LWH@1HGHl$ u-IAHHLHk HH1H끀t4LHH HH8 ~1Ho0H_8H1IAHHLH_ H1ff. fG Gff. fUSHuH9tgH H H[]ÃuHGH HR3 HHt6H H9tHrH(xt H{ H 1ff. G HO$HG Ht6HHHWH)H92HH HWHHHHHT$H<$蝝 H<$HT$Hff. @ HG \ AWIAVAUATUSHHF AHFHWIH9 H 1H9 IFH,IGL$L9tiHE H LI$蓎HHq2H` H9G 21H;= H/ Hm tyI,$ 1t$HI;^ IGH9gf IVH9 I9_ AucH HHQHH[]A\A]A^A_ HET$HP0I,$T$u ID$T$LP0T$Z At0IGDH4IFH<H[]A\A]A^A_tI9WgH HHQHbIVH . JcHI9W3I9W|&A0H . JcHH H AMw A1HAk0H . JcHT$| T$SH H AT1USHH=l H HD$HL$HT$HLD$HD$T0Hl$HUH u? 0HL$HT$HHA o0H Hc[]A\E1L;e}UJtHF 0HL$HT$A H X0tH H H []A\IHa H ff. HG0IHtfMQ H(LHH L1ɾ4?HL\HH H H H HtiHtDHt HWHHHH1H5M[HHHWHHHH1H5M[HH1HWHHHH1H5M[HH1HWHHHH1H5M[HH1HWHHHH1H5M[HH1HWHHHH1H5M[HH1HWHHHH1H5M[HH1L9 fHWHHH1HWH5M[HH1HHH1HW(H5M[HH1HHH1HW8H5M[HH1HHH1HWHH5M[HH1HHH1HWXH5M[HH1HHH1HWhH5M[HH1HHH1HWxH5M[HHH1HHH1H5M[HH1L9IQI)Au^HUoH1IAH)uQHHiMrH1HHH HH1H1Hi H6H <-IA0 IAH)tH-l H11sff. AWAVAUIATUSH^HHHnHh H H L3Mp-H H{H HG -L|$LzIH-H<H;D$a-HtvH{HG ) L8HHH-H<H;D$ -MtSHLL&n HH L;- uHHHH[]A\A]A^A_Mt1LGHHu,H H W H W 므{ ,1LA0 HHz oCDc Ls@C AAB Ãʀ U 1HU(HU0HU8HU@HUH DE1 HHHHL9b,IVHHT$聳HG,EHEHHT$tLu0HE8Eu]AHS ,@t8Hs0HHHE1E1@A@H|?\HsH+Lu@HE(LbIQHE1La 1HHD$(Pj jM H HHI+McLaI**W+ ATUHH~SHH^HuBHw|Ht3H71Hu"Hj H[]A\11Mt HW1LbIPE1LD 1HHD$Pj j H HH*H~LIATUHH= SHH9 H! Hu[H]A\| @ 1H辽IH*HH' I$ H{L A tHD[]A\_x H5 S H{ A HsD[]A\J 5HH L`M)tHL0 HH)HCHEM~J HsH}>HXH[]A\H{ )H{(rH)H HH HH H 0 HHt*HCA HEH H5w H8O* 1N)u)H)AUATUSHHXHGH- H9 H@`H H H Hr H9uUGf/x R f/ H,.}HHt(HCH9k)HXH[]A\A] HHu1f. HHXH[]A\A]f D H (L- HI| T IHu^I@ Hx` uH{H tHXH߾ []A\A]v HsHXH{ []A\A] H H5 H8S k(L LH8HHCH9 (HP`Ht H u+HPH H5 H816H1H3 HHH HHe1kH5 }O'I1HL@uDHt$H<$~hHHB'Hp Hx HHELHCH5U 1HPH H81fG f f/ v f/v H,z9 f UHSHH(HF H'HW H9u H([]f D HX H HQH~?H;qtHt3H9q tHt'H;q(tHt H;ltgHH9uf D H HHT$H_ HH|$HrH;{'H/ YHWD$R0D$H([]ø 9H H&H9u ff. @ H;+HHG`Ht;H tH uH uH5} z1҅1ff. AUATUHSH8HT$Ht$H|$L- HT$ HI G Ld$ L?Ltzt HT$Ht$H|$H8[]A\A]ޜH IH H{.I Ht$(1H Hl$(%HD$ HH-x衜ff. @ Gx H H H& @ G0H HH ~ff. AWAVAUATUSHLgLnH$M9LINH II1ItI|H9 ^}HH: H+ H9G2H/' H;=p t~H9 H H$HA IwI~HH H9 HWHFH OH vH H 19H[]A\A]A^A_ÐHH9(1M9f H1ItI|H[]A\A]A^A_{ D H$H[]A\A]A^A_ @ Ht v1q11q1Hf_XHPH|$Ƃ H|$ff. UHSHHH@ HWH9 11H; H1H1H H9G11H;= H/t H[]HGP0f. H(H HT$HY TDH|$HuH(ÉD$ D$ f D 4Hk BHZp BHHP Dff. f 3H BH p BHHVP Dff. 苙@uP f ATUSHHH0HVHB`HteH t[H- Hu HH5 H6 H9C> D H7 HHH H H0[]A\f D H; Ld$ Hl$(HL$LH4LT$H{HLL:HH~ Hl$(Ht(Iu;H|+ `1H= `t IuH9tOH{ `X1H Ht$`H3Ht$HP Ht0 +HJHl$H9uH H9CQ3HHtHu"HCHx H9H} H5Y 1"3HGff. AWEAVAUMATIUHSHHh$ HT$AMBDL$MtID$ bBHLH iBf5z MM0AM EAA9ωANAH|$ M/ Mt$H4Ht$Mu$ 7 JT5 IcH9 Hc$ H9h HcH9 HI 9MA9 H$ HcAMA)IDHMtUIcH|$ It' ID$H 1I;t$uzHD$HHHt&IA9t7HAMuD$9}11H9 9$ A9uLMM H$ Hh[]A\A]A^A_H DT$0E1HT$8LL$@DD$HHt$(L\$XIÉL\$TALAI92HT$8D1IDT$0LL$@DDD$H\$TH2L\$XFH|Ht$(L\$ j @L\$ H뢿 I;t$ HR I;tHH9u4D$9IS)H HMDDKH?H H5ֆ H81t}1$1Ht$IcH9 Hc$ H9+ HHt$LvMu $ t1HT$11H4H$ H4HcH9H|$L\$HDD$@L$8LL$0HT$(DT$ qDT$ HT$(HLL$0L$8DD$@L\$Hu}{H01H:HE1OE1H5 AIEH HDL Z HLEH= H;>RHH H5j QHH81*|[1]IcHH9$ IU<$ H5} H/ H =N HDL:N D;$ LMH , H<UH5`k 1PH D$ H81{AZA[GH= H HM HDLM 9$ LNIUH5 H;AH U1QHH5j H81/{AXAYLLl$AI1LHE4 IcL9r;Ll$IIIMH|$LL1 f. HHG C= L=H H;w W =@t9H0u97xIHH H)H H H HHHtǃuC<w w.@yH HHkPH H f H <H H5a H8 1 ATIUHSHHw?Ht I$H; u[H1]A\-HB r<[H1]A\1ҹ HH=9r 診u[1]A\b< S 聸Ht+P щ @t v=@b=XH[ <=@?=fXH[ÐSHG- H{Ht 1HC~H u H[ KHAWAVAUATIUSHHHGIILHH?Ȅ HBHIILHH I$1L1M9 @& !Aυ LnCHHA MM I ~CA~L$LHffEHt% ~DA~LffDHH9uLHAtHTA#TTM9s En H+ I,$ HUHHHHH3 DLHHE HBHZ HH[]A\A]A^A_ @^~ AωL$ A14$IcLNB4$L$ HH$ M IEH oCAoT$LHfEHtcoC(Ao\$(fE(HtIoC8Aod$8fE8Ht/H oAo,HfD HH9u @ LHHI9tCLH)Ht&H~A~ ffD @tHHHTA3TT@\M9 LL)HBHvvJ fo ; IH<IHof It8oGf@It%A MIIBofBM9uHHIŀtEJ H<HW?PIUL9}!W I?P M9~ W ?P 9H]H}IVBD?H pH 11HE D ]HHCH= Hm HH= HcH) HHlHE Tf D HtDDHpE H2 HMH @ L $?IHi:M $% C5? ?AWI S ?Љ ?AW I S ?Љ ?AW I S$?Љ ?AW$I S(?Љ ?AW(ItuS,?Љ ?AW,ItSC05?Љ ?AW0It4 t? ?AtHI9uf. ID$LIILHHL $:>H9 $HxIt$LH$L$ M9H$L$ IL g @ HHS |HNtHH9 = HCHP0I,$ ID$LP0HcL=HHe M"E1MLJ L)HL H4HHs H[QHHyHHHTHTH)H)H HH#L IMH[ MEHcIL<HH71MCTA TTHI9u1ILHK1HHMHHH1I11E1TTaCHn HHHlHE 666fHGH HH@ 8@CuPH t HG8Hu HËW$HwHcHxLG0MI~H94uIH@Fu Xϓ 1@A#8H tHw8 HtG$HOPHcHxLG0M I~H9 u IȃHm JGuRG-$H Y3ufAWAVAUATUHSH8H H|$HHT$H[ HT$(09H|$( H H|$HT$ Ha 08H\$ H8H H+HD$(I9M8A Ld$(1y8@D IG0 _ H|$LIH8Ha LLHH9Eq8(I/ I.-8 HcLIHttH@ =7EzAG B84 7IWH@7&I/{T7H H\$H0Hz -7Hz 1I,$uID$L$LP0L$H8[]A\A]A^A_IGHE17IWH@6P7ff. H=0 ATIUHSHt HAԅu?1H=0 t%H0 H|H:H H0 uH=p 1Hu[]A\[HL]A\AUATIUHSHHHg:H HEH9 HXH9J H}L,HU H9}bHHLdILH)H HtKLH<9J4 ~H9HEH]Le HL[]A\A]HH9H]1X~H9E1I<$QHH9HmzHII H]Ht[M9HI99H}HN,I9 IE 1IT$LHN:K9L`IH H5j H8 E1 939ff. HHG y9H;w9HGHH @ 9Hp BHX BHH9 Dff ;@uP f T9H[p BHJX BHH8 Df f AWAVIAUIATIUSHHH Hp H@ _H8HIELxI{ HLt$Ht$IUHrIHLHLHHsEHT$MLHHH+H HHH[]A\A]A^A_HtAED$HL HxHLH9sH HtgHtUHtCHt1Ht Ht LB LFL LHL LHL LHL LHL LHL LHH9L HyLLD LDLD LDLD:HO8LD>LD:LD>LD: LD> LD:(LD>(LD:0LD>0H9rJ HHL$HH,7HL$L0H@IuHMHT$HHLHHT$HHD$H9tH<HH+]HCHT$HP0HT$Df D AUATUSHH.7HHWI 7HVH G7HvH:7LhIU 7IX H# HJH~9H;ztaHt-H;z tUHt!H;z(tIHt L;dt7HH9uIT$H H5ù IMH8I1IGg 6fH I98 I H"6H98 uH H 6H98 tI$8 H98 5HHx HHt`HHLA$8 H+tH[]A\A]f D LHSHD$HR0HD$LI9AH HuQ5E5ff. ATIUHSHHH,6HFH9u"Fu9H{Ht.[]A\F HՅuH{Ht [LH]A\1[]A\ AWAVAUATUSH(F85LHHM5HFhHII@ @ DfPDfTD9fL[ HC`IcHL$H|H H_ HHD$ HL$HDHH H H9P5H@H5HH g5I1M} H([]A\A]A^A_HG H HG8H)Hx MM4DcTDcPD9cL;`5AL$;KLR5HC`LcHt$LD$J|LD$tJDHH<5AL$;KL 5HC`LcHt$L$ LD$J|LD$L$ u9KL444ff. HHօtpo f. H4UH1SQ躅HHt1HHg{HtH(tHZ[]HPHR0Hq1ff. fHHG 6G 5@tHw tH0H6C HH HHf ff. HtFSH H HT$Hhk ~$H [H\$HH߉D$ bD$ 1fH F6Hp HY6H@ Hf D Q Z6Hp Hm6ZUHSHH}8H r8H1.HHD8HHOH+tH[]HSD$ HR0D$ HG HtUSHHHoHU HC8H;-L 68HHHU NHHC HC H[] AWL@HAVAUATUSH Lg(HGHoM9 1LMfLz(HB HB0BH~=LL5 H HHt H;L9tHtH/uHGP0M9tL> HĈ 1[]A\A]A^A_H~CI L1Lf LHB Lz(HB0BHaMff. fATHO UHHSHL@ E111HH莒HtHHHLgH+t[]A\HCH[]A\H@0ff. ATIUHHSHk E111HH)HtHHLH3gH+t[]A\HCH[]A\H@0 Ux HSHH H;3 tH[]XHHߺx [H b ]逹 HWH J<HV 9<HWHJHwaHNHyHwS~@HHH HGH= w"H HcHHDH H?H=w bHHǾ| || ATIUHSHHHHtH??H9u3HG @uLH{Hu8H{HuXH{ 1HuH[]A\HՅtHLH[]A\LՅtHH Hu HGtHHGLՅtH?H9u % ukH|$H|$f. SHH;H H6HSH@ vxu H H [H ; D AWAVAUATUSH^H HFH|$HHW HQ H# L;M H HD$Hx IG N<H@`HtH s L=t}H\$@ H`4<Hl$PL|$HLh <I H= C HHi ;H`b1HĘ []A\A]A^A_IGH; H; LHH;H@Ld$@L 4HqH:HQ(D HT$L$@HBH:HR(LHAHH HLw HAEt!HL$HAHpH;q|H|$ g yH IGH|$HH$f IG S;I_HD$Hx L L`(H$H H- E1Ll$@ HtoHt5H;H9oQ LH H= A$A J<H9o LH H= C4IJ<H9o LSH H= C4H$II9 J<H9o L H: H= 8 C4IJ<H9oj L H H= C4J|H9o9 L H H= CD4J|H9o Ls H H= CD4H$II9'1HD$Hx(H LH0HHU8H18tL|$HLd J I 9I(H17 1HD$Hx y8L% HjQHE1L HHL$(Q1j jH HH} HD$Hx f1H d T LcM ID$ 8LHt$@qIHtsHH;D$@8H 1HD$Hx +8M IG uSL r6QWHuH H5S] H8p)WH7H1SM 7HLLzHHtH|$HUl HHHtH1L 71HKHA 6Ht$HTHHRHH;D$5H6ff. SH0 H>H Ht胾HCHxH@ H9uHH=R [%k H[ D UH?HSHHH@H[]ff. AVAUATUHSHH H>P HH HU HH Lh LH Hh LHLa IH@H JH@LhHXL` Lp([]A\A]A^ ~VE1HuuH; IHtZH{ HH MuZ HIHn@ HtjH\ H5Ű H81V1x @ HuLf|LA IH:@H譳@Lh1-?ff. USH赇HHt H H9Eu HH[]H HHHff. AWAVAUIATIUSHӺ HHL5 IH nMH?H-> HH9h?H(# H; 3 H LL&MIH I9o?I/ L;=? g LL9L= HL9 H?Mh HLIL9S MR? HLIL9l M ?Ih L=IH>Im I,$ H+ Hm HL[]A\A]A^A_E1H;Z AR AH蟖HHM> LLKIH)>MIELP0jID$LP0eHCHP0`HEHP0\HIH IH @L.R L;= hH蹼H b LH蠬 IH a LL聬 HCH X HLb IuG= D AVAUIATUSHHH\$ HL$ HŅ H I}HT$ Ią I I} HvHËD$ Ht[H~`L9}[MI)H M t{H= `EHH=HhHX Lp(H@ H[]A\A]A^PHuNHy6L9~1HEH1L)HHHIx.tHH)L9~E1GPH,IhH= DH<H I}Iu IM(LH HxHp HH(L@HHHHH >IF1HHIx H?H)L9|OHpdH H5$ H8FH H5 H8PH H5 H8ZSHHH/t/H{H/t.H{ H/t-H{(H/t,HH=J [%c HGP0HGP0HGP0HGP0ff. @ AVIAUATIUSHGHHHHHFHHHHH9U A > H H HU AT$A+V ?HH AL$ A+N )щ ?P ʃH AL$ A+N )щ ?P ʃH AL$$A+N$)щ ?P$ʃHtAL$(A+N()щ ?P(ʃHt[AL$,A+N,)щ ?P,ʃHt7 ALA+L)щ ?THH9uf H9g H4 I<4O)H0 ?rHsH94 w )Ή ?J HKH9 O ) ?r HsH9 w$)Ή ?J$HKH9 O() ?r(HsH9 w,)Ή ?J,HKH9 O0) ?r0HsH9~fw4)Ή ?J4HKH9~GO8H ) ?r8H9~(AT)ʉ ?LHH9u @ HPAuHHPHHHHH DLHqE" HJHv []A\A]A^H 1HP1f D XHHSH wH(uH辳CH HHHDH HSHb H H Hy9xuyHH= x9y HUH# x 9y uIH]H y9x HUH @9AuHH ADA9DtADHA9DryA @ HDDHyEtHxtHpHHH| HtH9u HIHIHAMA11H HRHHHP?HH;1hH HH HH f. U HSHHH;# tH[]XHHߺ [H P ]p HG HF } HWHx+Hu/HNHx]Hu GvH9u3Hc<Ht @ H1HT$@ xHD$HÃHc<1HD$HtHZ H D AVAUIATIUHSHHHWHx[HtaHHT$HH W5H $H{ R HD$IE M I $1H[]A\A]A^Huf D HMHO HuHD$ CuH9 Hc;HD$H4Mt3CMHuH9s Hc;H$H I$HD$IE 1H[]A\A]A^ @ H+uHCHP01 @ H} HHBHHgH,$H;4Lt$H LHh sHH3L+H\$H $H} y)Hc:H$H!3H43 AVAUIATIUSHHGHHHIHHFHHHHH HH9~FHǺ H9C H. HI] HH HH I$1H[]A\A]A^ D H H uHT$HD$ = HD$IH |$9IE H2HCHH3u H H|$RZm D Hp IE H Hd HH HH 9f LHH I} HD$IYIE MnoD9DH|$%Z H|$ #2HCKIE Hx ELY I} 22H" H5# H8Sff. AUAATUHSHHHGIILHL7IH I|$M EA IL1Ƀ HtSHt%DTLDIHHATI|$H)DTH L HIHHATHH)DTH L HIHHATH)H DTHwH L HIHHATDTHH)H L HIHHATDTH)H L HIHHATDTH~H)H L HIHHATH)HXIPM HHHHH~ AtHHtHL[]A\A]Ht A| HptH IHHHtA| HvtH9u1A I I I ItcIt@It TH H 1IADHTH H 1IADHTH H 1IADHTH H 1IADHTH H 1IADHTH H 1IADHTH H 1IADHTHwH H 1IADHЋTHH H 1IADHЋTH H 1IADHЋTH~H H 1IADHЋT H H 1IAD HЋTH H 1IADHЋTH H 1IADHЋH H 1IAH+1Hf D USHHHuHHH[] @ HHwLEL9ukH= eHt~HP HHpHXHE HhH@ HRH HPHyfHnH H7fH:"@HqH[]L uLHp vO-J-ff. AWAVIAUATIUSHD$ Ht I^H. HHH H~H Hx1L-c HMI@ H@H HEHrfHnH HfH:"EHJH I~yH$ HEHt_I~ yH HE HtCI~(yH HE(Ht'A K|syH JDII9uHIH",H Hx1I@ INH@H IFHrfHnH HfH:"AFHJH~AH IFHHt'IF Ht IF(Ht IDHH9uHHI$0 H1LH9 HM+A$ @t;I@ HpHRH HPHyfHnH H7fH:"@HqT$ HhHXLp P(H[]A\A]A^A_L-a 1I I IMHxIH*HHt2HHLD$ 1H V HmD H߉0M1rH1cHL*@fUHSHQH=h aIHtHE HHhHHXiZL[] SHWHHtgHOHBHH HHBHG HgHHtH/t H{ HtH/tHCH[H@ HGP0HGP0HHuÐUSHHHWH HBHOHH HHBHWHHgHG H9B0 H H@ HR) 1 H{ H H/t@H{HtH/t:H6Ht H t~UH[]HGP0HGP0HWHH9B0W(H@ HCH HCH X[] (t(ff. fHg< uP!yZHlHP H ff. AUATUSH )LoM G AAA )@tYHo0AuU] u_u7 DHHJ t HL9|HH[]A\A]1HoHAu] 룋] ()ff. @ R@f ff. @ SHH=e ^HtfHSHHpHXHPHP0Ht H@ H@( H@ HRH HPHyfHnH H7fH:"@Hq[ USHHoH HMHH9O HU(HG Hu Hy N LFHV H~ H @H HL9}YHz uyHHI9~IHz( ubHHI9~9Hz@ HHHI9~!Hz HHI9f HC Hm 15f HHHJHS0H (HHHC HS0HHH[]f. HHHHL9}Hz t7H HS0Hu'H0H D I9^HEHP01HHHrI9?Hz tHHHH I9 Hz tEI9H9H)N HRHHHHL HS0H('HHI9HҪ H5! H8HC1ff. 1USHPHoHW蛞 HkY[] HU'HG D'HGÐATUHSLfHL;%k t?ID$xH1'HHHt/HHBs''H H []A\HVHu'f UH1SHYHHt+HH<H'H< HCH4'Hk HH[] AWAVAUATIUHSHH;=% u H'HII?H MI LHH M~J Hx1L-w HKI@ H@H HCHrfHnH HfH:"CHJI I|$oH' HCItuI|$oH HC ItXI|$oH HC(It;A I<oH AWAHcHDIcL9|f D H0 Hj1HH9 H% @t;I@ HpHRH HPHyfHnH H7fH:"@HqHXI$HHPH[]A\A]A^A_L- I I XH(1Hu%[% AWAVAUATUHSHHH L@ HGHXHG%H6 Ll$MHxHBHGH H9 HOHJ HGH;A$ HIH HHGHI $H HEHx HGH H9 HGH HOH;H+ H@HHHOH ID$Hi HmHHE tH@8HD H E1HLHL蹐I HAHf I$H> f HoHE H@8HD H Ll$11M1LH1HLHvIHtcI<$H/ HtOI|$H/ Ht:I|$H/5 H~%Il$I H} H/B HH9u D M9y M\# H@H ID$HHEHx(HGH H9 HGH HOH;H H@HHHOH ID$H HE H|HGH H9 LM HGI;GF IwL<HHGIM<HH9HE D Ll$E11HLLM譎I D f D HGP0g @ H?H*I<$H/ E1< HG H)u HAHP0E1hHL$HL$H=?HI-Hf HGP0 @ H0HG E1HVHHHPHR0HGP01HGI/tDHE1p HGP0I<$H/BHGP06HGP0IGLHL$E1P0H\$!SHWHHtgHOHBHH HHBHG HgHHtH/t H{HtH/tHCH[H@ HGP0HGP0HHuÐAWAVAUATUHSHHH8HVHB`HtdH tZL% I4$"aHH H H;C H H8HHV1[]A\A]A^A_= D H; Ll$ Ld$(HL$LL\q LT$H{LLLB^IIuiHT$ Ht$(HHH8[]A\A]A^A_ .HuHsOI<$H5 1HCHE HH8H(褘1Mx$tHD$(H;D$ H% MD1HD$(H;D$ H M~HPHT$ IT$IILT$HHD$(J< IH Lt$(HD$E1LIHKHPHH< LOD H9h HHt9HL)IH< HD$HHsH;l$ rILH9? L)HHs17?I| H臗D$ D$ L9|LD$ uHD$ HH9^ HH5 #WHH LmM9L MuH 1"J< IHn HUHC h LEHL$HT$(H< H 1HII4HHH1HL9|1 I<H蛖L9|LH膖1HVH)HD$ HKHH)H4L)HH<Hs ff. fUSHHHHRHB`H H H~ HH0s]HHt-H H9uPH~2HHt H[] ^[] *HuLHL H9uHh H W H W Z[]YHH[]H HRH5) H81+1 H~ Ht# H H W H W AUATUHSHH @ HHsHHH9 HI@@( LijIH { At$ HKAAAHtRE" @@ MD$0HȄa @@ HS0LLH g HL[]A\A]F @@ H0 E* @@ IT$0HHHs@u,Ht@tfD*HMHHD*HHoD*d@ EMD$H HSH HHJu- Etr@@IT$HH1f BHH9 EtA@@IT$H1 HH9 5HSHIT$Hff. @ HH H<$Ht$He H H AWIAVIAUATUHSHHZ L@ L.LI}$H* HPHH H HB8HH HUH9 H II?H@ HC0@0)L1HE11HLHkH+tH[]A\A]A^A_ HSHD$HR0HD$H[]A\A]A^A_H HuDHHSIHH .HE1LHH?LBuHIULHHud&Hs1R1HLH1HHLGj*fAUIATIUHSH(H H H0H'H H] HtZHC /HHt$舝HH HH;D$Iu1H(HL[]A\A] H}HG Ht$-HHHH;D$H11PHE1L 11LHD$Pj jH HH WHYHRHE1LE 1LHD$Pj j豥H HH HtI @ HAVfAUATUSHHHĀH- HD$(Ht$@HL$0HO|OO: HD$@HT$ 1LD$8D$UHl$0Hl$8HD$EfindHD$M D$q D$a} H|$0H9 Hʗ L@ HGH@`H H 1UVHH" H|$8H9' Ht$ HL$(HF / ~ { ^ A HbH HHHH w2H! HHHDH H[]A\A]A^ D 1iE1HxfII thHH<HEAHHcHHt[EuBHh?PMtA?H<D` tX yHA E1 AIcI|$` 1IHt$(HT$4RHT$1&HPH H5) H81#1Hޒ HG# LH01 AUATIUHSH(Hѕ HT$ H` L@ HH;b HH|$ Hl$Ld$ HT$E1LHfHH蠌HHCH腌H([]A\A] AUIATIUHSH(H H HHH% H] HtZHC HHt$HHIHTH;D$KIu1H(HL[]A\A] H}HG Ht$荘HHHH;D$'HHYHRHE1Lă 1LHD$Pj jPH HHHtAIPHE1L 11LHD$Pj jH HHW11sUSHhHHGHHH tXHwHtHhHH [] HHc$ x*Hp H W HH W H W HhH[]1 Hl$HT$1HH<$ $H<$PHt$ HL$HH|$H HH% D AVHAUIATIUHSH`H ` L5 HI@ H@ z HD H Lt$L Lt$HLL$E1L L< L9t E L9 HZ HHx2t5E1HAu.tQHHDŽtA f |$u |$asci Hus_asciiH9D$ |$lati Hlatin_1 H9D$t*H5) LtH5! L H`HL[]A\A]A^ L9 HP _L9 H |$ fH`LHL[]A\A]A^ |$in1 I f|$ if|$t|$fD$<_ D$ HT$ <8u%z u7H`LHL[E1]1A\A]A^O<1 z6u z 1H|$Hl$ H HD$H] fHnLd$HD$0HD$ HD$( fH:"HD$(D$8fHD$H)D$Pr HH LHHx IH H@ YHLsH`[]A\A]A^<3Dz2:z 0H`LHL[E1]1A\A]A^# H`LHL[E1]1A\A]A^t HutHL5W I W I W pHs1aHT$oH xxT nHtHOHHt0MtL HHt5H>t U HSHHH;s tH[]XHHߺ [H S" ]u HG : f. USHHoH HMHH9OHU(HG HHu N LFHV H~ HHHHL9}hHz t/HJHS0H HHHC HS0HHH[]HHI9~)Hz t HHHH I9~ Hz tI91HHC1HHI9HkHHL9}Hz eHJHS0Hd4/f AWAVAUATUSH HHVHG G HLH$ K @= HW0fHDŽ$ H$ HU$ HG)$ H$ HdHDŽ$ DŽ$ H$ Ƅ$ )$ )$ ' HH H$ HBpH$ DŽ$ Ht Hx 1H HDH$ H$ H$ HAH$ H H$ L=T HD$H$ $ H$ HB5 <%! H$ DD$`%E H Y D$d HD$hH\$pHD$X ( L$ I@H$ H H$ = LIL$ ЉT$` <w5IcLD$dID$dL$ Ib * BЃ . H$ HnD$`߃Lh H$ uƄ$ H$ H$ H9 HHL$ H$ H IT$ AH3 I;D$( MdMg l$`xcv?M H! H$ L@^ D auSH, I9D$H|$h |$p L$dH$ L vnc ID$ 8 I|$1 1L=ƃ H|$h |$p H$ .% O G XMD$I@`H{ AX H A { D$dI$LT$pƃL; + H|$h X AdH=# EJcHf. D H|$hu |$p 1HT$XHt$`LD$t 8l ] Lt$XMO |$t A A~ 4 I^Hl$hH9}L$dHJ HcD$p/ L$d/ H$ L> L~ H$ H$ H |% HJH$ HHH$ H |% HJH$ HHH$ Htr|%~ HJH$ HHH$ HtI|%tYHJHH$ H$ Ht$<%t5HHH$ H$ HuH$ Ƅ$ f D H$ H$ H|$ƌ H$ HAH$ HzH$ H9$ ! $ X H$ H$ H $ HDŽ$ u%H;stHHc HHiHH H[]A\A]A^A_M HWHH$ HWH$ H$ 1H$ HdH$ 1H$ HUDŽ$ Ƅ$ H;HU1H$ H9$ H$ H|$Lr H|H$ dH$ H9$ N 믺 DT$d0 AI@DT$dH$ H BHBT$`H$ vL _ IcL~ L$dEAA07H QH CH54 L,H AMID$H;H HH@w HH5n 1"H$ H $ 1L$dH9D$`Pj aa AF AAAAAA EIv0|$t 1AbD$ + E11Dl$tDl$ HD$H9}H\$hH݀D$ DT$tI Em DH9~ E9DAC E, 9s4HD$1LDT$,L$(HL\$ L$(DT$,L\$ 9BEt H9 A99 MtH$ LE |$t e L$d LD$hI9F A u|$t + D$dm Ht+HL$E1ILH$ H$ H$ HD$hH9H)؋$ H$ H$ IH2 LH$ xH HHxxHHl$XD$t Lt$X7H$ $ HD$hH$ HHH$ HH$ `HD@ЉD$`H$ A ."1D$pH$ HHH$ H H$ H$ $ d`HD$`H$ * 0 D$pH$ HHH$ H H$ `HD$`A@H$ q/ A L$pD)A9k ADDT$d+ ALDT$d# A9DT$d A&DT$d- AL]PAIDT$dL$ I T HBT$`H$ }L IcLAIDT$dL$ IukAAAHt$TL辿HH.H= D$dD$dD$dD$dD$dH$ $ I)DH$ L@ H$ H\$hx LfB<%> H$ BDD$`%HH% H$ H$ H$ @aH$ H+$ L9 NLIBT$`L$ L] IcLA t)L$ H$ H$ $ H$ L$dHD$hʃH9LhD$`߃X0o?"HEDH9 HD$ H=H$ H$ Hg LL$8LT$01E1f<F%tSHHA H IIԋL$ H$ H$ $ H$ LL$8LT$0@tL$ EHD$0H$ <%L 1H$ BD1D$ + H|$HB1 E11<%t)HH A H HL$HHD$@Et HD$HH$ @DHD$@H$ 2H$ HLBH$ L$ (HH$ H$ H$ 3[D$`)uƃHBH$ H$ LHHy$ tH$ 1$ +rH$ HHH$ rH$ *L$ foG DŽ$ I@)$ H$ HH$ $ M BN D$`߃XoxD$d 1H$ Ht$`L[^ Q{LL$8LT$0HDŽ$ H$ cH$ HH?H@ HD$hHHD$hH H$ HHH$ HQH$ H$ $ UYHD$`H$ .D$`߃L>h0Ht1HH$ UpHy H W H W AE1E1DT$ L\$HcD$p1D$ Ht$b H$ oIcA HL$hHH)HIH9Hk ELbBaHPH*u H5V 1H81H u H5$c H8ԤAMLH H nzHHH t H;DH$ HH+H@ D$p |$p H$ HHH$ HOH$ H$ $ FWHD$`H$ Ht I@X H:HH5Bb 16Hu N1H$ ,nfHXu H5q H8y2D3 H/Off. fHHփ uE11H1tHE1Ij 1 Hf. AV1IA AUIչ Hg ATILULSHLL$ H\$H1%HH HHH H(t[Hu HHX .HH It$IULHH+ItIHteI,$tQHH[]A\A]A^HPHR0H@u HHX ɅHHuHCHP0MuID$LP0H.l1 D UHHHSLHH LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ H$( HD$HD$ D$0 HD$*C H $/ HD$HPH HT$HU H HtzHT$Ht H< HJHL$H H1HHH9~PHJHt=H1HHH9~;HJHt=HHL$HJH1H9~ H HJHt HHH1H9u H []ÐHt$H} P$H H9Ht҃/v)HD$HPH HT$HUH H,HH}H $H:Ht/v,HD$HPH HT$HUH H\PHHM$HHA1ɸ /v6Ht$H~H6H|$H| HH>H9$H| HH H9 H9f. USHHHH(Hu2H HDH;H5r 1H(H[]jHiHRE1L 1HD$Pj j 7H HHtH0HtZ1HtHxHt$Ht$uPE1LK 11HD$Pj j ~H HH0HuH5Dr f. HwEOuHkq H HH HPm H5a] H81Z D AWAVAUATIUSH(H_ HHG HvIl$IHH94HEIH= wzEHp HHHH|HH;Il$ HSHk H H{Lk H* Hm H{ _ H(H[]A\A]A^A_ D H H1H LHT$H< $HEAHHcHHHx $HT$ HhHpHH D%?G?I<tDvID$H;9HBHP0Hm ) HEHP0 _HH HG oILH t H$E1 H$HHt=ADMc%?LGHPHwHO 1H(kfff. USHOWHG_ H - H9GHP HHt6x y4H} t HH[]HeH H_C]C_1f AWH' - AVAUATIUSHH8H9GVH HiDhEI , Ld$E1HCxE1HD$ LHD$( IHH= LxM0 MNL HE E E1E @ HHS@{[L\$0Hu0DCZASMMMIIc _AXH MMMLd$IM HL)H Mz LH Hm t!HMl H8[]A\A]A^A_HUHD$HR0HD$LEHE HS@{[CZARIIML\$0ASM41H y= HkxHtL}MHD$(H|$ J HL$L9d$~XMu1IHX HT$LHIHA HL BLINHL$8c1L9|$HHT$ cH{x11HsxHT$HtcHCxHT$1H I9}Mu HHHL HbHyk LH W LHH*bH{xME1LcxHttbH 1H Hu)MMuHk H W H W XE1L 'bf D AWAVAUATUSH8H Hu1H8[]A\A]A^A_HEHH E Hu @lH}0Ll$ IH I 1HH H maL=.j ~C 1LLI fI:")D$ 街HHL-aH%a*H 1"IHH.H} HkE1E1Ll$ 1 Ht>@: L|$IL;u#HEJ<HG G Y@1HGHw0Ht$ HD$J9HrH>H:H|H|HzHH)HH)HHuLHPIA HILI9NH HthHtVHtDHt2Ht HtLVA LWNNINNINNINNINNINNIM9NI@NNTNTNTNTLTL@8LTLTLTLT LT LT(LT(LT0LT0M9c럋>:ttPtftAHT$LHL$+ qHL$HD$Ht$ eHE ILl$ 7f D H;wu1AVAUATUHSHHLgLw(Lo H0 LL)LmJ(I9 Hx|fH*M fI*Yi5 f/ MrH H{ LQHTfHnHkLkC ( 1H[]A\A]A^HHfHH H*XlIL9rHkHHC(( LAfHL H*X@HHHH HHLl3LHHSHH9HFHHs(HHD$H{ ZHD$f AUATUSHH9V3IIHӉL膂]Hu 1H[]A\A]I4$Hs#u8HtAE tD fAD HD HKLHID H묋AE D AD @ AUIATUHSHHXHII?H1LBHH A @ Hd HKH@ H@H HCHrfHnH HfH:"CHJMt'H{ Hu !HtH Ht'H(tHH[]A\A]HPHR0MuH[1ff. fAWAVAUATUSH8H H|$HD$IHxH;=d )M H b Hc LE1H 1]+ILR FHD$I\$Dx A u!HHLH5\ HD$Dx Et$ DEAAA@ Ml$0DIt$@Ht$@Hto= @LDT$/HHL$ Ht$H dHL$ DT$/H@ HT$tA DDH\$ ЈC H8L[]A\A]A^A_H a LHt @AqEA@M|$0H|$E1H 1IHLA AЀ v.MI)K4 @ BDLLICTЀ wN, LLA LAIE LLILiA vCLIIHȃtf D fCnLLIIAGf weL9D$ LXLL LI貙MHD$Dx 8LIE L߃IIu HjAD$ @~LsL-IH\P 6@$IW0b AL$ HH <@IL$0HHsAu/Ht1@2 LLM{WHD$` |12LLH1HzHH2HtHtH)HHH)HHHH1LHHqLI WH|$G D$G A.A0IEMl$H<LfL41La?H w v ATUSHF LfHHLgx LߴIHHPHEHMH H1HH2H HqHHrH HqHHrH HqHHrH Hq HHr H Hq(HHr(HttHq0HHr0HtbHq8HHr8HtPHq@HHr@H t>HqHHHrHH t,HqPHHrPH t H<HH<HH9uLCHKM, H4L1҃ HtrHt\HtFHt0HtH HH HHHH HHHH HHHH HHHH HHHH HHL9 HHzH HHHH HHH HHWHH HHWHH HHWHH HHWHH HHWHH HHWL9wMa[L]A\H H H[1]A\ @ H Ht$(HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ H $ HD$HD$ D$0 HD$H f. AWLcIAVAUATMULSL)LH(Au3tmH L&H H)HH([]A\A]A^A_HHIHLu*LA, wufHtPH)HIH볅ujAB Mr @I0A IKLHD HuHD$`H(H`I9tH)HIHEf D H X H9G@ AWAVAUATUSHHH Ho H( Lu M A L} I} m M Ol'MtIE @ ItvOl'MtIE @ ItUOl'(MtIE @/ It4A ILHIl(HtHE @ IM9uHH[]A\A]A^A_ϛ HH HuLH;Y H[]A\A]A^A_HH H H;X uI} <f. HIH9 A IE @ HH H H;X |H} 2l M*K'LjMtHIE @q HzHT$c t%HT$H53X HBH9pHx IO|'MoMt>IE @ I t IGH5W H9pHx IuLA Le`Mt?ID$ @ H}X t HEXH5~W H9peHx ZIHM9u HH H H;9W $I} I} W HH9 A RIEf HH HuzHV I9EI} gH,H9a A % IEFHH9} % HEH H9 A % b1L9HC(L$Mt L1 uHH V I9D$I|$ tHH Hu!HU I9EI} H4H9uDA % uHH Hu*HU I9D$mI|$ \LHH9u4A$ % uLHT$LHT$LL҅^JL҅ YHff. AUATAIU1SQI0 1I0 E HtHH[4HuHHuX[]A\A]ff. fAWAVAUIATUSH( P =p A}` uAED$A9E LpHcD$IUA}` HH@L$D$ L 3HD$H A PA =p A}` J A]7IHE1A}` A HL) PA =p UA}` bAEA;E' IUHcH: ; A A A]M LJA D$A}` AE{ L2HHt L"oH8D$A}` AE L1HH@A A H(H[]A\A]A^A_L7oIc}IUHH: ' LAEa1HHA GA I9c MgKA]A M=p AE`AEA;E IUHcH: LAE0HHA A]M|$GA KPA =p E]`E AEA;EIUHcH: LnIc}IUHH: QLmWIc}IUHH: LAE0HHA A]GA KI%LLHT$K,?H HHHT$A IA]JIA 1҃A]`EIu LKHH1M~ I4HUH4HcI9LQA LLlA}` AuI}D HHHt$LHX D` Mu ݥHHAPEAؾ AVT$L$ AYAZHHDHcD$IUHH@L$D$ nkf D AUATUSHHH wJHO H51$ H=e HcHHl1HE H| HH[]A\A]ÐII tjII<IHH`HHtl?A?XD` MtDm 1HH5# H= C|HH[]A\A]ÿ HHt ] AWAVAUATIHHUSHH L9Q Ll$`HLAd j>ML; AZA[tP$ % O3w*H HHuDH H ID$Hp AH D[]A\A]A^A_f. fD$< H$ )D$@)D$PDL$lE9T$pcGH 4H H,L$h+ H|$xXt n ]HD$ E1E1LH$ Hj ) ZYgL$ MVAG IO z@AW0-S H)E11HD$ HL$Ld$@$ nLL$(T$$L$ | T$$LL$(r HD$<L$ HPLAUATj HD$(Ht$0LD L H HHT$<9S HH譽H1MH郼$ XLLHPATD$xPLL$8 H AMt I/ H|$@Ht H/ H|$HHt H/ Ht$XH=hx x ~ D HCH+C H9IH1MH郼$ XLLHPATD$xPLL$8% H A^H"L I9D$ H L1ɺ []A\A]A^A_IGLP0,HGP04HGP0<$ uHHK I9D$u:HLAE111LH$ ,u1H|$,{HD$ E1HcH)HL$H HL[]A\A]A^A_鏟 L HHHLH HAAEv HHGH HO(H~HHHFF HF 1HF(F$ u-HF0 HF8 t-f1F@HG0 D HFHF8 HF0uHFHF8HJ H~1HH1HFN HF qHO g @ Ho0f. AW1AVAUATUSHH8舗HT$(Ll$Hl$ D Ld$( D E1LHLHS HI H9T$tL|$ IG tAG @AG0_u LHT$Q _yAHT$LHWs1HD$( A LHE1LHLHS HH H9T$tL|$ IG tAG @ @AG0_rH5g LHT$螣HT$nAQH8[]A\A]A^A_ff. AVAUATUHSH HL-G H I]0IHtE1L H>H}H I9 L%p I< HsHEHX(HSH9uB 1H59 H1] H@ E1H L H =I H q0 H!1H[8Hx8Hx0Ht1Hp0=HHu1H q0 B LuM;u0uqH=*E H= $- H=%- M;u0uGH=m0 苚 H=4l0 H=h0 s H=|j0 g HGI HG@ I HuI Ht1I *=H HM;u0uH Hf H9uLɹ M;u0uH=tr0 Ht1Hfr0 <Lѹ H=zo0 H~H=ro0 H[M;u0uBH=tz4 蟙 M;u0u0H=u4 荙 M;u0u H=0f0 { M;u0u H=^p0 i I`# 1H L M;u0t H{0Ht 1HC05<H8H; u1Kr0 M;u0 i H-=/ H| c HsM;u0uH r0 HtsE1Hl$Ht$Ld$Ld$#fHD$P уTH P E1LHH OuHH=q0 Ht1H-q0 x;L谷 A HI A uL mI( Ht1I( ãM;u0u E1L #q0 I 11E1I I E E1E1I M E I; }H<Ht :I H1HI I I {1I HH8s H9uI I HHPT L9uI HtH_7H11I A H []A\A]A^ff. SHH(C @t H][HCHH9uH{8Ht071HC8HC0[Ht>f. ATUSHHt1H E17HLCHt H/I 1HHC @ LcHC I|$A$ ID$ Ht H/ ID$ I\$AD$ H{HC Ht H/ HC I\$0AD$0 H{HC Ht H/ HC I\$HAD$H H{HC HtH/tCHC I\$`H9t^H{ HC HH/HGP0HGP0HGP0JHGP0oHGP0 []A\HGP0f D AW1 AVIAUIATIUSH H$ Hl$0H HHBHI} 1Hf C HB]I}1H\:C H]kI^ H$ L$ ML$LT$@H$HD$0HD$M9 IM M|$ Mx I' H$LMLLLL$< LL$H LI IH$ tHH|$8 tHH L[]A\A]A^A_H H$ L$ IML$LT$@H$HD$0HD$M9+L轜 IoHD$IL1H)OHLL$HD$LX H\$Ld$LMMHl$LIM)M~5H$E1HLL]< HtLLHHIIIMLLLt$LHl$H\$M9y I H$LLL $L\$D(DsL $H{HD$HD$L1D dIHH@ H $LHT$HL)L|$HD H<$HxI-H$DH)$sHD HxH$LLLLL$ $s; IHHt$1H)ȪHULL$L` Hl$M,$MH $K HD$MH+LLIrHt HLLL)L`IIM)MMMLLt$LLHl$H $CLT$IH H$LLLLL$ $: IHLL$LT$HL)IJLT$ HIH9QI1J4 ©IHLLL$H\$LL` Ll$ Hl$OLHL)HLLHl$H\$|4$HLHL$ oqHL$ HtHI9HLLL)LxHt$LII}~IHTHLH$2L $I2H$ L$ ML$LT$@H$HD$0HD$M9JMbfL IMM9~MYHL)HIL9L1L\$ILT$L $LTIHLT$L\$H@ M|$ L $IIJ[ HHt$LMBHBM9 CL, HHt$IHLLH$MLLLLL$h7 IHLL$LT$HL)LLT$(HL)IH9 I1L\$ J4 xIHLL$L` Hl$Hl$ H\$ KH\$(HD$LL$M)H H$E1LLLLL$({7 LL$(HH ILI9 LN<(Ht$HIHH$E1LLLL\$ LL$ 7 HHD$Ht$1裦IH-H@ HL$LHT$HH\$H\$ HHt$LIHIH LH$E1LL)L6 H ILHt$LHILLLHl$H\$ Ht$HMI 1MLHMK4 LLHL)ZH|$HAF IBM9}Ct, I@17@qH1MLHIK4 HH\$}H\$s @ UHSHH=zH0 {HH5 7 =_H0 mHH 1 =BH0 1HlHH[]fAUIATIUSHHH HFHH$IH9 H HDnHH IH=H0 1H11HH |H=G0 xWHH[]A\A]f. HFHeH9u&Ht1Mt,LHzHHu1LHHH zHHHH @ AVAUATIUHSHg HMIƅL-F0 M= IEHH9 IELHHH!IUHHtL;` H@H HG0 HH=F0 H9 !mHH H+HLLLs2HaF0 HH9OF0 HPF0 rL1H[]A\A]A^ H H\nH F0 H+LpH(H*H9F0 HF0 sHE0 LLH/ HHKAWAVAUATUSHL%5 L5tE0 I$H AF ! A$T xHH@8HXANH M$PU + AF fH[0fAF H {E Hk Hc HE H9C8 H^0 9B~H@s8HM<H Mo ) fHmpfnf8=fA~GHt4HE t'} y!HD0 HHPH+ H@IG AFHfAN$ @ f In ACB xV4 Di+ HcHL} IOHAxHgH$LAH H$HEH1H1IIHHAuAF LH1H| IHC0 HPHtHXHH[]A\A]A^A_ANH=C0 HcHk HiHC0 HHHL1H=mC0 HyPH C0 HE H=?C0 1H Io H[0H. ;BHk ! HHHHff. HA2 HH t T u1ÐHGHH9u5HGHHHH!HWHHtH;puH@H Hu1QHtH@Z1Zf S1HH0 Ht>H a4 11H(5 HpH; . H55 HQHp Ha4 HPHx(uH[Hx uHHD$HD$ff. HOLOHA(L@@(uHuHQ0LAHA0LHHAHz Hz ff. fH UH- SHHHG H?H9 H kH=`A0 1HH=#A0 HtQHv HHtAH H)$A0 HA0 H^A0 H9u jH= A0 qu,H[]HHH=@0 qtqff. AWH7AVAUATIUSHHHG H9 IIHCHSHL!H,L, H1 L9u HC(H HuH9q I9upHE IIE HLeH+SHHH fH*HCH fH*^ Zf/ HL[]A\A]A^A_Lm M M9u HC(H IuH9uwI9uIE MHE LMgH+SHHH`HfHH HCH*XHOHfHH H*X:E1LLЅM} MtLM9wu^HC(Hj IwH9uAL9uEIUHIVH菜 LЅHE LkLЅuILHlI 1H9 H(H<$Ht$Ht>H- HT$H Hz >Ht6H(t1H(HPHR0H- H HHa Ńff. ATUSH0<H HPH H D$IHjHB WHH $HD$HʼnT$Hl$ HD$H9L ;\$}; $D$H0[]A\ff. U1H SHHH5 HILD$t/H$Ht$HӃtH+- H H[]øHt1f. USHQHC H9Cs H4 9k~9CZ[]ÅHqff. @ HWH @ @ v>Jσ?@ pp u*# @ @ w t։pp0 LNHrHHH HpH9sEz x?HrHpH9s2z x,HrHpH9s z xHHPHH9t H> y 1Jf 7Hr1DHEA?AD A@u@ @ ff. @ AUHW ATUHSHHHG H9 LfID$xHHIHCHSHL!L$M M;l$ugHC(H It$H9uBHH|Hu4HL[]A\A]f D HIf D HЅu M$$M M;l$u3HC(H It$H9uVH_HVHtM$$Mt>M9l$uHC(HV It$H9uH*Hu HЅ@E16f ff. Hff. QHNHEZff. AWAVAUATUSHH<$HT$ HHE1$Im H+ I/ IHEH IH H5 HHH HHH@ HLsLk D$ IIE H<$LLoI.LIFLP0=IGLP0MHCHP04IELP0&HHH H[]A\A]A^A_fWf;VF f9G f N9OHN H9O wt|N 9O fHNH9OXtRV,9W,GHN$H9O$9t30 DDD9DL L9 H 9| D AVIAUIATUSHHoL%& HI$d SHH HI$ e H3HHH& H9EuTH% H9E0uG11LL>IMtPH+tHL[]A\A]A^HCHP0HL[]A\A]A^HE LLH胔 HI8 H& H8藼tNLHLP Iff. ff. HH$ H9G~LGHcL9u HÃHL H HEH?" H5 H811fH(H<$Ht$HtDH?% HT$H Hy 讉HH(t1H(HPHR01H$ H H` oHP @ U1H SHHH5 HILD$HUHX H HOL HHH LH5I@L I9tM9tyHtpI@L I9tM9t^HtUI L I9tM9tDHt;I@L I9tM9t)LAHt JDH H9tL9t IsHH H9t5H5nH9yH HtH H9t H9tW H9H$Ht$H9u 1H1x H $ H H[]HӅy4/ SHH H" H9FuMHVHtCHL$HHHtH|$ tH" H H [H! H HHt$HHOHt$ff. fHHFHwHFpHt H HtH7 H9u.HGHHFhHt H8 H=? HZHGff. H;=" tkSHWHB`Ht=H t3H" HH0HHt H [UHt1[H HRH5 H81`1 f D k4 ff. AUHH AATHm USHHw HHPHH w$Hm! HHHDH H[]A\A]E1HxIH1AăH uHcHyHvEu*HhHPH?H JuHA AIc HAWIHAV1fEAUIATUSHH L%a! HD$H|$5Hl$(HO|OO: HD$01HT$8, fD$`HD$0Ld$ Ld$(H$)D$@)D$P(eH4$1HL$ HT$ILD$a H` H|$ L9 H# L@ HGH@`H* H 1IH H|$(L9X Ld$Ll$IT$H HO H HC HѱH9 ID$H, Il$ fLd$8I$Hl$0HD$@HD$H HT$PHD$x D$XD$hM95 M> LL)H9c J<H/ AU H H8 H Dm H)D\L@H J MDHE8 I MA IL D8uMpI MA IL D8uMpItyMA IL A8uMpItZMA IL A8a It;HD$A A BL LHH D8; IM9uHD$ @ Hx1LE1F8 ; BL;IILɀuIIL9}I-LT$Ht"H~HH% LT$HI Mt:H|$8Ht0HGH Ht H@H HD$8 H/ LHĈ []A\A]A^A_E1WMpjJ ?D:)uItPFL?D8M BL;IILɀ"M ALT$U H LT$IM3M+LT$1H4$LLT$t HHHl$0HD$@=HH9 Ho0 HGP0HB`H H LT$1LLT$Hq H= s D$(E1 I5HD$A BD B8 u3IM9uMpMpM)I}` HD$M9H4$H<$H<$- LT$IMHt$LT$\LT$HcH/u LHBA IHHLT$m LT$I@Mx$Mx MMM MLHM LHH H LH0GHH H5 H8GGff. fATH IUH)HiISIIщIH BLHIxHI 8HHDH CLHHI Ix8HDHt}CLHHI Ix8HDHt_CLHHI Ix8HDHtACL HI Ip8HDHt!A 1IHIM 8HDHu @ Hx I :tHu4H[]A\H I4+A<)@8<t3HudH)HyALLHHuL)HxHLHtL4C8tuLHtA<1@8<1uHuzALLHHu{YAWLYAVAUATUHHSHH)HDT JD Mu A LbLHA8MEItwKMIL LrA8MDItYKIL A8A It@HD$LjL4A LLHALHH D8MDIsHD$f D LH LD$E1E1F8(t:BL(IILuYMlI9~EHLE[L]A\A]A^A_M JL- D;D89t+BL(IIIL MALDIL9It1D{F8|-uIt A F;F89u IM9M9uEt6Ml DHHxME1LbE10HL$II9,MefSLFHI uw RF HVH u@t+H0;[闖u7HSH@:HHHVH~ [[HSH@q:ff. ATIUHSH=y&0 YHH5 =^&0 KLHH =@&0 1HJH[]A\fSIHHH\$HL$Lʃu@AB @tfA@ @t_Ht>H9|OH~8H ]A IHxH[ÃumI[d+ HH[A~HHt HHyHHcAH/u AuH~A Ik I[g( ff. HWHHHHHe AVHHAUATUSHTHxHҍZHDDDDDDDH9D HHcHH)H CHCHH= w*HP HcHHDH H[]A\A]A^ HxoIE1I twHH<HEAHHcHlHoEutHXHpHH ?PA?H<D)tn|HII t'A 뉿 flHtmH@ XI E1DlHtFAԉMc?L`PMHpHH xHE HH HH *ff. @ H H . - ff. fAWAVAUATUHSH(HF ~ HDGE D{EcHp, H9CmH H5 x H{0 HE {\ Le H{P {X ~ HChE1ɀ{Y AHE1E @e LmL;kW HO H ' H9H9uH H9) HE Cp HE Hr L HCM H IT H9 HJ I9F uHE HPHU IVHrI;V Z I~H,IvHE H IL L;k E H HC8Hx ID$LH= w*AH McIIDH H([]A\A]A^A_E1M HH b HH<HEAHEAMcLqiH E3 L`?PHt?H<h wX oHED$HDL$P0LmDL$D$iHED$HDL$P0H D$DL$LDD$ H$DL$ݮ7IFH$DL$DD$ H,Hm tH xHA D$HHIDL$DL$D$Cp HIm b H L9tHE LmA AMc1HǝIHL H賽LAhE0 ; H{0 1H 1H D$DL$/H ~ HPDL$D$fH:"H H PHD$Ht$1H H H <HH IHDD$舣a DD$E HC Ht$1H HD$H) H ;HH DHD$DL$ DL$H D$H v1A L HbHuTE1ɀ{Y AE1{X t.HMA 1H DL$*E1DL$HAHChH0;{\ t LCPME1ɀ{Y AE1{X AIED$LDL$P0D$DL$}HHM H5 H= $ 1[ kf AWAVIAUIATUHSHHHGHVHH`Hr`H Ly(H9uDML%T 1HL$ D HLLAL9 H[]A\A]A^A_ @ HtH~(H|$I9tM H|$ HX H: HQH} H;A8 Ht;H;A ( Ht+H;A( Ht H;D HH9ufHLLAL%} L9AL/L%c L%W LH|$ t%L%; HD$HLLL9}L|$E1HCH@`Ht H@(H9D$I9u HcIFH; L@IEHHH H8uRHH5 1u1{H HH9uHD$HLLL% L9FHCHH5 LH11! @ AWAVAUATUSH HGHD$P HFI HBHHHHt$` _ H; HD$X H~ L= HFD$ Ih H EtLhH A A, HHHL$HL$HHD$PHBIh HD$P Ll$XM E1A@ l$=E1H)^ H|$`H/C H|$XH M9H|$PH H H[]A\A]A^A_f. HHH HIh tmA A A A A A?t A A EE9sALl$HILL$D]Ip LL$Ih HL$P0AHL$LL$nH IlLl$H˽ ILL$ @ HH]HD$PIH Ht H+ HD$P Ld$XM D} LLHD$PHH? Im HD$P MuxLl$LL$L>HT$PLHJ HE1Ll$PLd$Pt L, @ HCHP0DLLL$Ll$LH IELP0[HGP0HAHP0Ll$H˽ ILL$Ll$H˽ ILL$Ll$H˽ ILL$u~Ih HHL$HHL$HHD$PH$HHL$Ll$X1HL$HD$PM |$ Ll$H˽ ILL$ |$ E1Ih Ip HL$Ih P0Ll$X1HL$HT$PMUHT$PLHHL$I HL$fHHL$1H\$PHL$HD$PLl$H˽ ILL$WHT$Ht$H|$H|$HT$Ht$Hp H|$H@`P(H HHHL$lHL$HHD$PHHt H)HL$1HD$PM |$ HyHHz HT$X[ D$ Ld$XI|$ Iy HAHI;D$LL$`L=g IAIh Ho|$ Bu HT$PLLG 2LP1Ll$PHD$PDLLPHD$PHHM5;A|$7H E1HH HH ZLp I HI LLHL$LL$|( HL$HHD$PHBH|$E1H|$`Hl$`LT$Pu H|$` HL$L=5 LIILd$(IH Ih Ih HD$HD$pIH HD$ HI$ HL$ HT$hHLOFY LLd$hHD$pHt$LHD$LIMHLLIMoHIH\$Ld$Hl$H} fH|$Ld$(Lt$vHnIh Lv HL$HHL$GH|$H\$P81HH|$PfHT$PLHHL$DE HL$HL$H1|$ H\$PHL$HD$PNHT$PLHHL$D HL$AHL$HLMmLL7HHHHL$pHL$LL$HL$HHD$PIHl$X1LL$H\$PHtFHT$PHHHL$_D HL$ULHL$E1Ll$PLL$L\$PHL$HD$pLL$Ld$PIHD$(HHD$ E1H;LLSHD$PHHGE1HCLL$PHt3LHHD$ C H|$ HD$PE1LD$PHCHD$HD$HHuLL$LMt LLL$ Lt$@LL$ HL$IALt$PE1Ih IHp1AH ADHt$8HD$ D$4HL$LL$@#AA Hl$ HD$ H D$4L$ EA uHHHD$PIH HtH1HD$PMHLLB sL[1H\$PHD$PmDE1AA H߉E)HH|$HAH|$HHHD$PI Ht1H|$PM HLLB L1H|$PHt$PAuHHHtpHD$PIHtWHtH1HL$PMt*HLLA Lj1L|$PHT$PLEE1mHL$JHL$H= LDE1ED$E)Ld$PHIHH|$ H|$ HHD$PH+ Ht1HD$PHLHH@ HE1H|$PL\$PAuD$HL|$HHtpHL$HHD$PInHt HWHL$E1LT$PHtAHT$PHLHL$`@ HL$LHL$E1Ld$PHL$LL$PLIEvLE1|$ XLd$(1II<HH9l$L1HL$HLHt$8HL$LL$@HzAWAVAUATUSHHLwM I HcHIL IED$4H H@( LHD$(-f L=^ M I| HH HLt`HHI9~ LLK"y>ID$4 tC) Le L L'HH[]A\A]A^A_ø :D$4 H5m L!yHHH= []A\A]A^A_} HWHFHt#OHt+vHx6Hx-19f D Htv1 @ Hx1111 AUATUHSQ H-IHv LLX L|HHt1HSHxHCH9,u HH螘 Z[]A\A]~H1^HHHLLtAHTfH H@ H H tH HH|$ H|$H H:H Hff. @ HGHtBHWH;P}%HJHOD HQ HHH H 1RHOHi1^1fH 1B0 ff. USHH9wr5HG HWH)H~%WHOu@@,HC HHC 1H[]É HiSHKHC tu f,AH뽉,HHHt$ ?9T$ u~ HH upH| = R= w+x0H H)H- H H H @ HG H HHkPH H H H5s H8$.H ;_ ff. @ AUATUHHSH8HVHB`HtbH tX$HHH H9C# HH|k H+t H8[]A\A]IIT$HD$LR0HD$H; 1HL$ HT$Ht$LD$(Ht$ Ht$(Hu(K H} Ht$(IHH|$(Ht 1HL$(Ht$H襐 IHtH|$Ht 1HT$Ht$ Hv HHJH|$ Ht 1HD$ H}LHLB3 HH, HIaMtLHAj I,$S2 H AVAUATIUSH@AHcHI[ LIkD$LD$4HD$(_RI|$ ~}L5eX @ HI;l$}eH~ LL ID$H<zHHHLH+uHCHHP0I9l$] LD$4 >_L讈 Lf!H@[]A\A]A^H=o Mff. fHHH;x(}HWHPHx Hxt D 1 D HH1ú H HATIHUHHSH_H9dHH HIIH H@HUH HuH<H HL"H9 HHHHH HfHnHHHL HHHtZHtHHt;Ht.Ht!HtHt HHHHHHHHI9t(HAAAAAAAI9u@t HHHIX[L]A\L 1NH L!H HH L9rH1LI9HBH H9sHH)Hv H H1HL H HteHtSHtAHt/Ht Ht H HH0H1HH0H1HH0H1HH0H1HH0H1HH0H1HL9H0H~H1HT0HT1HT0HT1HT8Hw8HT9HT8HT9HT8 HT9 HT8(HT9(HT80HT90L9uH1HHHHo HH9uHHHHH@]H HR[1]A\鿠1鸠 AWAVAUATUSAQHIHHMMF|5 6 f D IDD)~ZHCH;CsCHPHS Im tEE uHM6E L9t(L)LI,$Z[]A\A]A^A_Hf(uL1 AUIUHH(HG t; NHGHG G th@t^HG0H(]A]1LH|$HL$LD$BH|$pLD$HL$I@IE I E HuHGHHGHff. fAVAUATUHSHH?HL- M@ H# HIHGIHrH9uTAF PAV HE(H@H IT$HuI<$HKI@ B H[]A\A]A^ D HX HtmHJH~CH;BtHt7H;B tHt+H;B(uHt H;D_HH9ufHLD$ӫ LD$:1uHH HH9H5R1 LLD$ LD$u躁 HHtHH` H5: H81|H1 AWIAVIAUATILUSHH MMb IHH*Ia IH謭IHfHȉIm IY H Is A IIp H;Ld$@Lx 1LHH{H?H<1HLL$8"H$ HH0 Lt$hHL$HHT$Ht$MHD$h H$ pH T$KHLL$ MHL$I9INM Ht$|$fnHDŽ$ HD$HI9Hcf:"INIfք$ LHIHLD$PHT$XHE H$ HsXHl$`H$ LD$@V Lb HHP H@ Hx` 3 HLL* H|$h H H|$`HtH/t|H$ HtH=e HDŽ$ fH$ H=@ )$ R H H[]A\A]A^A_IE1A HGP0xHD$IELP0LL$I[H' H5 H8H$ #1H|$h H$ 1TL~ Lu&k HH H@ Hx` x HMVLA 1L% LHD$(Pj jH IHwH(I>MqH|$h1s}H? H5h H8ILL$LL$HIHLL$LI\ILL$myf AWAAVAUATUHSHH8HGL D H$H H HL)H7 N,7IF8LH IE0AE, E}(} AA a% H H5 HD$E LM$ A9 UAH| HcH HCHKH9.L9^ APL*| H=#d H5|D HAHAABDGHfD_ I9s?AHHABAADGHfD_ 1 E1H MU0HHRAE,H I D H8L[]A\A]A^A_ @ H$I9sA A;uAIA uDLL$ LD$^LD$LL$ t'1L9CcAA AAHL$IHf D H L- N4OIcD LL9C HCHL)H I9|f D L;ClAx \L;CRA8 CHCHKH9L9% A@<z_H <_ I9&AzH _ 1#HCHKH9L9A@<zH <_ I9uAzaHc _ 9?HCL{L9 L9LL$ LD$!LD$LL$ HAHJf_ M9ALL$ LD$y!LD$LL$ H AHf_ Ѓ1 HCL{L9L9LL$ LD$#!LD$LL$ HAH,Jf_ ŃM9LL$ LD$ LD$LL$ H AHf_ Ѓ9HCLSL9L9!! Ap j M9 A0A H 1D9 AALH+SE1H9LH)H HH MMH)ME H7L IiLH H 8IMu0IImIE(f Ict 9}J9j H ALA LL$ LD$LD$LL$ f. H IEHcHLPLH HQEZH HIU H)L9 EZL9| A L9@ ~ Hf~fAE MH/ H IGH@HH H H3HPIH)H HwMOMG H71 L HoH@IH AG(IH Mu0IImAE(AE, f D LL$LD$IEHgH LL$H H@ L LHLD$HPH H LL)MMME H7 H LH8LH AIHGAE(IG, G(ALw0MI,$ H$AQE1L)H9%LAQIq HLD$LL$̜ HtLL$H LD$AQN 7IIMH9AA<+ L9C! A{( t LH MA @ A}(t LH A Z H$I9<A0IyLD$ LL$ LL$LD$ AAII,A vE HL$LM$H $AQE1L)H9ZL 1LIU AA<w~ H H f~fAEt MAA H LILMH)LE H7H HH8L,H AIIEE(AE, AE(AMU0I,~ H f~fAEt A)t/AAc H$I9sA A9AU M A)uH H R AEE1HHH)H + AAI,A jH IEHLPHLH H ERHyHI} H)L9{ ~ Hxf~H fAEHt H)MMME H7k H L@(L,LLH 8Mu0IMMAE(AE, H$I9A8LL$ LD$} LL$ LD$A9hAIA :AALH+SH95 H L~ H)HHH+ f~H fAEtHxDHH, H9 H H H HHHH H L MMME L)H7 L IiLH H 8MMu0MImIE(TH$I9_A0A9LD$ LL$0 LL$LD$ 7AIA U1LMIE AAI9E . 1AILHI9M | L9 ~ H H f~fAE fInfI:"AEL H L)MH7$Hh Ii LL H 8ImIE(MU0BH$I9A0w H 40IyLD$ LL$ LL$LD$ AAII,A mH$I9A8LD$ LL$J{ LL$Iy躚 LL$LD$ AAII,A H$I9 AIA >AHL$IHH$I9A0A9LD$ LL$ LL$LD$ 'AIA 0A9 H HcЃHHHHH9@@UHLH9< H $I9 A8HIH$I9AIqHLD$ LL$ LL$LD$ aAAII,A NH$I9A w H A9AIA 9AALH9$qLAQIq HLD$ LL$蕔 IHL LD$ LL$MIIE AAL9 AI,} u L9C AA {H H LMMH)ME H7L IiLH! H 8IMu0IImIE(A9 H HcЃAHH4HD% HH9@@3 H* AAHL$I HH$I9A8 AIA MA9 H HcȃHL<H,MI9HDd$Lt$(MH\$ LL9 H$H9 ;sw } Agw D9 HH @ MNMF H M ANMH ICH IH IHIAIH9 H LIMKH)MC H7 HB8L H AIIIEAC(AE, AE(AMU0I, IFHTInMF HPH HHH Ma AFM ICI3H ICHVHH LH@H)IH IkMC H7 H HH8L,LH AC(ImAE(AE, MU0LIvH=P HFH _ H MV0HQAF,H I D IIFIV H H ItMV0AF,HHQH ItMNIn H M AFMH ICH+Iq HLT$H LL$Q IHLT$L LL$MH LEIE H LMNMF H M} H H A AoFINH fI:H Mm H IFH L MH I~HHG@t I9pL9OfH LMH)HH ICH@HH HLhICL MHPACH L)H77H ICIH 8LHhAC(AE, MU0H AE(ImIFHLIV HHH HHH MIIvHHHMV IFAMF MH,A E H MMHL$LMHH M&IV MNMF H MH AFMHt'x#HHH)HH4H H) ICMMH AAI,A E H LMHL$$MNMF H MAFMH` ICIMMH H I+IAIH9|'H<$I9sA0A;s HIIH9}H E1PH MSIFIV M8 ALMH,A m:MNIF MANM IMMNMF M IM @ IV8H9vHIF;HIHM8 LpH:L N,0LH 8H IE0AE, E}(. D I981H5&, H=K Lc E g EHl H HcɍrH 9yHcH E1ۃL 9]HcHH E1҃LH99L9C~ H H f~fACtd A1MA<FMAACH H AF HHHH)hHcHH9^ H H HH$ oH H HH)H H] H M&H$L)H9 @ AFDHHH)3 H H LMMH)ME H7 H L@(L,IiLH 8Mu0IImAE(AE, AHH, H H)H9 HH HHH IH THHAFMH ICMMH A)H$I9A0Iy LD$LL$^ LL$LD$HMMME H7[ H LHP@(L,H 8LHjMu0IAE(H AE, ImMML)H HHH)H HHH H)H H MMHcHH)H4H E1L9CjH E1H9H LMKH)MC H72H Lo8 HLL$A LL$XHL, H H)L9H HH LMHL H (Iq HLD$LL$Z HLL$L AQMH9LD$IE LIH9E KACE1AHcHH)H @ISHMIH AAI,A E H LMMHL$H8 HLL$~ !LL$H H I LN,78 HHT$(LT$ L\$LL$~ LcELT$ LL$L\$HT$(H H LItN H8L,H AIIEAC(AE, AE(AMU0I,E1L9Cr8 HHL$~ LcEH HL$J7IwoHHLL$LD$} LcELD$LL$H H IfN,7]HHL\$ LL$LD$t} LcEbLD$LL$L\$ H IBH N 7ACE1 HHH)H 7HH, HH)H9H HH HHH LAQI,AA 8 HHT$LL$| LcEyH LL$HT$J7I]UM&AAAI,A ~HH, H H+ H9rSH H H HHHH HHcHH)H4H HHLL$LD${ LcELD$LL$H IxN,7oHHLL$LD$h{ LcEVLD$LL$H I'N,7 HAFHE1HHH)MMH ME L L)MH7EH Ii LL H 8ImIE(MU0iH0AFD 1A8 iDd$H\$ BDd$IMH\$ Lt$(AA hHcHH9nH HH HHH H H HHcHH)H4H A}( 5H8MMME H7;H L`H H HLL$LD$|y LcEjLD$LL$H H IN<78 HHT$3y HT$H H LIiN<7IOHiH8L,H AG(H Mu0IImAE(AE, }]6N@_ D.E1&HHcHH)H4H yAF7HHH)HH4H H) 8 HHL$ LT$L\$x LcELT$L\$HL$ H H IN LD$iLD$&!@_ 18 HLL$HT$\w LcEJH HT$LL$J7ILtT^A9 XHcH HH,L<HL9-M$Dd$ILMH\$ LM9mH$H9G; A?D$( 9D$((IHA9 H HcЃHH4HH9HHH9H$I9tA w H e w H=R 9EHIff. ATUSH :H HH[]A\f D HFHHIHt HHHE HMIt$I<$Hh(ID$ Mc$ H)H HCHAHCHID$HC H)I HCPH{XH{ Ic$ H I$ H8H L@M II)LK`MI)LKhI9(H HW HxH/ L@M" II)LKpMI)LKxI9 H H Hx H H@(H II)L II)L H9 H~`Hɸ HH9 M$ I|H MM II)LLXMI)LL`I9/HH9uIc$ AoL$xHHC@K0 H[]A\ Ic$ AoT$xHHC@S0fvCpfvC`HtfvCpH~fv fvC`jfvDXUHIHCPHHIHCXHjHMc$ LY I9|RI$ HDHt@H<Ht7H)HIIHH)LLXHIHD`I9 HL9ufvDXfUSHHHWHoH HOHBHH HHBHG HgHHtHC H/t;H{ HvH{(HtHC( H/t H@ Hm tH[]HGP0HGP0HEHH@0Z[]HHu또SHHHt 1HK8H{ HuH{(Ht 1HC(1[1HS f. HX HJH2HB tHp HtH;puHHB tHp HtH;ptHA JD tHp HtH;ptIL9 @ AUATIUHSHL*I}FH HPHH HA HB8HH H%H9 H AH@ HC0@0H1HE1n1HLHތH+t H[]A\A]HSHD$HR0HD$H Hu<HHSHI ILHE1HރL!HIULHHuFHHXH H e1LHH1HHL =ff. AW1AVAUIATUSH HT$0HT$(HHD$8HIuH HkLd$@L-LD$tHt$h{ v%1A L|$(HD$8HD$0HD$HD$8HD$ H5. LjHIHVHL}NI. 9H+HD$0 Hm A HD$( HT$Ht$E1LL& H\$0Hl$(HHE Eu H5 LHRIHHLMI.IND$ LQ0D$ HEHE1P0ZHCHP01IND$ LQ0D$ } LD$t #&LPM LHĈ []A\A]A^A_L.M HĈ H=2 []A\A]A^A_vAVAUATIUSH^H@HnHK H H' L+M H H I}HH^ BHH H@H H HzIMH9ujL;-q HL8{HHtZHs HHͯHHE L;%D , H@H[]A\A]A^HHLHDHfIE !H@`H LR HHu3LsM^ IF NLHt$IHHfH;D$H Ml1IE YLLjHsH ZH- LH0"vHH4 Hd H+H]LHA$0 IHtH@ HKHHu HEID$HL;11=$HLjIPHE1L 1HHD$(Pj jH HHMtLIHKHA Ht$H蘺HHHD$H;D$6HT$MIEH M8HHHff. H HH9WuHHwH >#ff. H AWAVAUATUSHQHoH] HW AE1E1L * HHI@ < , M<LG<HHHIHHxL9{ Et M A' M ہIH@ i@jI@0 bHPDpH H D HHB H5 fDHHLA JHGH9tFHD8) <\! < u < < H^wHHH9uD2ZL[]A\A]A^A_ M<LG<HHHI9HBLB< wy M<LG<HHHI9IPHL9< v<\ $<"[ <' I<_LBHHHi<\tlU<"= <'e I<_LBHHHj<\Y <"U <'] I<_LBHHHI HfI Hfo Hf\I A" MgHL)H97LA' CA' 3\HGI II I9I II I A |A lff. @ SHHHHt 1HCHȨH[0ff. @ H N p Sff. @ HGH HF HGHHHv ^ HNHqHwRHыOHH1Hܙ ff. HGff. ATUHSHGHH@`Ht?H Hup L%l L9t9[]A\L%Y L9uL輧L%C p HHL9uL薧HuH{H O []A\h ff. SHHHGHPPHuFH;5̰ uTH HH;k HHH H[HJHgHH[ef H ff. H$HWHB`HH@@H H H9u H x H; u HH D f D Á ; ff. H H9Gu HH GfT{ NLff. H xbfUSHHH9H.H^ HHH= H9tH[]ޥHsH}Hf X[]g H f /Pff. @ FQPH HcHDHHHfZ D HG HF HHHT$m] H7Hӭ fHp@H@ HRH HPHyfHnH H7fH:"@~D$fH:"$Hq@HH: H D USHHG G @ Ho H_0H Hu!Ht H Hk0H# H ,Ht.1HvHHtHP HHHH[]Hì Hh# Hh# H 1[] H_HHp72fSH HGH Ht$H9u6HD$GHPH9 HYL$IH [ D HX Hb HJH~/H9ZtHt#H9Z tHtH9Z(tH v f.y z HD$HPH9eHX H HQH~KH9YBHt;H9Y 2Ht+H9Y("Ht H9\ HH9ufHt$H|$$| $xFYD$xHH [þ H9\HH9u H9H HuHD$H H .7H1HH HH9<SIH LOH ͨ Ht$I9u4A@ D LD$IxH9uVAHXL$GH [HLtuA t_L f.w zu}6Ht1H<uHt$H|$$4 $yHD$XD$)GH H r USHHH?HG t6H? f.gw E zt 1H[]5Ht1HH: H @ H(HHG HWHBHwGfHH*H(Ht$ v f.zwH|$H H(H H5D L$H8~L$f(fATHHUSHHsH HHHHH/u_L%2 H}H >Hi HHw HHtvL;% u%H HHnHH[]A\LgLHBHHAPA Lj 1HD$Pj jH HHOff. @ AVAUATIUHSHH HHSH f(f( $_ $f(\fT:t f."v z Hİ []A\A]A^醬HI $: H; f(t1H$e $HH ~ s t ) $fTf.f(H=C B H=. |$@l$@f99fD$@l$@ HL$4HT$0LD$8f( fl$@Hl$@HLd$8I)It$Hd|Ll$@d L|$4 DL$0IHHB H OF HEHE E)15I1A$|$.Dt$.DfD9fD$.l$.1H fDt$.l$.A<$"CL9HHHC Hİ H[]A\A]A^fYHİ []A\A]A^B<t YSX1H~%$r s )$$fTf.l D HG H@hHt Hx 1 ATUSHH=HGH-$ HH9uCH[]A\f D HX H HJH~?H9jtHt3H9j tHt'H9j(tHt H9ltHH9uf D HH`H H H HP HH9uu r f.L$ztEtAIHtBMD$I9tI,$AD$%D$LAP0D$ ?0HtD$IHu-q l$HH H2H9H u,HPHZ H5 H811%9q d$H cHH HHD$wD$Uff. VHsHwHFhHt H HtYHFpHXH=ʛ Ez HZff. @ USHHoHt]HwHHH9EH_Ht HCH[]H H8/9F1HHC褙1UHSHbHHt HӢ H9Eu HH[]H+ HH`Hff. AWHFAVAUATIUSHH(H= w[H|$Ht$H Hcۺ HHlHE Hl$He EHm HH(H[]A\A]A^A_E1HxH1AƃH uLcLAHHtEudLmHEH?H PuLd$Ht$ H9 Hl$fHUHD$HR0HD$dHA sAMc AUATUSHHHGLoHX M~?I1 D {u"Cu HCLH8Ht H H/t HH(I9uH[]A\A] HGP0 AWAVAUATIUHSHH8H ELo(HSHB`HtH tuL5 HI6^HHR D$(Mx Ht$(L趖 HEH H9 D$(AD 1H8[]A\A]A^A_H; L|$ Lt$(HHL$LLYcLT$H}LLL[IMt~L9tI|$H5 !D Lץ ID$ H=n L9IHHHHLD$ 8D$ "MA A t#H\$(H;\$ Id M H}0 Mu1HD$H\$(Hy!HSHT$ IVHHHD$HH\$(IE1/HPLH9 LKt%L)ILHD$IHuM9|IHH9 L)H6 >MD$MtEMd$(M M9HT$(1A HAL HT$L9|1MxL%ڞ HD$(H9D$ HD$ HEH H9 HCHD$ E1HD$ HT$ LHH] {H\$ pHVL)HD$(H;D$ 5HD$ +HIt H)L)I| HuH I>H5< HxH9T )HuD$(Mt)Ht$(L^ tHEHHxH9HEHHxH9y AUHATUSHHwH H(A H 5 P{H HPHH w$H HHHDH H[]A\A]E1HxEH1AăH uHcHHt\Eu*HhHPH?H JuHA AIcH= 1A HR4 zHG1if D ATIUSHHHHHH?Hu1HtI4$HH[]A\ה fAWAVAUATUSHHG 'G H:@tHHHH[]A\A]A^A_Lk LgHH@ @Lu0C уL$ LcH@|E1M9}|$ LLCzÃ~v$ta 聥Åx 0C >IC>?CD> IL}/f D AWIIAVAUATUSH HDŽ$ <+ <-( 1HL$8HӃ0 H9HA@EҍHЃ w HHH)ك. BHrE1Hg PЃ FPЃ - FPЃ c FPЃ \ FPЃ e FPЃ FPЃ FPЃ FPЃ F HV xЃ wBHxЃ vHH)HJ4 Hu E H ʚ;AH ʚ;@A A̓߉AA)1E E MtIEEAHE ARHA9HOHH<30 B/Mcº D$ D)E9END$11E1f D H A9HGl HOHH43FlnI9uDfH*D$ |$ t; |$1 A)HG. $ A)CH^$ E1E1E11L|$E1$ |$8 LD$ H|$ L H L D$HĘ []A\A]A^A_H0 H9IAI)HA EqK k HD9HLHH43L1I9DfH*DЍPH5H- fHcH*YX$ ADL$ A)E j L$ )ȉt!HcH , $ ^$ A0 ƃG $ 1H ), E AtHcA YуAH 1 MtIH9ALB<+- A <- BLbM0 L10 wk HHL)H AEtI9u M9HHVZEt $ ff.$ zAA(+ D$DT$ED$@D$ 1 9 DL$(DT$( HH:|$ DT$Dh@ DL$( A L{ HDH\$DEIA9~#AW 0 HHAEADt$E)LDE H0赏 HHAD A9H\$AEHL$@1DL$(H\$XDd$`IDT$<D$H !T$0}' HD$H)HcUHHuHH$ H HT$|HD$ht$(H HH@ D$d%x IHD|$|Ee L$HD)D|$0EGDaE9DAND9AODž~ A)A)A)Njt$0 LDD$P蠍 IHNHH HI> MDD$P EnDL蜏 HH |$@ E~H|$Ds HD$HE Ht$H IH E1DxHLDXM |$<9|$j H$ LL$ Y LLfD$PH AuA+vD$ D$ fH~HD$PDD){ HH H H fHnfHn _ H$ ^f/n Y,` f(E $ % = |$( t = [ fHnH fHnYX$ $ 9|$( L$<9L$ ,f*\E_ _ f/l IH҃D$8 AAIQDf H*A9AN$ A fW\ H>AIDL$(Dd$`H\$XDT$<EuH H#$ M E^ Y$ $ {MtM1fE1E1HD$1E1lH|$0 % L$D)9 DL$ A)E+Dȃt HH#& $ Y$ A A4 A1H % A At$ HcY$ AE [ f(LbE1ZHVHV ID$0L$HALD請 IHCt$HH|$L HD$H.HcT$H % $ Y$ H H H [ Z $ PH$ Y$ fH~H |w | P$ E1HVIDL$(Dd$`AH\$XE L$ H ImrE1HVIAHVf/\ H H|$ L L dHVGHV>$ k )Ѕ k !$ j HA9 HP<0HH L$ AƉD$)A9ĉL$@ENXH H#$ '[ f/DD))HH H H x H" D)HD$ Y$ HY$ bZ f/r'H,ȿ fDωH*f(E fH~ɿ I)ljI DljH H fHnEfW X K E1)уD$ !4 pN$ 5 P$ @H fHnYX$ $ fH~H ρ |\ P$ 1t$80H H DT$($ v]A} uA}~OL LD$0DT$@DL$<v LD$0HIvLHz LD$0DL$<DT$@ L$L$ 9L$(&D|$D$(LDH|$hLD$0ADT$XD|$DL$P} LD$0HH@ LD$D$0ֆ LD$HaH HD$@$ LD$HD$<D)D$$ tn L\$@LD$HHIGt$DL$PDT$X7HL\$HLD$@DL$ LD$@L\$HHIDL$ AGL\$HLD$@DL$ HA|n DL$ LD$@PD$L\$HL$|$<) 1|$t$ օ~8LLD$T$<L$ DL$赅 LD$HI+DL$L$ T$<4 ~2LL\$ LD$DL$y LD$L\$ HI,DL$LLLD$ DL$L\$d L\$DL$LD$ 0 1Hl$LDL$ HLD$ H9l$(@ 1Ҿ 蠃 HHaHA9HELH|$@D$< H|$@¸)D$<tLD$Hl$LD$ L |$< LD$DL$ wL$ DT$(:1E1E11HD$E1LD$|$8 LD$ " U S f/YU f(fW S LLD$DL$k Lc DL$LD$fW lS #1t$DL$ Hl$LD$K&IIif HtHcGH/ H H<Hھf. AUIATAUSH(HD$ "H Ht$HH9DHt$HHv HT$HtHt5Hl$H9H+t H([]A\A]HSHD$HR0HD$H|H LDH5ƍ H81,1 AWAVAUATUSHHX҉$H|$$ Hw I<+X D$ <- ,$A <0 <_ <$G Lc $L%3 ffC.z E1L5Ä 4$LME11 <_ LHAIA$HA9|<_i A_J H Lc $fH33 H*BYX Q f/@S 7H,LL$HHD$IH LL$Dl$@LMH@ H3 MBH\$0L|$(MωD$DHq3 JHD$HL9 LDl$DH\$HMNIHD$HL)HD$ U HM_ AA I9 U_y IAHMHAZ I9Q _b IA HHMA9 I9 _E IA HHMA9 I9 _ IA HHA9x I9o M _tIA HHD9}L9uD9I \ HA. LM^KI9 H|$ LL:IK| HL)HHH H H HtjHtHHt&Hf HHHЉH ?QHHHЉH ?QHHHЉH ?QHHHЉH ?QHHHЉH ?QHHHЉH ?QH9 Ld$8If D HQHLAH A?D!IċAHLAH A?DaIċAHLAH A?DaIċBHJ HLAH A?DbIċB HLAH A?Db IċBHLAH A?DbIċBHLAH A?DbIċBHLAH A?DbIH9Ld$8KTHFH|$I9 IM^L9WDl$@L|$(MH\$0E\ L9> |$ E ICHHHHH EDHJE HPHv"HtH+HXL[]A\A]A^A_1IC1EcLID$H= wI+uLsAD$HF HHL\IHA9 Ht$IIJIu}HgA|HrtcHHHHHIKH H߀ EHMudHAIIHHЉH ?AxHHA| HNtH9HwA9 H EHMḦ́Vs EH<HAtHt$HcHH HHF HA HHHDEL5} <$L11<_ HHU HA9|<_ @_ H IcAK H9(Hȹ HH HHHHD$IH LHLT$H1L1 HL9r:_tAHDH փ ~܉HHH ? WL9sƅt7HHL)HI9gL IH <0 <_$ <$tW$t:\AG<BtFA D$II[]AG<OtHc$JAG<XuA_IW <$GtpIAG߀XtM<bt@1<Bt:$ <Otff.ٯ3 ztN$ A $ <ot$ $ wHc$IAGI_H`J A $ A Ha3 d HHŃH= @vH3 J4H3 B 8HHH@_XHHtH+H\$Hs HH9HHFHHt&HHv $H5 H81&HqE1A H|z H@ H@x HcH9HPv H5ق H81HHHH;@A_t4$IA_ fH L;HM I9LLrHMI9t A9Ht$HIELHHE1FHHtH+LpI~ E1D $GL GLtsAGIuWfLL$LE1*$aLL$^G LCIHA9_I9'QID$ HMI9t A9H&L}<$ D$ L|$ HtH+1҉$Hff. AUATUSAPHHHH9IH=wu *HHHtRLmL*HC HMt HLHHC ( HC 1HkLkHC(HK0ZH[]A\A]1E1Hx ff. ATUSHHH0HFHP`Hu|H;vx R Ld$ Hl$(HL$LH~1sLT$H{HLL3HH I H1H{(H|$(H0[]A\H vH-u Hu 5HH H H9S HC(Hv HHH H 1H= LHyH[(1Ht$1HHx Ht$DHx(HT$(L7 Ht~HthHtRHt<Ht&Ht HOHT$ HOHT$ HOHT$ HOHT$ HOHT$ HOHT$ HOHT$L9 HOHT$ OHT$ OHT$ OHT$ OHT$ OHT$ OHT$ OHT$L9u5DH} H5 1EATAUHSHHHD$ Ht$|HT$HtHtH +H9%H[]A\ø HH9HNH HHt&HHp DH5| H81:Hk1ff. AWIDAVAUATIUHSLH8HT$(V H|$Dt$pAAAE @AAA Ln0A@0HL)API@ A@ I@A@ I@(HD$H4 ID$AN CD%<> <^ CD% >c ^c L11A AD <- H ( H # uJHD$(HH)H~:A[ A| 0u(0 A>C= HHD$(Lt$(HHKLLD\$ L$ HcЃ' HL$D\$ L HD$(H9tfAS AT , _D H9t?AT , .g HD$(H)HuA AD C0C 6 H8[]A\A]A^A_ ;CIT$H1H)0 D <;fCLLDRIT$ HH)HT$(H JHCHH)HT$(HAD @ <zIHHC H)HT$(HAD HD$(HCH9 A. fA|E ,T fA|E _ H9fA|E , ATE .HHHK(LLD $HD$( HcЃ: H D $\A ATE 0A ALU f-wi( H H ADU +A ADE C0AuxADE f>wf;FCDe f^u0fzu AT ^A| , A| _ H9A| ,^ AT AD >w;;CD 3AL -wT( H HY AD P^uAD !H|$AA%똃zu6 HC HT$({ ǽHC _ HD$(H9A AT ,sS0xDvZJ HHH HH H Hj щH5x H81]1dW%N,HPC , HT$(H9%A|_tzH{ _HHKH)HT$(H=A| zHHC H)HT$(HAWv_Ƽ,oHC , HD$(H9fA|E _DHHKH)HT$(HfA|U zg{ _AcHC , HD$(H9A| _OԻ{ _%AufA|E ,鐻A| ,,ff. fAUIATUHHSHG H] Ҽ@H0H9- b L HЃHAAH BL C HE1E1L@uH] MHD[]A\A] HSDP H9 D L% LAHADDL q ACHL@u HA Mk @ HA IH97 L% ADH BHL@$D` A HL)HIL9FMk HAMH9 ur_L AAH BuPD WDL%o AADDL V ACu+_ v阺D A v鍺 kHA H] M*E1E1ff. H t-HL$P E1j E1/ ZYoHD$HHt$E111虲 AWAVAUATUSH8T$(HL$L$HjHGH VLoA MLIMHH?HD$ M |$( H<$ A I H$xwT H<$HGH+G H> Mb H|$pHLM%111A0 Ml$EOAW L9N |$( |$ H<$ HD$pL01H8[]A\A]A^A_f u $ M HDDDDDDDI9ID$BtL$HHH)CHHHHSHVHcHЃ HHP|$(HIHL4 IH<$ M x LI5IHP щ @KT20MH MX LT$ ID$HE1HD$AwE11A0 AW FTDIAM L LT$M9A! A!A H A0)DRA͉HH ! 0JA)HHo ! 0JA)HH; ! ^ 0JA)HH7 ! J 0JA)HH ! V 0JA)HHt{E! ELHA)DшOHHtZ* L$(tdHJx A BH|$ A0u?H<$ uCHD$LE HIM9u@ D$(LT$ u|$ tH<$ B-tH$Lp @ IHM9tH5 Hf. Hf. Hf. W W WY W% W HcHHt$(L4H<$ H$xw MhH<$x LLL$LL$xMH$HpJ @H0H<$E1HG LHAo b E4|$( B07AS BxB0 H6A!AW A DT$/A0 ELDT$/)EA͉DRHA9|! 0JA)݉HA9>! 0JA)݉HA9 ! 0JA)݉HA9! r0JA)݉HA9! M0JA)݉HA9NE! ELA)HDшOHA9)RW.W뱃W댃WdW8AWA BbB0H<$ A H$xwHH@H+G HMDD IL DE!р ELH)AȉHD HAI9EuH[HD$pLLH0 H|$pHHԵHH@H+G L9BoB0郲Q f SHuGHhb H H HH W H W HFHF HF1:f. ` ^vP. Ht$! Ht$_ H/jHt$H> HF0H'`uL"f ,u. Ht$\! Ht$, HiHt$H> HF۵HtH HFAff. fAVI)AUM)ATUSHHD\$@Ld$HLl$PHl$XE C AUf1LCHH HsHC8 LK@HC( C + - LL40H0 = I9E IUIM)LKPM H111HD$1PAt$At$ H HC0HHthIUfnE fnL$ f8?L)f~E H)H HHCH H CH HC81E1Hu`1HC(HCHC@HHLH 8HH[]A\A]A^1E1HSPMD駴-HT+HC( S fnE I$fo - R f8?@3f~M Hr1L)1HC0H7AE> HfnE fAnM HC8LCf8?H{f~E H$麳I$I1fE1LCHH@C AUH HsHC8LK@LS(C - - DHH- T<u HS|HSHIAW1AVAUATIULSHXMIIL$ L$ HH A~ L| M^L|$@M H$ A Ht$HD8Et A H9 HL$@HLHt$HHHNظ II)LHH9HNHILHE1HKLARIASj H HXL[]A\A]A^A_ z 7f H$ It$ Ht$HD8EI1HL$@Ht$HE1 IHD$H-H H|$IHOŹ Ht$HH9HLH9HOLIHD$8I)LHH9LNMLHHL$@PARO,L$ ASL\$Hj LD$HHL$@HT$8Ht$( LD$HHD$XHH Ht$HT$L)H)HL$ L\$0HIL$ HH$ L)@n <_HH|$HMHD$ Hۿ L|$D$8HOLL9ILL9LNI)1HO 8IMLHL9PARMOML$ LHMLASML)ML\$HAVLD$HHL$@HT$8Ht$0 LD$HH Ht$HT$HL$ L)L\$0D$8HL$ HML)AMLLML$ L|$G4>EA AueMIMIM H9 IHLHHN߿ II)LHH9LNMLHDž'2HD$ DHD$MM~H9IA LMMMNM9MOA MMI)MHL9LNMMHO)L)MO L)L\$0APMARL$ AUPH$ HL$HHT$@Ht$8H|$0X H HH|$Ht$HT$ HL$(H$ L$ L\$0HMXME(L)EfAWAVAUATUSHHu-HD$P8u H|$@ H[]A\A]A^A_ H|$@ HHIIMM L)H E1H?L)IM H6臙MtHHE L)Hp @ @hH0uHIu90H[]A\A]A^A_Àu4HO ?HJH9?f 0 H0 HL"HJH9 0 HHD$@ @ @HD$PH6H+t$HE11H?LD$HH3HT$@蘘L)#IM E1H} MLL)IM H3uM AWLIAVAUATIUHSHHHDoLwH H~( LCMrHSH LCHHC0M% HLKPHHj H|$hwHL$pLqL.H H D$`LcH Iw HC0LC8HIw M LC@Mu HSH 1H[]A\A]A^A_Iw I?LH( HC@IG Hw L$PLL$H?L$ HIW H{(H$LL$K IW LD:IG HD$XI?1H.( LC@HC8IG MN&|$` u&Iw Iw L$PI?蔸 HCIG )E1Iw L9C0~1I0DL6H |X IHC0ff. AVAUIATUHSHH^HwH LuHFII~H 1HG HX H HPH~9H;ptVHt-H9p tJHt!H9p(t>Ht H9tt,HH9uIEIULOL@H . D HE HEH} H9HNHHƸ HNHHH`IE(L@@(u;MubIU0HLAH+t H[]A\A]A^HSHD$HR0HD$IU0LHLAH9XH HuIT$ (I|$ IU0HLA{f. AUATUSHHHxdHA H<A LMHML`Ht"ځ?H Pt?X Hth H[]A\A]HHH<W Ht H@2ff. ATIUHSHHH)HՅH{ Hu H{(Hu#H{0Ht([LH]A\LՅtLՅtԬͬV*f.R! ztYHt1Zf. HaS H@ Ht!HN KH1HHHE111HJf. Hf( fT f.X H|$ Ćfɿ f/ D$ 11f҉f.z %! HI H H!YL!DBH f/ H,H fH*H\H H9vff.z YHI H!H L!DBH f/ H,H fH*H\H H9ff.z* YHI H!H L!DBH f/ H,H fH*H\H H9ff.z YHH!A H H H!H f/a H,Hj fH*H\H H9s+u\ й= A< A)H HDH= D)H!HHH HcHH9HGHDf(\H,H?IIfIAM I*X= Arf(\H,H?3fW YIIfIAM I*Xf(\H,H?XHIfHAL H*XHf(\H,H?HIfHAL H*X}f.v fɸ/ H4f/HFHHH餪ff. fAWAVAUATUSHLoDG(Lg ImE HM I<$Lw( I|$HQH HC I,$ II IH}L<K&ItLIHH MOH9Nt+JT HHTI)tH H[]A\A]A^A_ @ H HVHIWI) HUH KL&HLI|IpH1MOH;wtiJL HHLI)u IQHD$LR0HD$h IT$HD$LR0HD$I|$ LHW1H1HIWI) LeHtQK KTNLHqK4H;rtCHT HJTIQHD$LR0HHD$HUC( 1HR1K HJTI)t\IsIQHD$LR0HD$]HHtHC 1H9YILHy tHIHHLHIQHD$LR0HD$L+f D USHHHWHoHtmHOHBHH HHBHG HgHHtHC H/t'H@ Hm tH[]HEHH@0Z[]HGP0HHufAWIHH5 AVAUATUSHX MyLL$HLpIH@LL$ M I HD$0HD$HD$I Ht$ 11II% D LH)L9LHPM9u L9}pIE v IEH HK H9Cs HC HLHHHCH)H^HFH9Q HHzHPM;utH1T$(LL$ HL$#IHtqHL$LL$ HX H MA E1E1LkPHD$If NKHHPI9tHPH0HtHHE LAH HkPHD$H L,(LL)HPHH H Ht@I|$Ht2HWH H H@H 1ID$H/ IPI|$Ht2HWH Hl H@HQ 1Il$H/ IPI|$Ht3HWH H H@H E1MT$H/e IPM9 I|$Ht2HWH H% H@H 1ID$H/ I|$XIl$PIHt2HWH H H@H E1LEH/ H}XLePHt2HWH H H@H 1IL$H/ H L Ht.HWH H H@H 1ID$H/tXL M9HT$H9T$ HX L[]A\A]A^A_H98 Ho01ID$H/HWR0IPM9H9 Ho0E1LMH/H9 Ho01It$H/H9 Ho01IT$H/5H9 Ho0E1M\$H/bH9 Ho0E1M|$H/=H9 Ho01ID$H/<T$(HgIEL0HF I9FIL>H|$LH|$H|$HH|$H|$LH|$H|$LH|$H|$LH|$H|$LH|$H|$LH|$#Lv=HX 11[]A\A]A^A_lH|$~HI9IkPLL$zLL$HHD$7鈯I\HE H9C1HLL$(HL$ Ht$ Ht$HL$ HILLL$(HFH)H9d8MQ E11HLl$HT$E1M.f NKILHPL9t5Iu"AI f LLZH2ItHLHLLMLl$?L<uMI 郮餮ff. AWAVAUATIUSH(LwL/LL)H9~H9LLEA<$)4 A$Ho HcHM9 ID$LL%Fp HD$ D Hl$D$ A׃} *Huw;E IcL }։T$ T$tW|$ t HI9ufHL)H([]A\A]A^A_ t$ϐ D#uH$~ ;UtHmLM9sLL)tHtcHtPHt=Ht*HtH ; nH; aH; TH; GH; :H; -HI9 ; HC8 HH; x HXx HXx HXx HXx HXHXI9u;Ur 9UH JAT$LЁ yL9p8hHLZL97s 1LH|$&XHCH|$uHL)1t$HEAϿ H HHDH# mHHM9r 9UL$ T$ L$ T$99E颬A} I]LAD$= lLHL9a8uXAl$LL9G; 97HAl$LL9 3f\ HAT$LL9w H A 9HAl$LL9; 9Hff. @ AUATA USHH;*HswH m HcHE1HD[]A\A] { uHsHA w #uHs$9ku;kr9ksHs AH w-@ՉHHк H#TCHHlDkD9r 9k3 D99CfSHHl HcH H@ H[f GH+ BH BHHd LH[fÃ| Hi@ 1ɀ< 늉 HIvIg`X+a_ <1Ƀ 1Ht@ Hcދ q zy1IH1 t$ yT$ H Pf_ Ѓ 9H? Hcދ i9wUH? Hcދ LzH? Hc_ " 1Ʌ1H[v f D ATUHSHHHVHB`Ht H urHE(L` MttID$ H;; uHSHtuLHL$H!H|$Ht5HG t(mHx H9EH~H[]A\1H/HyHuH: H5 H8hHH HHvff. fU` HSHH:tH;8 tH[]XHHߺ` [H ] # HG ATUHSHHF H~ H HtPHvHHxwHHHH?H4 HH)HHH)H)HH[]A\ HO; HH HH H[]A\H7 H H7 H HT$ HpIHBHLH!2H H9#91H HW D AWAVAUATAUHSHHHGHPHwqHH DHHGH= w)Hg: HcHHDH H[]A\A]A^A_H?H= H[]A\A]A^A_III?ILHEu$Et HuY[]A\A]A^A_麊HA MI)M/L虒Hq LAPD)E DHHMI9 Ax HHH ?HHMI9~uAx HHH ?H HMI9~QAx$HHHH ?H I9~-L@$|HIHHH ?AHI9uBTH^HX[]A\A]A^A_HE1L)HH1H9*?AH^[]A\A]A^A_D LHH f ATUHSHGHH@`Ht?H HuX pL% 5 L9t9[]A\L% 5 L9uLl/L%4 X HHCpL9uLF/HuH{H []A\n ff. AVAUATUSLoHo M H} I HE M~`1L5 ID$H|HGH L9uYHWHt~HGH;B}fHTHHGH|HHTH/t<HI9uH} [H]A\A]A^ D Ht'H|HDH/uHGP0HG H*taHm tfAD$(us1[H]A\A]A^LiHHt1M~ID$H|HG Ht+HDHI9u`HBHP0HEHP0H-H} HIL9hID$H|HG HHޭHHHf IIHHt?HtOH9t Hu=L9}&LM H)H9HOHuAA HI9LLHHHrHHHHHAt1HL9r @ E111Ҿ H= AVAUATUHSLfMt@HIuYHF1HuH5 [H]A\A]A^ HHHy龵H4 H5 []HH A\A]A^ڔ LgIHE1M9}(JtHj5 H誔 H[KDI[L]A\A]A^f. ATIHUSH`HH;= 5 tiHHLH{P xXHl$HHT$Ht$ICHt0HT$HsPHKXI\$H9HNH9HOыL$uHH`[]A\H H 3 H9Ku$Hu H;SuHH|$ tHHH)H<0HHאAUATUSHHHHHHHHH״HƴL% 4 HCHHxfHHuH{H L HHIH{HHE~tL HH%H{HHE ~PL HiHH{HHE(~,A LLHAHٳJDIL;kH|HH[]A\A]ff. AUIATIUSHHH~2 H@ HG@7HыU Lo8H?ru ~/LHMtK@ ,H{LLAуE H[]A\A]H5t HLD$H $Q H $LD$t1HCf. AVAUATIUHSHHжHI4$HݶHHֶHHHDPHHHHH w"Hv1 HHHDH []A\A]A^E1HxtII taHH<HEAHHcHHaEuBHh?PMtHA?H<D` tP E1 HA AIc AWAVAUATUSH8HoLI9 >HI F N LH)H9 MI)AFL9LCM$ p H+ LH:Fǃ HD A<$uAD$& L9G L= IH1H+ILHL MHkAEH L9 MtGIt2I HL 1LH+HHkEH HyL9 LuL 1LL3HLsXEHupHL 1LH+HHk4EHuLInL 1LH+HHkEHu(InL 1LHH+HkDHcH8[]A\A]A^A_HL 1LH+HHkDHAFMM$=AFEFH HMN H$ LH)H9 E1MC< MUL9uL9swAF I9tkH8EuL9s]1 A8U utLXL9tDHL9s4LHuAF A= w 1҉ L9sD8m tDHI9u1HH)LL)HSHDHtf H$IJD HkHuK41H߉L$L$_CL$L$HkH HH bK41HLT$(L\$ LL$L$LD$CLD$L$HLL$L\$ LT$( &L+1Lk1I HL9u L6tHk1LHH+BHH^ HH 붐U HSHHdH;#) tH[]H#HuH{HA X[] ff. SHH HWH M* H|$H4$H9uO@H$HPD$H9 Hff.L$zh D$^ H [ HX H% HQH~AH9YtHt5H9Y tHt)H9Y(vHt H9\`HH9uHt$H|$臁 H$HPH9Kf D HX H HQH~IH9Y"Ht9H9Y Ht)H9Y(Ht H9\HH9uHt$H/&L$ff.%H9H HuH HH9c%%f D AWAVAUATIUSHHGH;% HWAH;* A HBHT$L HE!HuiH|$AHHP&EuCI|$HJIH*&HFLHc H~HH[]A\A]A^A_H Hc%fATUSH0L%9* H|$L9 &IH-' HHH9 A@LCD$(I9 Sff.z \$(f. f. ~ f(fTfTf( f. f. ff/z ,$ i f.z fI~1$<j$fIn Hf(p f.& E%f. D$tfW H0[]A\f(\$T$6oT$\$,$f.r l f(f(T$1fW5} $fI~t$(@a $ ^ T$f.@Ef. e f. f(7HkHt$(H|$}? LCI9HL\kA H}f. f(ztzff. # f(T$ $O`T$f $f/ f.^ z-f$f(H]# H P߲Hu{\$(f.Z d$(f.z& ff/f/8u;f(jH~$ H5= H8R1f. zl"f f( $T$d$=_T$f $f/vf.P d$zf(H" H|$LHH@`P(7fɹ f.Eф"""1f. zfH~fH~HEfHnf(hf(Z!ATIUHSHHH H"L膮HHt(H@H H"HUHHH[]A\H}HL[]A\25fATHBIUSHHH"H>HWH H#H;! HH9 HT$E111/Hl$tHt1HH[]A\H;-$ t H HtH7 H8H# H@ Hz` uHf H2H@ 1M1HIl$H!HE t9"HGH H; H!ff. @ ATUHSHLfH"HHHsHtH/t)H{HH#"M."HEH HCH1[]A\HGP0SHWHHt_HOHBHH HHBHG HgHHHtHCH H/tH.HCH[H@ HGP0HHHuf SHHHHtHCH H/t H[ܡHGP0 HQ" HGH@ HH HRj!Ha!H HQ!H;BG!HRHH;" 2!f D AЉEAR@-"L MT @Ic4LE1H5,U "DEAQQAEVAADRDމw H ZH5T A g u g A H5T f H5T A e H5T A H5T eH5T AWAAVAUATAUSHHL$L$ DD$DL$ |$8l$8f9#"fD$8l$8HL$0HT$4DLD$8 fl$.Hl$.HcD$4HIH"Hl$8D$ H)E"Ht;L " @A M Arp HPH HAHA A LOʉD$E1 A IyHLL$L)H<TIH!|$0LL$ |$ I LL$M I9 LLHImdM)J43ILMA.IKHMdLL$II) A}.u |$ I Et4H$ T$ImH5h HH@ AE 1[HcLl AE HcK H{fnf:"fCD H?/ HH<HSHHL[]A\A]A^A_fIcL Afu;H HNЃ|$ LjtrL9 Iy1E11ɉD$ Agu-H |$ t H9 |$ McuIAe Z -LXuI9LLL0 LHL)LHHW.HHbI9LL$L,(}L0 LH)LL)Hw.HI\L0 LIGLHHx|$ IcfdHHLUbLL$L,(1AU %@Nu1ɉL$0 &RIH |$0th|$ Hus<Iu)H$ HϺ H0aHMuRLiH$ HϺ HpaHMtAE -HH +LX +HHAE ff. AWAVAUATUfH~SHH HxHT$@1҉|$ t$LLD$0fD$(yT$(%H H HT$( Ll$(I D% = g L$(ff.z" H </ H HH</ DAL$(HC LE% H D$lH AHL$(E\ l$hAD$l H|$h T$l )L$h KT$lS kE/ 5 EfE1)HD$(A*Y k HH H ?H H fHn\) Y) X) Xff/D,b UD$ )A_ 1Ʌy 1҉)Er DDd$HD)E1ދD$ d 6 A F D$ A D$L|$HDpD$T EAOE1 DD\$\DD$XDT$Pt$8L$$T$ HD$H HD$t$8T$L$$D8HDT$PDD$XD\$\HD$8A E |$H d$( |$HQ AHP E1AA B4AYt$(E |$ D$(t f/d fA*YX fH~HljH @H H E |$HE|$$AxfHnH D$(Hc EYLT$8A - f,fIj*׃0\f.z @}E9 YAIËL$hKf D |$ 1D\$Lt$8L$$T$ T$L$$HHD$t$8D\$L~ HD$1E1A D$TA8HHD$8DD$Lf|$HH EP E EK 6 )H-q8/ DHx HE HW8/ H@ E A HE~~9щNA))) L-8/ M IE H8/ H AE IEE LDL$PT$$DD$ IH |$ DD$T$$L$P~EtH HD$( D$$ AEHAt ww? @ Dƃ)օOƃ B4 D$ H߉T$g HHFT$~LI IHD$tLHJ % ED$ E E~HD HHDD$$ Hl$HT$AFLd$8L5R6/ HDHD$ LHP KD$Dx0HcE)# HH{LLLApAA9C 9 Ht$LF HH G|$ A HcwC)T L LCK4NLAQ9V# HcG I4I<H7J u E HD$IE|$I9)H1Ҿ [ HH HD$1Ҿ HH9 2 HH HD$H Icf/D$( 11ɉD$Dd$HD1DEHD\$| D\$)A4+2 )AffA I**Y fH~HH H H fHn\ Y X Xff/D,fA*f.zA1҉1t$) A E1HA EAIcHH9EH|$lE E1W T$l SHD$@Ht$0 H=+ Hx[]A\A]A^A_I HD$@ ' H HD$(u4Ht$0 H=˺ A E1ҋD$LgD$TA6Ht$0 H= 늉l$hAE18E11AL$r@ )A华 AE 1H H)/ HH)HHH= p HC(H H HCL^M98 VEYA9 D9y HcG H552/ LH<LD{ " ~:H߾ T$ m HHLHv T$ ID$A$HD$IcE5 H1/ H L,IM HD$Ht7Ht H9H HD$Hc@\ Hu1/ H|$H H<HHcC9 HQ1/ H H H HD$HT$@ D$HH|$0 t HD$0HT$HHD$8Hx[]A\A]A^A_ Ht$LL$$A L$$HH D HcG=I4I<H7xJu E ID$DHD$A9 A$L$LDT$$lHL$LDT$$yD EHcwL MI<LH u E3 {|$ xEoE1ɸ DL$$L$PT$$DD$E H HHjHHG HI譈LMDD$T$$L$P me HHH|$1Ҿ HD$HHI9s!IVEYHID9I9rHcw L// |$ M I<L D{ 1tD$19 I@H9ApAA9IL9IApAAII9wL9roL$LD$$MF|$ D$$L$LJD$(m D9WT$1KHF|$T D$ > Dt$TL|$8A 1f E9 H1Ҿ HHq ALHI H 0AGD[Eu{L|$Hl$1M|$Hfd$(Ey.AE11#fd$(E|$HH_ HcT$H|$L y ED$(HL$8 f% f(H^,f*ȍp0@qY\f.ztD9, YăHL$SHD$(H .D$$ A}x HHcMHPHuHH H HD$H H.HD$Hc@H߾ L|$D$ HH` T$ Hl$1LH߉T$ { 2T$ K HD$HD$H80?ID$HD$A$9HD$HH@Q9 HL$H1Ҿ l$H HH ERH1Ҿ u HH |$T D$ tyDt$TA3 HH HH[j D$(HT$8H94D$HHL$1 iDDt$T|$T D$LHl$1ЉD$HHD$8HD$LlBmL$LDT$$QBL$LDT$$(L-C H5<!/ LH)HHH= # IE(H H IE L$PD$LDT$$ADT$$D$LL$PH- H= / HH)HHH= # HE(H H0 HEPXHL$f/<f.S C T$HT$$+ HD$HD$H89t D$$D$HHT$8H9uD$$ 0Hl$X f(Xf/w\f/HT$HH:0tHD$D$$D$HA \ fHnf/w8fW f/_D$LЉD$HHD$8HD$;Hl$A:cE11HD$Hl$1D$HHP@1HT$D|$HH DDAEA a E1E0 |$(^|$(( P<HHy ( L$PT$$DD$(<IH DD$T$$L$PL1Ҿ IH HH4 ( t$XL$PT$$DD$;DD$T$$HL$Pt$XH B H HD$ HD$ ! ff. USH)H&/ HcHHtTHH H@ H[]û CHH' HH< :HtˉhX H@ 뻉 L / C HH4Hx HHHHL)HHH H0HL f. 1Ҩttèt; ft7t=uuu 뿃 @ AUATUSH H H41 IH trH-k / H L-{%/ t6HL< MtnIcT$RIL Md I $Ht[If D t HE H Hf. HL[]A\A]IsLHD$<HD$Hu$ @ AUHcHcATUSHHWDgHHHՉWH A W HHHՉW H A W HHHՉW H AtsW$HHHՉW$H AtYW(HHHՉW(H At?W,HHHՉW,H At%1ɋT0HHT0HHՍQH A9ސHuHH[]A\A]D9c ~IcAlDcۋCxIHK HcSH@HsHH HL|f AVAUATUSH% WGA DlC D9 >IHHx~H1H6HHHcCHsL A D D)щHNL9 DFDAD GFHNL9 D^DAD ؉GFHN L9shDV DAD ЉG F HNL9sHDFDLVL_AD GFM9s$A2DII ACABM9rݐLHKH)HHI9ɹ H HBщuAHcCEl${H!/ H H H [L]A\A]A^ÃtbDlC A9r D A9]A9ND9@L9rsHn9I HcFW)u HHH HDp9qt҃HqH9sDApA9tA9HH9sHDApHHA9uH9rfO Hfnf:"fGyff. HH VHWBE<t)uH H5 H8,1ZPG Y z |ff. HGHuH H ff. AWAVL5AUATUHS1VHE1HJ (H;]sSHEL, L$MtHE0M<$HtI|$L9u@HtHE8Hu LMUHI|$1HHE Z[]A\A]A^A_m AVHcHD AUATIUHSH L- M@ H4H虈H# HPHH HA Ht$Hl$Ld$ HB8HH HfH9 I@ HC0A@0H1HE1K21HLHH+tH []A\A]A^ HSHD$HR0HD$H []A\A]A^H HuzHHl$Ld$I Ht$ 4LHE1HރLr(H H c1LH1HHL>HHUHHHtLd$HPHl$mfUHSHHX HHf H HH@ H= HH9 HHtH+Ht:H$ HE H蹘HHm tH[]HCHP0HUHD$HR0HD$H Hu H=D HH9t6H苕 rHHUHH= HH9.Hu) AVAUATUSHH^HCxHgHHH HCHH= w*H HcHHDH H[]A\A]A^ HxoIE1I twHH<HEAHHcHqTH EutHXHpHH ?PA?H<D)tn|HII t'A 뉿 THtMH@ XI E1SHt+AԉMc?L`PMHpHH x1ff. fAWIAVAUATUHSHHLHHMEH H(H L"HBIE1 Hp HH@ Hx芫HH Hx H@ HHǀ H@ ǀ ) 1HH}H?H<H.H HH HC@ HT$HL$Ht$LC@LH HH* t$EH G MLHL$I9INM HD$fnHHS Hǃ I9LOHcD$Hf:"fփ IHHHs(HC0I$Lc8H L HE H{ Hk, L- HKI@ H@H HCHrfHnH HfH:"HCCH@@HJHHE111Ҿ H= IHHH I,$H; H+ H H=4 HH HE HpHhHHPI@ HRH HPHyfHnH H7fH:"@HqHm t,HH[]A\A]A^A_ D HCHP0ef HUHD$HR0HD$HH[]A\A]A^A_ÅHf H5W H8/$H /1H{@ H t H{@ZH1_H H5E H8#L˃ Ht$WA L1L3 HD$(Pj j/H IHtIE1L H|$S UHSHQH= ۧIHtHE HHhHHXZL[] AUATUSHH_H Hj HL@ HC H@8HH H111H1LHHH H}HH9 H{IHtSH I9EIm L;- u6H}HtHE H/tNHUHtHE H*tQH+t;1HH[]A\A] H}HHE HH/uHGP0멐HCH1P0fHBHP0HE111LBHHH H8跋tjLe1M 1LHU H}HtI1LHEH)1*LK L;- f AUATUSHH HM 6 Hp Hx Lh Lc ǃ HC(H H H Hǃ H Ht H=k HC(Hǃ HCHCfL HpX ubHH H@ Hx` u{HsHLL1Hu1HS(1҉ H[]A\A]1HSH9S( ԃu" HHS H@ Hx` t 3 H @ USHHHWHoH HOHBHH HHBHgH@ HG H{8Ht H/ H HtH= 9 Hǃ fH= H H{Hǃ HtHC H/t-H@ Hm t4H[]f D HGP0r @ HGP0H@ Hm uHEHH@0H[]f D H@ H{@ SHOHHWHAHH H HAHG HgHH H{Hu H[sQ ff. USHHHH(HtxHHiE1L HD$ PH1j jvH HH H H?Ht$1T$uh HH uZHthH(H[] HyePE1LT 11HD$ Pj jH H H8Ht$1|$ tHi H5: H8J |H JH HHBQE1L 11HD$ Pj jHt$(H Hl$HH H(1[]1.AWAVAUATUSH(HGH<$t$ ~ G H4$Hn@ 1Ln0IHk E1L5 I9Y LHH) H H H HtcHt@Ht AD k A< HAD N A< HAD 1 A< m HAD A< P HAD A< 3 HAD A< HAD A< HH9 AD A< HKAD H˄ A< HAD Z A< AD HY= A< u}AD HY$ A< udAD HY A< uKAD HYA< u2AD HYA< uHYH9 I, H9 A| LK] D$ m Mu I9 LL)MH_ HLL$HL$HH#@ HL$LL$ @* LS0LLH II7 II{Hs0HL9 Ht~HtgHtUHtCHt1Ht Ht Iw IrI4I4HI4I4HI4I4HI4I4HI4I4HI4I4HL9s[I4HxI4ItItItItIt?HG8It:It?It:It? It: It?(It:(It?0It:0L9rI<L1t 07 tD0fD7Ht07MID$ HHHH IL$HqI;L$ I|$H It$HHHCHP0H4$H3 H9FL H(L[]A\A]A^A_À H$Lj 5LzH@i1[IHE1L5% M9~H-) L @ A< u8HI97 A_fvHsLD$ LD$I9; HHsfA< / |$ Mu I9 HL)MK<i HH9HL貈 HrI5I9A| tI|$ HL)MHAHk8H H HM LK@LHL$蚈ID$HL$H H+LHHIH$H? H9PHHI9fA| HsH$8LhH1oIHE1L59 I9LA< u&HH9t@AL yH Ht H9jA| HK$|$ tHMu H9HHK|= HL$L)"HHeHLކJHL|$Kfc9,AWAVAUATIUHSH(L-- HT$I 6Å~!Lt$L聖I. L蝮IH M IFL HHt71HL1H#H H+ H(uHPHR0詯I@ Hx` I.t H H0HVHH([]A\A]A^A_IFLP0IFLP01H' H5Ql H81HSHD$HR0HD$c H+L1AWAVAUATUSHHd I;F:IIf H HcH D H HR01H0 HH9 0HHn @tBHD HMH@ H@H HEHrfHnH HfH:"EHJI\$HHIH HHh H+o I\$HH m I HHHhH+@ Ic|$ eHH`"I( HHth H+ Ic|$$heHH&"I HH:hj H+ Ic|$(.eHH!IH HH h0 H+toIc|$,dHH!I@ HHg H+tEAAHH[]A\A]A^A_HCHP00HCHP0[HCHP0HCHP0HCHP0HCHP0H rHHGI\$HoHI HHgH0At$L HHwI HHfH#H #rHHIT$LLHHtI HHyfQHIT$LLH vq HH.I HH3f HRIT$LLH P + HHI HHeH ;Hh>qHHIT$LLHHIH HHelHI\$HHI HH_e7H~At$L! HH I HH#eHBqH qpHHIT$H LL HHI8 HHdHAt$L HHI HHd\HHh oHHhIT$LLfHH#IH HH(d HGIc|$ aHHI HHcHIT$LLHHIx HHcHH nHHIT$H LL HHIP HHMc%HlH0 nHH1IT$LL/HHIH HHbH?H ?nHHIT$LLHHI HHbmHAt$L HHTIh HHYb1HxIT$LLXHHI HHbH9hH@ hmHHIT$H LL HHI8 HHaHAt$Ly HHvI HH{aSHH- HE HH5S1H lHH4AD$I0 Hff. fAWAVAUATUSHH<$H HIHIHH\$IHgHHX E1 Ht`Ht*HEH<$LJ(AH IT$J*A HEJ H<$LHAHIT$IHHEJ H<$LHAHIT$IHL9l$ HEH<$LJAHIT$I]H<$LJHEHAH IT$IH<$LHHEJAH;IT$H<$LJHELkJAHIT$JLkL9l$UHL[]A\A]A^A_H1[]A\A]A^A_UUHSHXHF ~ H{LFHl$f1HH)D$HD$@ )D$ D$@ )D$0菌 Ht$0H\$HtFHD$ |$E u"HH;st#yfHHpHHHXH[]6HHt1HHD$mH. H W H W H= 1f AUATUSHHLgLHIHH?GIHPH w+H HHLlIE HL[]A\A] Hh3IHtHCIEMtH HsI}HL[]A\A]AWAVIAUATUSHXHGHT$IH4$IIIHHFIILHHCHHD$2H &LI2HH3&H4$MoBDHH&H HU1E1)M% Lt~HtKHt!FA HAH A?HDUBDHH AH A?FTIBDHH AH A?FTIM9 B|MAHH lj%?BDHB| IH HH lj%?BDHB|H HH lj%?BDHB| MHH HH lj%?BD HH M9kID$11HD$H+ Ht|HtIHt EV IDI %?DAD$ETII DI %?DADHETII DI %?DADHH9 ETLFII D%?ADLET HH II D%?CDLETH II D%?ADLGT IpH II D%?CD LH H9eIE BDA9D L)L$HH$0IH#H$J4 L$L D2D$D2D$0HD$J H9T L$4KDHLd$ ILl$8ILt$(MH H@ D>. EH<$L"`H H<$HD$HHD$HH;BP H L;x0 ;"B#BT#|$D|$0IH F\#H 1HIAII M I9 MN LEE11҃ HtRHt#}Hc IH)H ?AÉ;|IDHH)H ?AÉ<H|IDHH)H ?AÉ<HI9 f. LHrIDHH)ȉH D?H L HIH)ȉH ? LIHH)ȉH ? L HVDIHH)ȉH ?AÉLI9fD) IHEM HCH9D$MLd$ L$4Ll$8Lt$(M AIE1AAЃ H H HtsHtNHt)HP CtDH H !HBDICtDH H !HBDICtDH H !HBDICtDH H !HBDICtDH H !HBDICtDH H !HBDI CTI}H H HD!HH BtCTIH HD!HH tCTH HD!HH BtATLoH HD!HH tAT H HD!HH t ATH HD!HH tATH HD!HH tAH D!HD H I,$ HUHHHHH~|HH HD$IVH(HHHHH~ AtHHt#HXL[]A\A]A^A_1A|H\$Ht A| HptHa INHHtA| HvtH9uHt| HptH9aH& HMOHHt| HvuB#BT#t$D|$0IH F\#H 1HHAIIH L H9NDt$DH?3EȉMH L L9<DH?DʉIH L H9D$Aǁ?vCtDH!HBDIID$LP0-EIAHH11TЉ ?HL9|ff. USHHHCHt`H{HtHG HtLH[]H'HHt HHHC[H{HuH{Ht 1HS>1U\Hu H{H"1HClHd H8tft+tf HG8G, @ o,uHH uHG@HHW81 f1 f.GEf USQtu-HH4<HvdHH[HZ[]à t; @ UHSQ HXHHtHuU UPZ[]HHHfAT fI~UfH~SXH>H5 HHLcHHk[]A\ff. fATUHSHcFHDgA)% HHOHHDp9ro sHA HHË}HH D`HcELEH{ DcLJIM HcCHtEHL)H D)JH9 K } H)H)Hz H{ H H9 K } H)H)Hz H{$H H9 K$}$H)H)Hz$H{(H H9 K(}(H)H)Hz(H{,H H9| K,},H)H)Hz,H{0H H9sXK0}0H)H)Hz0H{4H H9s4A4 B #B|% H)H)B<"HIH J<#H9rfHHkA H)HHH9H_IBIM9r%1H9HBI DR[H]A\ D A0IH)I@A1L9r1IM)IMf A A@H H)IpAAL9sH A<0H)A<1HHH I<0L9sHrH9sIzp9t9wIAA9 ,HH9sHzpHH9uH9r1HHH@ H HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ H$ HD$HD$ D$0 HD$ܽH @ USHHH H@ HG t+H@8HHt 111HHH[H1]XHH[E111]|ff. ATH E11UA 11SGr Hj Pj H H>HHHH H輖IHG @ >@>IL$0HHH HH HHwHHH9 Ht~HtgHtUHtCHt1Ht Ht HS HQHHHHHHHHHHHHHHHHHHH9s[HHpHHTHTHTHTHT3HF8HT1HT3HT1HT3 HT1 HT3(HT1(HT30HT10H9rH4H1@u:@u&uHH= L[]A\ f H̋ =Hk8HQ L I$f. AWAVIAUATUSHH8=DFv Mc~E9E HG$A~LE9f IDELc2 DD$GHH HHIcDD$L,L9s-LH1DD$H)HHH DD$HIFN L9 H{ IcHs$MH|$H{(L Ht$Hs,LC H|$H|HSH9Ht$ LBҋ0H DkLILD)H I9 Dk DqLMILDiH H9|$ Dk DqLMILDiH H9|$ Dk$Dq LMILDi H H9|$ Dk(DqLMILDiH H9|$ scD{,DqLk0LMLqILDyH I9s9LT$(EU E>IILMILEVH I9rLT$(f D BHL9ME~AMt?DeH8H[]A\A]A^A_f {G$D9c DQ;AUtAAtIIA} uAuAN1ɾHHrH@ eHL9?ff. AWAVAUATUHSHcNw9{ DqLoH1McLeIO MAExDA9 LT$AMLE11f ADIHILIɉI)I I)LDWH M9sLT$A HcMs)u6HMD LAxq9tm9s []A\A]A^A_f D )t @ xPL1ɋA<$IHH)H)HFH M9sIcID 8 uHI9rLDsIpI9sAxq9{IM9sHAxqIH9WM9rp8 uA1Ad9ff. fAWIAVAUME1ATUHH7SH H|$8LD$LD$H|$ HT$H D1Eu H= L9u L%4s EL% s H\$@1L)ʹ HHB D$p HHHD$hHt HH34JHD$@ @ @3 LT$HT$ LHH)H~kt$PLD$HMJE1HL$`E 29 D (A IHHA fAtHI9sHT$ HL$`HI9tHM H+D$8IE H|$HB H|$H> HMHĈ []A\A]A^A_MuÃv 29 D (A 0IHHA fAtHI9sX Lȋ2H)H9 HHAtI9 H H H HtnHtQHt4Ht29U HHAt29> HHAt29' HHAt29 HHAt29 HHAt29 HHAt29 HHAtI9 29 LYHBCt0LH9 HHAt29w IKHPAtp9_ IKHP Atp 9G IKHPAtp9/ IKHPAtp9 IKHPAtp9 IKHP AtI94 HT$ HL$` eHH+D$8H ) LPHD$0Ht$LHLT$(PSHD$0PHD$ PHD$HPHD$XPLL$HLD$h_ H0qH|$@HtDH|$Ht5H|$Ht&1HHA AtI929rD (A wMFEtHT$ (HL$`= U 9 EH(QHD$ = EuA29rHHA AtI9sHHA AtI929;D (A wsE= ueILL$ L9t$AL%m ܴҴMtIu H H W H W HD$ X= uVI LL$ L9tA L%qm DHD$ DHDH9tE1 w19L9iE1L%m HG t-HF t HHT$( DHD$HHo H f. AUATIUHSHHHGHvH( Hu9HL Hu*GAL$Hca<HHH[]A\A]HHHIHHHHHHCH9 H! At$HEH { HqHg L HHHHHHH)HHE JtLEHL)HHH HtTHt'H HHH HHHHHHH)HHH H HHHHHH)HʋH HHH HHHHHHH)I9 HHH H HHHHHH)F H H HHHHHHH)FHH H HHHHHHH)FHH H HHHHHHH)I9jHr:HD$HIBLl$H} IEyJHtRH|$U[ H|$ BLl$(A|9|H HD$HAII} uDL+1HHT$LcHHtH|$|ZHD$HZAI|$ yLLLH軰HwAI1 1HЋTH H 1HHsH HxaHGA|$O)щHt)HHHIHHHI|$ VEA|$HHuËEAL$Hnff. fATUHSH HFHEx@ Hh HxHHt1HPH路HEx@F H{PHt1HCP蕯HEx@$ H{XHt1HCXsHEx@ H{`HtE1Lc`PHEx@ H{hHtE1L[h-HEx@ H{pHtE1LSp HEx@ H{xHtE1LKxHEx@~zH HtE1L ®HEx@~UH Ht1H 螮HEx@ ~1HHA IcHH:Ht1H qHEAD9`@1҉P@1[]A\ AW1AVAUI1ATUSHHGHL$It$ ILHHHBDHMaH,IHHDDDDDDDHI9HMk II7 7 L)HHHMg uL NDHH ?AI U HH ։H ?IBTItQu HHL ډH ?BL It.A BtHH H ?C IM9uMBTMJD$H fD$BDH*M~V BDfYH*XIt2BDYfH*XItBDYfH*XY f. z Me H} m H[]A\A]A^A_16ID$ɾ HHI)H MQMM AI{1HAL|$Aփ H H HtjHtHHt&H B|H H D!HC<IB|H H D!HC<IB|H H D!HC<IB|H H D!HC<IB|H H D!HC<IB|H H D!HC<I B|I[H H IHDC<B|ID!H H IHDA<B|D!H H IHDC<|L[D!H H IHDA|| D!H H IHDA||D!H H IHDA||D!H H IHDA|<D!H H D!HA|H T$u%HH| tL$T$fWN B|D!HC<IHI9D4 I9ff. H(7N AWAVAUATUHHSH(7UAăEH=. @EL5 Iu HT$HH E Ll$MtVH}HHHEL=.. HLL9t"J LHH(H[]A\A]A^A_רA HEH8 I(f H,HH =H Ie HIHl =HHt a IHc HIp LI;M@ IHCE1HE1H ID$L9 H 1H "@H IH HE 6 L=3 I E H= HHIMLLL 1LT$LHqLiH|$_LWHO\H(DH[]A\A]A^A_1 HLHHILH1$HH LHH HC C IH LIp LI賦M L{I IHx$BHLT$uLT$HI-BHE1Ht$H LT$Ip Hl$LT$HHBHLT$uHHHLT$kALL1HPHx H5_ 1H81 <HG HI赥MtID$ BIT$HBI\$M|$ LHIuHC EBIG BN IHBI BHI0q 舾LI MBHuLHڿ 1> HIL1MA A;ASHHG /D HCHtHHF t~ 'DHH[1HPH H5= H81:H1[Cff. AWAVAUATUH1SH H|$H|$(HL$HL$H Lt$@1H LIԺ ILD$p Ht$h CLH\$ H\$L|$ L9s\LkLl$<\ 9t$TV HT$`H|$HHJHL$`L$PuUL@tL|$H H} H|$Hx H|$Ht LHĈ []A\A]A^A_ÃufW룉4M9@H@ BLD$(LL)HH|$8M9 CLk L Ll$<u L1L9ADHA wxLH uH\$ 9L$Tr!HT$`Ht$H|$PHBHD$`A!Lb LK DHAwaLv<Ut@HT$`Ht$H\ |$PLBLD$` 9L$TrHHT$`L ZL DHAA@tH\$HT$Ht$LLHL)HD$0LH)HD$`H[ HD$hPAVHD$PHD$(PHD$PPHD$`PLL$PLD$X_ H0zH|$@HtDH|$Ht5H|$Ht&1L+ L[ LHu.Hé H W H W ~٠1HU ff. AWAVAUATIUSHH(HDL+LLsL` HH L=E LI_ ιHHjDH}HNDt0H% H IH6H.H(L[]A\A]A^A_IFfInfH:") $H9CID$ H@H9E(u&H} HCtH3 H Ifo$Ht$1H I{ )T$I]Cf D BATUSCL_IIAH5 L)H- H I9I9tCMXL)I9I9tCIiHE HCHz H9oCIXH; aCH9XCHDHHHE Hh-HI轞H赞L[]A\ff. fHAWE1AVAUATUSHH=9 H8LD$(HL$ HT$(LD$ LD$HD$* CLt$(s AN AAAAAEAE9.CHSHD$MNH9 HT$HLD$ M5 L)HL9 @ @@ H0 B@ CI0E9 Au<J<LLHII H E9 H8[]A\A]A^A_Au9MLLHJ<I6J HH81[]A\A]A^A_ &BH =BH[HDHH;LLDDLD$L $G L $LD$HI+ BLH$H$DLx HT$ I1E1HT$ ff. fHHwH AWAVAUI1ATIHUSHHXcHa H H@ Hx` hGgIHSH H HH H5 7H9h HsfLS HH Pr H\$L$Ht$HD$ HL$ HD$H D$(D$8H I9 H I EH~ I)EL2M4<IDHE8m I AJ HHH IhD8HDI AJHHH IhD8HDItkAJHHH IhD8HDItLAJHH D82 It2 A IIL D8uIxH)HL9u D 1Mx,L1E8 tmALIILuyHT2I9}1Ht0HCH Ht H@H HD$ H+ HX[]A\A]A^A_ I D8t7ALIILtHHI9`1IEHI EzE8|uI E<*D8<)tL9u IxH 17H1HщŅ= Ht$L$H\$H L9HXH9uYHk0HCHP0HL9iHH?HfDALL HHH?HHH= DLL1H@ [HcI/u uHbA H~ I)E\2M4<HD8EIA H HRH5L H81.HA ILLL; HHH?ff. AW1IAVAUATIUSH(LFL HT$M9tH5. I9 IT$IGHH9 I1 HD$H- H Lt$Hl$L-n I9D$ Hl$IW HHIG(H9 HHuHt L9 H9rHXHuHt L9 H9WHX HuHt L9 H9|<HX0HL9t H H@H9| HHHHtL9uhHH9~HD$H([]A\A]A^A_HHl$LpHHLHD$LH H8 t=H+ HCHP0Hl$H9}HHH HH0H|$LHgtBHD$LHLhHLHP BuH|$LHgBHIw(I LHu LLLL; tH(LL[]A\A]A^A_EP IT$H|$聕Hy1HD$ff. fS10 HHt11V HCH5DH[ @ USHH~HHFH>DHH8DHC8HtWfH/CHCHt5H;-X t,Ho H9Eu:H{HE HkHt躔HEHC 1H[]fCH~CHH\ HHC{1HC AWAVAUATIUHSHH(HD$HCHu ICC AUATUSH HnFHH@H= w%Hǜ HcHHDH H[]A\A]II tCII<IHcHPHt??A?HhXD` MtDh 멿 HtH@ XEEfATUSHH`HGHFH8 j HHvH H. H H" H.H9t HW HoHHT$Hbi H|$HT$0HT$ Hl$ HD$( HD$8 HT$@HD$H HD$P HD$X H HSL$*L9` H8HK EH9 Ht$HL Hsz@ Ht@ LcL9c 3 H|$Lc Ht0HGH Ht H@H HD$ H/ H`H[]A\ @ HHyHHHD.HD)H)H)HHHwLHhT ODHSHCHK H9!DHt$ х Hl$ HtmHCHPH9u6Ho0FHGP0MD.D)D.fD)H|$Ht$H|$H H|$HH HVH5vE H81<'HC6Cf SHwH8 DH{Ht 1HS訐H{(Hu H{0 CHCH[H@ 1HC(xf D ATIUHSHHCHN I<$H;= = HWHB`H H H H0WHH HEHCHUHM H)H H9 H<H HM HD H H@HH# H []A\f D H Ld HHU1HɲH Hx LHr HHH1u2ut []A\ @ f Ht D t+$H H} HUHM H)1HHEHIH=HHH] @ H Hh# Hh# L` H;XtH H}8 uH]H H HRH5V H81$1A AWAVAUATUHHySHHHD\H)LD$Hp A LRLHA8LEH NMIL LjA8MDH NMIL LjA8MDHtkNMIL LjA8MDHtMNIL A83 Ht4LbL4A LMHALIL D8MDIs @ H LLl= E1I1E8\ t?ALMILu]HDH9~EHLE[L]A\A]A^A_ D H HL D>D89t4ALMIH LAHDHH9{HyIE1Ht1D~D8|uHt A F>F89u IL9L9uEtI^I1LRHL$II99HvE1ff. @ HG AWIAVAUATUSH8HF HGHVIIIHILHILHH1H $MHV H I Iw HCDDDDDDLL)H9 HH9 Hk CDHEHPHcCTHHDH҃HcH)H= k H=| HH9HMHjH A7 I)LHHHHH)I9DM6LD$IzHt$LT$GHH LD$LT$Ht$I HPH1HL HH1M LE1H3thHt/H CtHH H ?B|HICtHH H ?B|IHM9 D CtI@HH H ?B|HCt IHH H ?|HCtHH H ?B|HAt L@HH H ?| HM9iB|E1Hy2IHK HHT$(L苷HI Mo H|$( LH DEHCHHHHHBTHk HBHDjMc IHH)L9ILD s6Dt DtAֺfD!STH*H HL$dJD- L$H= [ f(H<$ yfW] H8[]A\A]A^A_0.H HHI)HT$LHD$Lt$HHE HT$Ht$LD$AL4 IxM A1MAAA I I It|ItTIt,I ALH H DH!DHTHALH H DH!DHTHALH H DH!DHTHALH H DH!DHTHALH H DH!DHTHALH H DH!DHTH! ALLGH H HHDHDALHD!H H HHDHBDALD!H H HHDHDCLIxD!H H HHDHBDCL D!H H HHDHBD CLD!H H HHDHBDCLD!H HDH HHBDC D!H H DH!DHBIE1AA$HH A| DEY ] HfTH*XAuA HH ?zHH H H8[]A\A]A^A_I~ILAG ?CTfIFH*H: CTfID$H*H^ ^XH4 ALH H DH!DHTHAwE1Hx TDH H 1HDAHe-E DE(G }I4I LL)w1jL$H= u&LY DDL$f.wqH7 H5 H81H<$ f_X RY[ HfATH*XH H5C H8輸1?Y u[ HfATH*XvH H f D AW1AVAUATUHSHHHL% I$H H^ L-S IL9hFBH(Z H; H H1I$H H9IHP M9oAI/ L;=R Hu( HIH}AL9hAH( H; Hu I$h H9u'H}HH+ItBHL[]A\A]A^A_H^^IHtH}HJLHρIH+uHCHP0E1HH; A AlH蒁Hˈ H5 H8E1lL ^@E1HH;5 A A9@f@ HHwHtH(H= D HAWfAVIAUIH1ATUSH H-W HD$(H\$@L|$8HO|OO: HD$@HL$0MHHcount HT$MHT$HD$E1D$UHD$ Hl$0Hl$8D$q D$aD H|$0H9tHt$ E H|$8H9 Hl$HL$ IHUH H- H H! HH9? HEHl$HHU 1HE fHD$PH:V HT$@HD$X HD$`H$ D$hD$xHD$PM9 MH I| I) HN I9 H I K E1HLI1HHHHPIH H HHHDH Ht<H|$HHt2HOH H HRH 1Ht$HH/ HĘ []A\A]A^A_1H $1HHH $- 1L1H uLcLHiLhHPDH?I JuFH =H9 Ho01HT$HH/aHOH$Q0H$MHt$(BkHl$Ld$(HL$ HUH HHB`Hr H H $fI1HDEH $H H= D$8M9IM1 LHD$HH<$HD$H<$(HH 11HI9: uHH9uHHI9ID$Hc@I/u @HE1HLI M*PH1Iι LHK|5 M) HHHV H5 H81HT$@Hf HHwHt H(H=4 1ff. fHGHt ~HHGHGH HGH 1 AUHATUSHHwH H(AHj cH HPHH w$Ht HHHDH H[]A\A]E1HxIH1AăH uHcHHKEu*HhHPH?H JuHA AIcH= A1H bHEhKcKAWHHAVAUATUSHX LxM L5ń H5 :IH RLHM RHD$0HD$ HD$I QHt$ 11IIaf. HC HLHHHCH)H^HFH9 HH' LH)L9PLHPM;M L9 IE IEH H H9Cv1HLL$(HL$Ht$ ?PHt$HL$HILLL$(HFH)H9M9PH1T$(HL$ HD$Ht{Hx HL$T$(tPHX(H M E1Ms E1LkPHD$If NKHHPI9tHPH0HtHHE LxH HkPHD$H 8L,(LL)HPHH H HtAI|$Ht3HWH H H@H E1M|$H/ IPI|$Ht2HWH Hn H@HS 1Il$H/ IPI|$Ht3HWH H H@H E1MT$H/g IPM9 I|$Ht2HWH H' H@H 1ID$H/ I|$XIl$PIHt2HWH H H@H E1LEH/ H}XLePHt2HWH H H@H 1IL$H/ H L Ht.HWH H H@H 1ID$H/tZL M9HT$ H9T$o HD$HX []A\A]A^A_H9 Ho01ID$H/HWR0IPM9H9 Ho0E1LMH/H9 Ho01It$H/H9 Ho01IT$H/3H9 Ho0E1M\$H/bH9 Ho0E1Mt$H/=H9 Ho01ID$H/:H|$LH|$H|$HH|$H|$LH|$"H|$LH|$/H|$LH|$<H|$LH|$MH|$LH|$^HPM9MK KLp(I\Ht} H9Cb1H KHT$E11f NKILHPL9t+IJAf LLBH2ItHLŅJL`tvUKJJK HHwH AUHH A ATH USHHw[H HPHH w$H| HHHDH H[]A\A]E1HxEH1AăH uHcH7Ht7Eu*HhHPH?H JuHA AIc1 AW1AVAUATIUSH o H|$HT$HL$hHL$`HL$XHL$P@gHD$Lh@ HD$@@ Lp0@M L1HD$hHcgM 1HD$`E1T$8H$<LLH\$hR[H $HL gIWugIM9HD$hHt$`H;p*gH|$PHuDH|$XHgHD$hHĨ []A\A]A^A_Ht$H|$ LO LpHfj AVHIAUATULMSHT$@HLL$0Ll$8HH HHH L9s_Hs"upHtFAt;ALfL.IHxLHHILHLH)HH)HHH[]A\A]A^I H9r[L]HA\A]A^郺AALLH~IH1MsH2s A8HH@~I:MH9|H~Hu&1f 2HH@0II9 ]zsAUATUSHHz H9G`yHfy HHIL@ I$ HyHG HIyI$ H9O(7yI$ H9O0%yHE H 1H[]A\A] ATUHSHGHH@`Ht?H Hu L%u L9t9[]A\L%yu L9uLoL%cu HH賰L9uLoHuH{H[- []A\0 ff. AWIAVAUATUSHHhHGHVHH HH HHH蘸LI荸LHHIIH(oL oMteLHHIHHHHHtHHHHHH HHHHHt$HHHH HHHHHHuHHhH[]A\A]A^A_HhHH~LTIHHH H HCH $HD$IGHD$1HD$ HD$H$LpI H$N, N(A@H~Hп@ H?)IoH- ApA< MV)A)HDHH A@ H I9 CD MFI9r C|HHH L9 CTDHH 1A E1HE1A L9t0JD IHM)HILHHLH)IH9 H $HT$XLHJz}H mH\$HD$XL<$H\$HXIH\$1ZH\$XLnHH $L9t$V H\$XLlH|$ . H|$ HD$XHh[]A\A]A^A_IMHILLMIH|$ HB H|$ H|$ <l11s@t LLMIHHMIIIHD$H H$H8U LLD$8LL$0L\$(bHD$H|LD$8LL$0Lt$L\$(HD$ H I?u L9t$ LLD$0LL$(L\$ L\$LL$(HHD$ LD$0{H$H\$Iw1Lt$8HHJ)HL$0HHD$(HHkH\$ HD$IHCHl$@1HD$HIHD$H9s[/IIHHIIMLIMIL)HىH H)?AZˁ?A]HH LT$IHD$HHL$0Hl$@LLt$8LL$(L)HHI9 HBHLD5 H1H<L9rkH\$Hl$ H<$HHE 9jL1jHYHH$MLt$IH|$jLpLt$Lp:<IIMH)L҉H ?A< H ?<HPMwLt$I L|$ 7H HD$H|$ yiH|$jiH HHD$XPiff. AVAUATUSH HG G @t$Lg0Hou H HL[]A\A]A^LgHHtHcHHH9LH1HD$H,H L@ 1f!E L HHH9}{LQ= vAƉAAA A= wnHGs f: HLA<;@yH8B<@yH847@qH BA|HH|$L) mHD$H []A\A]A^D D AAH DYL r AM3G,.DiM+AD AI8AIBAI40@qBA ff. ATUSH HG z VLgM G ՉHoH@tHo0HtHHL9WI1HD$HLP LM D GC 1f >C f7C HHL)HЃI D H^N \HHHItfIt0 D H^ \wHHHc D H^ \GHHH D H^ \LNLBLLM9 H\ BD H^wv\ۈIqAIPHJ BDH^wH\IqIPH; BDH^w\IqIPH4 u8fD HHI9]L)H|$ /HD$H []A\à Hf: 뻃 DU = +H o f: AHA L GDFAL AAGDFAL AAGDFH G> BDE = #뀃_ DU = *b- DU = VDQ DU = g& ~@ Ln HfNMA NIGBD = = 4@ AH ANH sn AL GDFAL AAGDFAL A AGDFAL AAGDFLA NA G D = \ND = *:D = ̅&uCDU = D = u:DU = >D = _H 11[]A\RD = ff. AWAVAUAATUHSH(G t$ ! LeH@tLe0HmHHH9pH4 1HD$HLH LH" E111E1L5z Lkt E1LHH9 AEuO+f xL~~ E:EtEuAt|$ At+A L x~vHII tLHH?AFAE x~ L=s E<?ES LFt+A A)DIH u A?B E1ۈLM@߃A8 -LI1LE1jATE%+< xL~~+LA = ILݡ I LHH?A<8@~+A Lt# H)ȉH IA?BFEt-HL)H|$4QHD$H([]A\A]A^A_Eu A|$ 6A,9I IA% A w; HE1fFZf D AWAVAUATU1SH H|$8Ht$HT$(HL$H|$hHl$HHl$@H) Ld$pI1 LE1E11HD$DT$1DŽ$ E1IH$ L\$ LD$PLD$8LL;D$Pb E0EE L@A+ A LD$8D9$ rJH$ H$ H)H~2$ H|$x D,HH$ LD$8E1qD L H$ DAF߃A@ HwwH IELD$8w HډHAHH!Ã|$ (= DL 1LD$8T$AF냃: Af GHH$ H|$ u E{ H|$ H\$HtE HD$L+D$hL H? H|$@H' L譑Hĸ []A\A]A^A_AFЃ D+ t H] |$ A-> ILD$8E1E1DL$HH+T$hLD$8HT$`L;D$PsH- ʃ߃Aw?H$ E111DD$A LD$8HD$ oD4HAF*Qр v+t鯀H+D$hH B HD$`LD$8L+D$hHt$HHD LD$XWATHD$HPHD$XPHD$xPH$ PH|$XL$ L$ h H0YH|$HHtZH|$@HtZH|$pHtZ1fHD$`HL$HHD$ H9$ uHD$ H$ $ vHt$x$ HHH|$@HH|$pHHD$XZHD$IZH<Z1HA+H>IH V T$LD$8At$LLD$0LD$0LD$8IH ) VH+ LHD$8 $= ~t$ L ց eeQHt1HHb H W H W |$ uw tkHtfHD$Ht$HH H HD$XPATHD$HPHD$XPHD$xPH$ PH|$XL$ L$ e H0}H\$H#ff. @ AUATUSHHL%Ta Ll$ LI$] Hғ|$ HHH|HHt:HCH;\ H{AH0XH(XHD[]A\A]HXAff. AWAVAUATUSHLG0LoH_ IWHo(u|IH~ H;; H{ HHHxFL4 HJI9L uOH]Ht)HJK9L5u2H]HtH)H I9L uHsAD$0 1 @ L4 KT5 H HqH2HsH9 H9 HN$0ITHI|$IT$H/ H9 KT5ITHI|$ IT$ H/ HSH9~[KT5ITHI|$(IT$(H/ HH9~0IT H|ITHHTH/ HH9 D H H[]A\A]A^A_ D HyK|5H{H9HyK|5H{H9 HIL HHH9HWHD$H4$R0H4$HD$H9yHWH$R0HSH$H9XHWHH$R0H9H$ 7HWHH$R0H9H$H{HHT$腙HID$ HH$[UH$HT$HŐHID$ 1H9IL ILHHLHHH$7H$Hff. U1SHH-HHPY H9E 1H;-\ Hm t H[]H AVAUATUSHoLw H HEHL HG0H9GIIAI9EuwHAHtcHKHS(HC0HHSH9|eL9~Eu[[]A\A]A^HAHHt)THC0HHC0H;C|IAL9|EtHkHt1HHCS1Lsff. Hc?ty ff. AWAVAUATUSHLLg(M H H I<$ LIHtr1L9}@HE LsNlMtL#Ht3IDHHE0H I|$ tHL[]A\A]A^A_Hm 1LHuRE1I$ 1L9}HE LsNlM Ld#HtI|IDHRHmtHuHE0HU 1LH JLHD$iRHD$}H`HE0HU LH HD$1JD4RHD$HE0H nff. fAUATUHSHLcgH_A8]D;c S H{C HG H CC JD(H EH[]A\A] HC H H=* Lkk IHH@ HH@ IE Lh Lc LH}HH]H/t'KE E15JD(H EdHGP0H]H!1C 1Aff. AWIAVAUATUSH(HZ H5W H|$HHh`H9T A@f(fT )& D$f. ' f. H|$ D$ 1ҍf(f: f.z XPf(f: f.z XBf(f: f.z XBf(f: f.z XBf(f: f.z XBf(f: f.z XBf(f: f.ztoXBf(f: f.ztVXBf(f: f.zt=XBf(f: f.zt$BX 9? tD$ f/0& & f/ H,IHc HHDt$ DAHHcIHrHEXLEqHH+H H7 1HL Im I Hm tsI,$ H(L[]A\A]A^A_BLLI5NM 1HL 蚬Im I H+t MMHHCHP0MtMpID$LP0kIELP0JHCHP0HDH&W H5 H8E1& IHH=R H5 H8ւ^ D SHWHHt&HOHBHH HHBHgHG H H[鬵ff. ATUHSHHtHE H/ M~G1 9]~8HcHH|HtHD H/uHGP09]f H] HE H L%* L9c H;u}Hk H HHC * HtdL9eH} uHH] 1HHU HU * Ht7L9cu)H;u#Hk 1HHC H* HtHHHK[1]A\HGP0ff. F1f/GAWAVAUATUHHSH8Ht$ rXH% Ll$ IIAH cV I Ht$(LR H\$(L9 A-F 1҉T$A+b A>0uAF<XuILH= B<6w< _ H.P FH^H̽ 0<6w D < xCH0<6vL{MML|$(I)M)# HI9<P CH{+ H0< CH0< v 1LL$LL$HH5 M~+IIL94 IGH) 0<6w < M H>H9 H?H9 MkIqLL)II<L9 0<6H | HH HH9HMH5I9 fH ! IH HF Ht~Ht<YMHI)H)L9IL 0<6fH*XYMHI)H)L9IL 0<6IfH*XYMHI)H)L9IL 0<6 f*XH YMHI)H)L9IL 0<6fHVMI)H*HH)L9ILX 0Y<6fHMI)*HH)L9ILX 0Y<6PfHrMI)*HH)L9ILX 0Y<6fHr*XHDƅH <R uxL9 |$ tfW 9H;-"N HH8H[]A\A]A^A_ÙHpD$ IILH)fxHoI>LL)H1w1D$EIHL)й f HL a HHHѺ A6L9 LH)06DAfH*XYH9I9 LH)D D)A0A6 Hܸ EfF D!*XEt/ Dtq f*XH A<f(8IWH)4HH;J H5 H8z1DHHL@Hu HpL9|?HpHxL9MI)E A0A6VEB< GHL9HHL60@6 @2IH?N H5 1H8 zf ;ff. AUIATIUHSHHHtHH9urHG @u{UT HٺI9 1f D HcH|(H~ALAԅu19]H} H. HLL[]A\A]HAԅtH[]A\A]ÐHH H HGiHHGE 1L-8f D 9]~AHcLd(MtID$ @tHH Hu9ID$tHID$9]H} HttH[]A\A]O L9uRA$ % uHH9uA % 1H} HtH|I9L1H|$H|$ D ATUSHHG8 Hs(H H{ HtMH9 (IH HF I9D$GI,$ L;%8J tdHs(H{ HHHHs Ht H3BH{ HHT HH Hs(H¿ 1腠HHAH[]A\H{HHtZH{H;=NK t8HHt8H{(Lc0HC(Hk0Hu MLAH AHA1L f D AUATUSHH_H9{8 H{0 Hu^H{HG IH H{H;=J HKH H{(Lk0HC(Lc0H M Hs(H}H9t@ yIHtlHJE I9D$E1L;%H @I,$t~~BHs(Hk0HC0 HtHC( H.tHH[]A\A]HFHP0U1H{(H Lk0HC(HC0HK?@AL2@=L uL1@ @ SH臊H?H{?H[錨ff. AWAVAUATUSHLgLoID$L IEL LAHHtFLAHHt<HD$H|$?~HH[]A\A]A^A_Hc?t1H1Q?ff. @ USQȘHHt+HG H Hh 1蓝HH?HHZ[]ff. UHSHRHVRHL$HE1E1j HHZY RH+Hl$t HH[]HCHP0 HB H9GQHG H@``x1HHrTHG THGHuGHH]T1HtHH1ɺ E1HrADLMI MMI M9uMڅy H?I9tHtSMxHIHȖ AVAUATUSH [wH_HCH= w#H;F HcHHDH []A\A]A^E1HxgII tiHH<HHEAHcH賞HvEu?Hh?PMtA?H<D` tX HA 뎽 E1AIcff. ۈff. SHWHHuH{HuH[,<<ff. ff. 1H9 Hff. ff. USHHHD H@ HG t H@8HHuAYHH[E111].111HH1HX[]ff. AVAUATUS HP =p W` HDk IHu}C`DkH"HHtZDcD;ct/HSIcH85t@ Dc H[]A\A]A^H_ HcSHCHЃ85uDk L ff. AVAUATUS HP =p W` HDktIHu}C`DkHHHtZDcD;ct/HSIcH8t@ Dc H[]A\A]A^H^gHcSHCHЃ8uDk L/ff. AWAVAUATUSHH P =p {` DcMwHHDs`EAC9C HKHcHу: tkE1DcHs LuIH1M)Hz HL[]A\A]A^A_HL IT$AH IcL9}H߉C/HtDcHE DD;c HKHcH8 t A UH߉SIHt߾ HHHDcLhHչ A DM;C HsHcHփ: HH $CH $HHL9tCJT IAHHHT$H4 H $~HkH $HT$HH\CWH\SHH $\tCH $1 AWAVAUATUSHH P =p I{` ~ DctHHG{` ,HHf HE HDkIH H}IHL`HߋkIH> LIHHyL`SA A H߉T$ M{T$ HI M9 Nd SIDkA {` Hs LtIH|M~ZH@HU HItIID$HUHPIt6ID$HUHPIt# Ht IL$H4HcL9|HAw HL[]A\A]A^A_DcHE1w ΉSM0܉kLA MHJ4 HtH!fH=)+ H"+ H9tH; Ht H=+ H5+ H)HH?HHHtH< Htf D =L. u+UH="< Ht H=R ydL. ] w 1HHfo H HH1H) HH fvǂ HBH ǂ HB H H ǂ H B, f. PHWHP fF fo6 H HP dž HH4 F` H Zff. fPHfH dž fo H fo HF HF H ZÐATUSH0L%e. H[? HOH1H L1HHKe. & 1HHH7e. Ht H0[]A\/ff. @ HwH1 HHV B HBB ff. fPIfo H A@ I@A Zf D AVAUL- ; ATUHSA} H·E1I H! I H1HhHHX1[]A\A]A^ff. H: H@ HHH=7]. * f. =]. St2 HH1 HQyH[_ ff. fSHA E1H1HHt$HT$HH[f. H(Hc1H<$HD$ Ht$HD$) H( @ H1 f D AW1AVAUATUHSHHIIJ|= /H7L%:7 1I$HIIJ<0 uLl$1HT$LHT$HHH9߇HsH=b. H}HI4$H95b. tINHr HHHIIOH1LHb. I$L1 HH[]A\A]A^A_ff. ATI1UHSHH H <$ HHtH HHGI<$ 1HI $H H[]A\ff. f=ua. SHt 1H[H5&8 Pa. _ ff. fH8 @ D S1H H[Ã=aZ. tSH fZ. LZ. H y HokuH 4Z. [fSHH@H $\$H@[.j ff. AUATIUHSHXHLl$ 1Ly H{LHv HHsL10 HE HuH] HX[]A\A]HH@HuHZf D USH8HtH H5RH HDHu11Ht$HH<$HL$HT$HD$ u31H8[]ÍC܆H5H lHWH*륉 D AWAVAUATUSHH H|$HT$H؉Ld$PHL|$P H-5 ED$$~L$ E LtHL D$$ LH|$paD|$pHT$xL$ EY$ 11|HHRn IHH$ HHHD$0LHo $ t1^ H$ 1 D$, HD$ H DŽ$8 H$0 H91 D$(H$ H$H$ HD$H1 H|$ D0tQHt$H<$HG D$ fo$ H$ L$ fo$ )\$p)$ EN D$ H<$Hދ$ D$ $ D$ H$ L$ E $8 $ ~$0 $ fք$ f:U H5E \ D$ HHE A $ y 1$ $ E1H<$ $ Du*$ H5 H$ $ $ A A9 E1H|$t LD1 zLHL/ T$(H߉. H|$$ 11H߉T$pHL$xfoL$pH$ fo$ )L$P)T$`NLH } u$4 $ $ $, x H51 xH!4 ɉ x H. $ t$$ w1] HHX N H H|$ HE1HD$HH []A\A]A^A_1 مE1D$ H|$H5; ~ H$ H5 " IH$ 11xIHt.H5 HsrH5܄ Ls[$ 1$ Ht$0D$ LA< |$,D$ D$ XD$, $ yHs/ $ $ yHy2 8 $ H, HDŽ$ x$ DŽ$ |$$ $ AtA9 鲀餀Â靁 @ ATIUHSHHpH<$ AH/ x t 1HHpH[]A\A$t} LL$@L AD$`At$AL$AT$ D$Dtt$HtL$LtT$`u1LH HtWHLHnLL$@LLL$@L1D$@ D$PH HD$\ HD$HUID$xfLHHT$ D$(HD$ I$ HD$8f AWIAVAUATUSH1HXH o Lt$ H$H L)L$HD$H%HIHGIH1L\ A? H$foT$ALJx IX ILJh I A Mg Mo@ HI IGPHD$A I 1HXH[]A\A]A^A_ú H5 Lvc D AT11USH |tHmH5 HHot!H5ـ Hot1HĠ []A\ÿ bHH 8 Hl$ H[ H ~ H fHnH H\$0fH:"H )D$0fHnH } fH:"H~ )D$@fHnH s fH:"Hm )D$PfHnH c fH:"H_ )D$`fHnH _ fH:"H= )D$pfHnfH:"HB H$ 1H$ )$ H3HHdntH⻀ Ld$ Hl$ LH\$ Hׁ uff. fAUATUHSHH ILR<$ u|LL$ L/HLLA<$ u[Ld$PL~{ hHKHLL $u LL $uH|$ L3 $fo$foL$HE MH []A\A]ff. HuH5"V HÃuH5BV HfLTHHthL , E13fH9tEuYI9tjH+ HL@:t,E1LAuŀ.tQHtIA L I9tHP _I9tH1 @ S1HH H$1HT$HD$HL$J H H[ÐuH=U ÃtuH=<U H ff. ATIUHSHH Hw<$ HSxLH H H[]A\fS1HH H$HHD$D$ HL$H H[ff. @ H H=qU ff. AWAVAUATIUHSHHHH $At{AuzA 11HwHRH H9LxJ< )IHLHH/HM,$HtHE 1 E1댸HH[]A\A]A^A_ff. ATUSHH0HLd$HL|$ -1HT$HLHD$J |$ Ht$HFd tL赤 |$ 1HH0H[]A\fUSHQe\H H9H, HHHHHZ[]f. f ATUSH IL<$ H ' x u/Hl$ HHL\$0 $H ̀H []A\f D 1|$ D ooFHF HG G AWAVAUATIUSHH8 Ll$ H$1Lv|$ H$ H{HHL= D|$ oD$(E 1HL D|$ oD$(E H & { +{ Lt$`HHL7 D|$`oD$hEHC =N. u5$ N. u H=" 11Ҿ X9 HL9 D|$`oD$hE)H|$@ DH|$HP 9 : HHH LHD$ D|$`HT$hHL$pEEH|$R= HHHD$<? Ht$LO? D|$`HT$hHL$pE H$Ht$H|$H0@ D|$@oD$HEu_ LfDC H)$ fo$D|$ D$(foL$ foT$0LA $AT$H8 []A\A]A^A_5H$ HKH5H! 1iC HÞ& L2Hukff. UHSQ^HXHyHt HHHZ[] D PH5 j& Z AT1USH0H/H1HHHuH1H0[]A\H} Le~HLsΐAV1IAUIATUHSH ~ H>HD$HD$tH1Ld$趽HD$Hu1ހIFLH<H{HT$HHHD$I9 L foL$AM 1HH H[]A\A]A^HFH|$Ht$HHD$ yZ n% D AUATUHSHH8tN AtDC$AtDK(Lc 1H, LcE1H % Ll$ H=B. H D % HsH;LD$ cu8mt3I X HB. H|$L D$t{ {$ {( x]H5, LC H{$H5u H 1HH8H[]A\A]ÃE,1s$"H5+ L H4{$H5u H {( i1C(_1҉S$OC ff. AUATIUSHH>Hto1HHH$9HD$IH~1H9] ~%HEH<H~ID HH $L fo$A$1H[]A\A]L fAWAVIAUATE1USHQL/M91ZH[]A\A]A^A_HC= J,HbHu#HTILLHYtIH)HIC< tU1SHQH{H9+躼1HHCZ[]H<H蠼ff. tQH`Hu1Z1À8 tZAWAVIAUIATIUSQL= A }L=#" I9~J,} -~]~H5) HIem~H5( He~H5@* He}L=! L}HH-: -}Jm}H='* "aH }x:u2A |Ha! I9|HPID HH! H?. Z[]A\A]A^A_ QuH=-s O_Hc~11 eHHtH5 Y`Z@~f. H yHBfHnH5ffH:"fHnHfH:"Hl. PHcH1Ҿ 11Ҿ 1Ҿ 1Rf t H H9H H5H tXHH fHn H=H HHXH H8 H ZfH:"DH fHnfH:"AH SHHH H[ff. HH fHnH fH:"fHnHPfH:"u;H9H H5H tjH`H H=aH HH H H Ãu:H9G H5G t*HPH H=QH HG G G ff. AWH AVfHnHn AUfoATfH:"IHUSHL.) $I9}H=~I9HHHINIH}H}J4 ̸IH}H I L9}L91 LHE LuHL[]A\A]A^A_ÐHH1鳹 AUIHATUHSHH( oU IHHMXHSXLHEHCHEHC o] [ HE0HC0HE8HC8E@C@<$ f}H H HL<$ C}H H HL<$ }H H HL<$ |E`HuxH{xC`V|H H ;|H H |H0 H0 |( H@ HLH@ ( <$ b|HH HH HL<$ ?|HP HP HL<$ |HX HX HL<$ {H` H` HL\<$ {Hh Hh HL9<$ {Hp Hp HL<$ {H H HL<$ m{HMHHSHHLo o o <$ {HMPHSPHL<$ zH H HL]<$ zH H HL:<$ zx H HLH x <$ zH H HL<$ bzH H HL<$ ?zH H HL<$ z HuhH{h H H H H Sy L 1H(L[]A\A] D SHHX1H HCX1H H ̳1H H 跳1H{xH H H H0 1( H@ mE1HH L@ WE1HP LH AE1HX LP +E1H` LX 1Hh H` 1Hp Hh 1H Hp ֲ1H{HH IJ1H{PHCH赲1H HSP裲1H H 莲1H H y1H H dE1H L NE1H L 8E1H{hL [T @ AT1U1S\HHxH=i HVHxL%q I4$Ht|1[Hx >JHx8 xM$$ H=i LjUQx)x Hc[]A\nx AWAVAUATUSHHX H|$H$ T$L1$ n; H{h u H{xo}HsxH{h }1H$ {`H|$HH DŽ$H H$@ L$ L'Hx LHX C`KSs t$ t$ t$ t$ H$ D$ D$ $ Ht$HHD$$ }$ H$0 L H$ HLHD$8H<$C $ ށ$H ~$@ C $L fC f~ 1HD$`HD$hHD$pHD$xH$ H$ C` H|$H, $ HD$`L$ HD$0H$ $ zHD$p{ HD$( H$ L=4. HD$ M H=l4. 1҃{ H$ H$ @ LD$xHL$pHLH$j $ LD$hHL$`HLH$B $ ~ }L$ H$HLH$ $ ] H4$L LL $ }L: 1H$ fo$ H|$0L$HHT$@H|$(H|$ HT$@L$H$ L$ fo$ H$ $ fo$ )$ )$ V L=2. MyH=2. DsE H5? LH{ y4H5sf DH H5A LH DsH5Rf DUHmH5E L}HU{H57f %H3H5E LMH{$ y={H5f HvH5O LHgvH<$ 1=V y0{H5e HyH59 LH_yH{X uvH5j LHxHSXHLL= H e < $ fo$ H$ H$ fo$ )$ )$ IvH|$1 t0T$LH|$HC $ H$ H$ F{{ C {$ y1ɉK${ ? H{H H LkHt ,LHL| $ ~H{P u%HSPH k HL$ H|$ 1H H 7. H H uH 6. H {H5.d H( H u!H HL $ zH H t uK11SIHA}H5 H&Ot#H5N` LOtL' |H X H HL$ e|HSxH H u:H|$H HH J $ H$ H$ t s{`uC` H$ 11H|$L$H$7H|$8-H$L$$ HD$L$ fo$ $ H$ fo$ (pHD$HX []A\A]A^A_1s YH H` D H H` D H H` D H H] D Ht$01DH` D$`f |$` vHt$(1H` DD$pA |$p |Ht$ 1H` D$ $ |{H5` ,H|{H5` H{H{8 u<HS8HLL9 H s` $ H$ H$ rH u?H HLLD` H K` $ H$ H$ crH u?H HLL8 H ` E $ H$ H$ r{ Dsy-DH5_ IH {E1E1DsDCLKH5_ DHtDs(1H<$HT$PL^ Ht$PH ^ H $ `tLt$PM#L|$X1H5 LLHL$X]LHH HT$pHt$(L$ fo$ fo$ )$ )$ 0tLH50 1KHL H{xH MuH~L6H E1] H 1D$ HD$`H8 HD$0L=(. L|$XLD$X ct=mE x H HcHHsxHJsH u_H=(. <H, HFH^mHUH5b(. HHr HHHtH HT(H |$ ssH L5I umH ucL9sx~lH H59 J,HMtNH uDHgH HlH uH u L5 H- L5 H|$H $ L$ H$ $ qHCx1H$ H$ I9 L)H<$LH$ H JH$ "mH u,H H=n u"H{xsfo$ {xH=> eHHkrL$ I? I/ǃ 1C WHsxH _ L$ fo$ H$ H$ fo$ )$ )$ xmH H{P {u H C{uH 8 C uH uHS uHS uH uH uH uH uH{ 8 uH\ 8 uHM 8 uH 8 Hs 8 C 11҉CHSH JH=v$. H H.MiH4$H ! 1L$ !iH$H X HL $ oNj H LHLg$ FHIHHh: HCH x LpgA} gH u+H LHLL$2 $ H u-LH HLL1 D$ EfLqA} tH u'H LHLL1 $ uH uL5PW xg gǃx E1D E1D z~ ~ B ffփ \ S JH K". HT$`LHt$0y$ fo$ fo$ )$ )$ {gH{xH D$ E1D L- LE1 [o1 1H$ HD$p HD$(H$ HD$ ~mymE1DCq eǃ V1퉫 IL1n!nH= f6nH U : : 1H= 3mL1nH- Hu n@H kU 1: : H= 3Hu A@H=z 5mH- . H5: HFnSnmH L/ HL $ oH 7H $H L. HL $ 5oH H f D AWAVA AUI1ATIUHSHH8H|$LD$t$ A H I9qJ< fIHmq1HD$(IHL$(H$L9l$s H $H|$LL| uRL9l$uKHD$(1AHtHM<$1H8[]A\A]A^A_AuD$ E1]AuEt-HD$HHHL$HL$( Hy H|$(A]|$ pL$H|$ t $pu)HD$H5T H0Ht HD$H)HEHD$HT Hff. AUMATI1UHSHH8H|$n|$ 2pHtHHt$!HH-pI<$\ 1HI $H8H[]A\A]ff. UIIISHIHI<L9rb f D = u p]?2 ^?o H7HwȉHL9F vq= O = R = oLH)HwpJjrY?o= M ]?T9o HHHHAH HfHnHH HHfH:"HfHnHfH:"HH fe WHH(G WHH8H0G WHHJI9aL9t%An1L)I[H]I911= wP LH)HnJq?n= `n= ]n Qn LH)HmJq?mHHOHmwnfHY 8 t1;ff. ATE1UHSHH0L9e 1HH0H[]A\HEHH|$Ht$J 7|$ nHt$I벐S1HH[USHHH Hu 1HHH[]Ã?/tHHt$c mnH|$ rnH ÖHD$ HH 1f AUATIUSHAQ~ tHHM:Hu 11HI $ ZH[]A\A]À8 tMHLHHڐATE1UHSHH@I9| 1HH@H[]A\K H|$ LD$HT$Ht$% |$ mHt$HT$ILD$ D ATIH HUHSHD mHH1 mHU HHLwL[]A\ff. @ AUATIUHS1QL/I9 1Z[]A\A]HELH<>AmHӐAWAVAUIATIUSHXH K!. H. H C!. H H ;!. H H C!. H_ H ;!. H H . H $!. xA$ A$ HnL H$Hm譵HHulH$H5ɓ H>smH<$]8 H=X 謷 IHXmH) I9GmH^N H5]N H l1H5LN Hp lH IN H5M HH违 lHH58N H襝 elH H5L H臝 GlH& H5N Hi )lHM H5|L HK l1H5M H2 k H5M H覝 k H5M H芝 k1H5M H k1H5M H訝 k1H5M H菞 ok1H5M Hv Vk1H5{M H] =k H5tM HA !kH H5nM H3qkH H5`M Hqj1H5OM H jHM . H5@M HΜ jA$ H ' D$<111Hs:IHjH3HHpajLH H; u|$ H H= HE111H|$:HH$jH|$HH7H9pjHYH H5L Hpi6 H5kL HHoiLHH^ LHHjHH4$L iHI$ H5G RH" 1LHXL[]A\A]A^A_I$ H|$0I$ L臺D$0qiI$@ MH|$0I$@ LRD$0,kiI$h H|$0I$h L D$06iHX H|$0HX D$0iI$H H|$0I$H L踹D$0h= HH 4HgH5 H8t$H5 H8tWH&HgADŽ$ yI$ 9H|$0I$ L D$07h1A$ 5ff. SHHH HuH[Ht$ H D$ XhD$ 9}ۉfAVAUATIUSH@ /YhH5- H7Bh/ 1I剴$ @ L HhL%HH%IH|H H9gHkI$Ht0HH L1J HHG/ HB1gHI$ff. fATI UHSH H\$H2HgHHt$HH|gL9d$igHLH$H*H H[]A\ff. = uPa ZË ff. ATIUHSHH|$H1E1ɺ HDHt$H.HT$: f;"f HH9fA$1H[]A\ÐAUIATIUSHH(H> t uJX HHfHHLL[H#fo $foT$ SH(H[]A\A]H= 7HfH b$Hf8 Hf11Ht$A fHD$H UH-( SHQHu HqfH0hf Z[]ff. fATIUHSHH@Ft H Ct1҅H t H t H8 t H< t H t H t H t H t1ɅHt t1H [ @Ɖ1 t1H M @Ɖ1 t1H ! @Ɖ1 t1H } @Ɖ1{ dH5 tbe eHCHSh1I$` C H$A$x HCpLd$LHD$DzHH=-. 1Ld 1HH@H[]A\ff. AWAVAUATAUSH T$Het^=> HHeeD$II߃D$ -I1AU EdT$ LLC)H eI)IM1d AU1ATUSHH8H~ HF8Ag 1HH8H[]A\A] ? u!S1HH,(hg 1[1 AW11H5 AVAUATUSASH-* L@ L 8g膰IH.gH} ̓Lu8L}(IFHE8M H8 H]0{P H](fH H Hk(fHnH H Ls0 fHnH flL; fHnH flLcp fHnfl \H H`# H` H9HPE1E1E1E1E1E1D LHE1E1E1DPE1E1HHHJLZD`0HH8Lh@1BH1HBX1B`1HBp1BxH Dr0HJ8Lz@HJPHJhH L D H L H9VCP H H} H`ZH[]A\A]A^A_þ 2HHRe H5R- H1CX MMfeH HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ H$ HD$HD$ D$0 HD$H f HH>H9gA_pHH9 hHi ʚ;H~"HII)L9gHH01t H?II)L9gHH0H0 HH~ HHH)H9|$H1H7t H?HH)H9~ggf. S* HH@HHx(H8 H[ff. AVh AUATUHSLo( RIH I} (HEHUHHEH D H H]EGgH Hp HS轄H fnE`C H H@ HCxHP fpHC81fC fH8 ( I} 衒EuL贃I[L]A\A]A^H & I|$H5 LHA I $H b I$` LH)H)h H1AL$ LeIl$I$ L"ff. fQ=. Hf 1&#ZHfH t8UHSH_RHHuHHfDž X[]H HH8 麑f. AUATUHSQL% HFI;D$0ufLh(HAx eHCI;D$0uEHx(HHH H8 IHCI;D$0u L`(EIh L& H^1H HZ[]A\A] U1SHHPR e1H eH-J. H{ H eH{xH eHC C X[]ff. @ HH ff. @ ATUHSZfE1U1f ] D É][]A\ff. AWAVL57 AUATUSH H LfH|$ Ht$L;`0uQfo 1HD$p k2 H$ U2 )D$pHHHH H9uH HD$011HD$ɒI$X H m1豒I$` HlH|$ lH6 Hl$PL;`0 =. u;H ȟHC0Hl@ lH8H;HuC. Hl$P1 1HL-3 H L;`0` I| fskHHju1۹ HH L;`0% H=F )-kH=r jع HHB L;`0 H= jH=|2 uH5;' H=T2 e Lj u 1A$x HH L;`0p H=i tiH=U* `iH=* Liع HHy L;`0 H= aiH=s2 uH524 H=K2 d i1۹ HH! L;`0 H=X hH= ~hع HH L-4 I L;`0upI} w hII9uH L;`0uIL-j E1H\$pI} 11Mg JH_gIIuE1J<IIu1 H蟞I$ H D`IH/fH 1 I$ HH~'fL.r `IHeI$ HHE' gLs _IHeI$ HH 'fL _IH}eI$ HH&fL Y_IHDeH n I$ HH&DfLCl _IHeI$ HHZ&eL ^HHdH I$ HH&ZeHg ^HHdH I$ HH% eHo `^HHKdH I$ HH%dHJh ^HH dHE I$ HHZ%sdH ]HHcH% I$ HH%&dH ]HHcHM I$ HH$cH `]HHKcH5 I$ HH$cHJ ]HH cH I$ HHZ$HcH \HHbH I$ HH$bH \IHbH ] I$ HH#bL `\IHKbI$ HH#qbLQ '\HHbHt I$ HHa#'bHn [HHaH I$ HH!#AŅaHD HH L;`0uuH=. uH5 H=. ^ #a1۹ HHB L;`0u5b H5 HH HH Wz`H?H|$1 I$ (IH_H- H H- H} H؇ wb IUHH 1H} H HTb IUHHBH 1H88b IUHHBH 1H8 b IUHHBH 1H8 b IUHB 1H< z_HHuM$ I$ uYI$ HM I$ u H= r QI$ H^1 I$ HZ I$ mI$ H 1H|$ HD$LpLt$(ɗH]Ix H=} a HD$H]H|$fHH]H HD$(H5B HH Hx Ux]H H87 e IH\HH HH ; \LH53 HT\LH|$p H5< Hte HH HHH5>3 fTHAE[H5 r H3e HH[HHH5 3 %THAJE[H5 Hd HHe[HHH52 SHA E?[H5 w Hd HH$[HHH52 SHAEZd HHHZHHH5 dSHAEZ VWHHZHHH5E2 (SHAMEZH w H5)2 1HH=%2 %hHHXZHHH5 2 RHAE2ZH=v 'HHZHHH51 RHAEY VHHYHHH51 ]RHAEYH=B 譓HHYHHH5q1 RHADEzYH=[1 oHHbYHHH5C1 QHAE<YH^PHH!YHHH5 1 QHAEXc HHXHHH5 iQHAEXd HHXHHH5 2QHAWEXH=- H - uH5f H~X 7 H>pHH2 @ THxYH HC\OHiYHC / TH8YHC(1THbXHC0CB THAXHC8H=. ёH XHC@Hc= XTHWHCHHc= ?THWHCP1+THWHCXHHH50 OHA!EWW SHHAWHHH53/ OHAEW1IHWL=B 10IH HLHqVLIH<HuL:wVLJLH_HD HHH5. OHA9EoV1 HHYVE1L= K<GHFVJDII1 uH= 1HH5 DHIMUHLH5. ~NLUH=. ЏHHUHHH5- BNHAgEUH=/r 蒏HHUHHH5- NHA)E_UH=- H a- u H5 H[U H mHH Q HCQ HC QH=>- HC(1HC0~QHC8HD$Hx` UHHH5k HMHAmE\ IHTH=, 臎IHTHH5xD LLL$ $TH=, GIHsTHH5, LLL$$KTHH5 LL1T PHHTLHH5~+ aLHAESH=&, 豍HHSLHH5, #LHAHESL` LH,H* HHH5+ KHAE<SH=- L-- u H5Ф L8S HD$LHXjIH HH` RHLH5,U ^KL` H=3 谌HHRHHH52+ "KHAGE}Rc HHlRHHH5 JHAEFRH='- uH5ƣ H=- :R 1}HH HHH5* JHAEQČHHQHHH5f VJHA{EQ1{}HHQHHH5E< JH߉CzQHD$H@`H$HdQHD$(H|$H5 Hx Hd H|$1 HD$H= LxU HD$(H H|$( [H1 H5ى HHwIJPH H5) HYI,PH H5 H;IPH H5ϕ H IOH H56) HHOH H5 ) HHOHj H5) HHOH H5 HHxOH^ H5=v HHZOHh H5( HiH<OH H5( HKH OHL H5C H-H OH~ H5o( HHNH H5[( HGNH H5D( HGNH H5,( HGNH H5( HGjNH H50 HyGLNH- H5r HHXG+NH H5 H:G NH H5Q| H GMH} H5U_ HFMH H5j' HFMHQ H5 HFMH H5 HFwMH H5' HFYMH7 H5A HhF;MHq H5 HJF MH{ H5v H,FLH H5 HFLHO H5Z] HEL1A @襥H5A HHIELLLt$(Ix H5u L` ^LLVHHJLH HI H\ H0 8HI` H? H HIh H" Hx RLIp VHHKL- I IuIU HDKII9uH H@ HhH HHD H01R IH=K1HH="% a LH 覿H H KH5 % HWDJH- H H5$ HHU H+DJHU H HH5/A HDÅJI PI H H|$(I H5$ HJH|$H A$` I > HD$L`A$ QH >$ HJr FQHʵ HH2QH I$ _QL5($ L蛄HHQHH5: H=$ 17XIHQHW LIMPH|$LH HILMPL+ PLL( lPHL$H1MH H5t# p LH蕽H@PH脽11H|$vH$l$0H\$@foT$@HD$8HD$ foL$0PHD$ H []A\A]A^A_HHhJ`IHVIHLIbIBI=IH3I.IH$IsJIJLQ*`HtH- Zff. QE1A1" HjPZff. AWAVIAUI1L-\- ATAUSHHKD H HH" H< K KD AL<HH%? A H HH1IT EtXHcE4H6 II"A J< PHcID H? JDt H[]A\A]A^A_Hc1A4H II"A J< uOE1HcHAE$뮅`O aHHOH݃ - H"KD H< t>L<HAH%? A tH HH1IT N aHNKT - HNNff. QH=h) }NH=) |NH=`) |NH=,) |NH=) |NH=$) |NH=) |NH=|) |mNH=) s|YNH=) _|ENH=) K|1NH=L) 7| NH=) #| NH=) |MH=) {MH=|) {MH=h) {MH=t) {MH=) {MH= ) {}MH=) {iMH=) o{UMH=p) [{AMH=|) G{-MH=H) 3{MH=ԩ) {MH=) {LH= ) zLH=8) zLH=) zLH=) zLH=) zLH=H) zyLH=t) zeLH=) kzQLH=L) Wz=LH=) Cz)LH=d) /zLH=P}) zLH=|y) zKH=u) yKH=Tp) yKH=l) yKH= j) yKH=Xc) yKH=D_) yuKH=[) {yaKH=X) gyMKH=S) Sy9KH=P) ?y%KH=M) +yKH=J) yJH=H) yJH=F) xJH=0E) xJH=|C) xJH=A) xJH==) xJH=`2) xqJH=L,) wx]JH=X)) cxIJH=d&) Ox5JH=P$) ;x!JH=!) 'x JH=( ) xIH=T ) wIH=) wIH=) wIH=) wIH=$) wIH=p) wIH=|) wmIH=( ) swYIH=t ) _wEIH=) Kw1IH=( 7w IH=( #w IH=( wHH=( vHH=( vHH=(( vHH=( vHH= ( vHH=( v}HH=( viHH=$( ovUHH=,* [vAHH=<( Gv-HH=( 3vHH=T( vHH= ( vGH=L( uGH=( uGH=( uGH=м( uGH=<( uGH=( uyGH=( ueGH=`( kuQGH=L( Wu=GH=8( Cu)GH=( /uGH=( uGH=|( uFH=h( tFH=ԡ( tFH=( tFH=( tFH=X( tFH=( tuFH=0|( {taFH=<z( gtMFH=Hx( St9FH=4t( ?t%FH=@r( +tFH=p( tEH=8l( tEH=Dd( sEH=^( sEH=Z( sEH=(V( sEH=R( sEH=O( sqEH=J( ws]EH=C( csIEH=d>( Os5EH=8( ;s!EH=|6( 's EH=h3( sDH=t1( rDH=@-( rDH=+( rDH=(( rDH=&( rDH=%( rDH= #( rmDH= ( srYDH=4 ( _rEDH= ( Kr1DH= ( 7r DH=( #r DH=( rCH=( qCH=( qCH=h( qCH=( qCH= ' qCH=L' q}CH=x' qiCH=$' oqUCH=' [qACH=' Gq-CH=' 3qCH=' qCH=' qBH=' pBH=' pBH=$' pBH=0' pBH=' pBH=(' pyBH=T' peBH=' kpQBH=' Wp=BH=' Cp)BH=D' /pBH=' pBH=<' pAH=' oAH=' oAH= ' oAH=' oAH=' oAH=' ouAH=п' {oaAH=|' goMAH=' So9AH=4' ?o%AH=' +oAH= ' o@H=ض' o@H=d' n@H=' n@H=|' n@H=H' n@H=' n@H=' nq@H=' wn]@H=ة' cnI@H=$' On5@H=' ;n!@H=\' 'n @H=' n?H=ԙ' m?H=' m?H=l' m?H=' m?H=' m?H=p' m?H=܆' mm?H=' smY?H=4' _mE?H=}' Km1?H= z' 7m ?H=x' #m ?H=$p' m>H=m' l>H=h' l>H=hd' l>H=b' l>H= a' l>H=_' l}>H=\' li>H=Y' olU>H=0X' [lA>H=U' Gl->H=h * 3l>H=N' l>H=D' l=H=L>' k=H=9' k=H=6' k=H=3' k=H=/' k=H=-' ky=H=4)' ke=H=&' kkQ=H= ' Wk==H=' Ck)=H=' /k=H=p' k=H=<' k<H=' j<H=' j<H=' j<H=l& j<H=& j<H=& ju<H=& {ja<H=& gjM<H=& Sj9<H=& ?j%<H=& +j<H=& j;H=X& j;H=& i;H=* i;H=|& i;H=& i;H=& i;H=& iq;H=& wi];H=X& ciI;H=& Oi5;H=0& ;i!;H=<& 'i ;H=& i:H=T& h:H=@& h:H=,& h:H=& h:H=d& h:H=& h:H=* hm:H=ȕ& shY:H=ԓ& _hE:H=& Kh1:H=l& 7h :H=& #h :H=& h9H=P& g9H=<& g9H=}& g9H={& g9H= z& g9H=x& g}9H=u& gi9H=dt& ogU9H=0r& [gA9H=p& Gg-9H=ho& 3g9H=n& g9H= m& g8H=Li& f8H=xg& f8H=e& f8H=Pb& f8H= `& f8H=_& fy8H=4\& fe8H=Z& kfQ8H=X& Wf=8H=xW& Cf)8H=$V& /f8H=T& f8H=S& f7H=hN& e7H=4L& e7H=I& e7H= G& e7H=E& e7H=DC& eu7H=B& {ea7H=\@& geM7H=H>& Se97H==& ?e%7H=@7& +e7H=5& e6H=*& e6H=$"& d6H=p & d6H=& d6H=& d6H=T& d6H= & dq6H=& wd]6H=& cdI6H=$& Od56H=& ;d!6H=\& 'd 6H= & d5H=4& c5H=& c5H=L& c5H=& c5H=& c5H=0& c5H=% cm5H=% scY5H=% _cE5H=% Kc15H=% 7c 5H=% #c 5H=% c4H=P% b4H=% b4H=% b4H=% b4H=@% b4H=% b}4H=X% bi4H=d% obU4H=% [bA4H=% Gb-4H=(% 3b4H=% b4H=% b3H=,% a3H=% a3H=% a3H=p% a3H=% a3H=% ay3H=% ae3H= % kaQ3H=l% Wa=3H=X% Ca)3H=D% /a3H=0% a3H=% a2H=% `2H=% `2H=% `2H= * `2H=% `2H=D% `u2H=% {`a2H=ܘ% g`M2H=% S`92H=T* ?`%2H=% +`2H=,% `1H=% `1H=Ċ% _1H=0% _1H=% _1H=% _1H=t% _1H= % _q1H=% w_]1H=8% c_I1H=d~% O_51H={% ;_!1H=x% '_ 1H=w% _0H=Tv% ^0H= u% ^0H=s% ^0H=Xr% ^0H=$p% ^0H=n% ^0H=|m% ^m0H=hl% s^Y0H=i% _^E0H=g% K^10H=Le% 7^ 0H=b% #^ 0H=Da% ^/H=`% ]/H=^% ]/H=H]% ]/H=\% ]/H=@Z% ]/H= Y% ]}/H=W% ]i/H=V% o]U/H=0U% []A/H=S% G]-/H=R% 3]/H=P% ]/H=N% ].H=L% \.H=XJ% \.H=H% \.H=G% \.H=|F% \.H=E% \y.H=C% \e.H=B% k\Q.H=LA% W\=.H=@% C\).H=>% /\.H==% \.H=7% \-H=H5% [-H=T2% [-H=`0% [-H= -% [-H=+% [-H=(% [u-H=&% {[a-H=<#% g[M-H="% S[9-H= % ?[%-H=` % +[-H=% [,H=% [,H=d% Z,H=% Z,H=% Z,H=(% Z,H=% Z,H=@% Zq,H=L % wZ],H= % cZI,H= % OZ5,H=% ;Z!,H=% 'Z ,H=H% Z+H=T% Y+H=% Y+H=L$ Y+H=$ Y+H=$ Y+H=$ Y+H=\$ Ym+H=($ sYY+H=$ _YE+H=$ KY1+H=,$ 7Y +H=$ #Y +H=D$ Y*H=$ X*H=$ X*H=$ X*H=T$ X*H=$ X*H=$ X}*H=8$ Xi*H=$$ oXU*H=$ [XA*H= $ GX-*H=$ 3X*H=$ X*H=$ X)H=l$ W)H=$ W)H=$ W)H=$ W)H=\$ W)H=$ Wy)H=T$ We)H=@$ kWQ)H=$ WW=)H=8$ CW))H=D$ /W)H=$ W)H=|$ W(H=$ V(H=$ V(H= $ V(H=,$ V(H=$ V(H=$ Vu(H=$ {Va(H=$ gVM(H=$ SV9(H=$ ?V%(H= $ +V(H= $ V'H=x$ V'H=D$ U'H=П$ U'H=$ U'H=H$ U'H=t$ U'H=`$ Uq'H=l$ wU]'H=$ cUI'H=$ OU5'H=$ ;U!'H=|$ 'U 'H=$ U&H=$ T&H=@) T&H=$ T&H=$ T&H=}$ T&H=|$ T&H=y$ Tm&H=v$ sTY&H=4s$ _TE&H=`p$ KT1&H= m$ 7T &H=k$ #T &H=h$ T%H=f$ S%H=e$ S%H=) S%H=_$ S%H=]$ S%H=[$ S}%H=Z$ Si%H=X$ oSU%H=V$ [SA%H=T$ GS-%H=HQ$ 3S%H=4O$ S%H=@L$ S$H=I$ R$H=D$ R$H=DA$ R$H=) R$H=\8$ R$H=2$ Ry$H=40$ Re$H=-$ kRQ$H='$ WR=$H= $ CR)$H=D $ /R$H=$ R$H=<$ R#H=$ Q#H=4$ Q#H=$ Q#H=$ Q#H=X $ Q#H=$# Qu#H=# {Qa#H=# gQM#H=(# SQ9#H=# ?Q%#H=@# +Q#H=,# Q"H=x# Q"H=D# P"H=P# P"H=# P"H=h# P"H=T# P"H=# Pq"H=# wP]"H=8# cPI"H=# OP5"H=# ;P!"H=<# 'P "H=) P!H=T# O!H=# O!H=l# O!H=# O!H=d# O!H=# O!H=\# Om!H=# sOY!H=# _OE!H=@# KO1!H= # 7O !H=ت# #O !H=# O H=p# N H=# N H=h# N H=4# N H=# N H=l# N} H=x# Ni H=# oNU H=0# [NA H= # GN- H=# 3N H=# N H= # N H=# M H=) M H=y# M H=Px# M H=v# M H=(s# My H=a# Me H=]# kMQ H= Y# WM= H=J# CM) H=DD# /M H=:# M H=3# M H=1# L H=t/# L H= -# L H=*# L H=X(# L H=D&# Lu H="# {La H= # gLM H=# SL9 H=# ?L% H=# +L H=l# L H=# L H=D# K H=# K H= # K H= # K H= # K H= # Kq H=# wK] H=# cKI H=# OK5 H=P# ;K! H=" 'K H=" K H=" J H=`" J H=," J H=8" J H=" J H=" J H=" Jm H=" sJY H=4" _JE H=" KJ1 H=" 7J H=" #J H=$" JH=" IH=" IH=" IH=" IH= " IH=," I}H=" IiH=" oIUH=0" [IAH=" GI-H=H" 3IH=4" IH= " IH=l" HH=س" HH=d" HH=0" HH= " HH=" HyH=t" HeH= " kHQH=̧" WH=H=" CH)H=D" /HH=0) HH= " HH=(" GH=4" GH= " GH=," GH=z" GH=w" GuH=t" {GaH=o" gGMH=(m" SG9H=h" ?G%H=d" +GH=,b" GH=_" GH=[" FH=T" FH= R" FH=M" FH=4F" FH=D" FqH=?" wF]H=9" cFIH=7" OF5H=p5" ;F!H=<," 'F H=(" FH=$" EH=` " EH=" EH=" EH=) EH=0" EH=|" EmH= " sEYH= " _EEH= " KE1H=" 7E H=" #E H=$" EH=0" DH= " DH=H! DH=! DH=@! DH=) D}H=X! DiH=d! oDUH=! [DAH=! GD-H=! 3DH=! DH=@! DH=! CH=X! CH=! CH=P! CH=! CH=h! CyH=t! CeH=! kCQH=! WC=H=! CC)H=$! /CH=! CH=ܨ! CH=! BH=Կ) BH=! BH=L) BH=X! BH=d! BuH=! {BaH=! gBMH=! SB9H=T! ?B%H=! +BH=! BH=! BH=Č! AH=P! AH=~! AH=y! AH=p! AH=m! AqH= j! wA]H=^! cAIH=) OA5H=[! ;A!H= Z! 'A H=X! AH=W! @H=) @H=U! @H=X) @H=) @H=) @H=S! @mH=) s@YH=) _@ Zf. HW1 @uHH HtH8H9uH % PZÐGHO T7 Ãfqà GHW HD7 ÃHrà 4Hc HkGHHHHp1uQHOH;Nu\HGG 3V .HN @t-H0 @tH0sZ1ZHHHHf Q uHtJH1 fHp@H@ HRH HPHyfHnH H7fH:"@HqZ @ AWAVAUIATUSHH(LX My L{L;= Hs IM2L LH{H2HUH2L;=7 LX M M93HX HHHP HHM M2 H([]A\A]A^A_H HT$ HH N HH-2|$ HH#HIzHH$E1dH$HD$)LH$MH|$H1H$IL9NtIF u1LzI$}Me #AWAVAUATUSHQH 52HP 1LeM HTHX 1HI9uI LmIX L`I|$HH1HHXM~YIX HBH HE It@HB H HE(It.HB(H HE0It HLHHHLL9uZH[]A\A]A^A_HMt$L9 1N< LIH11L9}HTHX IT HKl= -1HH1H@HN$ LH膶HH0L1H͵E11I9 ID HcH;P}xLd1IL HqHH9~L;dtXHH9HI9LH x01Hc4IL HH;q} L;duHI9kIHcM9/HjLb1I9H|HHI9tH;|0HATIUHSHNP1IH H[]A\ ff. SHHHH= JHtHX([ff. @ SH' HuH[Hu HHEff. ATUSHHt5. HHtHhH膺HHHIt 1H[]A\L;(tff. ftSUH-_ SHQf. < t,CHt&<)u HH蜶uHCZ[]À{ u11 SHHHH= *HtHX([ff. @ ATIHUHS.Hs1H1HHHc1I$h Ht&HHTHA vHvD[]A\=I$h HH0ff. SHH=~ 1^HtHHX[ff. @ Hw H 9 9A,Ht&1Hh A HIH9p |; ff. ATE11UHSH5؝ HHL HHT$HE1'H}L$HL$H5* I HL[]A\ff. fH` HtHx uAWL S 1L= AVE1AUATUHH5d+ SHH=C HAPIH ) vAZA[IH1H` L;p|XL[]A\A]A^A_FtH@LHLN,1IE L6HH0tLI t HfHnH9uLFHPHOIL I HHPHFH1H HF 1 ff. AVAUATUSL'M`3Hfo1H @1HIH e HGH`HG0Hɂ HGXHFG H HO{ H H H: H Hl H8 H^ H HV H9 HHHHHuH3333333H{L)H92Hk(QIH|2LHHW L Ht2HE HLLH 1Q2[]A\A]A^I` IE1L 9 1@HHIzLM9t)HLIL @ LH@ Hx HIk(HH9|1Hff. fAVIAUIATIUHSHHc/H1HH5ܓ LHq1HqLHH1HH5 L;1H[qLHHR1HH5= LL1H%qHc}蜬HD$H1UE11L% 6HHHEH8L9t %7H0HT$JDUIHHcH9H|$L0HT$H5 Le0H|$p1H[]A\A]A^ @ Hx H981H!y SH@ HHH Hu[VHCHt+HC HH 1HC1H52H[SH觺2Hw HKH9B1Hx H@ H@ !1H HKH [QH - H 1H=A* CH- HtH ZÐUHSHHuCHx HHHx Iؿ LH 1wHH,oHHH[]H<$HHt$4HHtHwx H $Ht$ @ AUATUSHAPH u(Hǧ1 H0w H HHWH1 HGHk(H 0H{H Y0L-py Me M H HHL0H{8HAHs@HtHE ;0Hs0HtHL 0H]ZH[]A\A]谫HE HH0HK81H띾. LֳH/e t / f USQ3HHtH HHmHHZ[] UHSQH=s > H/Hp1HHHa /H!HZ[]f. S18H/fH@@(;4HCH_/H[f AVIAUIATUHSHHHuL-Tv L%u HHI$p /LI$@b H.L-v I$r HLż.LI$m H誼.LI$H{ H菼.H s H9KuI~0HI^0H.H[]A\A]A^ ATIUHS1 Hr.HHLH H߉k[]A\f D SH5r HH,6.H{H5.HG $.HWt Hp H.HP tH [-fAUIATIUSHQHC0.1LLHĹHH.H3HL.HH kH; u1Z[]A\A]f D UHHSQ"1H0HHHs HH@b Ņ0HjZ[] D HG`0f Hu SH8莦9tHt H8{90H=o HtX[0 H0UHHSQi0HHtHH HH jHHZ[]ÐSH Ȝ- C HL H IH 1<H[ Hٰ H SL y 4 PH H ]1 MPH H1H XHZ[f. H1 H! H z HP SH=1 3 H4z? H H4HC H4HC 4 H4HC(7? H4HC0HyHu4HC8H`HR4HC@ IH14HCH5 2H4HCP> HH3HCX H3HC` H3HChH[ ATIUHSH HH3H[]A\b fSH=Ƞ1 H4HHhp H H HSH H HC HC( HC0zH3H[ff. HG ATIUHSH?7LHH[]A\$ @ IHIH!HHLH8 uHHHLW L9rL HH8 tL9uIH<I|9H!ff. UH11SQH=j : H7HHtHxHM 7HZ[]ff. S10 H7HV-HCH7H[ @ Af D OA LHH HHHHO IHJD @ AUATUHSHQLo(Hc H=8H{IHteLcHc| iIH8H{ HtoeLc Hc ?IH7H{(HtEeLc(Hc IH7H{0HteLc01 @IH7H{8HtdLc81 @IH\7H{@HtdLc@1p @IH,7H{HHtdLcH1 @UIH6H{PHt[dLcPHc +IH6H{XHt1dLcXHct IH6H{`HtdLc`Hc IH~6H{hHtc Lch G IHI6H{pHtcLcpHc xIH 6H{xHt~cLcxHc HIH5H HtQcL Ict IH5H Ht!cL Hcx IH5H HtbL Hc ~GHHe5H HtbH Hc=n HH55H HtbH 1Z[]A\A]1H @ff. fUSH - H H=- uH5o7 H HGHH H= O(H4HCH= 6(H4HC H HdP e4HHcFHI4HC(H H[]P4K4 SHO4H5t H4H5v H¸ $4[ff. @ AUATUSH(<7 4HHAA{H94HL$HT$EEHt$Hw4H|$Ht$.FH|$HH(H[]A\A] ATIUHHS.&H5HHLHH H߉`[]A\AWAVAUATUSAPH5HIHIH5f I5H/ HH~5Hh HLLL@ wMk5HHL! ]5H h HE8HI0I9O Hu3H} H HHH5MHE H H=7- tGLL 1 IHtgH=- HH豯Lg_ Z[]A\A]A^A_q&H- Hu4H\u41HM &_Tx4s4 QIH5Me Hlx4I@Zff. ATUSH4HzH H4HoIH t4H HsH;w|H5h ye4I$L[]A\ 1H Hu?4 QHO X4H;w#4HGHH8HHu1Z(^f D AWAVAUIATUHSH. QL=f M@ ԣH4IH H $HH4IPo HIë44LLL)uIHs4HIPo H跭 HC unH 1HHt.H=e IH1IT$H5 HH ]HMtL]MtL]ZH[]A\A]A^A_HHb H IPo HE1ݪ33ff. AWAVAUATUHH5 SHHH L hb H d HT$0HT$xARHD$pP1L$ 0RA[A\e6HD$pLd$hE1L|$xLpHD$M M9~!HD$J|HG 5IHt$H gIH6H9 H\$H HH5HLLIIH4L5ud HI{ H IH]4H H H}( H$ D$H10 HH41HD$H H fHnLHCPH fHnHC`H HChH HCpH@ H HD$Hǃ F H HP HzHE HC0He H H0 H_ )L$ H@ HV fH:" fIL L$ p fInLfI:"P gHCHH 芝H;$ P3MPo H L u Mt H LH HP 2H H LH` NO H I@b HV H4 Mp H LfH xH Ii H <2IH_ H %2HX Lm HSHG |$ HE( LH <$ t L IHH L)H fInfH:"HCC HH H HH H 6 HR H ~ H H}@ uH 1H}H uH Z1I_ H H6H HH#1HY H=wh H5ph tf D HeH8 HuH FHHs H$ 1H\$L$ H$Iy H$ HD$H4$E1LLH k? H$ Ht$H{IH H@H H H !HSH9 H; ` 0H= ` HH H@ HOIE LhHHXHp,HG(I@ H@H HGHrfHnH HfH:"GHJHt$11H|$8H$ 3 H|$8IVM/L|V LHHHuI@ Hx` H\$/HH\$7Vfo\$ LH=[ )$ 5 IH HIi ZoLHUH.HL$011HsHIUM.LUH|$UHĨ H[]A\A]A^A_H-\ 1HDHD$H/<$ L I1H7 H|$ H HP HK IH.HgLhLkH/HLLH _HE1D $D$rHJ HpE1HHKL L9 IHP HҕHD$8HD$8HH-H@H HD$H HD$P H}( D$ 7 1H\$@E1<$|$L9l$n H\$@HcD$Hc$H|$HH) HD$@H,1HL$HHL$XHL$HH9L$ Ll$@L ;.LLl$@蒗H|$@ISM| H|$8SIEHD$HD$HHHp HHt$0 HH*-rHM,HP H H` H[x HD$8HL$H|$ Ll <$ LLGIH HD$@HL$XLLH@L,ޠ ,HD$XHD$HHD$8J\HC +H, =+Ia H I~ HޘuAI)I~ L8{Ia L覘_|$ &,<$ ,D$ $HX HT$@HL$HJ|Ht$8 HT$@HH HL$HB IH(Ht$8HJHPH;Z ,HH輽 H H Vt*H|$ 1t$4$t$ :H \ H9HHiIH1*H HL[%,L QH|$P (|$ <$t$ 1DD$HD$HDH9t9H|$P (E(H (tu1H @HH9u<$DD$ ^{HHzIp fHH*H L苠KB)Hǃ I<$ aL LjQHt H H|$ *H8 H3H9HT$0HLHE1H}( DD$ yX*Hƿ 1^HD$8H|$P *|$ t*D$ IE HIE L[(V(Q(L(G(B(=(8()))()'ff. AWAVE1AUE1ATIU1SQLL9}II\HC v9H V9 tVH<ZIMuHMIZL[]A\A]A^A_HL~tMLLLgu88f ATUHSH HJHu`H[]A\H Y H9Ht1H= IH#9H HH?9LM1ff. HV HE1HHH@ Hff. USQHz <HHw HHt&HH S HH H01q HiMZ[]fHV H @ HV H @ QHFHuH1HQ<ZHu`< H Ht$(HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ HH$ HD$HD$ HD$HV D$0 H0H@U H L H @ 黓ff. USQH;HH H߉*LZ[] @ AWfAVAUATIUHSHHT Ht$HH@ 1L{pLk`HCpHLshC` LHH$%oHtH4$HH u'HKHLLLH[]A\A]A^A_=H^M H HHtHt$4fAWAVAUATUHSHHHT H\$HL@ P:;H IH:|$0 :HLV HH LLHH HH:JH|$8HO:HHtJHHH54 kHAJEg:HJLwJ HH[]A\A]A^A_>:A:f AVAUATUSHGH Ht91LwpLg`fHGpLohHG`H# LLLHH;[H]A\A]A^ UHHSHAPHFPxH\:YHH[H]SHH[H{.ff. AW1AVAUIHATUSQL;-R AMA :LI HH9HS HH3HtH[txH HrT HH ( H:T HH t:H H3HuHN HHtH H3Hu fInfH:"CA$HC{ ID$HcCAD$ ID$IŅ Il$(L=jj H萓t<II7HuHCEt$!HuUE81H{ Z[]A\A]A^A_IGA ID$(H3HH+DH ހ8 8A뭸 8ff. f1Tf AWAAVEAUIATIUHSH(> H# LIHDLH IH Ht E u1HIDLL HHH(H[]A\A]A^A_N IH7 M HO H@ H =*@Dr$D+r D$ A*G4vAVT$9;A$ I HH HD$IT$H }& LHHD$}qIH:I HH?:L^FIT$Ht$LH 5qIHe:I0 HHu:LFD$HL$A9 :$981tuIH HHtIT$Ht$LgIH8I HHg9LED$HkH1&ff. U SVH: H= fHnH911HCH9HZ[]ff. fSHH 胂Ht 1HH HHPHP'HHHH)HP[ff. AV1MAUAHATIHUHH=Z SHH5q >z91A H@M A$ txn HHg9H LHO A$ uUME1DH} HHtH HIRLH H[]A\A]A^ HHu8AL$ HHt H 1H y8fHA @t+G Hq0tk5 HwuFHQHWGÉ@tu'G t,HqHG u\811G uF8A8<8ff. HGHtUSHQHwHB HH 8HH H9E8HZ[]ff. Hx) Hq) AVAUIATIUS H8HHHH7K HL^ LmuT LHH膒7HH2BH[]A\A]A^f D HtHH H1HJ H4$HH|$H LxHHt A1HÃff. @ AUATIUSQHGLx M7H{G HLI9E67HHuAI|$` g7HHHS7HHL.D7ZH[]A\A]H I|$` uH{H5nG u67 AVAUATAUHSH) H/7fHDHH)$ H H61H HH5T}H H=&} 6L H M6E < & E < twE 1< ) Et{< \ Etk< Et[< EHUuEBHt9< uHcHt) HEH$Et < uHEHD$L,$1H Mt@LL5HHH)LX 5H H5 ) L fHnHkHk0HH[]A\A]A^EH,$s< EMZHEH$EF< E2 < HEHD$HcHUHE< tE< tB HcHUHuHcHUHuHEHD$HEHD$HEHD$HD$HL)I}LHH V4H HP4f. HF H@ HB8H@HtH@HBH @ W U{H Hm 11E1E1HH1E1HPPH E11ɉp1fH 1@@ HxHD@XD D D L L D H H H ǀ @ @0 f Zff. UHHSHHAP+ H4H<HHϘH3Z[]fAUATIUHSHHHH^E HHDL@ L` fHnfH:"H3)$1HAD$x)D$fLd$ HD$8D$(. HH3E1E11HHLxH+Hu HCHP0HHH[]A\A]ff. AVIAUAATUSH:L`L^yHHk3EHA1u b D H< u3< )31KHsHu< t Et H H)HrL9sHu[H]A\A]A^EuE HHH2H @ SHC HHH^ H2HxH5:A IH9u M@L[̇tf D QH2HG8H@Hv2H@Zf. ATIUHHSHǃ t= H2HAԸ 2fQHGHWLNL@HtHB HDH? H H5 H81gZfSHH=]E IH HH I@HCH I@HCH I@ HCH I@(HC H I@0HC(H2I@8HC0H2I@@HC8H1I@HHB 1LA H I@P1I@XI@`I@hI@pH2B I@xyL[ @ AWAVAUATIUSH( udHII1LvL9 H,HH)I9_1L9}B #w-HHt' wHHI1ADŽ$ H([]A\A]A^A_ú H5 H\t?Hs #b w HH01Q1JEH}<:t<=uGH< t< tLC Hr@@ƀ_ADuAtHىL$ H9cH)LLl$1H} L$ HHH+IƅI0_Q2L$ bL$ H BAD- HH u0fATUSHH %2H1HT$H5x %f2H|$H DHH2{H$ H$H|(H1HxH[]A\ff. @ HtAt @ &66u @6Ã61 S111H@H|$HH|$ 1H$HD$HT$(L$HD$8HHt#H H|$8HM6H|$(H5H@H[f D HAWAVAUAATIUSHH9HFHI[HLDH16LD;HD$֑HD$HH?Au25H[]A\A]A^A_Ät/5 @ AWMAVMAUAATAUSHH|$ sH/5HLT$1@@f A A LC8C(rHCH4 0 HD$(tHT$H{HH? 4 xrfo HCpCxHu41111CHHHC C L{@Ls Dk<HSPK`HCX kdDchH Hǃ H[]A\A]A^A_ff. @ SzH'4HWHH>4HO H14H)1H5ڟ H=֟ i 4H~Ht[ 4AUATIUSHAPH0 HtH8 H)HH94I? 4B@ @ 94HcL( H=g Hg H31L(HHH( HhHtH0 HqH)HHQHź IH( H H8 HJH0 Z[]A\A]f D ATUSHd HHtA{< tH[]A\H HQ< 4< 4p@ 4t3Ce/3HtH9 H8tSHsBHL$19~H 1HHy(H1Hǃ sǀ uHt8H@@t 9H-9 H8"H { %3A$<2P2IcL$IcT$HMcL$ McD$ PH PH8 H01d~ H ZY D AWH 79 H9 AVfHnAUfH:"ATUSHHG<G8 G(= = u = td=Y 4= M P =p 9{` ]4HߋkeHU H[]A\A]A^A_Ë P =p 8{` HDcVHH H| H 1HTH Hs H躑 Huw3 P =p 1{` HDclDk`HE 1HTHz L H{ E1Ms2 H4 HhL` P =p 7{` 7DkP E=p 7D;cl7HUT1HSIcă{` HDxDp@1HHHup{` Dc"1HHH0 H{ H42 HhDc1 1 H3SHzH{ H HHz3 낉kDc1 1f D SH_HAH57 AH[ D SH߃HH~8HwH[f. SH_ [ H@t? HGx#HH9r߸ HHH9rHH#Gt H9tHft$RHGHPHWH;ۑ@9Xf D HAQ@HHHHHHHVU L@HH111AXff. AWAVAUATUSHhHHHHH `8 HD$H9HHFHD$H@ ~LJH~ILL $pIHKL $E1E1M9 MM ~D$fI:")$H I|$ H- 5 HE ILH}7HH H9 L= 5 HT$8HIs ̓HD$ H|$8Hfo $Ht$@L )L$@IH|$8H+H HI@ E1E11Ht$HahIHM9 fo$Ht$@LH LL$H\$P)T$@3ILL$HI H@ tHf4 I9A L<+HL1+H)+M M9 L+HHh[]A\A]A^A_JLHA ` M}E1I ID$HhTIQI9s鮐HJ| HHyL=Z3 HM LHHt=H LH HEI L@*VHqHH *L=2 HLD$ HT$8Is HI萁鸐LH5y HHD$C LL$#LL$mH<$I)ML)pL=H2 HT$@HLD$(LL$ Io H $LD$(ˎH|$@H $LL$ HЎLLD$ L $YH|$@I )MLD$ IG QL $Mu#LIHҎL $1I9IpLLL$LL$ HL$pLL$ LLD$ L $(LD$ L $麎ff. UHSHAPHcG;Gt?HSH8tZ1[]HxqHH$HMsuYH[]έL HcCff. o ff. OA IIIILH!HIxL9uLH6IH IL L! UfAnfnSfA:"f:"flHHBUHH|$00 )$H/fo$ HhX@ H[]ÐAVAUATUSHH~H0HFIH H MIH/HLH H;-R0 HE E1E1E1H{HkHsH{LkHH{ Ls HH{(Lc(H4H{01HS0HΩ1C8Mt L;%/ uUHtPH/ HT$HL@b L}~0Hl$Hq* H9CH{(Hk(H C8 1H0[]A\A]A^HWH I LoM MIILgH1/ H9I9$ I9t0LMHtHE HuqME1Mt&I w%dHߧHE E1MuLMI$H. H9gH9 H1HE E1E1MHIIE LoM MIE1 LbQE1L HHL$Q1j j:H HH鸧H'. LgH9H9HHE E1'M9HHE E1H;-- Lg麦HʦHE E1E1E1lfH11 AVAUIATIUHSH HH o- IHtH9u I\$HHDI9MH9tHu Il$ HHDA|$8 IH9E1HL1HLx LH}#HoH{H5' ԭt ID$0H^H{0HC0HCH[]A\A]A^ D H^HGH ff. H Ht$(HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ Hv+ H$ Ht$ HH@ HT$HHt$1H$ D$0 AH f ATUHSHH Hu H HHH[]A\zHt4HL$H$gHHչH{蒹H$HL$< Hu H{HL$H$H$HL$HI LCH{M I@H LOIt$1I9uoH4ItHL9uHC H9 1BrHCLM DA H{y H[]LA\e` H* H W H W HLHHoADHH9uLHAtH4Itf1MHcQHL$H$bH$HL$B_zSHWkHHt H{Hu:H{ HkH{(Htu H{0Htg HCH[H@ Q ff. @ UfAnfnSfA:"f:"flHH7HH|$0H0 )$讶H+fo$ HXHh@ H[] QHVHUHF HtH HW0HG0Hu H) H ZH ATUHSHHHL%̈́ 1LD$ L Hft.Ht$H{HHsHǿH H[]A\馿ff. @ ATL%' UHSI$Po H nI$p HHg SI$t HHL 8I$@b HH1 I$\ HH []A\ff. ATIHHUHS7Ht"HHLHH߉; []A\H' H8蕽H1 @ HG H HG(H SHp Hu HCpH}H HtH [eff. AUATUSQH_pH|H% H9Ct HZ[]A\A]HIHPE1L;c} JT JtLm-IH}pLmp: H]p @ ATUHSHHH/L%& 1LD$ L Ht.Ht$H{HHsHH H[]A\ff. @ SHHHSHsH;bu H% H [1[ff. fATIUHSLFHHwLæHS(HBHt[LHHR ]A\f QHHF HG HHw HtH1Z QHHF HG(HHw(HtH1Z SLOHM AtHwHuCHGHt[H [>HHH HuA u>lHHuIh HCH|1HS9HCIh Ht_fQH ܂ # H[$ H Zff. fU1H1SHHHι HHD$LD$1Ht$1HuuHuH[]H( Hn HH @ UHSHHH H9FtHH" HT$HH q@H|$HuHHH []HHH []yf HK- H Q ATIL 1U1L R SL"= H 3 I4AE$+E fd |fwIcL" HcI;B}N |tz}} d | ʃ} } & []A\f +D&THcI;B}0|t%d iBHAA.댍BHAA}BHAA-ύBHAA,bBHAAcff. AUIATIUSHHHoH;- t~H 1HT$LHPD Et^ w H uJ tpA+ LHHA( L賖 It5 1) 8 tCH 9Gȸ fK1H[]A\A]HD$I|$LP(HpMJաtABuI wfDKDC*wfC DC*eff. SfnfnHfA:"f:"flHH|LϾH )$蕭Hxfo$ HX@8H[ SHH HtHPH[ÐAVAUATIUHSHHHH;= H I 11HT$LHt$LOA A t}H}Mh LLKH L$L C ? A CHD$HC5 fK1H[]A\A]A^I H we; HtHD HtQLp bH;= u:LҧHu-1HT$1LH|$HN t tTtOCH 9Gȸ PfC> &: Hk &HD$S9HCI fCAWAVAUATUSHH P =p {` DcP D=p QIHE1{` A P =p {` R1 H`8HuV kM L(U Dc 1 Q H[]A\A]A^A_H ~HHD$t H7Ht M9HT$tmk KI/k`oHs LSHHcI9 LHD$uT HD$QI4HHH4MLHT$J4 [HHT$Ie D AWAVAUIATUSH( P =p A}` E}E9}NIUIcA HHDpL$, L6H{ L IHg H L: HJ L A}` H4 L^6H L5 A}` HD$ H L H L6 A}` HD$ L* HH AuI}HH.@ Ht$LM} D$B D$ IHt^I|$R1HAWD$,HPD$0PAVD$,PLD$8yR H0HHA A H(H[]A\A]A^A_LHD$y LL$HHu)A}` E} 8 L5HuE}1땾 L5HtLTIHtHJ L HtL A}` Hu L4HtL'4 A}` HD$uH L7 HhLf4 A}` HD$PL>) HH<AuI}UHHS@ Ht$LM} D$B D$ j IHtWI|$P1HAWD$,HPD$0PAVD$,PLD$8Gm HG H0LH 茕 HHGLHD$~ LL$HHuA PA =p b8 Ls3A}` L[3HH L觔H L13H L@ A}` L3HtA PA =p A}` x3 LAm2IHhAmA A}` u( L2Ht L2HA A E}A}` hff. @ AVAUATUS HP =p {` DsD9sH{2mHSIcƃ{` HDhD`@H HH!H {` I sH{HHD@ DH HC Mu=H}RDDPLp Y^HH, H[]A\A]A^MR뽐ATUS`fGHI;Gu1BCHKHcH9*:C[H]A\ÐAWAVAUIATUSH8 P =p gE1HT$ LLD$ t A H\$ H8H[]A\A]A^A_AmAH\$ LHJ)A AmPA =p A}` LEu;IHt L&0HuvA}` EuLjHt)A A}` AUD9~$HD$ AKA A}` Eu A EeA LHD$HtIWLpz yA~ PHPH$HL;IHH<$VNLHD$INHT$1HtHHH H4$HD$HHL$VH<$ NHL$LH.HzH$`VLMH$LD$H|$D Ip1L$趟H<$IHD$(U MH|$(Lt$(I} LaHD$AW LDH,D@(AG$QAu `^_HA A}` @ USHQ P =p {` HߋkbHu {` kHH Q Z[] D SH1 ff. @ ATfAnfnUfA:"SHf:"L$0flH IH|$8HH H)$觟H fo$ L`HXHh@8H[]A\f. USQHHtH8 HHHHZ[] AWAVAUATUSHAT P =p N{` Dc D P =p C HDs HHN {` DsH IH {` DsJH/HHt^H IHtNH {` Iu=11MHH H V Z[]A\A]A^A_Ã{` DsKH HHu[{` Ds;H% Hu 1DcE1111IHE H lH {` Iu111IH Hb 5HkIHH IHHy {` Iu1LHHM Hy HHr H Hu HHDH {` I/11LHIB Hx HH H* Rf D USHQ P =p {` } Hߋk)Huk1 Q Z[]H1Huf. UHSQH+ H@ H1HHgHH6HH HHHZ[] QHjLOH5; IL`L; L; t4I@H8 >ZUfAnfnSfA:"f:"flHH HH|$0H )$.Hfo$HHh@H[]ff. ATUS HP =p {` HDciHHt HT(HuI{` DcukH=HHt H((Hu1Dc1틃 H[]A\þ H'Hu룺 H ^uK D SHH HCHH9t5HHH HK0H9uHHC(HSHu%HS0Hu&fC(Hu['1HC[HS0HP0HB(ff. @ SfnfnHfA:"f:"LϾH flH)$~Htfo$ HX@8H[HaB1 HtR Yff. SH5` H耎Ht*R1ɾ E1s A HY^H B1 [ff. @ ATfAnfnUfA:"SHf:"L$0flHHH|$8I0 H)$觘Hfo$ HXL`Hh@ H[]A\f. USHQ P =p {` Hߋk%Hu"{` k4 H%Huk Q Z[]ff. ATfAnfnUfA:"SHf:"L$0flH_HH|$8I( H)$觗HPfo$HL`Hh@H[]A\ÐAWAVAUATUSHH P =p {` DsD9sHE%{HSIcƃ{` HDhD`N H$H {` DsL HD HHt41 HZt! HH[]A\A]A^A_Ã{` Ds H-$HH sH{%HH Dp @ H=^q L{ D$ HHj H{ HVN PDD1AWDL$ EHZYHH- H{ HH'HC HH Hj#{` HS#H ff. AWAVAUIHATUHSHAP IH H{` HCLx H HHH3HHbtHCH IHt[HxH5 tYL[L] A\A]A^A_ LHt HSLHLHPH荝MIZL[]A\A]A^A_ AWIAVAUATUSH( P =p A` A AOPA L$=p L~ IHW A PA =p A` Ew:HH: HD$ Eo`1E Ll!HusEwIw HIH IcH9{H+>LLLA ZA H A QA H([]A\A]A^A_L HHyH9l$t&HEwHOH4IVAH4hHL$HHT$HHH4 HD$螤HHT$HA D$AG1PGff. @ AWAVAUATUSQH=.- hIIHI L1LZHHAH=Q.- H豆HHH IFH}8Lx GHEHHHHLL HHLgIF ZH[]A\A]A^A_ff. @ AUATUSHQ P =p l{` HDk_HHtH IHuN{` DkH_IHtH HHu`Dk1ҋ HZ[]A\A]þ H Ht H HtH{ LH[ HHu Hs HtAf AVAUATUS HP =p .{` DsD9s HSIcHDhD`HhHH H{` I sH{HHqD@ DH HC MuoH}RDDPLY^HH\ H[]A\A]A^H uHSIcƃ{` HDhD`D2MRDs1륐H=Y 4 @ AWAVAUATUSHQ P =p {` Dk06HHE1{` A H IHu2DkMuaHE19 P LZ[]A\A]A^A_M9tNd DkIMHJ4 xIH HDc`EuHs LIHVIcL9}HL IUAH H9 Pa D H Hu(H501 H H HVHOHr01 HWff. fAVAUATUS HP =p C{` HDcXHHu?{` DcHXHHutDc1ɋ P H[]A\A]A^HK IHt H!Ht: H{` HuLHHM HHu-HsK IHx: H{` I^ H PDLLHHM HH-AVAAUATUHSH H H5Tr HU\IHRH!IH{DHuH}8 5HEHE11Ht HLHH~H{H5 1HkHC HU@HtLHuOHu0Ht HWu5L;H[]A\A]A^ÃSA HU @ SHw?HHt 1HCHCH[H@ fAWAVAUATUSHH P =p %{` Dc 2HHDs`E1A EHHHuMDcHs LKIH^IcL9|=Ho5 HL[]A\A]A^A_M9t#JT DcIHL IT$AH MHHT$J4 .IHHT$H USHVHH5 ~t+H~HHtH HuYHH[] Z1[] D HH11H9|HwH4ƃ>Hff. AWAVAUATUSHP P =p {` k A H H {` k HH {` k5 HH {` k# H HD k1ɋ P HZ[]A\A]A^A_HQIHeH2@ IHQH {` H<H{ LLL HHus H(HPHׂ IH<HS {` H'H{ L1K HH0? P =p {` HDk IH{` DkHŀ IH {H{ H11 K HHff. QIH5- HL{aI@ Zff. *wH HcH=u*t66 Ã=u<u, Ã=u>u- Ã=uՃ/uи0 ø. fATUS HP =p {` k A# HeHuk1 Q []A\HOHu ATUHSH HH}8IHx'H{ u @-HC HH HM81HHmHHt7M t0t%HU脄H^H1[]A\ff. ATfAnfnIUfA:"HH SHf:"L$0H|$8fl)$豅Htfo$ L`HhX@8H[]A\f AWAVMAUIATUHSHHL $Hn H Hi H1蒡IMHMADŽ E H{ Ll HHH{ H HHMH{ Et H{ M E L IMwH<$ H{ uH1IHVHs 1ɠHH?E1H{ 8 HT$WH HT$H $L HhLxLpHP HH(Lh0H[]A\A]A^A_H$HpL8H b IH= H$H{ HpH HHH$H@H$UIu IH|H{ L HHdH{ Lf IHuOEtJH{ L HoH1覟IHTH1苟HH_MuHs 1bHMuH1CI=IHr: HHH{ Iu Iz @ S*HHHH[ ff. fU SHQnHt(HXZ[]ff. @ UHHSQBH H HH5] HHXHW1Z[]ÐAVAUATUS HP =p E{` DsD9sHSIcHDhD` HCH H {` Hur H Ht`sH{HH[DH D@ PDs D H Y^HH H[]A\A]A^Ds1ff. @ AWAVAUIATUSH( P =p A}` A AMPA L$=p LRHD$H\ A PA =p A}` E};'HHEe`1A E L Ht(LpRHHtI9 HT E}HE}Iu H@IH IcH9~HT IFAHHQ*Ht$LLA GA HHtm L, A}` uYA PA H(H[]A\A]A^A_MHHT$J4 H HT$H%A D$1AE^ ff. UHH=SQH9 HH H Hw4HH~HH 1HHHBH*HBHZ[]r D USHQHq H.HHӚHt1H9Z[]HKH H HLHff. fHa HHH@ H@Hx H f AUATIUHSQHH MM,$J+HH;HHt.1H9~HMHcH<HJHH<1HHHI9 HZ[]A\A]IL$HrH< HHcH<ff. fATUSHH P =p Y{` G1HT$HHt$ kuz{` Dc H Hth H HtVHj>HHtF H Ht4H DH}{ HH[]A\à Hl${` DcHFHHuf ATUSH[HHIHHFHLHH߉[]A\f. AWAVIAUEATIUHSHHHdž HD$8DL$ HD$1M$HL$8HL$0MI9 AEIO<\u p@ H9 Ly<\u Lp@tgH9 Ly<\u Lp@t?IH9] AH<\u߄tH9sAGMO<N <{ L븃|$ uH9s: <} HI $E1I9N HL)E H$ HLLs IM AtZI$H9sQ8}tLLT$DHL$ L$ $ HD$HPLL$8DD$, H LT$ Iz f H} LU H|$8Hf A;L|$0M H} 3 H$ H$ HL补HH H}H|$zH|$ Lz LH_ H} bI9sHA8}tB$ DHL$ L$ HD$HPDD$,LL$X H H|$8HH P H} H} |$ I$ HH9ID$ HH[]A\A]A^A_ILL>H}L(D$ I9sALI<N$ <{LILH$ LHL$(LL$ LD$r LD$LL$ HL$(x|$ _I9VA{KHAA I$I9HH|$8H8H H} H} 1Ҁ8}T$ H9AGMO<NtW<{ LH H} H} {I9ALI<Nt<{LII9sA{MOuI9s IAy}uM11LIH HH[ LI $H01Sr VHL{HHX] H} 0SI?f. ATUHSH HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H L@ HHFHHtHHHHE1H$ L$ HD$HD$ D$0 HD$q HHfHH H[]A\ @ USHQHt5H.HH7Ht 1H9~HKH HIHLHZ[]1ff. AVEAUIATIUHHSHOELLHH[]A\A]A^ݡff. fH*AWAVAUATUSHXH9IHkH1IITHHH^IHzK 7II9s#A<\tb IVIAII9rLLLD$H1L)1rOIHtHt$HH&HHXL[]A\A]A^A_IA\IVH9 AG&IIyLII9s A? yIL1HL$H)rHH@ HL$փt$ rLWH@]LGLt$E1H|$Hl$ LL|$(MILLd$0MH9|AI1H|$HL$MHl$ Ld$0LIIML|$(Hk IHL$|$HLHL$8H/ H|$H5~O 1"HD$ HL$8f D UfAnfnSfA:"f:"flHHH|$00 )$sHfo$ HhX@ H[]f. USHQ P =p {` 3 HߋkF Huk1 Q Z[]HHuf. ATUS HP =p {` X HDcHt: HHH S`Dcu:{` : HHHuDc H[]A\ USHQ P =p {` z Hߋk&Ht HIHt Q Z[]Ék1f. H H @ AWIAVAUATUSH( P =p -A` A_A9_usL+IWHcA` HD`hL IHtJ1 L4t7A A H(L[]A\A]A^A_IWHcHD`hA` A A_ PA =p L־ HD$H*A PA =p <A` AG D$IHHD$ AG`E1$ LkHt-LN HHt L9l$ AGKID$D$Iw LAGՋH Hc$I9~I4HH$H4LH$A H$LHt$6A IH LA` AwI賰IHmDH D@ PAw D L7 ZYIHHL$LHT$HHH4 HD$PHHT$I"ff. AWE1AVIAUATUSH( MDD$ AL$L $HHHLjL.I9 L1E11<\ @ <[ <( <#:<'e <"] H <!@A<: @ ǃ@=t^ǃ@< <)z 1HHHH H9^@sHtgD<{H D< HLAI9s:E1<=DQ@Du ǃ@<@A=u @z <<vH9 LH9 < < L) HT$HyHL$'IHLD$HT$I9 BAD$H$p H$p HT$HxH LD$UHLHHT$LD$} HH9K HH)tmHtWHtHHt9Ht*HtHf 9 H9 H9 t{H9 trH9 tiH9 t`HH9tWf9 tPHA8 HtDH9 t;x HHt1x HHt'x HHt x HHtx HHt HHH9uHH)Ȁ9 A HHH)HOH Hfo%w fo fHL 1HHH H HtQoHFftff8 fsf8 f8#fsf8#ffof8#fsfof8#ffo Hftff8 fsf8 f8#fsf8#ffof8#fsf8#fffo Hftff8 fsf8 f8#fsf8#ffof8#fsf8#fffL9F fo H@ftff8 fsf8 f8#fsf8#ffof8#fsf8#fffo@ftff8 fsf8 f8#fsf8#ffof8#fsf8#fffo@ftff8 fsf8 f8#fsf8#ffof8#fsf8#fffo@ftff8 fsf8 f8#fsf8#ffof8#fsf8#fffL9foIfsIfJfofsfffA~@$ L)HHH ~ B~HHftH~ ff8 fs f8 f8#fs f8#ffof8#fs f8#fffff8 d fof8 G fffA~t{8 HHH9six HHH9sVx k HHH9sCx P HHH9s0x HHH9s x HHH9s x A$( LCD)DT$`IHIDT$LE1AVdANh L\$H MN DT$H I H$p @ADA mL\$DT$H$p HGDEBXuDWDR\HL\$HT$谜LIH|$ aH|$ Mt H8= 8! AHH9 18:& :} H$HHH8 H$h HLDHAv H$ @ PH$ DH H$x D@Y H$p HZYH 1H( []A\A]A^A_HH@dH=: +HJfE1E1H@LLH߀]E1H9m AH Ar DDHHH9 fo: 11HH$ H$ HL$ $ LLH$ $ AP$ $ $ D$<DD$8DHRH H$p LLHPHHttHH9$H H@ LH01Q_ KHPHH9sD`HHAT$AaH@ H!L LH01_ H$H8H A~hDH HHHH2uH9NL)LHpH<$HHtH,L` A(A AH H0=vHHJ L1P^ GH)DPHZ HI LH01 ^ HHuLHYJ 1] : t E1E1AE1tLAI9hALLAI9DQKLAA I98A8ALA @8At!E11AoALAI9s@8qp@8quL= AWAVAUATUSHH P =p y{` k9ktHkHSHcŃ HS`D`Dh{` [ HHuI{` k HH k1ҋ HH[]A\A]A^A_H4IHt HHtH]IHtHIHqsH{eHHHK DH LƋh HDL$ H $H $DL$ HHQLLEUD ^_HH,XH4IH HHHIHH {` IsH{蠡HHDH @ s DLELLPE HXYHfSfnfnHfA:"f:"LϾH flH)$~_Htfo$ HX@8H[ATUS HP =p {` k HHuk1 Q []A\H H6HtHYHufAWIAVAUATUSH( H =p LA` A_A9_ IOHcHD`DhLA` Hu LHuFA` A_ L1HHA A H(H[]A\A]A^A_LwA` IuA HA =p AG L$mH $AG1HD$E A` A@A DAwI<HHdfnH fAnI 0 f:"H fA:"fl)$R]HH fo$HhLpHD$A HAL艭A` HD$EHJk[H5L7IOHcA` HD`DhF D SHHHsH;vMx Hc[y @ ATfAnfnUfA:"SHf:"L$0flHHH|$8IH H)$7\Hfo$ HXL`Hh@8H[]A\f. ATUS HP =p a{` kXv HXHuk1 Q []A\H HַHtHHufATfAnfnUfA:"SHf:"L$0flHHHӅIH|$80 )$[Hnfo$ L`HhX@ H[]A\ff. SHH Hu_H HH HgH HtH{H u.H HtH{ HEH[H;Htff. AWIAVAUATUSH P =p A` EgE9gRIWIcA HDhDp L~HLHHHA PA =p GA` AG LD$ %H LdA` H LH HZA A` e LHOLIH;AwI譚HH@ R IO HtXHsH[H}QEE1RLHHPAV H HHmA A HH[]A\A]A^A_1묋D$ AG10 ATfAnfnUfA:"SHf:"L$0flHHH|$8A0 H)$'XHfo$ HXD`Hh@ H[]A\f. AUI1ATI1UHSH1AP豲LHvHtHHHLP^HZ1[]A\A]ff. SfnfnHfA:"f:"LϾ0 flH)$^WHtfo$ HX@ H[AUfAnIATfA:"IUHH SHHfnL$@f:"L$HH|$Pfl)$VHt fo$ L`HhLhHX @8H[]A\A]f. fnfnHLf:"f:"H fl)$VHtfo$ @8Hf. AUATIUHSH(L-I I} _ H Y fHt$HL$H@ HP`HT$HPh@`HT$HPpHT$1HPpH@ HT$`Iu H|$^ H|$HP u7HH u0LH Ju9H|$HH Ju!H|$H@ HL$HHt$HaH([]A\A]f D AWAVAUATUSHfnL$`fnD$Pf:"L$hf:"D$XflHnHHHH|$pH IIMM)$ UHMfo$ HhHXLpLx Lh(L`0@8H[]A\A]A^A_ff. AVfAnAUATUSHfnL$Hf:"D$@f:"L$PflHHH|$XIH IIL)$jTHfo$ HXL`LhLp Hh(@8H[]A\A]A^ÐAWAVAUATUSHH( P =p ~{` dCH߉D$ HD$Hu'D$ C1 Q H([]A\A]A^A_Ë P =p {` DsiIHk`E1A tDsKI HHt@HB HHt0M9uMLHT$J4 dH]HT$IDsHs LJoIHu;MI}LHcI9LaHt$LH߃ *:ATUSHu H H W H W H[]A\H HH9 H1H=C nEHH11HX@L$ HHHLHHH@@ Hp8Hp0vHE(H1҉BT r ATUS HP =p {` # HߋkeHu;{` kH[ HHt H[]A\Ék1HIHtH{ gQHHJ1LbHAUATUSHQ P =p {` HDk膡IHt] HHtKHdHHt;H{ PHHRL Hh HZ[]A\A]Dk1f U1SHQHtH.HHlHt 1HKH H HLHH9Z[]ff. @ AWAVAUATUSHH P =p {` p DsHHDk` E1A EP =p x{` ` HZHu\ DsHs L牃 kIHIcL9|]H P HL[]A\A]A^A_H补HHt M9t+Ds JT I@HL IVAH 5ff. fUHSQ P =p }` $ H]fHH }` ]% H@HH }` ]& HHH }` ]2 HHH}` ]e' HHH }` ]9( HHH }` ]) HHHM }` ]* H\HH }` ]S+ H6HH; }` ], HHHS }` ]- HHHk }` ]. HHHd }` ]0 HH ]1ҋ HZ[]H} HHuH} HHuH} HHuH} HHuH} HHdH} HHEH} r HH&H} S HH*H} 4 HHH} HHH} HHH} HHwf D AUATUHSAQHdHHuLǾ IA=KHRH(HXLhD`Z[]A\A]ff. fAW1IAVAUATIUSHX Lt$ HL$ Ht$DLHT$LLD$@ HD$( eHS LL$1HMD$< LH ) I E IHLL9s}HS<\uL9 sLkF<n HcHLSM9= H? Ss0 < LkHЈE{HL6eHX []A\A]A^A_Ã0M9s;Cx@w.LktM9s!Cx@wtЁ Lk@u HE HE HE HI9 uIE \IHE \HE "HE 'HE HE HI9 dI\H|$LL$LT$H H5? MLT$LL$ H|$H5` LL$LT$ LT$LL$H 3 uAE ?HM9H H5=& H8/H|$ H1dH|$H5F LL$LT$LT$LL$H H5 HH5[9 L)H81G @ AVfAnAUATUSHfnL$Hf:"D$@f:"L$PflHHHHH|$XH IIM)$GHfo$ HhHXLhLp L`(@8H[]A\A]A^ UfAnfnSfA:"f:"flHHHH|$0HH )$ GH~fo$ HXHh@8H[] AVAAUAATIUHSHu`H%H H9EH= iHH Mu;LcHHE HkDs Dk$H[]A\A]A^H H9GtI$ff. ATfAnfnUfA:"SHf:"L$0flH)HHIH|$80 )$EHfo$ L`hHX@ H[]A\ff. ATUS HP =p {` OHDc HHuY{` DcKH HHu${` Dc H= HHuDc1ҋ H[]A\þ HHtH HtH{ HHHHuff. fSH_ HH<Ht\H[AVAUATUS HP =p {` HDceHHu?{` DcHGHHuuDc1ɋ P H[]A\A]A^Hf {` Iu HHt: H{` HuLHH HHuJH {` Iv: Hh{` I\ H BLLHH0 HH&ff. @ AWAVIAUATUSH P =p A~` LEn. HHu&En1A QA H[]A\A]A^A_A PA =p A~` AF D$HHAF`E1A D$ L5Ht(L HHtM9tpAFJT ID$ƋD$Iv LAF^IHtoHcD$I9#HLHLA Ht IWD$H4MHHT$J4 SH}HT$Hb ATUS HP =p d{` J Hߋk5Ht!HHt []A\à ku1܃{` B p f HIH P 1kff. AVAUATUS HP =p {` oDsD9s HSIcƃ HD`Dh H/HHu@{` DsHHDs1ҋ H[]A\A]A^þ HHtH詐IHtsH{ՁHHXDH D@ DDH}PLs ZYHHH{ HHeHEHSIcƃ HD`DhC`I{` 9 UHSQcHHHZ[]fAVIAUI ATIUHSH >?HHtLLH LcHH[]A\A]A^ D AWIAVAUATUSH( P =p A` LA_ IHu&A_1A QA H([]A\A]A^A_A PA =p NA` 6 EwKHHHD$ Eo`1HD$E LHIw H|$EwjZIHt1IcH9D$HLLLA V!ff. AVAUATUS HP =p F{` k9kHSHcŃ HDhDp Hm,IH_{` kB# HHu k1ҋ H[]A\A]A^H芍IHtЋsH{~HHDH D@ PDs DL1 ZYHHH{ HHy\ff. ATI UHSH<Ht L HhHX[]A\ @ USHH(H&HH/Ht$1Ht$HT$ vHHmu1H([]ff. ff. AWAVAUATUHSHH(HS E HKLmAAAAHL$AAEE9< L93 @ Hs0H4$ @ HE0HD$E9 A C @E @M IHHT$H<$ILHt$A ehH H H W H W INHH W IN HI^(E9# H(L[]A\A]A^A_Aj M TIHHT$H<$ILHt$A 訽 HH $HHD$HQ HT$Ht$IFHE IIn L)J<uQ IF(|8HGH $HHD$HzHT$Ht$IFHE LIn HH)HRIF()8H8H{HH<$*HEHHD$5H|$Ht$DLDM HD$H:Hl H(Hٿ []H W A\1A]HA^A_M IHHT$H<$ILHt$A ^O HxVH $HHD$HM HT$Ht$HIFHE LIn H)HHM IF(7HH H W H W INHH W IN HI^(ff. ATfAnfnUfA:"SHf:"L$0flHHH|$8IH H)$8H fo$ HXL`Hh@8H[]A\f. AWHAVHAUH@ATIHUSHHHHH H9AHl$ H HHLc HHĘ H[]A\A]A^A_ff. UfAnfnSfA:"f:"flHHH|$00 )$7Hfo$ HhX@ H[]f. AWIAVAUATUSH( P =p A` @AGLD$Z HHA PA =p A` Ew9HHHD$ Eo`E1E LHubEwIw LbRIH IcI9fHLHLA PA QA H([]A\A]A^A_Lx HHtL9d$t(JEwIdH4IVAH42HL$HHT$HHH4 HD$ GH#HT$Hf AUATUSHQ P =p /{` HDcvHHt} HHuc S`DcF{` ,H6HHHS 1o HH HZ[]A\A]HQeIHtHH5oF %qHS LH HH4USHQHHH !4HHHhZ[]ff. fHHHFH a~ {Ht$SuH H HHrff. S 3Ht[f. ATfAnfnUfA:"SHf:"L$0flHHHIH|$8H )$73Hfo$ L`hHX@8H[]A\ff. UfAnfnSfA:"f:"flHeHHvH|$00 )$2HQfo$ hHX@ H[]ÐH1H1HD$LD$1 H5+ o"H|$H6Hc HHa ,H$Hff. HBATIUHSHHHHu ~ HU[L]A\n1f. UfAnfnHSfA:"f:"HflH HH|$0)$1Htfo$ HhHX@8H[] @ SHHH t'HJ HH9Fu)HVHt HH[ Ht4HHH[HHL$H4$wH4$HL$HHu1HI 1 D ATfAnfnIUfA:"HH SHHf:"L$0H|$8fl)$0Htfo$ L`HhHX@8H[]A\ AVIAUIATUSHH %HL$IHcHHtOHt-Hl$Ht#HE HLH HH[]A\A]A^MtIHILLK 1 AWIAVAUATUSH( P =p 9A` A AOPA L$=p L HHvA PA =p A` Ew=HHVHD$ Eo`E1E3 L˼H EwIw LbKIH IcI9 HLHLA LA HH L[A` A PA H(H[]A\A]A^A_L HHWL9d$t&JEwI)H4IVAH4FHL$HHT$HHH4 HD$?HHT$Hf. SHH0HF ~~ HHMu|$ H0[{ AWAVAUATUSHH P =p {` E1HT$ HLt$A k9kHSHcŃ{` HDhDpLH#IHt H賺Hy {` kH#IH H|H H苻IH HRH 1HH5]QX txsH{8nHDH @ s ED LLPHD$AZA[HSLd$ HL* HL[]A\A]A^A_Ã{` k+P =p (DsD;s2HSIcHDhD`HHH HkH HD$Q EHIHs1HH51P, ZsH{mHkDH @ DLIws E PMmHD$A\A]H {` Ds H蛸Ht&H>IHt HyH {` Ds HUH H{` I H*HtusH{)lHYDH D@ WDs D LAXAYH Ld$ LHjHk{` Ds H蕷HH{` I HjHsH{ekHDH D@ RDs DL=Y^H]ff. fUSAPH~ HH&HH H}HY[]c, USHQ P =p {` Hߋk薶Hu#{` k HwH Q Z[]ff. QHG ¸ Z U1SH8HD$(HG x H8[]f SfnfnHfA:"f:"LϾH flH)$ (Htfo$ HX@8H[AWAVAUATUSHH(HF e~ \L% I$H(Ht D{ E1E1DD$qV1H(Hc[]A\A]A^A_f fnfnHLf:"f:"H fl)$S'Htfo$ @8Hf. AWAVIAUATUSAPHw 1fCHbIv 1IOCIHHIv 18CHH1Iv 1!CHHIv 1 CIHI~ 8 &H11L(L`HHHhLx Hp(HX0Z[]A\A]A^A_ff. UfAnfnSfA:"f:"flHHsHH|$00 )$&H`fo$ HhX@ H[]ÐUfAnfnSfA:"f:"flHH8HH|$0H )$%H,fo$H(HX@H[]ff. ATH UHH5 SHL@ HHt HHL趏HH苎HH[]A\UH SQ %HtH(XZ[]ff. @ H=9 锖 @ UHHSHQ_ u1Z[]Hu HcAHtHtH;11H9=ff. fWH7Hc>Y D H<H11H9}HOH y %HAUATUSHQLg #Ie^H=n ID$HHH5i L)H= u HHHH H H= B ID$HH5 1H3 ID$HHnHz ^HC H5- LH=H= I$HH!H- H ]c It2H5n HH Z[]A\A] UISHQHH.HSHHH)Ip l H11H9}"HsH4փ~ tH6HcHtHZ[] @ H11 AW1AVE1AUIATIUSH(H^H<$HL$HL$HL$ H! HuH= L HH!I,$HAD$. HH HtHhHdQHP HH I<$H` `HhHHx HH<$ I4$HHHCtH$H H$Hp M$ IT$H5- 0<1HuM 4IH LP;H bH fA8%D$Il$LP HSPH L-m HS`H HShH HSpH@ H H H C GQIPЃv2Hu8 H IT IDHf H0HHcE uH{0 H|$ \ H'H HtNH{HOHHHH H H@b hHA EY H|$ H H|$ H H HPo H uXM$$. LHL)LH,IHSH HHL~ H(H[]A\A]A^A_HkE12H5 Ll0 H5| LU H(L} MH52 LI)uHEHD$HSHB HJ(HIHHCHH HH *HHLxL CHPHuHLH IE L 1-IHHD$H5m H H /HEHD$HD$HC8HEHD$HD$H5* H H H44HHC0;IE Soje` UHH=SQH9,HHtBH Hw8HH HH1HHHBH*HBHZ[]1 D UHHSQbLHHHH H߉Z[]ff. ATfAnfnUfA:"SHf:"L$0flH{HHHHIH|$80 )$E HZfo$ L`HhHX@ H[]A\ UHHSHAPΆKH~XYHH[H]ff. ffnfnHLf:"f:"H fl)$Htfo$ @8Hf. 1 ff. AVH AUIATE1UHS1H HW H9g HHHHHuH3333333H{L)H9nHk(IHYHHL @ 1Hl$HYqH52 D$ 4 HD$(H~ HD$8IED$0B HD$HH HD$XH5 HD$hH) H$ 1$ IE D$@8 H$HQZ D$P@ HD$HD$ D$`A D$pH Lt$xDŽ$ G H$ HD$M LHHjH LHLdTHĠ H[]A\A]A^IHH1S SHwVH H[ D H ʚ;HHHt*fH*D$D$^iY D$D$fH*D$ USHQ5HtH膂Z[]HWHH+Fu"HHHHHrL+LtHcHx1Hcf D AWAVAUATIUSHAPH/U р HEH9t7H;HW HHI$1 D H=x @ UHSQe HH H5! HH3H H5 HH H5 H Z[]H H@ H@H_ @ H= t @ AUATUHHSHHHHu8Hh EضH= w] fEDe U H[]A\A]H H9Gu/1HT$EHD$ H= wfE Dm E11ff. UH5 HSQH HH HH5 HH }H ۊ H5x HHHm XH H59 HHHH 1/Z[] AWAVAUA ATIUHSHH HWV Lt$0LD$HD$L1FHD$`HW17HD$pH,HE HD$HHHl$0HD$xJ HD$@IHM AA $AA$Ld$HAu D Ht$1T$$HHT$ Dl$PD$XDl$ % HT$@HH * HD$8HH 1HLA HT T HD$hǀ uRHsLdy 1LLI H\$8HtH H|$@Ht{LuHsLw tS 뢃uaH{莂 H[D$T Ht11H9~HcLHtYtHcL8 E1YLd$v~UHSQ5ÅuH}Z[]ÐUfAnfnSfA:"f:"flHHHHHH|$00 )$Htfo$ HhHX@ H[]ff. AWAVAUIATI USH(R8H@HHS HA$vH(H[]A\A]A^A_Il$HtH} tH 1H1E1HcHHM H9}L|EO8EuA?tA DA9~IHtH5 T$DL$ DL$ T$uIl$EIO1D$ 1HL$H1H9AG8Il$CHcD$ HL$T$ DL$HDH83HHTH5l HDL$T$ ' H5Z HDL$T$ H5E HDL$T$ H5. HeDL$T$ H5 HEDL$T$ H5 H%DL$T$ H5 HDL$T$ tkH5 HDL$T$ H5 HT$ DL$DL$T$ t&H5NQ H3 DL$T$ D$ HcD$ ff. SHH HFH@(x _x HHHN <$ s 1HH H[ff. @ HH9whf. AWH AVAUATUSH L5y H^~ e H|$` fH:"IF0)L$H$BHH|$0 H D|$0E Hn OHEH" H5 H 1HHxyH= y IHHE fH= HHAIȡ HD$ H|$ IxM L1L= LAxE H$H9upH, 1 D H 輹3 HH͖, ȵIHt 薹LH, H, 1HE LmI I \AąI Ht$PH HD$pI H HHD$ I m H|$PH5w I I A : HT$pE I I HT$(\IHH|$([HHD$({ 1HD$(E1H L"H} :H{ HH D HEH H$H9 1D H, H oH, HH, H HH9uEt; n{ _{ H=U c HH/"v H} LeH8Ht$ Uu$ @ `H= IH>Hy} H8M$ 1A$ ASL9 LA$ ԓ HXYHHH= HT$ Ht$ Iȝ 董 H|$ GuH H8HM$ LA$ APL8 A$ X AYAZHiHH= HD$ 臢 Ht$ I H|$ tH5 H8ͰA$ LM$ Ha QL P ޒ ^_IHH5, HHD$ Ht,H,HHt>HHtEtH|$ ;tHv LH= ġ LI M kLsh f)T$Lsfo\$1D|$PT$h\$Xfod$Pfol$`)d$0)l$@EH= IHL5; L IHH5 LIHH5 HLuLAsL9sL1sH= ejHHG T I,:IHHH5O LLL- rLLlHu@HML IH-HLLgGLrL- LLH;{ tHuKHH H5 IHHLLL rH$H9 H= r HHt&H HC(p @ t!H=8 HH qHC(p H|$ 1HD$H []A\A]A^A_Ãp tH= HH `qH= IH1Ht$pIX H HD$p脧LIqMLqH= ' HHZpRB9 ff. HHtH? HW1:tHR:uHBH x H9Ht1 D AVAUATUS HP =p ?{` Gk9kHSHcHDhDpHIHk1 @ AVAUIATIUHS Hx H@ H,Z$+Z * [A]=*@AE E u)H}LLiX AM9uw wuH}LLGuuHmH1E1HE H9~IcH|HLL4Lt AIckLa Hw H@ ÐAWAVAUATUSHQ P =p D{` Dk@IHE1{` A {HyHHt7M9tK,DkIMLJ4 IHIDkMk`Hs L&!IHHcL9}I IUH L9 LZ[]A\A]A^A_ff. Hv H@ H@@`f. AUATUHSQ4H Hc} HlIHHHH5 >LAcmEHc}1IHHHH5 LA(mEHc}IHwHHH5 LAlEQHc} IH<HHH5x LAlEHc}IHHHH5F RLAwlEHc}EIHHHH5# LA<lEH} IHHHH5 LAlEeHc} IHPHHH5B LAkE*Hc}$IHHHH5 fLAkEHc}(YIHHHH5E +LAPkEHc}, IHHHH5 LAkEyHc}0IHdHHH5 LAjE>Hc}4IH)HHH5 zLAjEHc}@mIHHHH5 ?LAdjEH}HHHOIH HLH5 LA jEH}PHQHMOIHK HLH5 LAiE8H}XH H/s H IHLH5 nLAiEH H2 HNIH HLH5 #LAHiEHc}`IHHHH5b LA iEqH}x IH\HHH5 D LAhE6H IH HHH5v oLAhEH o IHHHH5 1LAVhEH H: Hq H IHLH5r LAhEvH H Hjq H IHLH5= LAgE2Hc( IHHHH5 kLAgEH0 k IHHHH5 -LARgEH@ H< HLIH HLH5 LAgEkHH H H5LIHQ HLH5 LAfE HP H L%p I$HLH5 ULAzfEHX H HKIH HLH5 LA/fEH` Hf L%o I$HLH5t LAeEQHh H HKIH HLH5: }LAeEHp H L%n I$HLH5 ;LA`eEH H} L%n I$HLH5 LA eEHc IHjHHH5 LAdEDHc IH,HHH5N }LAdEHc mIHHHH5,s ?LAddEHc /IHHHH5 LA&dEHc IHrHHH5 LAcELHc IH4HHH5x LAcEHc uIHHHH5M GLAlcEHc 7IHHHH59 LA.cEHc IHzHHH5 LAbETHc IH<HHH5 LAbEHc }IHHHH5p OLAtbEHc ?IHHHH5F LA6bEHc IHHHH5 LAaE\H HH&GIH HLH5 LAaEH HHFIH HLH5 =LAbaEHcx -IHHHH5q LA$aEH H H|j H IHLH5h LA`EDH He L%8j I$HLH5 yLA`EH Hh Hi H IHLH5 5LAZ`EHc %IHHHH5 LA `EH HHJEIHR HLH5U LA_E5Hc IH HHH5, nLA_EHc ^IHHHH5 0LAU_EHc IHHHH5 LA_E{H}h IHfHHH5 LA^E@Hc IH(HHH5v yLA^EHc iIHHHH5K ;LA`^EHc +HHHHH5 HA"^EZH[]A\A]L%g I$$L%ng I$L%]g I$ L%Lg I$~HCIHz HBIHHBIHHBIHHBIHL%f I$H~BIH%HdBIHpHJBIHVH0BIH<HBIH " SHH 3 HHH J<$Ht$HT$1H [ @ QH e H@ HH@HZf ATUHSH?HJI1H9] ~)HEHH<,AH IT$HHL[]A\ff. ATIUSH Hcd H\$ HHL@ d'LHH&I<$Ht$HT$ HHO<$Ht$HT$ID$HHH H<$Ht$HT$j1LFP HLH []A\ff. AVI1AUIATE1USH/HHHE H9FLcM11I$H9~YHcI|HLL j HcIcH|HLLS ~AIcH{H HkE11H$HE H9 Hk E11HHE H9`H{(H H[011HHH9 []A\A]A^HcH|HLL{B HcIcH|HtLLSBthAIcoIcH|HLLW tKAIc$LL< bLL$ .JE@;6 QBH HuZAZf D AVAUATIUHSHH?AH{LHpALkE11MIE H9 H{Ha []A\A]A^IcI|HMLHAt AIcCfG <HWH@9 @ ATUSHHttcH []A\HHH1H9}HT:tH Ht$d Ht$HHHHH[]A\F HHt$8 Ht$HHtHe HIhWLHt$ff. { ff. ?uvAUATIUHSHQHHt ?H[HE11HH9~)IcH|HLH3t AIcϸ Z[]A\A]ø f. UHSHH== QMH*HHI HH HHt gV1Z[]ÿ fSHt$HH?11H9~%HcHT:uHc1蟑Hu1[葑Ht11H93~HcʃHLHIHHLHcf D AWAAVIAUIATMUHSAQ`HHtOIHv^ DHLLU LHHtIMLLLH臰 HHH ZH[]A\A]A^A_f. USAPHt0HHH虬1E HMH] Z[]H_ H8x+f SHgHH] H;PPu H9X0[1[ AUIP ATIUHSAQ5H?E11HL L@ HC HHCH1H{H{8H H5] HE H+Lc@H@ HDb$D+b A*G$dDcH=*@CLLHƨ E1j E1 Hj G Y^BHCHCAE IuH謎 H KHD91HH1nIHH{1HHHAVSLNSEZH[]A\A][u;Mm11Mu iHcI9E YHcHIt}u:7ImH*E11H;E IcHHt}AIc @ AVfAnAUfA:"AATfoIUHHSHfnD$@f:"D$Hfl)$=HH=) IHHfo $E1E1HhpLpI$L` `H`PL@L@(L@0L@8Dh@DHDH@h XXHEHtxD x@ 11cHcPsL{T1HC 1HC( H{ HC0H{( HHsH}H贡H} H LeMt?AD$TH߉CT?QH]At7AtDI|$0HR H[]A\A]A^HQH]At CD HCHE(HCHE()fATUHSH 1臊HHH@ 1H耔IHiHEY HH u-LHH=( x HHMPLEPH[]A\HuH= 1K Hf D AUATIUHSHHtf: taHt$H IHHt$H05LHHt8HHL1H߅@OH[]A\A]H Y HZ ATIUHHcS^HHHLH41H߅@TO[]A\ff. fATIUHSHu3HX H HHHL1H߅@O[]A\Ã: tHH=4HHu$H Ht$(HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ H$ HD$HD$ D$0 HD$qH ff. @ AWAVAULnATILUSHHHu.HW HL1ÅufH[]A\A]A^A_Ht$Hn IHtHt$H3IHLHLLw1LML莛ff. AWHHAVAUATUSHXH HD$ HiE11PL@ j j j R H HPL0HLxML=V LhM H 1D$HU H@ H HHH-CV H9I9wE1I9 E1E1IcI;N}^E I| H r AL-U HXH> 1HT$H-U H9uHMuZHH= |$ HE HL LHXH[]A\A]A^A_IE < HL HD$ E111PLK? j j j H H L-U L0MHL$MHH=: d HL$MH#T Ht$1H H\$H 虁HH(K Hx ZD$_ff. @ AWAVIAUATEUHSHHX$ HT$L$D$ DL$<L$ LH<$ .MtIF HH<$H ID5H$Hx0P D_A9AH|$ ENAH|$ M HINHD$0IcH9Hc$ HMcD\$LOT T$HH)Ƹ LT$HHHL$@LD$(HHt$ZLT$IHQT$HHt$1HL$@D\$LT$LD$(LcI9}'J<D9mAIHE)McJ|ыT$LT$@MLt$EI9T$(HM)HcM| ED9 Hu;SM9Hc1I<D9;$ | D$<9pI뷋|$(HL$ )H|$ HHTHt$0H|$LD$L$ LD$L$ SM9HcIHuHMLt$LT$@H3HXL[]A\A]A^A_11HD$06AUIATUHSHAPHG@D A H3HtH {HsHt H tsHCHu5HC(Hu:HsHt H[ tQEuBMu) Z[]A\A]HpHtrHpHtzLHW uUSHHH> H H[]11HDHpHu HcH;}H|$3H|$u D AV1AUATIUHSLoHL9}H;lu I[]A\A]A^HE1M9|1J|H_I UHSHAQH6Ht y @HsHtH` HsHtHG HCHuHC(HuB Z[]ËP$D@HDH HMRP H0R `_AXHEHP뵋P$HMHDH D@RP H0R 'Y^HEHP}xf AWIAVAUATUSH( P =p A` vAGLD$JHHAA PA =p A` EwHHZHD$ Eo`E1E LwiHubEwIw LIH IcI9fH6LHLA A QA H([]A\A]A^A_LhHHtL9d$t#JEwIdH4IVAH4HL$HHT$HHH4 HD$HHT$H7f ATUSHH> H []A\HE11HDHMHP$DH D@H0RP R ZYtAIcH;}ff. AWAVIAUIATMUSHH(D>HGHiHT$A LD$D$Hu@T{~VIELL1҃hTAF,PAF(PHt$EN$EF ^_7AIM } AL*1H=/ 1;IHIM LLAdDI\DAXPA`P ZYLBIELHPHu }o IEE1`PHm1Ht H;E HcH; M Ht$Lf}:IMT$LAH ЈAHt A H([]A\A]A^A_ø t51 D IcLHt|AIc: LtIELHPI6| IEL`PIv@T| IEIV1ɃhT1Ht H9 A~ LLK|Af USHQH9H.HH胺Ht1H9~HLHIHLHZ[]ff. @ ATUSHHI HHAH 'ZHHAHtG}HHHHHI@H@MLr@1[]A\VXH뷐SfnfnHfA:"f:"LϾH flH)$Htfo$ HX@8H[USQHG HCH.HH/HHǺ H߉?Z[]fH/u= @ 1USHQHwH HWHt,Hj1HٚHtHC H@HDHC Z[]fATUHSHHvHt 8zUHsHu>H[Ht+E11H9~!IcHHtj,AIcڸ []A\ËC,HM HPC(PDK$DC ZYuff. fSHHʃu6 E~gH@H H:tOHH9rH[ÃuKɁ HE~;[ Hp|HHHtHH)[H)[É[H DH[[e ff. f~Z fATH1H5 USH HT$3H|$Ht$k HHHH Ht$HULd$MLH"LHYH~H H[]A\ D AVAUATUSHHGH Is ILpH L9J< zHHLHHR MtMe [H]A\A]A^HezL9(f. H( uHGG @t uHG@ IHw(IH G @ HW0IyM HvKH9 J I9 L1Ƀ HteHtSHtAHt/Ht Ht A AH AH AH AH AH AHL9 HqAD AD HAD2HNADD2AD D2ADD2ADD2ADL9uHs IqL1HHIHH@IBof80fsf83fsf80f83PHf83fsf83H@H9rIHII0J L)M9 M)IqHvaB~K4LHf80fs HH)f83fs HAf80f83ffNf83fs f83fNfFtSHtIQPHt<QPHt/QP Ht"QPHtQPHtQPÄ&HOH@1L9tAAHHLE1HWHQH LfHHT$ Hff. fIIH H<A . / Ap/0ML1H H9t^/t?HHHut@/u. փ/ HHPH̓.uDXHPA/tL1҉L9HL9t 9/L)HHqI1LÃ? 1%ML1BAx/I@0// IIDXHPA/YHPK D SHHH? H9Fu)HVHt HHt-H81Hu(H[HHt$uHt$HHuƃH c H@HHk7 ff. @ SH觸Ht1H81Hu[H ]c H@HHkh7 كff. HHH5` 1HT$-aH|$1A/ HO腺HHxH|$1豼HH? H W H W D UHSHQH`> H9Ft/HRHHt*HH辷HtH8 Z[]HVHuŃf. SHH~H ~HtH)[ÉH7H:tH9rH[ @ QJHH8 Z D H> HHH@ HT @ ATMUHSH H;w; 8[]A\ff. AWAVAUATUSH(HF ZLfIMJ H!sHH1HH1HD$E1E1HD$L9}RI|H;=> uHG 3Ht$HD H18/LDHD$HMlMJ< rHH1E1M9}4J| Ht$M9Ht; uaHHpJ| uIHuHyHHHHHHuH(H[]A\A]A^A_HHLH J| f. USHQuy HdyŃHOZ[]f USHHHGH@`Ht HcHHuHH[]tHt$H;N9 tH[]H3Ht$f D AVH1H5 AUATUSH @ HT$K)SH|$1HH4HA( mHH\$H}tH HH u*HHcHHH @ H[]A\A]A^Ã|$// HrHt1҉H\pHIQpMtJ< IHHHLHB LHHISLA)H{ff. AVIAUIATIUHHSoLHoIT$H WH9NH)H9xH_I9FH2H A|/HT t/ H H| Lm1ff. @ AUH1H5 ATUSHHT$P'tBH|$1HHt.H55E H HHu'H5 H8 Hzr1HH[]A\A]Hbr1+HH nIHHH zHIY~MtI kC, LHL LHqIH/ L{IHuGA} t3HLIHHH2LN0H& LL)HHxAT tH tCHHLHHHpYIHt,HH&xLMl$/CHPSATE1HHU1HH5 SHH= HTeLd$ HL藁H Hߺ 1 HHLH~HHI)HlHHk111{ GHL[]A\ AVAUI1ATIԺ USH O HeLt$HǺ HLvHHHHH []A\A]A^f D SHA1HHHt$AQE1jo AZA[t H}HD$H[f. SHH=u8 0IHt"H1LHXHCIP I@I@(FL[ÐAUATUSHH(l$PEu&H3 8t/=9 =9 -H(AH[]A\A]H(A[]A\A] ff. f11:f. SH7xHHu H[p-ff. AWIAVIAUIATUSQH 6 L@ w(sH5 H HHthMtqM}LH1H=ܪ HH,Ht41LH'HH,HtHsLHH,Z1[]A\A]A^A_ÉHH=> 1Hf. ATIUSHoLH HH߹ []A\ H SH5< HGw H5 H0w¸ u[H5ME Hw¸ tH5 Hv¸ tH5/ Hvt@H5O Hv¸ tHH5 v[ø ø [ø [ D AT1L% USHHH0Ht$HL$(HL$ HL$HL$HL9( HHL$HT$ Ht$(LD$- H3 H@ Ht$(H@H HV H H HE/ H9 诵HHt}1H0 HH1fHChHCHC8C(L9( }LL$LD$HHt$HL$ HT$( H|$zHu(H0H[]A\EHuHq Wf ATIUHSHH?tH{ Hu[]A\LHff. @ AWfAnAVfpAAUIATI UH SH8DD$ fL$H E1DpfH}LP`LH@P HHI$Lx(LcIIHLE1BIM9~DLrHHIGLHT$J4!yHT$|HI(HLk011Ҿ Hx=HC8H HBPv HC8Hz @ HHHC@HHD$111E1HKhH D$ sx D SHC HAHC(HlH}81HSHHtK1H5 gM IHxH}@H\L'HE8H@HHCHHtH E(HH]8HLe8{ ID$pb HU@HBH HRH5| H|X IAD$wFIt$I~HnIHILHx0 LI#'I AA AFMn IE L5/ IV L2jLHD$(&H|$( )It$H|$(*H|$( HD$(ID$1Ҿ H{ tK H8[]A\A]A^A_ID$H HD$(L5$/ LIV iIHPHE8ǀ 1A$ yL5. HIH I_ @v_H]Ff D HHGE1LL$HHw6PIѺ APIH5ԣ HD$P1Q H H1ff. AWAVAUIATIUHSHHL6M~MtaH. I9tUH', HOH9$I LCXI9uxIIw* 1LIHILM$M} MtI$LcHHtHE H{HkPLsH1IE 1H[]A\A]A^A_Mz S1H H0HD$(HD$ HD$HD$HGHt$H9( 1H0[UHHSQ2HHt'H}H>HHH HH#$HZ[]ff. ff. AWAVIAUEATUSDH(Ht$HT$HL$eaIA 1E1H I9J< IML1A HHwy HL9|Hr LL)qsH H\$H1H([]A\A]A^A_E 1A ASA E1< w ?HɀJ@rgD (A vr vrAˉAɃ?AHfnK A A?D A?@D fnff~J& H @r?ɀ?J@rfAWAVAUATUHSHH(gjHWjU C LuL{AAAAAAẢL$D9 M9 @ HM0HL$ z@ HC0HD$D9l$ A E @ C @ MO \IHIH I B HT$H|$LLA IHH/ Hl$HHT$H THT$LHID$HLI\$ H)HSID$(˵HxD9l$* H(L[]A\A]A^A_AD Mx [IH"HT$H|$LLIA =: H\Hl$HHD$H/ HT$LID$HII\$ L)J| ID$(HDu HD$H|$L HH( HE Il$H W H W IL$ HH W IL$(HuHHt$HCHHD$H|$`L$Ht$LD HD$HM4 ZIHHT$H|$LLIA H.Hl$HHD$H HT$LHID$HLI\$ H)HH ID$(dzHWM ZIH@HT$H|$LL HHl$HHD$HGaHT$LHID$HLI\$ H)H aID$(6HkH& H(H []H W A\1A]HA^A_yIcI/u IHT$H|$LLA Ix|HSH7h HCH[H@ SHHHHt 1HsHX H{PHt 1HKPD H{XHt 1HSX0 H{`HH[Zf. QHWHHHHH~<HHPDH9Hk HHHHZ1Zff. USHHtu9te9 1H[]Ã=3( us1 |$Ee|$ 9t1 eycHL$|$3 |$HL$TjQT Hc11|$Y|$.' ; D QH?HG HGHx7tiHuWHZ1HrLHH H HH H9u!HH$ H5߿ H8PHH$ H5 H8P1ff. fSHA E1HHHT$$HT$HH[ff. ATUSHF {HL%Q HHLH :L%0 HSHL { L% HSHL | { L% HS HL T { bL%ړ HSHL| , { L%ʓ HSHLT { L% HL HH H8HCH9L% HS HL { L%q HS$HL u {$ nL%! HS(HL M {( &L% HS,HLu % {, L% HS0HLM {0 L%֒ HS4HL% {4 NL% HS@HL {@ L%1 HKHHHLR H{H L% HKPHHL& V H{P nHKXHH5> H - L%C HS`HL_ {` HShH5 H HSxH5 H H H5k H H H5 H L% H HL r HL%ґ H HL D L%% H HLf L% H HL8 ^L%^ H HL L%< H HL L%! H HL ^ tL% H HL 0 &L%Ґ H HLR L% H HL$ L% H HL <L%j H HL x L%N H HL J L%/ H HHL H NL% H HHL H L% H HHL H L% H HL \L% H HHL% U H H HH5^ H & H HH5L H L%j H HHL H vL% H( HL ( (H0 H5 Hw H@ HH5* H6 f HH HH5 H E HP HH5Z H $ HX HH5x H H` HH5A H Hh HH51 H Hp HH5 Hp L% Hx HL x H HH5 H! Q H HH5 H 0 H HH5K H L%A H HL> $L%O H HL L%, H HL L% H HL xh >L% H HL x> L% H HL` x1 []A\à UH 1SQ HuHHHWTH߉}Z[] UHSHQb HtOH5t U 1Z[]耥HtH- H} 軯H} HH5 1~f UHSQ2HHHZ[]fAUIATIUSHAPH=v `tIuH{LY[]A\A] H- H9kfAWN<AVIHAUILATMUSHHH4$I7A8 HcH Il$1ɻ H9|hH9HOLH)LH)HH9HH[]A\A]A^A_IH<$LI)IIKt A8 HH}tLIoIH LHL$H<$H)LH0A8 HH>HL$^HHHXIHٻ L)H9}6I4H<$HL$LA8 HHHL$u HHHXH9HOLL HGH= wH HcHHDH H?H=wE ATIUHSHH H H;b HtJH@ tO1qHHt[HHLHHN1<$ 'H []A\H1LHH HH5 H81辣f AWMAVIAUIATIUHSJ HHH;8 HcH 1MA HD$M)M9}4L$J<HL8 HHwL$tK$Ld$L`M9LINLd$LMIL9~5IHLM)IMK<8 HH tMgILHH[]A\A]A^A_MGA M9}IJ HLD$LH)H $HH88 HHH $LD$u K$LL`M9LLINMH)I)=ff. fAWAVAUATIUSHHHT$H IH* I9G 1Hl$Lt$ E1HD$HD$M;o}]IGJ<H;= HG ti1HHtuHT$HHL%HL|$ IH|$H/H/1HH[]A\A]A^A_H LH5j H81CHHw LH5B H81f AWAVAUIATUSHHH_H H[ H;X0uH|$ S |$ {I] H t>H GIH$HHH51 LA. E1 H Ht;H`IHHHH5J LA E H Ht;HIHHHH5 {LA E H Ht;HIHOHHH5 4LAY Ek H( Ht;HIHHHH5 LA E3 H0 Ht;HDIHHHH5c 覍LAE H8 Ht;HIHzHHH5 _LAE H Ht;HIH3HHH5 LA=EE H H! H H5? Hތ H@ IH HHH5 謌LAEH0 謫IHHHH5a nLAEcH` nIHKHHH5 0LAUE%HX LP HD$TIHE1M9 HLH5 ڋLAEH=9, HY? PH$IHHHH5 膋LAE{H H H5$ &)HHm H袠C1 @HH%HHH55 H߉0IE`HHH[]A\A]A^A_HD$= J<H|$XQH|$H H1IHH H HD$HT$LLLD$UH|$H|$IfHS(H|$ Ht$ |$ Ht$1I]HHD$H)HHHD$%HT$HHzzLD$HHD$R 5ILIHL I3H MHIsMu$HxHu#JLLKLIHHHA IISIs MtAJDIHLHHKDHff. AWAVAUI1ATUSHHHHt$Ht$ HX t(H=6, թHX H5, H Hh t(H=5, 裩Hh H5, H H@ t(H=5, qH@ H5, H H t(H=5, ?H sH5, HV H C HH t(H=45, HH 3H 5, H ~C5, H= 5, 1A 迨H=5, 1H4, 誨1L0 H 4, I9~H8 H<H1@MdJ< IHL5J HE1L90 ~*H8 HJ4I>H1ML0Hh1E L9t H} :tHt$1L%W4, 1LHHL[]A\A]A^A_ff. HH HBHHHHHHHuHVHBHHFHGHHHOHff. @ AVIAUL, ATN$ UHSH2LH H?HLJH}Hu []A\A]A^I^LLH[]A\A]A^ZJf. AUfnfAnATfA:"IUfoHSHf:"D$@fl)$U ID$8LhpL<Hfo$LHk(IEhP H[]A\A]fSHH8 u1[HHS8HJpHAHBp1 UH1H5Q SH HT$H|$1HHqHt$H$u5D$(% = SH- H AHE HĨ H[]H- fUHSHQH6:'HsHu Z[]Hm: H1 AVfAUATUSH@ 1LspLc`HCpHCLkhC`H HtHH!HLLLH[H]A\A]A^ D F v8 w/H HrN/wH HuHG8ǀ ÐG a@t yH5 ff. fUSHARH: H@ HG t(H@8HHt111HH1HX[]fAYHH[E111] AUATAUSQG Lo @Ho0 L}HHt(@ |@kH{0LHEtm ZH[]A\A] ff. ATIUSHG8Hx t\H Ht=H; t71A|$ %H1譌HtnHtL tYHcH;| []A\H H> HVHoJ8 tU Ld%u1HCLHptID$8fv L H} H@b t YU L$ 1J1 6U L$!1 @ HHH >H <:@9H ~<:@yH ~<:@yH ~<:@yHtv~<:@yHtd~<:@yHtR~<:@yHt@~<:@yHt.~<:@yH t D>FD9HH9uÐAV11AUATUHS1HtHU H9~PHcLdA$ w4H& HcHI|$I|$ Hc1[]A\A]A^ø Ml$M I|$gI|$ UI|$CtI|$07I|$ tBMl$MnE11I9E _IcIDHxAIcI|$+0E11I9E ?IcIDHxAIcf AUATUHSQ HurH] H8H > HH HvH H8 uH H8試HHZ[]A\A]DmKEK HH> DmKHAGEblf Pz H H Zff. fGK<t.<*H H @Ѐ< uf=wH1 HHǘ Hff. fUSR(HtJH=*+, HtAH~ H9tHHH=+, 1H R *, X[]H*, Huff. UHSQHWz@ Z[] UH SQH H@ 1WHHHH HH0 ZH[] @ UAȉSHHHD$Het HD$H[]Hl$HA H9CH;- u H H871HHD$XH Hu UHHSQ>HbH}HH HHHZ[] AWAVAUATUSQH H@ H HCxH H;H tE1Hu X[]A\A]A^A_1L{`LchfLspHSpHC`LLLMtL}MtLpEtf D APYHt HY?1Z AWIAVEAUEATAUSHHHWHz8 u$1HT$HT$HB8HCHx8 H{8L6=HHtUEEDH=bv 1ŏHH[HCHHx8ٜH1H[]A\A]A^A_& @ ff. AWAVAUATIUHSAPH^HuH HK1A H߾. xHuYHIH5f HYuYE IL$L LPEPDMDE9LY^Z[]A\A]A^A_H1H}zIHuID$x@ZL fSHG 1H@H0 HH1C HCHSHVH[ff. @ AU1 ATUHH1SH(H4$ILD$H5 *~H\$HSH HwHj H9$[HLl$Ld$H;LLMXH<$ u H;- 1H0 HHtlHT$H$fHA A(HQHtlH HAH HA8LLLLWHD$HuiHD$Hu_1LA0HA(MusH H(H[]A\A]HL$HeH1H_ H;-H HQHA8uHHA0Hu.H HP0fHnfH:"A(HtHJ(HH0IH(HH(ff. SHHH@LD$1 HM H5 H[ÐHH= QQZ H H Z D SHHt t1[H5r VtH5r VtQzHH=y$, HH9 u-T$, uH z UV*HvHYwR SHHHHHT$H `H{Ht$r IuC 1@H[ff. SE1HH H4r fHn1fH:"1H0H 6eHr HL$ LL$HL$LD$LD$D$ )D$> IHt$Hu4|$ H;tHy;H 6euS1H0[H 6e1H HKV y HHS㥛 H9~ff. HcHi ʚ; D UHSQu H8HHE8HHx HHHZ[] AWAVE1AUATUHSHHHt Hw HIA11HaADžuEu A HD[]A\A]A^A_9H LHD$ H|$AbKH> I| G HHG8ID D AR Hff. @ t#uHy HHHÅt\ HyHHHHIHHHHH9|tHHHHЀtI@HxI@ff. ATfnfAnUf:"fA:"SfoHflH)$nHC8L`pLĽHcHk(IT$RHD$0fo$*HHBR H[]A\ @ G @H07fAWAVAUIATIUSHH L{MIL@1{M D$ 8 1L9 ItL$ LLL$d8L$HIE8oC HCHtHLqM HLLLH[]A\A]A^A_Ã{uH[@@KtLLM9tIE8E1HPpLrLppD I}8L$ǯIHWL$HL ;I}8薯H$H%HsLE1HCLJt c L x LHCLBt H$LKIM9tHCLJtUiHCLBt\ PLL4I}8菮HH HL IE8H $ LHPpHJHHp1ɉ Gt IE8HPpHZ1HXp CLL3 uf. HHWHB`HH@PH AWAVAUATUHSHH|$H~ LuMt M>A1L9|H []A\A]A^A_HEEdH| AL$v HAKEBff. HGHPHwHHcHHp Hh lHD$HtH|$x HD$Hff. ? tHWH; H; H;$ H; ff. @ S HHɝHz C H [ Ha FQHcH k Z1Ҿu Zú 11Ҿv 迯Zú 맺 렺 f AWAVAUIATAUHSH(L$ DD$DL$H L6I Ic1 M<HD$I @11I9~IT:DHE1 = M9~KtHI|$` Lt$f HޮH([]A\A]A^A_Ët$ H軮1ITHL:CHI9uL"HHP1ITHRHHTHI9uEu D$`*|$ A t$ IcH1HHHt$ H|$` E11I E1M9 OdA<$t@LHT$erT$tt$ H脭 I뫅u HD$t$ HJ8[ It$H t$ H-u|$` /R HL)HWHIMLHT$t$ Hʬff. HE1E11VHÐAWAVAUATIUSHH8HF(HnL~ LnHD$HFHH$BD$ ` LHm AD$8D$M HH HD$HgLt$(Hu1HLHD$( DHu LH -HEHy HuLH HE(Hg H HT$LHH x HT$(HE DD$T$ LHH4$b{ LHsIHHuH5^ HHkHEHHHC8HPPHU HHHPXHUHgH1MHP`@M I;m Md HIt$'HEI9E It$HHEI;E }xIt$ HHEI;E }YIt$(HƾHEI9E ~:It$0H觾uHI;m }ItH舾VHH߾ -#HHHC8L`I$C HMHT$HH|E #LlHdLHG H4$H8Hߺ []A\A]A^A_H5 E1=I? 6IG@ D$&HPHzHPHf HnHL$^Yff. UHSHQH6 HuH{ HuH HuHS kHu(H Z[] AUATUSHHHXHdH$HA H H+HE } E1I Ht$ H-PwH6 H HX[]A\A]Å1EH\$HH; H车HHH|$@ H Hu/H5 1 ;HtHHD$2HD$nff. HtAAUATUSHQL.M Z[]A\A]HE1JtH tIM9t @ HtPH6 mZø ff. fHu U1SHHHcH;} HtH|$StH|$۸ H[]f AWAVAUATIUSHH(Hn0HH} 9E1HkHtLs E11IcH;E |rH H(L[]A\A]A^A_E1IcH;E }HtLAHC0HHf L˥A sHHt IHD$Ht]ID$8H6HxH%HHHtDHHD$rH|$D$4|$tHt$L ZA HD$ Ht$HH`H@H0HLk!HHHHLHL꾜 LǤIf D S:pHHtH:BH[ D ATUHSH^H HFHHHIHHHB "z Iu(H HuHHo H []A\fH AUATUSHQH> Z[]A\A]HFHIHHPH0a EH;~HCHLHPH0= !A H9~IcHLHDHPH0 AIcи @ AVHBAUATIUSHH HI,$HE } H H\$1 L-I HLd$@ LLu[HHM&H|$ H|$( u H|$ QHsL;5 ?HĐ []A\A]A^Am Hu ATUHHHG8HL$HxHH$e"IHHHLHEH$HL$ :HHH $H $tH H]A\ff. ATUSHHH= IH.dH1HXL`HP Hh([]A\ff. HM( HM( AVHAUATUSHH@HeHjHHIHL/H HoID$H H C IE1HH9I9LDHE L4HL HH^ H'uiHHH)P H IEI9H;( uiIcU\HM1LH5 H= LHLBH HHHH@[]A\A]A^MH Lt$LLD$LHHZ H5r HD$ IH LM eMLH L胂H|$HcID$H LgsHO E1HL IHtHM\1"ff. ATUHSHHHt$ HF H;H ~ II$C P1HH dAąu?H$S HK,u#H~ @LHC0|_tH;HD[]A\À|_u8_ux_uHH AH HOHH5 H81>mA GH 9Gȸ fG HG8AHcpx~HxxHD H H L ff. fAV H=Q AUATUSg HHHC H5W HI1A vH H= H W H5W HL Hn H1| IFHHAH HH X H H5W HH<BHN H6, L% Hh( H a; H4 H( LkpH) H( H( H( HL( H|( HOx5HL9tH3L9uLylA [H]A\A]A^Tff. fH H@ H@Hx Deff. AWIAVIAUATIUSHt$ H}LM I E1M KD- HH - 1H~IT: HH9u1L9K H~ 1ItL HH9uM= LLcl$ LLH! Hھ L H[]A\A]A^A_E11MtM.KD- H aPg A LjT$ A LZY M E111L9 IlH} U HU Eu1Ҿi LZr HuLT L,A 1HITH: HM.ZMt-11I9~$HcLIDHpdHcLLL> {AHt%LLLLH)蠩 E1M Lje|$ H{IG8nHpLHHHLLH) E}xsff. 1Hx fUHSHHP_ZYHHH[]Nff. H HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H HH$ A H@ HT$HT$ HT$HHH$ D$0 ߓH AWAAVAUATMUHHSHHHG8HWL $HD*L$ A DE H HMt$触lHC8oE H hH@E@ D$ E4 1AwfH7 VH11AWLL$`LLD$s _AXEtS H6 H߾ 1HIHC8LxI0 Et @ MH1Lv2 LfL^IvHBgA~ D H 1Ҿ HKta1Ҿ H8 |$ 'H[]A\A]A^A_P11Lj LL$`HLD$U ZYQfUHH5 SHQK \HsH0H'H HCZ[] D MA fH$Hx H9GH D LP f. SHHHqHtH[ff. @ USHR5H u7H{Ht { u HkH@ XH[]=H{AWHcAVIHIAUATUSHH8HH8L$ x LD$LL$H$虐H{8H荐H{8I聐HIM?M6H$IH$E, HC81Ҿ| HH@P HC8E1ɾ] H߃D$ HPpHjLHhpD J H$HH0cH$H@HtLE1M9` AWLcM;> |$p Ht$HdT$ H߃Hc8 HC81HPpLjLhp Ht0HHHC8HPpLb1L`p H8[]A\A]A^A_J|$p Ht$HuH HX|$p |$pI Ht$H mHt$H XT$ H߃Hc,4H$1LHLL$(H@LD$ JtLD$ LL$(IXH$Hp H|D HVD$xHLPLL$(LD$ L$ _AXM;>7Ht$HbT$ H߃Hc6>94/*,HDSH~ 4H[off. fH= @ P H5 Z f SHG8HH @H < t-V Ht/ Hw[þW u D H= q d @ ATUHSLg HI<$Ht HӅu@I|$Ht HӅu7I|$Ht HӅu I|$HhHH[]A\YTOHHHHpff. HQ@Ɓ u5yDQH t,t6 t5QPu ƀu tu ك݃ ˀATIUHS8 HxHHH{Ht [LH]A\ff. ATIUSH/AT$ It$J9 DR)HcI McHk(Mk(Hk(JJ|H)HH)H(HIH H H H HtZHt/Hk o HH(L) o@8D L@HLD o HH(L) o@8D L@HLD o HH(L) o@8D L@HLD o HH(L) o@8D L@HLD o HH(L) o@8D L@HLD o HH(L) o@8D L@HLD H9f o HLHHPL) o@`D L@pLD Lo@(L) AoAD MA LD Ho L) o@D L@ IALD HAoAIAL) AoAD MALD HAoAI`L) AoAD MALD HI8Ao`L) AopD MALD HIAo8L) AoHD MXLD HIAoL) Ao D M0LD H9HcŹ Hk(HHH1[]A\o HH(L) o@8D L@HLD kf HHWHAHH H HAHGHVH HGH:H~H7 P=1Zf D AWAVAUIATUSVL )H$IH L M = H8 HHtgHHH)Hc9HHHHHH9HHHHLRHHqHiII,$HsLH5E L@j1H5E LQ H5E L5 H5E Le H5F LI H5N L- H5=E L H5)E L H5E L H5E Lq1H5D LX H5D L< H5D Ll H5D LP H5D L4 H5D L H5D L H5oD L H5[D Lx H5FD L\@ H53D L@ H5 D Lp$ H5T LT1H5C L; H5C L A H5C L1H5C L H5C L H5C Lf H5C LJ H5xC Lz. H5fC L^ H5RC LB H5@C L& H5.C L @ H5C L H5C L H5B Lj H5B LN1H5B L5@ H5B LeA H5B LIB H5B L-C H5B LD H5zB LE H5hB LF H5[B LqG H5KB LUH H58B L9I H5&B Li J H5B LMK H5B L1L H5A LɿM H5A LN H5A L H5A Lu H5A LY H5A L= H5A Lm! H5wA LQ@ H5jA L5 H5ZA L; H5GA L H55A L H5$A Ly H5A L]1H5 A LD H5@ Lt( H5@ LX H5@ L< H5@ L Խ H5@ L H5@ L H5@ L1H5@ Lg H5@ LK H5@ L{/ H5p@ L_ H5\@ LC H5I@ L'ۼ H58@ L H5'@ L H5@ L H5@ Lk H5? LO H5? L3 H5? Lc1H5? LJ H5? L. H5? Lƻ H5? L H5u? L H5b? Lr H5Q? LV H5@? L: H52? Lj H5(? LN1H5 ? L5 H5? Lͺ H5? L1H5 ? L H5> L| H5> L` H5> LD H5> Lt( @H5> LX H5> L< H5> L Թ H5> L H5y> L H5g> L H5T> Ld1H5G> LK H56> L{/ H5(> L_ H5> LC H5 > L'۸ H5= L H5= L H5= L H5= Lk H5= LO? H5= L3 @H5= Lc LH5= LG PH5= L+߷ TH5}= L÷ \H5n= L `H5_= L dH5Q= Lo pH5C= LS tH56= L7 xH5)= Lg |H5= LKH H5 = L- H5< LŶ H5< L H5< LLH< H=z v jLH< H=x S GLH< H=p 0 $Hy H5<T LH Ht< H=y` Hr` .H5`< LIGHHG ˵HP< H H` H#` H= ` HPpH H .H5< LIG H sIG H L H=_ H8 H8 H; H_ HR+ =.H5; LIG(H EH=._ HW H; H_ -H5; LIGHN ҴIGH H=^ H8 -H5 LIG0H 1H5q^ L&H|IG1H53^ L{&H5 LIGH IH; H=] H] 3-H5: LIG8H H=] -H5 LIG@Hc ʚ;:IHѳH=: wIGPHH=: wIGXH1|iIHH-) OHEHtЅt<H] HH1H HHtCHLLX@H HH} uYL[L]H5: A\A]A^A_D. ff. @ AWI AVIH *-AUATIUHSAPwHIIIHc}f9HHHu HL;5t*HHZL9uYL[L]LA\A]A^A_-鞲 SHGHHp(Hp HHHH9HH'HHzHPHX [HÐAWAVIAUATUSHH8H83sH{8I'sH{8IsH{8HsHD$M#MHH|$ LH%HC8E1E11ɾ HHPpLjLLhpD ~MnM7 HC8H߃hx MnM HHy4 IFHmH HD$HC8E1fvHHPpLbHT$L`pD U # H E111Ҿ HE1HD$H{8I9|oxfv1Ҿw H]uHC8HL$HHPpHJHHp1ɉ HC8HPpHj1Hhp H8[]A\A]A^A_IFNlAoM I} s qIH,IuHt=Hy$ HLH I} H{8F pHHD$į HHC8HT$1E1HHHpHQ1ɉ HPp>xMmMt211I9E ~(HcH߉T$ItIT$HcHC8fvH߃hx Y H HH HC81IHPpLbL`p E1I} 3IcI;E &ItH͇AjoH{8HD$\oH|$ rHHD$ dIu H衻HT$Ho9HC8LL$ E11ME HHPpLJLLHpD IMH< HC8fvҾH߃hx ǭHY HH5| H Iu HúIu H貺HH肻LHC8HL$E1fvH5 HHPpHJHHpD Iu HHIu H7 w HuqʬHD$HL9{Ǭ11H9HcH߉T$,HtHL$ 軅T$,HL$ HcE11I9E IcHIt胅MAIc?:5 UHH;= u H]H<$Ht$uH<$(Ht$H]$ @ AW1AVAUL,7ATUSH H|$H|$8Ll$0HL$(HL$ H HHIHtY H~IH @ ѫ@ҫIS0LH茅IH9u6HĈ L[]A\A]A^A_HxHk8Hd L IHT$HHt$@1LH H4$1HL\$@fIndHl$D|$PfH:"D$XLt$H)D$`Hl$H;l$0Z Dm E wIvM|$P\ D|$PLt$HHT$` LD&HHD$`Hl$댃תH+l$8Ht$(LHl$HH 0 Hu Hl$Pt$HD$PHD$8PHD$0PHD$@PLL$`LD$hn H0 H|$@HtSH|$(HtDH|$ Ht5E1iHD$`ALDHHH%HD$`Hl$LzALD %H|$(HҩH|$ HH<$IH<$1 *HM H W L W D|$PLt$H"fUH SQHHf, HHHZ[]ø f. f. f. f. f. f. ATUHSH HW8Bxu H []A\ÃAHHcHqHH> w HtHu HHHHHooIBxD)$)L$ HDHfsHK8fo$fo\$HcAxHHHHXQxAff. AUATĨUHLMSARH L@ $HHHH 1H5z LOHLLHV8 HH{ZH[]A\A]ø f. AUATAH UHSHQHcHH~ EurHp Y H|H{ EuP HPZ[]A\A]þ6 c Hjt< c ju$HFo@8HG8 Et c Hxj H! ;ͦ H_ HE8fv dE E111Ҿ H H[HE11H9 IcHHt\~3AIcE H Y HiɥH5 H+HsH Hs HѱH[H%>HE8Ethxfv WRMHC> c h' H c Hh @ f. f. f. f. E1E11Ƀff. f. QH H Z @ f. f. f. f. S x Hg%Y H w Hng[ @ wH HcH1HGH@Hk H f. WH$Hx HYI#1Z D HH HBHHHHHHHuHVHBHHFHGHHHOHff. @ USHH(HT$Ht$H|$C@k(H{8%HC@HhHx[H@H5H H<H{@HHC8 JHC8H@hHtH HuHT$Ht$H|$H([]K1HC8 D ATIUHSHH HHH?Hu4HtHu HL[]A\lH] H H H[]A\f SHHHGHXhHH{( HԣHC(H1[ATUSHH=2 H9uH$[H]A\XHHL`HL0 1HHụHLHHLHI9H蹝H{ H[]A\f D HG(HuHH|$H|$Hٚf SHG G H@t4 t0H=( +WHH1HGHH_L_H[H= VHf D AWAVAUATIUHSHAR~\ u7HHL⾄ HcZ[]A\A]A^A_DvTDvPD;sL HC`IcL|HE8x H LHxH IA HE8Au~HE8LA Hx8 Hcо HYcҢArHcS\f HI3c駢H5n Lg uHE8XHx@L Q&HHZ SHGHHu H[%耛ff. ff. UHSHQHHFHt~ HCHt~H&HHHE1H9}HLHHLHHKH41H9}HTHHTH]ZH[]H;բ uHHH5 H9uqHE Hff. Hu USHH(HG8o H)L$HhHG8HyfoT$ H([]HT H|$oB 1 PaH|$1Ҿ 7apH|$H @ SHH1H 8# H5 H= }=HC0H [ff. AWAVAUIATUHSHH(H H_ HNIHBM H;HaIHH=LH8H I4 L{M2 IG ߢA E1I H LHh XAƅ A H+ H1HHthHp EDHL$ H(H[]A\A]A^A_LqIRHE1L 1HHD$Pj jDH HH1H{wOAą>1PHE1Lj 11HHD$Pj jH HHtIE1E1 H{ OAąy1?H L?1H1託E1 E1D#f AVAAUATAUHSHGHHpG HH9}iS4K,E)1Dk0DHȃ Ӻ R 1DHE 1DH8 1҉H, []A\A]A^HH;¡ H= = á= ?>HcQ Hy? DBDA D ËQ LAzy Hc ? 1@AT8 Q LAzy Hc? 1@AT8 AVIAUATIUSH H.Lm 1IHCH9~IT:t^HI uH\ L]ۡ1H9} It>tlL貐H۸ []A\A]A^ÅH= yHH)H= gL^ L\h ZHv ATUHSLg HI<$Ht HӅ I|$Ht HӅ I|$Ht HӅ I|$Ht HӅ I|$ Ht HӅ I|$(Ht HӅuwI|$0Ht HӅudI|$8Ht HӅuQI|$@Ht HӅu>I|$HHt HӅu+I|$PHt HӅuI|$X1Ht HH[]A\[]A\ÐAU1ATUSQBLHWI1L- I| Ht1LZHH&HL%;#H߃ZL[]A\A] D QH H9GHGHtHHwH1ff. fAUIATIUHHSQHHנ1HcL9}HIT H:HH|HH IHH)L⾬ HIZZ[]A\A]f diHBHcHHUH ff. USQYHHtHX>HH譒HHZ[] AVEAUIATIUHSXHHt"HELLHZHH`HH[]A\A]A^ÐHHHHx HHHHÐSHH?Ht H{HtH{ HtH[:f. 1SHHGpHHtؑH{ HtʑH{Ht輑H{(Ht讑H{0Ht蠑H{8Hu H[艑 AVE1AUATUSHH_LL$HtwHC x umH HIHLt$ALHd R Hu@LLH> HH= w'H{ :tfMDe E1H[]A\A]A^à SHHHHVH#HH[j~f. ATH1UHH= SH5q H@9I1 2 L1vHD$HHP LHT$(HT$HP1HT$ D$\$8 HL@H|$0HtVHD$HԞHt$H H|$H)4vH|$|$ HjH@[]A\ tË? tP , ff. ~4SH5K HE1H=Ɨ 1H Y HC0HF1[1 @ AWAVAUIATIUHSHHM L=& L5 P AH#fod HD$ AHT$HHBH1 HH; HlHj HBHZ(Lj0Lb8Lr@LzHuH;- u H)KHBHH[]A\A]A^A_M0MxX USQH HHwHH HWHHtHuHx HHH HZ[]Hh' Ha' AWAVAUATIUHSHHHH(HT$tHD$H([]A\A]A^A_H HHp IHH@ HLH=y 1>IHߣHf I.HD$uIVHD$LR0HD$H I|$` HM IMbL LH1H=<D />1LHH? Ht H+kIm ƢMu1I/1 H=I @ USHQHo #1H5 H H5 Hܺ H5 HҢ H5 H褺 H5 H舺 H5 Hl~ H5 HPb H5v H4FH=ſ HE HH*H8Z[]AWAVAUATUH1SHhXL|$ HHLHH)H( Ht$PHLt$ LLl$HLH D$ Ht$PMIH-L|$ LHT$H D$ HHL)HH F H)H= F rA9LH5} HHH5t H1A9HH5b LL1H=W j$HH5M Hk HHh[]A\A]A^A_ UHSHH|$}1H|$HHH.1H[] ATUHSH.HIHHEHHL[]A\YIf H9 H9Gu hHH霌 ff. ATUSHLgMiH? HHGL+g(HPH H SHH9HLH)H9H,H{H-HCH IHC(HLcHC H[]A\ÐAUATIUSQHH; fH* _ X^_ f/ H,H# HH9rI9l$ L, LAT$@HH$IrL1HHHIT$MT$Ht~LI LM HH9taHHtHrH:L!H4LLHHtHWH7L!HLLH:HtHH6HzL!H<LLHHtLAT$HIl$I\$1Z[]A\A]\H,H?HfHH H*X HG ff. fAUATUSQH_HIHsIH.MI9MHCIuLOI9. IM)IRHv H?I9 HHL)HTHI9 Ht{HtcHtPHt=Ht*HtH! HHTHHHTHHHTHHHTHHHTHHHTHI9mHHHHTHHHTHHTHAHHTHAHHTHAHHTHAHHTHAHHTHAI9~HE 1J,Z[]A\A]LH HLLH|1HkAoHH9uLHH)H)AtHHHHTHff. fAUHX ATIUSHH?Ht$o :H\$HNHH*HHH53 7HH܄H1HiGHH辄HНHeIHI<$x*M,$H1H[]A\A]ff. @ AWHcAVAUATIUSHHHFH8T$ L|GH{8IGH{8HGH{8IGH$MDH;M2H<$ 'I7H~5 HEHH}HC81MHHHPpLrL LppIwHS Hի T$ ID$HcHpH H9/ M|$M9 HC8fvH D HC8H߃hxAoL$8 i HDLH|HC81L<$HHPpHjLHhp H# H1 HΪLH[ HC8HPpLj1Lhp H[]A\A]A^A_H}<LH$E11I9IcHIt]AIcf S1HA 1A ]ǚ1҅[USHQH- H{KHHh8HHU% H[H HAHZ[] D ff. H AVAUATUSH@ LpI 18I HGI HGI HvH-pj L@ H}111HHMH} Hr HAGE-H(L9uH=b YHH Adž 1[]A\A]A^fAWAVAUATUSHL- AED$ M@ L I|$GxH L=+ 1 ID$LL D$ MeIE , T$LhIAtPHM7AG IMtL;5 tH5F+ L^ uH5;+ LK u1. H=+ HtE1L + ~H=+ HtE1L+ ~A L ID$D$H} 80H=5+ HtE1L&+ ~H=+ Ht蘴1H5+ L?I|$ |$ H ŘAX AH H8H;L 1 + D$H[]A\A]A^A_ff. fATfvIUSHH8 BAHH¾HHv w HDHC81HHPpLbL`p _HC8 HHPpHj1Hhp 跥2H袥 Y H荥 HxH߾ []A\_ff. @ H ATUHSH@ HL`I$ HtI$ HH[]A\b隗ff. fHA H@ H@ u 1ÐAUH֣ ATUHSHHHke fHnfH:"H HBHXP )D$01fD$XHD$@HT$`D$ D$HD$hHHA HLd$0H;LO FIC T$ LH HLn HĈ H[]A\A]ff. fAV1AUATUHSHHD$H fHF8HH;= VDeE HF1@H1A+H{H IA A D MttHt$H Ld$Mt$ Ml$L L91Lu H}I9Le@E(Lm0 H]8H[]A\A]A^1P D4Hu(H fE1E֖f D ATIUSHEHH֘H@ u H: HHyHHH{ H;CyI $ []A\fHa SHH@ H@ tH [.vH HuH H1[ H [rff. @ AUAATIUSH(Ht$;H}HH萶H;D$IAHHEHT$Ht$: H߉AH|$> H|$H H(H[]A\A] HAQEA |JH ATIUSԻHHH9LHH_H{!3HHAHXH5À HC9HE HKLHEHH[]A\ AWAVIAUATAUSHH AH~ u E L-` S(L ,s(DL &{(IŃ(EH{ uCuHEILLVu5LL HĘ []A\A]A^A_Ät鮗IL!H{ Hs8H8: t 1ff. @ ~1Ð1iIf H=@ @ 1ff. fAV1HH @ AUHH ATUSH H\$HD$LL$1ID$ ʎMH Å; H-HT$HtHH= H HH@fnf:"D$= H f uwk ɗH @ L-Lp Ld$ Hl$(HLl$ ;HSLDŽ$ H虼mC Hð L9uH~ H H []A\A]A^ AWAVAUATIUSH(H H-~ H9t HXL-} I@ I *HHЗH9Lt$I 1H\$I LL0HH@H@ AH|$H|$H=H#t1LLI H\$תHHtjtI $H([]A\A]A^A_ԖHc' H} H@ H HGff. SHH8Ht 1HS8sH{@Ht 1HC@[s[ÐH=H+ u<VH=N+ YH2+ HɖH5+ H=+ 1Z1 SHMt H;ۻ [ @ AU1IATUHSHHHHHD$H$HsHt<sWIHHI1LLD$H N H ԗLrHD$HuZH{PHCPHH$HtH H{XHCXHH}HEH H{HHCHH1sH ff. ATAUHSHHH7H~H|$<O~DH'w, HEk+uZI L H+ H[]A\<'~(<'wHV HcHF<!Z<&t.Ht /vHCHD$HE 1뫃H- Ht/wP/w HHt$HCHCH<Hg/w6H|$#t+s<t H@>[HCD AVAUIATUSH HFHHH @+H IHHu.LHLI,$H+ژ1[]A\A]A^HUH @uH;-y 0Hm 1HL @fHqIH7L@A @V| HHH;y HrHtHHHLHxa /ff. SHw HCH[H@ SHHHHt 1HKHoH{PHu H{XHt 1HCX{oH[1HSPgo D H Ht$(HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ HH$ HD$HD$ HD$HJy D$0 H0Hw H H @ AVAUATIUSHG HHx Hf{HaHJHEH{;JH4HE H;vH HE(H{ H HE0{ { HHE8{ HߖHE@H{0 HɖHEHHKH HLCPLLs`LkpC HKXM HL$ ~HKhM HL _H{8dHMH H{@KH4H H{(2HH [H]A\A]A^f D AWfAVAUATUHSH Hu Ht$HLd$ HL$L@ IE`M}pLMuhAE`HD$1IEp"HL$HLHþ HL? Ht$LLL^H []A\A]A^A_f D USQHH2HHHH%*H߉;lZ[] D AWE1AVAUIATIUHSHAPL=s EHtL5; HL蔎H+LHH-/Ht Z[]A\A]A^A_Hu IL$`H9)1 %{ff. AWIAVIHAUATULSHH $苷HI@IMHIF LH0GIHהLH蕫HHHxvfH*YA fHT$H* $XHT$HHcLMlKHcHcIDITjLj1H[]A\A]A^A_HfHH H*XuAWHAVH)AUL4 IATIUHSHHHD$H I HNHI9 HTHte:u`HID$L{HJ4dID$HJ4dI ~ H 1 HL9| I HT$i H0H[]A\A]A^A_I ~1Ҿi H0ukIM9} ID$HJtCdIIH|$軤IH-HPL9} ID$HHDHH@H HBLH LhHT$ H 02Œ ۴ff. AWHHH AVH' fHnAUfH:"ATUSHxHH> )D$ E1fD$HHD$0LL$PD$8D$XHHTHKH HD$ H?HHD$ HT$XHw 1H5D H= 蕝81ɉIċD$HD$Hl$@H; H|$XE1ՏA*HH菫HHH01 IHu= HE"&LHH]HLoBH/g1A$贰HHɸHIMt2I_H]A.HuHtA.{HtpA<$ W|$ HaHHH|$HxL[]A\A]A^A_HD$ HD$Ho }H- ( A ff. HH tH o H@ H@ u1H txT uHHt&Ht$/Ht$HHt-Ht$eHt$HtHh HHt e1H D H*AWAVAUATUSHXHt$1DD$LL$Ht$@Ht$8H9IIIcKtm LidHH I1MfA$HI9~XIHA_Hkfv܁ vg ( vs?H ?ȀʀNVAD$L9|H|$@HH|$8H HXH[]A\A]A^A_?HȀVAD$볃|$ uH|$Ht$ M8Ht$ D$L9}Aof (f= 1L9AF D$ Hi HcHI1I)H9O$dLOIL2H9~A_- wZIHAT$HHH9~AHHA?A ȀAADA?ȀAH.HD$8Ht$@HD$ IH H PHD$PPUSLD$(H|$8* H IH]H|$@Ht[cH|$8HtLc1v D HHHHHHHڔH8.H @ AUATIUHSHAP uU{ C Lk$L) L1HHyHuE1s { LctQHC$HZ[]A\A]Hй HHHHHL9|I)넃{ HP (HLHH{ HB t H;ǔHG LHH)nƔ UIIISHHLWH-f I9tH57i I95Ip(Ix HL$LtHD$HH@HI H[] AUf(ATUSH(fT 7 f. 7 f. f1f/ H|$ D$ D$D`DLcAA|$HcHHteD$A}腟'H,fɿ BTIH*\\EyԅuBH(H[]A\A]HNj H5G H8/1H|e H5] 1H8H[fW5 'f SHHHHHHHH HA ɖy H; H[ @ ATUSHG L%h HI$ HuNH= HHHHL 1H I$ ) HH_H[]A\[I$ ]A\ ATUHSH HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ Hg L@ HHsxHHtKHHHA H$ L$ HD$HD$ D$0 HD$HH^HH H[]A\ÐAWAVAUIHATUSH H LzH HIMIm Ml I}H HG tLt$xLkHH)H聡H;D$x/MI Hzg D$@ AHD$H1HD$(HD$0HD$ H(m H)IHH@H HE1H- 1|$Ilj|$8|$ |$|$ |$<$DL9sI4@+ a<HcD HD$ H|蓦H[A믃<$ HD$Z |$ t rH|$ Q |$ |$ ? D$Dt$8A!֕L$$ȋL$ ȋL$ȃӕH|$ H|$0 H|$( A |$@ { LNd LL$HHL$ZL1H52 H=A( HHL8\Hp"IHEE L=d Lt$x1H LHl$xI OIHH+LHD$8[HD$8HsE1HAHI uHHHD$@H|$@HD$8A~[HD$8ES |$ $T$ D$ |$ H= ( DHH5 1軉HH0H[|$ ] LHZH H[]A\A]A^A_ÄT間=鱓$鵔 Ô$ _D$ RH a I}AHU I}H|$ H Hc H9g HGH$ !Lt$xLgHD$ H%H}H;D$xH$Iq E1HT$HD$@ LL$(LL$0LaIM|$PLA 1Lv H$ Pj joH IH7韐E#H` RH5 HH= ( PLL$81LD$@HL$0Y^HHvHPYL=b LHIP FL'Y1Aău0HI IHnb E1D$@ LT$(HD$HLT$0LT$ D$ D$ {HE I wHH=( dIE HD$0Ht!Ha H9 1HD$0I IE(HD$(Ht"Ha H9ߑE1Lt$(II}0H D$@KI H|a HD$HLS_ 1HD$ IE1HT$HD$@ LD$(D$ vH=( x +HHH@H$ Lt$xLVdHD$0HhHH;D$xH$D$ZxHD$[( aH@A)D$@ IE8HD$H,|$ JLVHe` E1AD$@ L\$(H HD$HL\$0L\$ 鹍f BAWAVAUATUSQ4H\ HH9G HH9FHvxHxAԺ t(E89C8u E<9C<uE@9C@uE09C0uEH9CHt"AtH] H Z[]A\A]A^A_銑LCL9Eu1H5o L +p 0H >>f9uALHcL9|gff. 1AP0 Ht P11@HHp pPZAWAVAULnATUSHH HFHLxII Mu MI}HSHG Ht$`aHH$HaH;D$`MIR I}H Aă[I IEHD$1Ƀ{ HL$ בL_ AŅ, HȑHt$ LdđHD$ H HD$H11E1H - EC 1HLt$AH=W H5 觉 E K@E4I1A$HD$H;7] W Dt$H|$ H1茚HC葯{ z { H,_ H {1l ُC {Ht$`I訚L>D$x% = @ qH$ H~CH[ LHH \C# 1H|$ HtRH []A\A]A^A_H<+= a<َHcHETKA 9E<K@ A 1HT$ADkE1DDcAA DcHV LH8LC)A<${阍EK@A EK @ A vH߹ 1/ HHQ1H[ A HD$Y/K L$H|$L1H5, HH H@ HHCQ1҃{ 鴌饎fHѺ C4 U11S Q轙ÃΎӃZ[] USV ˎH;{H@H薬YHc[]+5ff. SHGC HH{ H{(Ht 1HC(DPHCH[H@ H? f1%AUATUSHH~HHFHrHHIHhIH/ HKIHHgLIOI HC H5W H H;H{HE HkH4H# LcxHHC HCPH' H9CH-( H9EC C,1H[]A\A]A _ff. H U1HSHHW H|$Ht$H .HH;V HH9uHNHH[]ff. v@3 SHx HH8HH{xۋHC8HqH{hHZl HChH*HSx1HCpHBH H HH HH HHt}HH trHH@tgHHt\HHtPHH tDHH t8HH t,HH t HH tHH@tHuHҺ HHEH Ht1[Z H AT1IUSHHGHt$HD$HU H HH`HHQ HH0 HHLHIl$0HH[]A\ D 1ɺ 1 ff. AWAVAUATAUSHAPDwHu|E1LDI+LH@S tHHH? SHxYH[]A\A]A^A_EHP H8^[]A\A]A^A_G H/IHn郋f AUIATIUSQ HmHH:HH^HKZH[]A\A]f. SH HH[f D AVAUIATUSHHBH;B HPlHS@(IEHHHHHLrATK<6HHuHUH~aHE1'M9~.ClHI H ClHށ u[]A\A]A^HHf SH H,S HT$H ~H\$HH+t H [HSD$ HR0D$ HN H5 H8x SHHHFH;F xHHHKHCH;C HHHK0H[HQH}N x H:H5 1Z AWAVAUATIUHSHH8HD$H HV { Hl$q H@H{8 E{, M HCx ? H+ H{h11{ HCpH|$HCPE1H? {$ H-Q H{HT$ HCPHЙ KCLd$ MNL] LHHH7 H;-Q HE M H|$IE1I$H H1HM1H{hHCpH8L[]A\A]A^A_I<$Ht$y.(HH H;RQ IuHGH{h1b51Ƀ{ HCpHL$(HCPE1HtH+C@IL9LjH1艽HD$(IH Lx M; E1{$ tHJ HH] 9GHCPH~_H H HH!HtDK4/HU H HPH H)IH ه1fHSPC@H~NHCxH9CP}DH( H HPH K/Hs@Hs8HH9J HHk@M<Ht MH|$(L Ld$(HHH{xHHH) Hs@LHs8LL)Lk@H HḦELt$(LEE1Ht MH|$(LwLd$(|EaHS@H)IHS8HH苻HD$Ht>Lk@H|$H˔ H|$E1IH ÆH|$Ht3EE1Hr HHH1ɨt t fHtHC@IH)#鳈 ff. AUATUSH \I1A|$1 ImA|$Ht$HۋLqH\$@HHH9H? H HH)H9HH11-HD$H؈Ll$H9 HA|$It- H)L HtHHI;m}H|$HHD$HĨ []A\A]û wHAWAVAUAATIUSHH9HFHIˍHLDH1&LD;HD$FHD$HH?Au݈H[]A\A]A^A_Ä H H1HK H|$Ht$H CyHff. AUE1ATUSHH( LD$Hh1FdHHCp= {( 1H{hLl$Hsp!1LH\$L%K H I$ xH{h1H_HCpH H BHC1LI$ H HD$DxH{8HHt 1HK8H|$Hˇ1HSPHS@1H{hHCpfH(H[]A\A]H- K HE HH HHPnAK魇ff. @ USQ HJ HH ZHHHXH߉AZ[] H H1HGHt$HD$HI H %wHQSTH#J H Z D AVAUATUSHG c @tbLg0HoHuiuUA,$ StHHc[]A\A]A^$Su6ku։1kLgH뜃ԆA,$E1HtNL9LL(AESu DStIDjuD+kuH G H H[]A\A]A^邆f. AT1H H USHH HD$H H Ld$H|$LH uHC@t/H3{ ?Hy ^H H[]A\Cff. AUATUSHH(RtuL%G Ll$1H LH\$I$ uHt$H|$LHnHgF HI$Y GHT$Ht$H|$A HHH>HG HHQHH([]A\A]ff. USHHH|$Ht$HT$HuHH[]HF HH@ HG @HC`HHL$HT$HA/ff. @ ATUSox&GH/{Ho1[]A\ SHG(#H1H {H{Ht 1Hs =H{8HޅH{hHt !s1HShH HHCH[H@ f. HHFH~HuHu H8A HQHA Lk| HHL$Q1j jwRH Htff. USVHWH;E t2dtPr HHt_H1 HH5<HZ[]G(FHG@8YHw8[H] HA HRH5% H81;1 UHSVU HHp HHxHZ[]f AWAVAUATUHHSH H LrH HHHH}Ht$HLm H}HG Ht$@HIHڄHo~H;D$@MR H}H! AǃzHID H} H ~UI HD$Hfo9 D$l H$D)D$pD$hACԄ H5) LnLcEt4H5 LW H5 LA :l- HHpLLd$hLL$ LH H5P !8 HHBTpH4$ALH$ IHH<$9H L[]A\A]A^A_HYHLsATHA 1L , H$ Pj j.OH HH1H}(Htp$$u 'HuqIRH}0$$H,鐂E1HYH|$h Q뱃1E1A O霂 WH=`@ cHHt11ɉHHpHp(HZfAUATIUSQH H_ {$@F HHKoLh8@8oKHHC EXHC(HtKHE`HCHHLH HS@s$LO HW LeI$ID$ZH[]A\A]HE Hcff. w @x HB@ Hk8H H dTGH"@ HHkPH f. S4H=@ Hc}IHtR11AX\1AP(Hc1I@HcI LHI@hHI@ IH0IPpI@xI L[ff. AUATIUSAPH^HAŅTHHtjHCH CC !HS@ @H{01A |HI $ Z[]A\A]黏ff. fHcF$u9HF0Ht$H HW0HHF8Ht HHG8HHVHFHH~1H9~HN0LHO0LHHN81HtH9~LHw8LH9H41HG@ATUSG\Htou9HGhH8t(HGp1HWPH9 DH{x k([]A\ý Lg8C 1LZF L@Zt뵽 ff. H= ATUSH@ HX H tH[]A\H= &H0 H H= H8 H H= H@ H H=? HH H H=u HP H H=e HX Hk H= ~Hh HO H=3 bHp H3 H= FH H H= *H H H= H H H=A H H H=\ H H H= H H H= H Ho H=k H HS H=Z fH H7 H=9 JH H H=Y .H H H= H H H= H ! H H= H! H H= H! H H= H! Hs H= H ! HW H= jH(! H; H=p NH0! H H=Y 2H8! H H=L H@! H H=; HH! H H=# Hh! H H= Hp! H H= Hx! Hw H=ܦ H! H[ H= nH! H? H= RH! H# H= 6H! H H={ H! H H=c H! H H=R H! H H=I H! H H= H! H{ H= R H! H_ H= rH! HC H=0 VH! H' H= :H! H H= H! H H= H! H H=y H " H H=j H" H H=$ H" H H= H" Hc H=7W vH " HG H=f ZH(" H+ H=c >H@" H H=V "HH" H H=Ҫ HP" H H=ے HX" H H=*B H`" H H=] Hh" H H=I Hx" Hg H=1 zH" HK H=# ^H" H/ H=P BH" H H= &H" H H=ֽ H" H H=ƽ H" H H= H" H H=\ H" H H= H" Hk H= ~H" HO H=N bH" H3 H=7 FH" H H=[ *H" H H= H" H H= H # H H=@ H# H H=M H# H H= H# HtsH= H(# Ht[H=F nH8# HtCH= VH@# Ht+H=M >HH# HtH=A &HP# H=" ßH HHmgIH\HH5 =H LH5r ¶ H LH5c 褶L+E11HH H5 L r% H8" HH̅11Hc& H8" A L ' H H5^ H!% H H~H8" A L H ~ H56 H$ H HDH8" A L H < H5 H$ H@ H H8" A L H H5ƺ Hs$ Hp HЄH E11HH5 L A$ H" HH Hr H*% L%3 H@! H" LEYH8! H" L&:H" HL A H H5 # Hh HHH" LѴH# Hh L貴ƃH" HL A H H5 /# HP HHH" L]qH# HP L>RH" A L H Z H51 H" H HH" HL A H H5 " Hx HHۂH@# L诳ÂH" A L Ը H H5ܸ H," H HH" HL A H N H5 ! H@ HHLH# L 4H" A L s H ~ H5T H! Hh HH" HL l A H ~ H5! c! H0 HHH@# L葲H" HL _ A H } H5۷ ! HX HHhH# L<PH" HL Z A H U} H5 HH HHH# LH" A L Z H | H58 Hd H HH" A L P H | H5 H* H HH" HL A A H ,| H5϶ H HHJH# L 2H" HL $ A H { H5u HX HHH# LɰH" A L H U{ H5 HF H HH" HL A H { H5 Hp HHfHH! L:NH Hp L/H" A L H wz H5 H H H~H" A L H z H5m H^ H H~H" HL L A H y H5U $ H8 HH~~HH" LRf~H" A L H fy H5 H H H,~H" HL A H y H5 H HH}H@" Lî}H" H L褮}H" A L H x H5 H! H H~}H" A L x H Nx H5 H H HD}H" A L c H x H5 H H8 H }L G E11HH" L HH H|L E11HH" LQ H H|L E11HH" L# H H|H E11HH5 L H`! HHK| Hw H /|H@! H`! L|H8! H`! Lݬ{H`! A L H v H5' HZ H H{H`! A L H ?v H5 H H H}{H`! A L H u H5IJ H Hx HC{H`! A L H u H5 H H H {H`! A L H Qu H5^ Hr H( HzH`! A L H t H5+ H8 H HzH`! A L H t H5A H H H[zH`! A L ˱ H ct H5ͱ H H H!zH`! A L @ H t H5 H H0 HyH`! A L 6 H s H5f HP H HyH`! A L , H us H54 H H HsyH`! A L 2 H +s H5 H Hx H9yH`! A L H r H5 H Hp HxH`! HL Ű A H r H5İ h H( HHxH@# L薩xH`! A L H Jr H5 H H HpxH`! A L g H q H5^ H H H6xH`! A L e H q H5, H H HwH`! HL ^ A H Aq H5 e H` HHwHp! L蓨wH`! A L H p H5ɯ H H HmwH`! HL A H p H5 H HH0wH! LwH`! A L H p H5M H H` HvH`! A L H o H5 HG H HvH`! A L H |o H5 H H HjvH`! A L H 2o H5 H H H0vH`! A L H n H5 H H8 HuH`! A L H n H5Q H_ H HuH`! HL A H An H5 % H HHuH(" LSguH8# H L4HuH" H L)uH E11HH5 L / HX! HHt11H tL o HE11HX! LU HH HHtH@ HtL . HE11HX! L H HHit跰H HTtL HE11HX! L H HH#tqH HtH E11HH5 L H HHs11Hp sL HE11H L: H( HHsH HsL , HE11H L H@ HHNs蜯H8 H9sH E11HH5 L g Hp" HHs11H rL HE11Hp" Le H HHr H HrL HE11Hp" L H HHyrǮH HdrL HE11Hp" L H HH3r聮H H rL ժ HE11Hp" L Hx HHq;Hp HqL ƪ HE11Hp" LM H HHqH HqL Q HE11Hp" L H HHaq语H HLqL HE11Hp" L HX HHqiHP HqL ͩ HE11Hp" L{ H HHp#H HpL HE11Hp" L5 Hh HHpݬH` HzpL O HE11Hp" L H HHIp藬H H4pL HE11Hp" L H HHpQH HoL Ш HE11Hp" Lc H HHo H HoL HE11Hp" L HP HHwoūHH HboH E11HH5E L H0# HH-o11H oL HE11H0# L H HHn6H HnL HE11H0# LH H0 HHnH( HnL HE11H0# L H HH\n說H HGnL M HE11H0# L H HHndH HnH E11HH5 L r H HHm11Hc mL ̦ HE11H L- H( HHmթH HrmL HE11H L H HHAm菩H H,mL C HE11H L Hh HHlIH` HlL HE11H L[ HX HHlHP HlL HE11H L H HHol轨H HZlL { HE11H L H HH)lwH HlL 9 HE11H L H HHk1H HkL HE11H LC H HHkH HkL HE11H L H HHWk襧H HBkL p HE11H L H HHk_H HjH H5B HL A H Zc e H HHj11HV jH E11HH5У L HP! HHvj Hb H ZjH@! HP! L';jH8! HP! L jHP! HL A H Ab H5@ H0 HHiH# L賚iHP" H0 L蔚iH H5v HL C A H a H HHki11H WiHP# H L$8iH! H LiH H5j{ HL , A H ` Hx HHh H` Hk hHh Hx L荙hH# Hx LnhH@! Hx LOchH8! Hx L0DhH H5 HL A H _ H! HHh H~_ H gHp H! L踘gH@! H! L虘gH8! H! LzgH H5ߠ HL A H ^ H` HHQg H^ H 5gH H` LgH@! H` LfH8! H` LėfH H5/ HL A H ] A HX# HHf11H2 fH" HX# LThfH H5ȟ HL K A H F] H0" HH+f11H fH! H0" LeH E11HH5~ L i H" HHe H\ HR eH" A L H W\ H5 H H HmeH" A L , H \ H5 H H H3eH" A L H [ H5 H H HdH" HL A H ~[ H5 b H HHdH" L萕dH" A L H [ H5G H H HjdH" HL ) A H Z H51 H HH-dHP" LdH" HL A H JZ H5 ~ H HHcH" L謔cHP" H L荔cH" A L H Y H5 H H HgcH E11HH5r L - H # HH2c11H cH # A L % H 6Y H5) H H Hbǃ . AVAUATUSG( HLg8HG {\ HFHbHP`HuqH;@ L:HH Hx8H ^bHcK\ 1H9| HCPHHCHH[]A\A]A^HshHHH tH] HH0HHtkH[]A\A]A^I H1 HEbHp bHi H5 H82<1rH| H5 1H8<U蹛HtfATUSHHH Ld$Hl$HL$LH8JbLS0HL$LHI:yHHC8HHT$HI HHT$H1H []A\ff. HXH=t L m HtrHLfH9p0t)H8H8 uI1HI HHu"H<$ u3HXHH8LAH8 tLD@I9sD9@tHH螁 H8I뤐AWMAVIAUATIUIcSHHH4$HT$@HFaI1H9t I<HH aIDAWH= M1A@ H5j A AP AUAH HL$8HT$0M` LH0LHHH[]A\A]A^A_ff. G(u(QHW0H`G(HHou*1Z1ff. AWIAVIAUIATLcULSAP?H`H1L9t I| HHw`HDIX LHݏHЉ Z[]A\A]A^A_ATIUHSHHHt HӅu-I|$Ht HӅu I|$ H1`HH[]A\"` `f. U1 1SHH H|$@Hl$@HH$`C H(_HD$@111H$HD$HD$PHT$HD$ L$+HD$8HHtHH|$8HH|$H tH詞HĘ H[]ff. PDO(A HOIIA HE1Hw8 HLX u1Hx(у88p_уXX_с ]_с t A^уt A ta1Hp8uHx( ^1@$ HH0LPIIB0DZAzX [^H H5 H8:7AH H5 H8 7ff. AUIE1ATULSHhHMH t< Ht$LEHHt;HDH;D$^HhH[]A\A]é ^IAIY HD$^ff. fHo0f. ATUSHH(_L#H5 I|$KtaHkHE 9_} _I|$pHuH H []A\I\$pLHHHs Hx _SH&C_H[h @ Hk' Hk' H=ɇ @ AWAVAUATIUSHLoM Il$ ID$8Mt$HH H)H^1LHL<^9]L~`HUhHcT HM`A|$@ M<HLt@u^MuHL^ tH{ H8:^螬1H[]A\A]A^A_vID$IH3^MtHL I9G@It$8I|$ HL$D HL$ M`E0 HU`A|$@ M<HLu<f. H_H H9GtH{ H ©fW ЉuG_@t(H07Ãu P_@HGH:_pHHք _@HGH_ H`鷝 111 D AWAVAUATUSHHLwM^Lo HLHHT$(Ht$0E1H|$8豞E9eL^HT$(Ht$0H|$8HH[]A\A]A^A_鵪 D HHHW H:H` SHHHF a`Ht$= HHh`H@H;D$]`HH[ @ USHQH H@ HhH A`Ht H H HtH Z[]H Z HuHO HH5 H81 1 SHHH_HH?HuHCH8 ~ H H[__ @ H(HHHt1ff. HHHH_ff. QH S`H H ZfUSHVH H@ HhH %`Ht"Hl `H HY[]%`ff. G I`ǃ7 UHSHAPH H9tH( H9( u H8aHuHwH} ~HuYH[]]0a2a H S8 uH H;Ht 1HH 8 uH H;Ht ʠ1H[ USHH H$ H$ H$ IHHDŽ$( A`H$HH []f H= @ H foq+ AT1USLg HH=1 H0A$ ID$HS`A H5 H(7`1H5 Hu( ` H5 HY(` H5 H=(_ H5؏ H!(_ H5Ï H(_ H5 H'_ H5 H'v_ H5 H'Z_ H5q H'>_ H5\ Hy'"_ H5H H]'_ H53 HA'^ H5 H%'^ H5 H '^ H5 H&^ H5 H&z^ H5͎ H&^^ H5 H&B^ H5 H}&&^ H5 Ha& ^ H5} HE&] H5h H)&] H5T H &] H5? H%] H5) H%~] H5 H%b] H5 H%F] H5 H%*] H5э He%] H5 HI%\ H5 H-%\ H5 H%\ H5 H$\ H5o H$\ H5[ H$f\ H5G H$J\DH53 HHc$+\@H5 HHcc$ \ H5 HG$[1H5 H.$[ H5 H$[ H5ی H#[H趋H+ H5 HH-zv[Hf+ H5 HzX[IT$H5 Hy<[H=D ?pID$HH [Ho[H H (+ A H@ H@0H9Bt- H+ H;H HHZAHAAt#Dt HtHH+ tH H + H; {+ u8H5 HHrZH+ HBH5 Q1[]A\f. H 1H ;t H$HĨ H HHHHZff. HX\' HQ\' HHc' HAc' H= @ SH_ 11H5! HCgHH[ff. USQxHHt#H@ uH%HH@HHZ[]f D AWAVAUATUHSHXHG 1HD$8 HD$H'ZH HHa K HD$H [H|$ HH[E1L5 oHCLJ<苲IHZIWH@ ZHZMoI IE n%DZ+ LITLLL;c|H HHH] IHZH@HL$@E1HL$0 YM;t$ H K|HT$0HZ ~IfYL|$@M L@HD$H8YLHD$HHD$(H|$FIHtVHT$(LH IXH|$HHXH|$ ^$H|$ AQEX' L:H|$.IH_XILt$H HLHZ |0XLH|$HLHD$811H8 HH HHp HH i|WHHE t-H= H H Z b{Hu\xH H H HX[]A\A]A^A_H|$LxnWH|$L^nfWH J H9Hu&H<9HV`H`VH H H H Z Ts]VVVff. fH HWff. SH7 WH= BIHWHHHXfL[ÐQJJHWW1H WZf HWH H9GtH Hp D H AV1AUIATIUSHH|$Ht$L %HWHH H9Ct/HHHBWHkH HHXHH[]A\A]A^ H H1HGHt$HD$H Hp o$Hf. HGH WH@H9GWH0,ff. HP H @ QH;=H t%Hw H HZ xHtH Z謂Hu HH HZ H H8J1Zf D ATUSHHVHH腤AąVH H HHZ ]=Ņu#H:Et H H H 1[]A\H H%ff. k6 ff. UHSV10 HIVHH H-VH@1fHK HC(CHZ[] UHPi HSHAP: {VH9H H HY[HPo ]j<f. Q BVIHYVHH5" H1H= ! Z @ SH uH HtH[PH H H@b vHH VH@H HVHH[ff. fAPsHt8 HtY閱H H Zf AUATIUSHQHUH+H[HC HHuUHHљUUHL IHkUHxH OULID$ H@HE t H `uHHHZH[]A\A]H4 JUf AWAVAUIATUSHHhHVofH:)$fI~HE LL HH UHxH TR Mm H{ IEH9C( Hn T H fo $Ll$P1H LH@| )L$P HHTL=\ L9z H HD$8H9lTH;= TLHX 1HQH9}L9d; HH{H T/ H{H E1L1H5k 1IH TH@E1 TM;t$ H{ Hu H߅%TLLl$8IE HhL[]A\A]A^A_< H$HmH< %IHOS1MHD$HHD$@HD$(HD$HHD$0H{HT$(LLD$Ht$0 LD$D$$ HD$@IH I@H{H RHM8Ht f RIEHC(ID$HJHHHT$tH|$$$ RI1H9$~eI<HT$GIH{RH; HT$t7H HHHT$( LD$ D$ARHT$( HE11H9$~I<HD$HD$HL(|$$ HM QHH HD$8HL=k H{H: H߅QjLbH{H yQD$$ M<Q @ SHHHHX H H nHRHHH9 QH[fHy H @ ff. AUATUH1SH̝HQHh HHuHH[]A\A]1ILd$HD$1LLHtH$HpH> ~H;5 tH脌Qf. AUATUHSHQH? t|L+1LGHHt11H= H3IHWQHH~GLHH'QHL cHAHZD[]A\A]1WHHqPP @ HF QHG PY1f IH5 HH9'QLLOL IM9tH5v I9%QI@ AWHAVAUATIUSH(L- M@ L?H.QH;N Ht.HIH{ M~ HH3HtHm tu&H(H[]A\A]A^A_HUD$ HR0D$ A~ I Ht$1H fI:")D$HHP: QIH5m HmlPIxHt H H0c mHQP xHuH H5x{ H8?1Zff. H HHHH8 ff. AVIAUATIUHSHHL Ht$L@ H H0I OH|$ OMOHuH- UHHthLH5j^ HfxJHH5 Hfx4Ht$Hٺ LHHtHpLH%HHH1[]A\A]A^f D AWAVAUATUSHXHt$L$LL$ OA1 AMU*OEu D$C L= |$ L z AH H- DH z AWH HD$@PPPHm H|$0LD1tHD$8HH HNH CHH) LIHNHH HlNH Ht$H1H H\$HHHNHD$0豗H|$0D$,cD$,gNE M H H8C A9 H"LH|$ H\HHNH$ H?IHMPH^F IHx AVHX AWPL|$81H|$0LLL$@ H LIHH|$ MYM|$ H H=H HE覥HHMHHP Lk[MH8HXL[]A\A]A^A_L= L=s H E1DH- Lw Hw AWH HD$@PPPH|$01DH HHt HH\$L5 L{L @ AWL~AVAUATUSHHxHFH LPII M7MNIoHtZL% L9 HE LMHHt$8 HHPMHv!H;D$8FMMI MgM I MoMtL;-O L E1I I LT$HLmLT$D$ L1I|$R HC H L;% O L=. M8 Ht$0L2HD$HKH H;D$0 LM H{ H H{(HMH{0HLH{8HWLH{@H:LH{xHMLH HLH HNKH{HH0KH HKHǃ 1H H HKhH H58 H'A H{(HI H艢HC(HJHH5u HHJD$ I$LHLcHCXD$HC CY JLs Ld$HHILB rJLHH AąYJHIFHN' H ' H9H9u H' H9u>HT$(I L3JH|$(HtH>' H9GJH Ll$81H Lt$8LIh xHD$8HHIH?HD$D$IC_LIX LC]o2ŅuIH|$8Ht@k^HCp NIC HxD[]A\A]A^A_IELT$ tJLHt$8BIHIH H;D$8jJLT$kI(D$`JID$ aJL= I@ H@ H LHt$8HHvHHD$ H;D$85IH|$wHHKH2L Y,HLjIMULT$LL6 HAQA HL$HQ1j j6H LT$HI^H1҉T$T$ 1 HC(HHG3HHGL= 1HC E1D$D$ M8 k1E1L$L$ -MIt&1At tIHX IHX H{(E1HC E1DD$DD$ H2 H@ H@x H1L% XGf. AVIAUATUHSHɡH HH H9CHH HT$HHЁ /{HLl$M]HLLAEAHHEu H LHH5 H81m1Hff. fQH< u H1Z< HW1GZf. ATUSHLg@Hu+9 1G\HW@fGZ1HCPM H1GHH*HC@HG} GfCZ } C\P G@GHx0H{PH5#= !t D AV1IH AUIATUSHHHG Ht$HD$H" H HrGHHzHA/ARGAusH{8HSGLL HC8HH$G{Z tE{[ GH 1H=~' 1HHFH{8Ht 1Hs8Hk81H[]A\A]A^ff. f FH H1HGHt$HD$H) H HHXn UHHSQ;HHt'Ht)HHH5 1聗HHHHZ[]HĘHff. @ AW1AVAUIH ATIUHSHHG L|$HD$Hp LHP HD$HEHHHAuAEAt1H[]A\A]A^A_H}0HE1LLHEh HE0HEH LLH +oELd$MtID$H " t"H3HtLY8uHHCHEhLUf. H H @ EH H1HGHt$HD$H9 Hh HS DGH u< [HԷ1ɺ 1覆HHt C>C AWAVAUATUSH] t H0 Hu1DGpL- I1HG LH I H$ HH`DMH HǺ L`HA|E5DCff. H! HHH@ H@H ATIHUHSHD襗HHHL$ HtH[]A\ff. APHCH HCY"ff. @ H HHH@ H@H AUATUSHH~HHFHCHHIHCIH/CH˙IHCHuLI<I HC H5 H HXCH{HE HkHQCH= LkxHHC u#Cfo 1HC@H8|' CXH9CCH' H9EC C,1H[]A\A]Bff. fH U1HSHH, H|$Ht$HP HBH; HBH9uH(HH[]ff. B@閴f D HI H @ BH H1HGHt$HD$Hy HP HHh T @ S1H0HH~H=+ H&BH=+ H)BH1DH0[ff. H' H' H' H' H' H' H=9 T @ AT @ H5yh USHHPTA H5_h H8A ` H5Kh H A H57h H rA H5#h HVA H5h H:A H5g H A1H5g HA1H5g Hz@1H5g Ha@ H5g HE@ H5g H)@ H5g H @ H5{g Hc@ H5gg HG@ H5Sg H+@@ H5@g H@ H5,g H? H5g He? H5g HI?@ H5f H-?8 H5f H? H5f Hg? H5f HK? H5f H/? H5f H? H5xf H> H5df Hi> H5Pf HM> H5<f H1> H5*f H> H5f Hk> H5 f HO> H5e H3> H5e H> H5e H= H5e Hm= H5e HQ= H5e H5= H5e H= H5e Ho=H c Hc 1IfHnH c fH:"Hc )$fHnH c fH:"Hc )D$fHnH c fH:"Hc )D$ fHnH c fH:"Hzc )D$0fHnfH:")D$@I4HHG<HH u1HP[]A\f. Hx$' Hq$' ATI1UHH= S( Hy<LHHH X<H[]A\ff. UHSHHQHB uI 1(HHt;HfHH]HuE ' HtHHE8 Z[]H; HG ;H@8Hf D SHgH( ;H{HtH{HtH{ H;HCH[H@ fHHHW H:Hy; H(HHH_;ff. HBSHHH;HH;u[錗9;Hs[ D ATIUHSHHHt HՅuH Hh;1[]A\f. SHG Q;HH=l IHG;1LI@HIX蝉L[ ATIUHSH HHt HӅ I|$(Ht HӅ I|$0Ht HӅ I|$8Hu{I|$@Ht HӅuuI|$xHupI$ HunI$ HulI|$HHt HӅu>I$ Ht HӅu(I$ 1HtHH[]A\HӅx[]A\HӅtHӅtHӅt AVIAUIATU1S2IE LH HHBTHAE-u HI;m|H H5 a H8`1[]A\A]A^1HUHL*uHA H S H9xHH9{ tH{Pu!1{$ tH{`uH)Ǹ [HHHHCHH19H+C@ff. @ SHHHu H[-0ff. AUIATIUSQH 9I<$pHHtHHiHHH9IT$HL=8H4 H Z[]A\A]8ff. QJCHtH H H ZAWE1AVAUATUSH H- DD$H|$ H@ HXL L|$ :HX H u'| %=HH uHP Hu uD1Ld$@H|$@LH@ :t Ht$@H :H|$@1탻 I ;HH H HX HP . H: % | D$ H5 肬H | H9C; H 8 ;D$H []A\A]A^A_H"IH>HH5ğ 1H=#^ ^>L. LIMN>H LHD$@BHt$@HkLA^1EHH HfHP HHS<HX Hw<H_IH$>H HCIH >@ LH5ߞ H=T] D$ 1u:H5N L>M IH:|$ Q LHt$@uD$X% = @ :M *;LH LE1HL$ HD$V AL+L#| Dt$:HHHIHH9Hu> IH9H;J !7HL | 9HH HX {H: H8 7Hd6O838E89SH5@ HHJ<H= zIH<1LI@HIX&L[ÐAUATUSH( H? <HGHH5 HH@ H5 H)1thL$ @ HL{ IHߺ L`H / HIEH H%<HH)HHH~HH胤H <HE H( []A\A]H HSH;HH; SH HHtɾH[`'SH H7<Hp HH@ IHH <1H#7[ff. fATUHSLg HI|$Ht HӅuI|$H;HH[]A\;AWH1AVAUAH5( ATIH= Z USH;H=Z +HH"=H5Y H%$HH<LQLHIHZ<EE<Hz L 1 IH;L=( 11LHAƍIHO;HRHJLBL:L21H[]A\A]A^A_ÐH5 d; @ H& H& SH_Hk<H={ vHHt#HHXHCHGHG01HG HG(~H[f D H5 : @ HHHHt1ff. HH;H5T w; UHSHHH;H?HHuHu HH[];f ATH IUHSHu HH;q H;HtHHIػL[]A\PH;HJ ;HJ!HH;L1A$0 IHz;HHXHE Hh뙐11' UHSQH=S >uHHt HEHHHCHE Hk HZ[]fSHHHu H[# ff. ATAUHSH }H;HHDH~fHnH HHq;1HH= )$H ǃ H H H>;fo$HkHk0HH[]A\f AVIAUIATILHULHS H ;LHCH:LhL`Hh HX([]A\A]A^ ATIUHH~SHZHd;HHH []A\ff. fSHHHt莹H{Ht耹H{ HtrH{(HtdH[黶ff. ff. QH6;;H~ H Z HG(H;H ff. ATUSH u Hy HWH5. H81O1^H H L\ LCHHuAMHuHHtH HL>;HH[]A\H@H H';HE ff. @ HH H9G ;&f D AWAVAUATUSHHXH|$8Ht$0 o;Ll$0L Z;HD H9#;Ld$8Ht$8 H ' Ht$I9D$:I9@ HT$0Ht$0A Ht$H9B:1E11HD$HJD- HD$IcI9HH|$H t H|$HH<H\$HHi:H| HI!HXL[]A\A]A^A_HD$E1L4IcH9~6Ht$HL$ L H5 I{MAHL$ M9tUAH|$H u5H|$H)0HD$HH9HH9-H1H)H9HLHHD$HILtHAHt$HHLHHLHu HT$0I~H5p @HL$ 9QH;= t=LG A tH54 Ld@H[' I9 ø @ H tH`H9tUHSH HH Ht$HHt Ht$1H;]!9HH[]sH[]ff. ATUSG Hy"HHCHH9![]A\H( 8@8Hk@H8Lc(A $@ _t8 H9}HA|u롸 ff. [b@ SHH=' nIHtH1LI@IXvL[ff. fSHHHtYH{HtKHCH[H@ f. ff. Hh' Ha' QHtH Zff. @ HX ' HQ ' H1H1HD$LD$1 H52 ȇ7H|$ HÐUSQH7HU Ha HH8H=wHHIH7HHHvIH7H_7HZ[]f D USQH- Ha jHHtMH@ 7Ha H=H7GH7H]HHH赲HZ[]ff. H= @ U1H5V SHQHo &HEHj7HH -W7H5 1H&HE HH67H,&7H5 1HV&HEHH7H, Z[] ATUHSLg HI|$Ht HӅu,I<$Ht HӅu I|$H6HH[]A\66f SHH Ht*Hp Hu HX Ht1HX P1[1Hp >ff. ff. SH HH HtH HtHP HtװHX H5H` H5Hh H5H HP Ht芰H` HtyHX Hu>Hh HtHp HZ5Hx HCH[H@ * HHHHC5ff. HP +5H(IHT$Ht$H|$PIP L HT$Ht$H|$H(\H~ AWAVIAUATE1UHSQN|IG tHMh Mt<LKHH4HL24HDL, HtIL;e|X[]A\A]A^A_Ih Ht1Ih @ HGHWHHHHHH4HHHDH1H4fUIISHLNLI M9tH5 I9 ^4H HcHI@I9Cu4IC0HtIP0HtH9uHLL[] I@I9C|H H H[]I@I9C~HLL[]n LL>HH3H*eH߉3@H[@]eLωT$ T$ LLT$ H HHSHPAW1AVAUATIUSHH(LFL HD$M9tL M9 ID$H9CSL|$Lt$Hs(H{ LL tEHD$LH(HPHE HvHAE2uH@ HHQH H H H([]A\A]A^A_LLbLLOLLyuHHc2HHHHD$eHD$ff. H HH@ H@H ~ff. H HH@ H@H Nff. H' H' H)H ATIHUHSH? H IL$H4 HPL1I8HH:H H|1HHzHtyH|1HHzHtfH|1HHzHtSH|1 HHz Ht@H|1(HHz(Ht-HL10HHJ0Ht I4HH4HH9uHX[]A\1cUSHHH(H1H1Hz1Hq1H;HG 1Ht$AmHH1Ht$HT$HqHt$HƏHHH(H[]ÐHG8G@Hw8H3f. 1 ff. AVAAUATE1US1II HHL#PHH2LH,HH2LEu H `HHO[H]A\A]A^2ff. @ PZ=fPZ=fPZRfPZBfHwHGH9m:HVHWH?HxHf D WH' U: 1Y @ @餍 @ QcH;:H95:Zff. AUHE ATfHnUHSHHH= fH:"HxH )D$ 1fHD$0 D$HHT$PD$ D$8D$XH4:H:A H:Ld$ H;L,9I T$ 1LH0HL3HxH[]A\A]1LiHD$0 D$HH|$PID$ )D$ fD$8D$XPHA 1LQ HD$Pj j荽H HHHR9H{Ht$ O<9ff. fUSQHHH*9HH萌HHMHHZ[]ff. AVAUATUHnSHH HFH8HHIH8H}Lu RAă9Iu^H H8 H8 H{HCH8H{ILsH8ES ЈC 1H []A\A]A^8ff. fAWfAVAUIATUSHHHWhHG`G`LpHT$(1HD$ L|$8HWpH HGD E H* H|$ 1H0D$ HD$8HD$MtvIMg H5B HxpH@ twAtH\$|$ 8MtI$H;L#Ht茥H\$A HMvH\$H\$HL$8HT$(LHt$ HH[]A\A]A^A_ՖH}pH5 7l HGH@ H H= T @ AUH?ATISHHHuNHtBHH71H3HL[A\A] H71HZ H# t)HSHqH2HtH07HuQ7@7ATHWI' HG' UfHnH F' HSfH:"HQD' 1HB' H )$fHnH Q?' IfH:"H@' )D$fHnH;' fH:"H=' )D$ fHnH 8' fH:"H":' )D$0fHnH15' fH:"H6' )D$@fHnH 1' fH:"Hd3' )D$PfHnHs.' fH:"H0' )D$`fHnH +' fH:"H,' )D$pfHnfH:"HN)' )$ fHnfH:"H'' H$ H )$ H}'' I4H 6HHu1Hİ []A\f ATI1UHS0 HZ6HHu[1HCHC(LrHCH+6H5 1H HC HK6H, Hh HC0H[]A\HHH6HFHCH51HHS(r D H=y" T @ WH5 1Y @t @ ATH_' H]' UfHnH Z' HSfH:"H1\' 1H0)$I~ fH:"Hn" )D$fHnfH:"HF )D$ H^' I4HB5HHu1H0[]A\ÐSHV#5HH[f D APH;5 6H6HF 61ɉ HHGpHwpH51Zf D SHH5uAH{55H{ 55H˧ H [H> HHQH[fH=Y 锨 @ ATUSHLg H= I$H8H5 1HKID$HH8H81H5q HHH8HHb8H貟1H5 HID$Hv81H5 HHID$[]A\fH1 HE111H@ Cg AWE1AVAUATUSHxHG8LD$LD$H8_ HH H8HCH9HMHl"IH8{^ L% A8I$X ~C Lt$ 1H LfI:")D$ LH袞H=81LHL87L|$0H{8E1HF' MAH9G DHBIL 8L9M#7H{xLcxH8ID$1H H~DffE1I*H*^{_ u#HޝDHx[]A\A]A^A_fHD$H|$HHD$ 1HT$HT$H6Ht$1H= IHf6H H HtcxHD$ Ht$ 1H H Hȍ IHA6H@ 171HL$HT$LH5: 7HD$HP 6H HD$LH ʜMu$H I$ E1H1lIJH AUATIUHSHHH6Hj I<$dIH6H@LHBHG 1Ƀ{ HL$, H6H{8 6{, HCx H 7{ tHCPH H1HD$IH6H{h1XM6+B{$ HCp HCPHIu H H{hI1HCp4PI{6I6L9~ H|$L @HD$H[]A\A]HY35H+C@H>H9HHNH[]HA\A] f555M5+6 H PH H5F H8.1Zf. AW11AVAUIATIUSHhHD$Hn H|$HT$ 1HD$0HD$ Ht$HD$( HT$8HD$@HL$HHL$PHL$Xj H H IIA~D$1HLH fI:"H )$dHHttLH;-e t~H HH0YaHHΙH6H6I96HtID$0HtHID$0HhH[]A\A]A^A_ JLsH5 AWIHAVAUATUSHH8tt;IwHLH 5H HHQHH8[]A\A]A^A_hHH6 HIH6H10)HD$Hb6HD$Hx 6Lh(HD$,1HD$HH\$EiIH5Ht$L '5D$,HLAD _L9|HH9>5HHHH)H95HT$LdH|$LT94HD$L- Hx SLh(Jff. USVH? K6HK_HHM6Hx H 1H1HH(Q_HH薗HZ[]ff. @ AUATIUHSHHXHD$H95IHF61HH1 6LD$L,$1HLLHIH9HHMID$H9HNH H|$tH2HX[]A\A] D AT1I U SHHPHHHLs05C H. 6{5C5HT$H4$RH H5HHH|$ tH2HPH[]A\ AWIAVIAUIATIUSLHHWH Ho(M LL) HLL)H95H4LL$7U5IUL$HL5Im(H)Jt% J| L)1H~ LHs%u`Ht AU uBH[]A\A]A^A_IH}LHHU IT HT H)H +H)HH1AT fT AU AT T I}0LD$H $H $LD$4IUMu.I)M(H4L6H $Y41I} tHIm("L)J| Jt% H $H4$LIu5H $y34H-g pH-[ f D HBATUHSHH 4HLe [L]A\}4 H(HF f5~ 5H; Ht$uHH|$EZHD$H(u5f D AT1 IUHSH`H\$HHBHe5I<$1HU- C H5H5I|$H;=ڜ ~5HG I5Ht$!HH5HH;D$5Ht$ H|$HHT$ HH4H=0 1?HH|$ tH.H`H[]A\4ff. fATUHSHL%v I$0 葮HuH}` 5H[]A\Ht$1HD$HI$ H HH4QHH[]A\AATIUHSHHHuH{H4[LH]A\HՅt4 AU1 IATUSHHhHl$HHBH4I} 1H+ C H>4Hl4I}H;= 4HG 4Ht$PIH-4HH;D$4Hu[H|$Ht$ HL$LHt$LHT$HHtHH=. 11=HH|$ tH,HhH[]A\A]I}<u3H|$Ht$ uHL$13SH.4HGH 3 41[ @ ATIUHSHHHuWI|$Ht HӅu3I|$ HuJI|$(Ht HӅuI|$8Hu(I|$0Hu1[]A\HH[]A\HӅt33ff. PZHctATIUHSHHHt HՅu H{ Hu H{Eu[LH]A\2j3c3e3 APHcHxY+t1Z AVIAUATUHSH(HHu`I~HubI>Ht HӅu=I~ Ht HӅu+MnHE1IcI| Ht HӅu AE9f@1[]A\A]A^HӅtg4f D GuAUATUhSLcHRIxFHJ(Ht1L HPHpI$L _HH#4蛎L蓎IXH[]A\A];K ff. H3H)w AUATUHSHRLn H ?MeL9uLcHH3HSH3fH} I]BM3X[]A\A]f D ATUSHL% I$@ I$ HiCHI$ HVCHHtIH;- t@H} u4I$ Ht$1H Hl$HHX3U1HtIH; t@H- u4I$ Ht$1H H\$vHH3H[]A\f. AUHBIATUSHH(H2L&H3HnH H( H9 肷HJ HH* H3H3H= HL^ Ls 2H< I9D$2Hc Ll$LLD$LH H5 HD$rIH A$< 63< .3L LMHH 5H|$H2H([]A\A]I]H' H92HHE 1H9H wMLHH 11f. H SH@ HG8HXH2H2HC[f. UH5n SQQHv2HH-BH߉e21Z[]H 1H@ H@8H@HtH@ @0% .2 ATUSH@ =2 H21!HH2HAHAKE1 1{` HD$uxH- Ld$0H 1LH\$0H cHH1HC H 1LH HD$0.H|$H1H@[]A\~C H-s Ld$01H LfH:"H )D$0߿HH1nFHڒ H ff. ATUSH 1 HZ1H/' H9Gf1H HtSx 1C]H߈C_&xlHC Ht$1H HD$H H *H[]A\1 HH0H?HA蛈E0t 10f D USHV F1H8 0, tGHGx xKH{h191.HHCp1 1H{hHKpH<HZ[]Ft00 D SHw H0H{ u HQ H [H{Pt4HCHH0Hs@H)ƺ H HCPHu01{$ tH{`t SHH$ t HW`Hu Hِ fo] H CXH[HwXH9tHGHH@HA0H)HH)H60H9}H)HHs8! HR0HA0HCXHCXHCH/0HS`HsX @ QH 0H0H H9Gu Z1Z AWAVAUATUSWHF H@ Hk /P /1L{pLk`fLsh HDžP HKpC`LLLHIw1P ZL[]A\A]A^A_ff. f ff. SHG`5:/1H߉CnH !/H HCH[H@ HWHtBHGHx H;B}HRHHHGHH1PHGHOHI1^1ݐATfAnfnUfA:"SHf:"L$0flH0HH0HH|$80 I)$H0fo$ HhHXL`@ H[]A\Ð1SHGH Ht 1HC 裄H{(Ht 1HC(菄H{0Ht 1HC0{H{8Ht E1L[8fH{@Ht E1LS@QH{xHuhH H50H HuZH{HHt 1HKHH Ht1H H Ht1H 1[E1LKxԃ1H ăfSH( HHè B( u HH0 ހ u[fSHHHt 1HSXH{Ht 1HCDHCH[H@ SH8 u %/[;/ff. fSH I/[ff. fAWAVAUATUSHXLH|$ Mx M2E E2L% I H5 L\!1H m 'E I H3L01HH3HuH H+HtEHSE I HHH0I H3H1:HHd3H I9E{2HD$HE1L|$(HD$HD$@HD$HD$8LD$8HD$xHt[H|$H1&HH%2Ht$@H¿ 1IH1HH(1LOHGHt$@LLn1HL$HT$LHt$舔tKHD$HH5P Hxo tEKHt$@HF 5H=Z 13"L|$(H I9Eb0L HD$ HXH nIH/H H H K L[H|$ A uIX Ht H@H.H HEDt$ILh\IFJHhH@ HXH; ~>L9t9H*I; t(I; t H|$ H HIMyLDt$HE/I >I 1>I udHI HWH9}?HGH5 LIx tL) HtHx Ht1HP 11e /1Ix Ix ~H|$ HX[]A\A]A^A_P HE HH=q 11H= 1K4HH= 1HT$0HT$V.AWH IHAVAUL- ATfInUfH:"SH H[ )D$01fHD$@ D$XHT$`D$ D$HD$hHl0HZ0IMN0Ld$0I?L| I)Ã20I IH6 k)Ń*0I! HT$h1LH ADt$ AH5K * IA- H|$PD1-L3 1H҈ , HcHLHĈ H[]A\A]A^A_1LqHD$@ D$XH|$`ID$ )D$0fD$HD$hPLA 1Ln, HD$Pj jH IH. IHt$ 1P8.Hˀ Ht$hH8fQH_.1Ht$PDD1荿..ff. SH \uuH{( udHCHu6H{Ht{H{0Ht{H{ Hu/HCH[H@ HP`HtHx8 ~H{ tH诼HHw0HtH=N 1<.o AT1I U1SHHPHHHL-C H葠-{-C-HT$H4$DH. Hj-H+HH|$ tHhHPH[]A\ff. SH_P u&A 11Ҿ ǃP 1P [f. USHVHGHt0HPXHt'Hx8 ~H tH҉>HD-uH{Ht 1HKy1Z[] D H: AUfHnATH&x UfoSfH:"H x HfH:"HH H -)$ 1f1HDŽ$ DŽ$ H$ HD$@ D$XH|$`D$ D$$ $ )D$0L$HL$hH-Hz-A Hk-L$ H;L-Hl$0H{H,I,L$T$ HLA j HLHH H[]A\A]f D SH_ H{Ht 1HSwxH{Ht 1HCcx1[ff. @ AWEH AVL5T LEAUAAǃATAAUHSA ǃHAQEDEɃHN8HW8EEH5 1H= 葭c,H{ t H} 6,H{ ,GIE^,Hu H{ .ALE,H H Z[]A\A]A^A_ ff. HG H8Ht1RHIw1^1fff. AWAVL5AUATUHSAQLoLL M9tSA tH} ueH I9 t H HtH8Ht 1H0vMu Z1[]A\A]A^A_H{ uOH YH[L]A\A]A^A_HEE1Lh M;w}HEJ<Ht E1NdvIHH#뤐USHPHo H@ ZH[](v SHHHu!H{Hu%H{ Ht 1HC u1[1HKu1HSu [ff. HH*4ff. tcHGfHnfH:"HtNH H1H6~ H)$H 軫HHtNuH~ H Hi"H~ H ff. x#SHH G@+Hy~ H H [Hh~ H ff. SH_ H;Ht 1H3tH{Ht 1HKtH{Ht 1HStH{Ht 1HCt1[f ATUS HP =p *{` '+HDc HHt H脘H*{` DcuCHY HHt HTH*Dc1틃 H[]A\*f ff. AWAVAUATIUSQ P =p *A|$` * Et$ IH*1A|$` A td*Et$I HL HHt)I9uMLJ4 IH)IEt$HtdA\$`u[It$ H%IHuI*I IFH HcH9|L A$ A$ LZ[]A\A]A^A_LE1ݳA$ H藁8 t!HxH)HxHt 1HPar1Hf. ATUS HP =p ){` )HDcy HHt) HTHt H[]A\Ã{` Dcu0H6 HHuDc1Ǻ H Duj)f SH_ H;Ht 1HqH{Ht 1HCuqH{Ht 1HCaqH{Ht 1HCMqH{ Ht E1L[ 8qH{(Ht E1LS(#qH{0Ht E1LK0qH{8Ht E1LC8pH{@Ht 1Hs@pH{HHt 1HKHpH{PHt 1HSPpH{XHt 1HCXp1[ D AUATUSHAP P =p s({` Y(DkD9k HSIcHD`hHIHt^sH{HHHU(DH @ D1Ixs 1APnY^HH( HZ[]A\A]Dk1H蓔'HSIcŃ{` HD`h^'f. ff. ff. ff. HG H8Ht1RHYo1^1fSH H=* 'H=* Hw'H=* ua H=* uH [H1 H1ؿuH]* H9$u1H=.* 蹿H=B* 1H4* 1Hi H=8* H HAuH="* կ1H* d = z u H=z HuQE1USH n9 APHp D y { t1Hs1҉{;FHð H9uH=y HuZ[]1Hy n1H y ^[]mff. AUATUSHQ P =p '{` &HDk HHtH IHu9{` Dk&HX HHtHx IHu"Dk1& H訑Ht^& H葑Ht& AWAVAUATIUSH P =p &A|$` "' Et$zIH&HD$ E|$`1Et&Et$I\ HL^HHt8H9l$uHL$LHHH4 HD$IHB&IEt$It$ H\ IHu%It IFAH4IcH9|LnA$ A$ HL[]A\A]A^A_f AWAVAUATUSHQ P =p i&{` & DkPHHV&E1{` A `&H9$ IHu2DkMu=HE1转 LZ[]A\A]A^A_M9t^Nd DkIDc`EuHs L6 IH%IcL9}HL IUAH HG MHJ4 IIH*%H{ D AU11ATIH5vf USHASLo(L[%I} 5 I} HkH H H H%H C\H HtE1L HjH HtE1L -jH Ht1H jHx H#%H Ht1H iH Ht1H iH Ht1H iH Ht1H iHx H$H Hu$H HQ$H H! H H H H H H H H H( H H0 H H8 H" H@ H% HH H( HP H+ HX H. H` H1 Hh H4 Hp H8 Hx H; H H? H HC H HG H HK H HN H HQ H HT H HW H HZ H H] H H` H Hc H Hg H Hj H Hn H Hr H Hv H Hz H H} H H H H H( H H0 H H8 H H@ H HH H HP H HX H H` H Hh H Hp H Hx H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H( H H0 H H8 H H@ H HH H HP H HX H H` H Hh H Hp H Hx H H H H H H H H H H H# H H& H H* H H. H H2 H H6 H H9 H H< H H? H HB H HE H HH H HK H HN H HR H HU H HY H( H] H0 Ha H8 He H@ Hh HH Hk HP Hn HX Hq H` Ht Hh Hw Hp Hz Hx H} H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H( H H0 H H8 H H@ H HH H HP H HX H H` H Hh H Hp H Hx H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H! H ! H$ H! H' H! H* H! H- H ! H0 H(! H3 H0! H6 H8! H9 H@! H= HH! H@ HP! HD HX! HH H`! HL Hh! HP Hp! HS Hx! HV H! HY H! H\ H! H_ H! Hb H! He H! Hh H! Hl H! Ho H! Hs H! Hw H! H{ H! H H! H H! H H! H H! H H " H H" H H" H H" H H " H H(" H H0" H H8" H H@" H HH" H HP" H HX" H H`" H Hh" H Hp" H Hx" H H" H H" H H" H H" H H" H H" H H" H H" H H" H H" H H" H H" H H" H H" H H" H H" H H # H H# H H# H H# H H # H H(# H H0# H H8# H H@# H HH# H HP# H HX# H H 1 HtE1L ZH Ht1H nZH HtE1L SZH H {E1LL HX HtE1LX ZH` HtE1L` YHb H;X0uH :H .H Ht1H YH H1H Y[]A\A]YH7 I} I} Hm,H L LI9 HI9uYE1L 0YE1L YE1L YE1L X1H( X1H0 X1H8 X1H@ X1HH X1HP X1HX oX1H` \XE1Lh HX1Hp 5XE1Lx !XE1L XE1L WE1L W1H W1H W1H W1H W1H W1H sW1H `W1H MWE1L 9W1H &WE1L WE1L V~E1L VzE1L Vv1H Vs1H Vp1H Vm1H Vj1H( wVg1H0 dVd1H8 QVa1H@ >V^E1LH *VZ1HP VWE1LX VSE1L` UOE1Lh UKE1Lp UG1Hx UD1H UA1H U>1H {U;1H hU81H UU51H BU21H /U/E1L U+1H U(E1L T$E1L T E1L T E1L T1H T1H T1H T1H lT 1H YT 1H FT1H 3T1H T E1L( T1H0 SE1L8 SE1L@ SE1LH SE1LP S1HX S1H` S1Hh pS1Hp ]S1Hx JS1H 7S1H $S1H SE1L R1H RE1L RE1L RE1L RE1L R1H R1H tR1H aR1H NR1H ;R1H (R1H R1H RE1L Q1H QE1L QE1L QE1L( QE1L0 Q1H8 xQ1H@ eQ1HH RQ1HP ?Q1HX ,Q|1H` Qy1Hh Qv1Hp PsE1Lx Po1H PlE1L PhE1L PdE1L P`E1L |P\1H iPY1H VPV1H CPS1H 0PP1H PM1H PJ1H OG1H ODE1L O@1H O=E1L O9E1L O5E1L O1E1L mO-1H ZO*1H GO'1H( 4O$1H0 !O!1H8 O 1H@ N1HH N1HP NE1LX N1H` NE1Lh N E1Lp NE1Lx rNE1L ^N1H KN1H 8N1H %N1H N1H M1H M1H M1H ME1L M1H ME1L ME1L wME1L cME1L OM1H <M1H ! )M1H! M1H! M1H! L1H ! L1H(! L1H0! LE1L8! L1H@! LE1LH! |LE1LP! hLE1LX! TLE1L`! @L1Hh! -L1Hp! L1Hx! L1H! K1H! K1H! K1H! K1H! KE1L! K1H! KE1L! mK}E1L! YKyE1L! EKuE1L! 1Kq1H! Kn1H! Kk1H! Jh1H! Je1H! Jb1H " J_1H" J\1H" JYE1L" JU1H " rJRE1L(" ^JNE1L0" JJJE1L8" 6JFE1L@" "JB1HH" J?1HP" I<1HX" I91H`" I61Hh" I31Hp" I01Hx" I-1H" I*E1L" vI&1H" cI#E1L" OI E1L" ;IE1L" 'IE1L" I1H" I1H" H 1H" H 1H" H1H" H1H" H1H" H1H" {HE1L" gH1H # THE1L# @HE1L# ,HE1L# HE1L # H1H(# G1H0# G1H8# G1H@# G1HH# G1HP# G1HX# G1H lG AUATUSHQ P =p {` HDcHHu>{` Dc|HhHHu_Dc1ҋ HZ[]A\A]H踛IHt HkHtL1HHHHu HyIHt H wL1HH距HHaf D USHRHG H H H H/H{`HH{hHH{pHH@ HtE1L@ ETH{PfC@H.H{XHH HH HH HH HuX[]H Z[]1H RE%ff. fAWAVAUATUSHH P =p 0{` Dc荂HHDs`E1A EHsHHuMDcHs LIHIcL9|AH߅ HL[]A\A]A^A_M9JT DcIHL IT$AH fAVAUATUS HP =p {` hk A HQhHua{` k& H2hH{` kwH H'k1ҋ H[]A\A]A^HCIHtHÐ IH{HO {` HfH{ LLcHHu^f D U1SHQ9k1CZ[]f D ATUS HP =p *{` k A# H%gHuk1 Q []A\H_Hu Hh SH艒H HtE1L nBHP Ht1HP TBHX Ht1HX :BH` HH; tH 1 [f. PH=v& H=u& H=pu& H=u& H=t& H=s& G H= s& H=r& H=r& H=<r& H=q& {H=q& oH=Xq& cH=o& H=o& KH=4o& ?H=(n& Ý H=m& 'H=l& 諝 H=l& H=k& H=lk& H= k& H=j& H=j& H=<j& H=i& H=i& H=8i& H=h& H=`g& H=g& H=f& sH=|f& gH=0f& [H=e& OH=xe& CH=,e& 7H=d& +H=c& 诜 H=b& H=a& H=Pa& H=a& H=`& H=]& g H= ]& H=\& H=h\& H= Z& 7 H=Y& H=dY& H=Y& H=X& wH=W& H=tV& H=V& SH=\U& GH=T& ;H=T& 进 H=S& #H=R& 觛 H=@R& H=Q& 菛 H=P& H=<P& H=O& k H=N& _ H=M& H=LM& H= M& H=L& H=K& # H=<K& H=J& {H=I& H=I& cH=H& WH=H& KH=tG& Ϛ H=F& Ú H=E& 'H=pE& H=$E& H=D& H=D& H=@D& H=C& H=C& H=A& W H=pA& H=$A& H=>& 3 H==& H=@<& H=:& H=h:& sH= :& gH=9& [H=8& ߙ H=8& CH= 8& 7H=7& +H=t7& H=(7& H=6& H=6& H=D6& H=5& H=5& H=@5& H=4& H=h3& C H=2& H=p2& H=2& H=1& H=L1& wH=0& kH=t0& _H=(0& SH=.& ט H=p.& ;H=d-& 还 H=,& #H=,& H=@,& H=+& H=H+& H=)& w H=p)& H=d(& _ H='& H=&& H=&& H=T&& H=%& H=|%& H=0%& {H=$& oH=x$& cH=,$& WH=#& KH="& ϗ H=!& 3H=\!& 'H=!& H= & H=X & H= & H= & H=4 & H= & H= & H= & K H=& H=& H=L& H= & H=& H=H& s H=& g H=& [ H=D& O H=& Ӗ H=& 7 H=`& + H=& H=& H=\& H=& H= & H=8 & H= & H= & H=4 & H= & H= & H= & + H=d & H=& H=& wH=@& kH=& H=& H=|& GH=0& ;H=& /H=& 賕 H=,& H=@& 蛕 H=& H=& H= & w H=P & H= & H=x% S H=% H=% H=T% H=% H=% H=p% H=$% oH=% cH=l% WH= % KH=t% ϔ H=(% 3H=% 'H=% H=$% H=% 蓔 H=% H=@% H=% H=h% H=% H=0% K H=% H=X% H=l% ' H=% H=t% H=(% sH=% gH=P% [H=% OH=% CH=l% Ǔ H= % +H=T% 诓 H=% H=% H=% 苓 H=% H=% s H=l% H=% H=4% H=h% H=% H=p% H=$% H=% H=l% wH= % H=% _H=% SH= % GH=% ;H=% /H=X% 賒 H=l% H=% H=t% H=% H=% w H=P% H=% H=% H= % G H=% H=T% H=% H=% H=P% {H=% oH=% cH=% H=@% KH=% ?H=% Ñ H=|% 'H=% H=D% 蟑 H=% H=% H=% { H=t% H=% H=\% H=% H=D% H=% H=% ' H=@% H=Ժ% H=% sH=<% gH=й% [H=d% OH=% CH≠% 7H=% +H=% H=ȷ% H=|% H=0% H=D% H=% H=% H=`% H=% H=Ȯ% H=|% H=0% H=% H=% H=L% wH=% kH=% _H=H% SH=% GH=% ˏ H=D% /H=ب% #H=% H=% 蛏 H=ԥ% H=(% H=% H=p% k H=% H=% H=L% G H=% H=% H=(% H=ܞ% H=0% {H=ĝ% oH=% H=% WH= % KH=% ώ H=% 3H= % 'H=P% 諎 H=% H=x% H=l% 臎 H=`% { H=% H=% H= % H=% H=% ? H=% H=% H=`% H=% H=ȏ% sH=% H=Ѝ% H=D% OH=% CH=l% 7H= % +H=ԋ% H=% H=<% H=% H=% H=% s H=% H= % H=ԇ% H=H% C H=܅% H=P% H=% H=% H=L% wH= % kH=% H=% SH=<% GH=% ;H=d% /H=~% #H=l~% H= ~% H=}% H=}% H=<}% H={% k H=z% H=Xz% H=y% H=y% H=y% H=x% H=\x% H=w% {H=w% oH=Xw% cH= w% WH=v% KH=4r% ϋ H=q% 3H=\q% 'H=q% H=Dn% 蟋 H=l% H=ll% H= k% { H=j% H=i% H=\i% H=i% H=h% H=Xh% H= h% H=g% H=tg% H=(g% sH=f% gH=f% [H=c% ߊ H=b% CH=Lb% 7H= b% +H=a% H=ha% H=`% H=P`% H=`% H=]% s H=[% H=@[% H=Z% H=Z% H=\Z% H=pW% + H=W% H=V% H=LU% H= T% kH=S% _H=hS% SH= S% GH=R% ;H=R% /H=8R% #H=Q% H=N% 蛉 H=TN% H=N% H=|L% w H=K% H=K% H=K% H=I% G H=I% H=TI% H=h& # H=G% H=0G% {H=F% oH=E% H=E% WH=@E% KH=TD% ψ H=D% 3H=C% 'H=pC% H=$C% H=xB% H= B% H=A% H=tA% H=(A% H=@% H=p@% H=d?% ? H=>% H= >% ' H==% H=4=% H=<% sH=<;% H=:% [H=:% OH=8:% CH=9% 7H=8% 軇 H=T8% H=8% H=7% H=p7% H=D6% H=5% H=5% H=`4% [ H=3% H=3% H=\3% H=2% H=2% H=1% H=L1% wH= 1% kH=0% _H=h0% SH= 0% GH=/% ;H=/% /H=8/% #H=.% H=.% H=T.% H=*% 胆 H=|*% H=p)% k H=D(% _ H='% H='% H= '% H=&% / H=%% H=|%% H=0%% {H=#% H=#% cH="% WH="% KH=t!% υ H= % 3H= % 'H=P % H= % H= % H=l % 臅 H= % H= % H= % c H=\ % H= % H=% H=% 3 H=,% H=% H=% H=% H=% H=% [H=% OH=X% CH= % 7H=% +H=t% H=(% H=% H=% H=D% H=% H=L% g H= % H=% H=h% H= % H=% H= % H= % H=l % wH= % kH= % _H=H % SH=% GH=% ;H=d% /H=% #H=% H=`% H=% H=% H=|% H=% H=% H=x% H=,% H=% H=% H=$ # H= $ H=$ {H=D$ oH=$ cH=L$ WH=$ KH=$ ?H=($ 3H=$ 'H=P$ H=$ H=$ H=l$ H= $ H=$ H=H$ c H=<$ H=$ H=$ H=X$ H= $ H=$ H=$ H=h$ sH=$ H=0$ [H=$ OH=$ Ӂ H=l$ 7H= $ +H=$ H=h$ H=$ H=$ H=d$ H=$ H=l$ g H= $ H=$ O H=$ H=\$ H=$ H=$ H=8$ H=$ wH= $ H=t$ _H=$ SH=$ GH=p$ ;H=$ /H=$ #H=l$ H= $ H=$ H=$ H=<$ H=$ H=$ _ H=X$ H=$ H=$ H=4$ H=$ H= $ H=$ {H=d$ oH=$ cH=$ WH=$ H=4$ ?H=$ 3H=\$ 'H=$ H=$ H=x$ H= $ H=$ H=$ o H=h$ H= $ H=$ H=d$ H=$ H= $ ' H=$ H=4$ H=$ sH=$ ~ H=0$ [H=$ OH=$ CH=L$ 7H=$ +H=$ H=H$ H=ܽ$ H=$ H=Ļ$ ~ H=8$ H=̹$ H=$ H=4$ H=$ H=$ H=$ +~ H=$$ H=$ H= $ wH=$ kH=4$ _H=$ SH=$ GH=0$ ;H=İ$ /H=x$ #H= $ H=$ } H=T$ H=$ H=$ H=P$ H=$ H=$ H=l$ H= $ H=$ H=H$ H=$ H=$ {H=$ | H=8$ cH=,$ | H=$ KH=$ ?H=H$ 3H=$ | H=$ H=D$ H=$ | H=$ H= $ H=4$ H=Ȟ$ H=|$ H=0$ H=$ ?| H=$ H=$ H=$ | H=t$ H=$ sH=|$ gH=З$ { H=d$ OH=$ CH=$ { H=$ { H=$ H=$ H=\$ H=$ H=$ { H=$ H=̏$ H=`$ H=T$ O{ H=($ H=܌$ H=$ H=$$ H=؋$ H=̊$ { H=$ kH=t$ _H=$ z H= $ GH=$ ;H=d$ /H=$ #H=l$ z H= $ H=T$ H=$ H=$ H=p$ H=$ H=$ Sz H=̀$ H=$ H=4$ H=$ H=$ H=0$ {H=~$ oH=x~$ cH= ~$ WH=}$ KH=4}$ ?H=|$ 3H=|$ 'H=P|$ H=|$ H={$ H= v$ y H= u$ {y H=t$ H=t$ H=|s$ H=s$ H=$r$ ?y H=q$ H=p$ 'y H=`p$ H=o$ H=n$ y H= n$ gH=m$ [H=dm$ OH=8l$ x H=k$ 7H=@k$ +H=Tj$ x H=i$ H=i$ H=0i$ H=h$ H=xh$ H=Lf$ gx H= f$ H=e$ H=(e$ H=d$ H=c$ +x H=b$ x H=b$ H=a$ wH= a$ kH=`$ _H=`$ SH= `$ GH=_$ w H=^$ /H=X^$ #H=,]$ w H=\$ H=T\$ H=\$ H=[$ H=p[$ H=[$ H=W$ Sw H=V$ Gw H=@V$ H=U$ H=hU$ H=S$ w H=PS$ {H=R$ oH=R$ v H=,Q$ v H=P$ KH=P$ ?H=(O$ v H=N$ 'H=M$ v H=DM$ H=L$ v H=K$ H=@K$ H=J$ H=J$ H= I$ Wv H=H$ H=DH$ H=G$ H=G$ H= F$ v H=E$ H=E$ sH=D$ gH=pD$ [H=dC$ u H=C$ CH=B$ 7H=`A$ u H=@$ H=h@$ H=?$ u H=?$ H=>$ H==$ su H=l=$ H=<$ [u H=T;$ Ou H=;$ H=9$ H=09$ H=8$ H=x8$ H=,8$ wH=7$ kH=t7$ _H=(7$ SH=5$ t H=05$ ;H=4$ /H=X4$ #H= 4$ H=2$ t H=t2$ H=2$ H=1$ H=p0$ kt H=$0$ H=/$ H=l/$ H=-$ ;t H=-$ H=,$ #t H=+$ H=P+$ {H=D*$ s H=)$ cH=($ s H=($ KH=t'$ s H='$ 3H=&$ 'H=%$ s H=$%$ H=$$ H=#$ s H=`#$ H=T"$ os H=(!$ cs H= $ H= $ Ks H= $ H= $ H=, $ H= $ s H=t $ H=$ s H=<$ gH=p$ r H=$ OH=$ r H=$ 7H=$ r H=t$ H=$ r H=$ H=$ H=$$ H=$ sr H=$ H= $ H=$ Or H=$ Cr H=$ H=$ H=D$ H=$ H=l$ wH= $ kH= $ _H=( $ SH= $ q H= $ ;H=$ $ /H= $ #H= $ H= $ H=$ H=H$ q H= $ H=$ H=D$ H=$ H= $ Gq H=$ H=$ H=$ H=# q H=p# {H=# oH=# cH=L# WH= # KH=# ?H=H# p H=|# 'H=# H=# p H=# H=# H=# H=4# op H=# H=\# H=# H=# ?p H=x# 3p H=,# H=@# H=T# H=# sH=# o H=# [H=d# OH=# CH=# 7H=@# +H=# H=# H=\# o H=# H=# H=# so H=# H=# H=t# H=# Co H=# H=# +o H=# H=# H=,# wH=# kH=t# _H=(# SH=# GH=# ;H=D# /H=# #H=# H=`# H=# n H=# H=# H=P# H=D# _n H=# H=# H=@# H=# H=# H= # H=# {H=# m H=8# cH=# WH=`# KH=# ?H=h# 3H=<# m H=# H=# H=# m H=,# H=# H=# om H=# cm H=<# H=# H=# H=# 3m H=# H=# H=4# H=# sH=# gH=P# l H=# OH=x# CH=# l H= # +H=# H=# l H=# H=p# H=$# H=# H=L# H= # H=# H=(# H=# H=P& +l H=# H=# H=L# wH=`# k H=# _H=# SH=<# GH=# ;H=# /H=8# #H=# H=# H=T# H=# H=# H=P# H=# H=# Sk H=# H= # H=# H=(# H=ܥ# H=p# {H=$# oH=ؤ# cH=,# j H= # KH=t# ?H=# 3H=# j H=# H=# H=X# H=l# j H=# H=# H=# H=\# H=P# Kj H=d# H=# H=# H=`# H=4# j H=H# sH=ܒ# gH=Б# i H=# OH=# CH=# 7H=`# +H=T# i H=h# H=# H=Њ# i H=D# H=x# H=,# H=# H=T# H=# H=# H=P# H=# i H=# H=L# wH=# kH=# h H=(# SH=~# GH=}# h H=|# /H=X|# #H={# H=z# h H=y# h H=hy# H=\x# wh H=x# H=$w# _h H=v# H=lv# H=@u# ;h H=t# H=ht# H=s# H=s# {H=$s# oH=r# cH=Lr# WH=q# KH=tq# ?H=(q# 3H=p# 'H=Pp# H=o# H=o# H=,o# H=n# H=n# H=Hn# H=m# H=m# H=dm# H=l# H=l# H=`l# H=l# H=k# sH=|k# gH=0k# [H=j# OH=j# CH=Lj# 7H= j# +H=i# H=hi# H= i# H=h# H=$[# f H=X# H=LX# H=W# H=W# H=(W# H=V# H=V# H=$V# H=8T# f H=S# wH=`S# kH=R# _H=R# SH=\R# GH=M# e H=M# /H=XM# #H= M# H=L# H=K# e H=HK# H=J# H=J# H=$J# H=I# H=lF# Ge H= F# H=D# /e H=D# H=|C# e H=0C# {H=B# oH=B# cH=LA# d H= A# KH=@# ?H=h@# 3H=?# 'H=P># d H=<# d H=<# H=,<# H=;# H=9# od H=8# H= y& Wd H=8# H=5# H=85# H=4# H=4# H=3# d H=H3# sH=1# gH=1# [H=D1# OH=0# c H=,/# c H=.# +H=t-# H=-# H=+# c H=*# c H=*# H=8)# H=L(# gc H= (# H='# H=h'# H=&# H=&# H=D&# H=%# H=%# wH=`%# kH=t"# _H=("# SH=!# GH=!# ;H=D!# /H= # b H=L # H= # H= # H=H # H=\ # wb H= # H= # H=8 # H=L# Gb H=# H=t# H=# #b H= # H=# {H=# oH=8# cH=# WH=# KH=# ?H=# 3H=\# 'H=# H=# H=X# H=# H=# {a H=T# H=# H=|# H=# Ka H=$# H=# H=L# H=`# a H=T # a H= # sH= # gH= # [H=d # OH= # CH=# 7H=`# ` H=# H=h# H=|# ` H=0# H=# H=xs& s` H=# H=# H=4# H=# H=# H=P# H=# H= # H=l # wH= # kH=" _H=" SH=<" GH=" ;H=" /H=X" #H= " H=" H=t" H=(" H=" H=P" H=" H=" H=L" H= " H=" H=h" H=" H=" {H=D" oH=" cH=" WH=`" KH=" ?H=" 3H=|" 'H=" H=" H=8" H=" H=" H=" H=" H=<" H=" H=" H=X" H=" H=`" ^ H=" H=" sH=\" ] H=P" ] H=" OH=X" CH= " 7H=" +H=" ] H=" H=<" H=P" ] H=d" ] H=8" H=" H=" H=" O] H=" H=" H=P" H=d" ] H=" H=l" wH=" \ H=" _H=" SH=" \ H=0" ;H=" /H=" \ H=" \ H=" H=t" H=" H=" w\ H=" H=$" H=8" S\ H=" H=" H=4" H=" #\ H=|" H=p" \ H=" oH=" [ H=" WH=" [ H=" [ H=" 3H=<" 'H=" H=" [ H=X" H=" H= " {[ H=t" H=" H=<" W[ H=" H=" H=" 3[ H=" H=@" H=t" [ H=h" [ H=" gH=" [H=" OH=x" Z H=," 7H=" +H=Դ" Z H=h" H= " Z H=" H=" Z H=8" H=L" gZ H=" H=" OZ H=" CZ H= " H=Щ" H=d" H=x" Z H=" wH=" kH=4" Y H=" SH=<" GH=Ф" ;H=" Y H=" #H=" H=" Y H=t" H=(" H=ܞ" wY H=P" H=" H=" SY H=" H=" ;Y H=T" H=" H=" Y H=" {H=$" oH=ؘ" cH=̗" X H=" X H=ԓ" ?H=" 3H=<" 'H=В" H=" H=8" H=̑" H=" {X H=" H=(" cX H=" H=" H=d" H=" H=" H=`" H=" H=ȇ" sH=|" gH=0" [H=" OH=" W H=́" 7H=" +H=4" H=Ȁ" H=|" H=0" H=" H=z" sW H=x" H=x" H=4x" H=w" H=v" 7W H=u" H=$u" H=t" W H=Ls" wH=r" kH=q" V H=(q" SH=p" GH=pp" ;H=do" V H=n" #H=,n" V H=m" H=l" V H=hl" H=k" wV H=0k" ۿH=$j" _V H=i" ÿH=h" GV H=`g" ;V H=f" 蟿H=e" 蓿H= d" 臿H=c" {H=c" oH=c" cH=b" WH=b" KH=Ta" U H=`" 3H=_" U H=p_" H=d^" U H=]" H=\" U H=\" H=t[" oU H=[" ӾH=<Z" WU H=Y" 軾H=X" ?U H=XX" 裾H=LW" 'U H=V" 苾H=U" U H=(U" sH=S" T H=0S" [H=DR" T H=Q" CH= Q" T H=P" +H=O" T H=(O" H= N" T H=L" T H=DJ" H=G" H=F" H=`E" [T H=D" 追H=D" 賽H=\C" 7T H=B" 蛽H=dA" T H=@" 能H=?" T H= ?" kH==" S H=h=" SH=<" S H=0<" ;H=;" /H=:" S H=,:" H=8" S H=T8" H=7" S H=6" H=P5" kS H=4" ϼH=3" SS H=3" 跼H=2" ;S H=T2" 蟼H=H1" #S H=0" 臼H=/" S H=/" oH=8/" cH=-" R H= )" KH=(" ?H=h(" 3H= (" 'H=P&" R H=$"" H=!" H=!" H=@!" H= " oR H= " ӻH= " WR H= " 軻H=" ?R H=x" 裻H=," 藻H=" 苻H=" R H=h" sH= " gH=" Q H=" OH=" Q H=" 7H=" Q H=" H=h" H= " H=" Q H= " H= " sQ H=, " H= " ˺H= " OQ H=h " 賺H= " 觺H=0" +Q H=d" 菺H=" 胺H=" wH=`" kH=" _H=" P H=|" GH=" ;H=" /H=x" #H=," H=" H=" H=H" H= " H= " ۹H=D_& _P H=! ùH=l! 跹H= ! 諹H=! 蟹H=! 蓹H=<! 臹H=! {H=! oH=X! cH= ! WH=! KH=t! ?H=! 3H=! 'H=p! H=$! H=! H=l! H= ! H=! ߸H=h! ӸH=! ǸH=! 軸H=D! ?O H=! 裸H=! 藸H=! O H=t! H=! O H=<! gH=P! N H=! OH=! N H=! 7H=`! +H=! H=Z& N H=\! H=! H=! H=! sN H=! H=@! ˷H=! 迷H=! 賷H=\! 觷H=! 蛷H=! 菷H=x! 胷H=,! wH=! kH=! _H=H! SH=! GH=! ;H=d! /H=! #H=! H=! H=4! H=! H=! H=P! ۶H=! ϶H=! öH=l! 跶H= ! 諶H=4! /M H=! 蓶H=! M H=! {H=! L H=x! cH=,! WH=! KH=! ?H=H! 3H=! L H=! H=! L H=X! H=L! L H=@! {L H=! ߵH=! cL H=|! ǵH=p! KL H=$! 诵H=! 3L H=L! 藵H= ! 苵H=! L H=h! sH= ! gH=! [H=! OH=8! CH= ! K H=! +H=4! H=! H=! H=P! K H=! H=! sK H=! gK H=@! ˴H=T! OK H=! 賴H=! 7K H=! +K H=$! 菴H=! 胴H=L! wH=`! J H=! _H=(! J H=! GH=! J H=! J H=ؽ! #H=! H= ! H=! J H=H! H=ܺ! H=! kJ H=$! ϳH=ظ! óH=l! 跳H=@! ;J H=Զ! 蟳H=! 蓳H= ! 至H=! J H=D! oH=! I H=! I H=! KH=! I H=(! 3H= ! I H=! I H=d! H=! H= ! I H=! H=Ԫ! oI H=h! ӲH=\! WI H=P! KI H=! 诲H=! 3I H=! 藲H=! I H=t! I H=ȣ! sH=\! gH=P! H H=! OH=X! CH=l! H H=! +H=t! H=H! H H=ܝ! H=p! H=$! H=؛! sH H=l! ױH=@! [H H=! OH H=Ș! 賱H=! 7H H=! 蛱H=! H H=x! H H= ! wH=@! G H=ԓ! _H=Ȓ! G H=! G H=0! ;H=$! G H=8! G H=̎! H=! H=! H=h! H= ! H=! ۰H=d! ϰH=! ðH=! GG H=! 諰H=4! 蟰H=! 蓰H=\! 臰H=P! G H=! oH=! cH=L! WH=@! F H=Ԃ! ?H=H! F H=܀! 'H=! H=}! F H=|! F H= |! H={! H=T{! ߯H={! ӯH=z! ǯH=y! KF H=Dy! 误H=x! 裯H=lw! 'F H=v! 苯H=4v! H=u! sH=u! gH=s! E H=Ds! OH=xr! E H= r! 7H= q! E H=o! E H=(n! H=m! H=m! H=$l! E H=k! H=lj! gE H= j! ˮH=h! OE H=hh! 賮H=f! 7E H=f! 蛮H=De! E H=8d! 胮H=c! wH=c! kH=4c! _H=Hb! D H=a! GH=`! D H=`! /H=X_! D H=^! H=^! H=4^! H=H]! D H=\! H=\! ۭH=[! _D H=X[! íH= [! 跭H=Y! ;D H=TY! 蟭H=hX! #D H= X! 臭H=pV! D H=V! oH=U! C H=T! WH= S! C H=R! ?H=hQ! C H=N! 'H=N! H=dN! H=N! H=M! H=M! H=4M! ߬H=L! ӬH=L! ǬH=J! KC H=dI! ?C H=G! 裬H=LG! 藬H= G! 苬H=F! C H=E! sH=<E! gH=D! [H=C! B H=XC! CH= C! 7H=B! +H=tA! B H=@! H=@! H=0?! B H=>! H=8>! H= =! gB H=<! ˫H=;! OB H=(;! 賫H= :! 7B H=9! 蛫H=7! B H=x7! 胫H=,6! B H=4! A H=3! _H=h3! SH=|2! A H=1! ;H=1! /H=0! A H=,0! H= /! A H=.! H=H.! H=\-! wA H=,! ۪H=,! ϪH=+! SA H= +! 跪H=*! 諪H=)! /A H=)! 蓪H=<)! 自H='! A H=&! @ H=8&! cH=%! WH=%! KH=$! @ H=($! 3H= #! @ H="! H=D"! H=8!! @ H=, ! @ H= ! H= ! o@ H=h ! өH=| ! W@ H= ! 軩H=$ ! ?@ H=! 3@ H=! 藩H=! @ H=T! H=(! @ H=! gH=! ? H=! ? H=8! CH= ! ? H=! +H=! ? H=! ? H=|! H=! H=$! ? H=! H= ! g? H= ! ˨H=t ! 迨H= ! 賨H= ! 7? H= ! 蛨H= ! 菨H=X ! 胨H= ! ? H=! kH=4! _H=! > H=|! GH=! ;H=$! > H=! #H=L! H= ! H= > H= > H= H=P ۧH=d _> H= çH= G> H=` 諧H=T /> H= 蓧H= 臧H=P > H=$ oH= cH= WH= = H= ?H= 3H= = H=P H= H= = H= = H=@ H=T o= H=h ӦH= ǦH= K= H= 详H= 3= H=, 藦H= 苦H= = H=H sH= gH= < H=D OH= CH= < H=@ +H= H= H= < H= H=$ H= s< H= ץH= ˥H= O< H= 賥H=| 觥H=p +< H= 菥H= < H= < H=` kH= _H= SH=< GH= ;H=d /H= #H= H=` H= H= H=\ H= ۤH= ϤH=x äH=, 跤H= 諤H= 蟤H=H 蓤H= 臤H= {H=d oH=89& : H= WH= KH=4 ?H= 3H=\ 'H=p : H=$ H= H= H= H=4 o: H= ӣH=| ǣH=0 K: H=D ?: H= 裣H=L 藣H= 苣H= H=H sH= 9 H= [H= OH=8 CH= 7H=` +H= H= 9 H= H=P H= H= H=, עH= [9 H= 迢H=h 賢H= 觢H= 蛢H=$ 9 H= 胢H=L wH= kH= _H= 8 H= 8 H=P ;H=Ĵ /H=8 #H=̳ H= 8 H= H=h H= H= k8 H=$ _8 H=x5& S8 H=, 跡H= 諡H= 蟡H=H 蓡H= 臡H= {H=d oH= cH=̬ WH= KH=4 ?H= 3H=\ 'H= H=ĩ 7 H=X H= H= {7 H= ߠH=Ȧ ӠH=\ W7 H=Ф 軠H=ģ ?7 H=8 裠H=, '7 H= 苠H=T H=H 7 H= gH=p [H=d 6 H=؝ CH= 7H=@ +H= H= H= 6 H= H=ę H=x H=l g6 H=@ ˟H= 迟H= 賟H=\ 76 H=Д 蛟H= 菟H=8 胟H= wH= 5 H= _H=h SH= GH=А ;H= /H=8 #H= H= H= 5 H= H= H=0 ۞H= ϞH= ÞH=L 跞H= ;5 H=1& /5 H= 蓞H=\ 臞H= {H=ć oH=x cH=, WH= KH= ?H=H 3H= 'H= H=d H= H=̄ H= H=4 ߝH= ӝH= ǝH=P 軝H= 话H= 裝H=l 藝H= 苝H= H=h sH= gH=Ѐ [H= OH=x 3 H=, 7H=~ +H=t~ H=} H=|} H=} H=| H=X| H={ לH=y [3 H=4y 远H=x 賜H=v 73 H=pv 蛜H=$v 菜H=u 胜H= t 3 H=s kH=ts _H=(s SH=r GH=r ;H=Dr /H=q #H=q H=`q H=n 2 H=j H=j H=Pj ۛH=j ϛH=i ÛH=li 跛H= i 諛H=e /2 H=(e 蓛H= c 2 H=a 2 H=$a oH=` 1 H=_ WH=^ 1 H=] ?H=] 3H=\] 'H=[ 1 H=d[ H=8Z 1 H=Y H= Y H=X ߚH=hV c1 H=U ǚH=U 軚H=DU 诚H=T 裚H=T 藚H=`T 苚H=T H=S sH=|S gH=0S [H=R OH=xN 0 H=M 7H=M +H=4M H=L H=L H=PL H=L H=K H=lK יH= K ˙H=J 这H=J 賙H=<J 觙H=I 蛙H=I 菙H=XI 胙H= I wH=@ / H=4@ _H=? SH== / H== ;H=: / H=9 #H=8 H=`8 H=8 H=H6 / H=5 H=p5 ۘH=$4 _/ H=3 ØH=l3 跘H= 3 諘H=2 蟘H=2 蓘H= 2 臘H=1 {H=1 oH=. . H=. WH=@. KH=+ . H=+ 3H=<+ 'H=* H=* H=8* H=) H=$ {. H=t$ ߗH=$ ӗH=# ǗH=0# 軗H=" 诗H=X" 裗H=l! '. H= . H=4 H= sH= gH=P [H= OH= CH=l 7H= +H= H= H=< H= - H=$ H= H=L זH= [- H= O- H= 賖H=| 7- H= 蛖H=$ - H= 胖H= - H=` kH=t , H=h , H= GH= ;H= /H= , H=l H= H=T%& , H= H= H=P ەH= ϕH= ÕH= G, H= 諕H= /, H= #, H=| 臕H=0 , H=d oH= + H=, + H= KH= + H=( + H=\ + H= H= + H=X + H= H= H=T ߔH= ӔH= ǔH= K+ H=d 诔H= 裔H= 藔H= 苔H=4 H= sH= gH=P [H= OH= CH=, * H= +H= H= H=| H=0 H= H= H=L דH= ˓H= O* H= C* H= 觓H=p 蛓H=$ 菓H= 胓H= wH= ) H= _H=H ) H= GH=P ;H= /H= ) H=l H= H=T ) H=h ) H=| w) H=0 k) H=$ _) H= S) H=, G) H= ;) H= /) H= & #) H= 臒H=м {H= oH=8 cH= WH= KH= ( H=H 3H=< ( H=и H= ( H=8 H= H= H=4 ߑH= ӑH= ǑH=P 軑H= 译H= 3( H=l 藑H= 苑H=Բ H= sH=< gH= [H= OH=X CH= 7H= +H=t H=( H=ܯ H= H=D H= H= אH=` ːH= 运H=ȭ 賐H=| 觐H=0 蛐H= 菐H= 胐H=L wH= kH= _H=h SH= GH=Ъ ;H= /H=8 #H= H= H=T H= H= H=p ۏH=$ ϏH=ا ÏH= 跏H=@ 諏H= 蟏H= 蓏H=\ 臏H= {H=ĥ oH=x cH=, WH=` KH= ?H=Ȣ 3H=| 'H= % H= H= H=̛ % H=@ H= ߎH= c% H= ǎH=P 軎H= 诎H= 裎H=l 藎H= 苎H=ԉ H= sH=< $ H= [H= OH=X CH= 7H= +H=t H=( H= $ H=P H= H={ H=l{ H= { ˍH=z 迍H=z 賍H=<z 觍H=y 蛍H=y 菍H=v $ H=v wH=`v kH=v _H=u SH=|u GH=p # H=o /H=o #H=Lo H=`n # H=m H=Hm H=l H=k k# H=k όH=j ÌH=lj 跌H=i ;# H=th 蟌H=(h 蓌H=g 臌H=f # H=e oH=xe cH=d " H=`c KH=tb " H=(b 3H=a 'H=a H=Da H=^ " H=l] H= ] H=\ ߋH=h\ ӋH= \ NjH=[ 軋H=d[ 诋H=X 3" H=LX 藋H= X 苋H=W H=hW sH= W gH=V [H=dV OH=8U ! H=T 7H=@S ! H=R H=R H= Q ! H=P H=dP H=P H=N g! H=@N ˊH=L O! H=L 賊H=|K 7! H=K 蛊H=I ! H=xI 胊H=,I wH=H kH=tH _H=(G H=F GH=E H=E /H=D H=,D H= C H=B H=A H= A H=? k H=> _ H=8> ÉH== 跉H== 諉H=4< / H=; 蓉H=: H=P: {H=8 H=x8 cH=l7 H= 7 KH=45 H=H4 3H=3 'H=2 H=2 H=82 H=0 H=/ H=/ ߈H=. c H= - LjH=, 軈H=d+ ? H=) 裈H=) 藈H=@( H=' H=' sH=<& H=% [H=% OH=X% CH= % 7H=$ +H=T$ H=# H=# H=P# H=" H=" H=L" ׇH= " ˇH=! 过H=h! 資H= 7 H= 蛇H= H= 胇H= wH= H= _H= SH= H= ;H= /H= H=L H= H= H= H=< H=0 k H= φH=8 ÆH=L G H= 諆H=T 蟆H=H # H= 臆H= {H=D oH= cH= WH=@ KH= ?H= 3H=\ 'H= H= H=x H=, H= { H=t ߅H=( ӅH= DžH= K H= 诅H= 装H= 藅H=` H= H=( H= gH= H=D OH=8 H= 7H= H= H=H H= H= H= H= H= ׄH=` ˄H= 迄H= C H=\ 规H= 蛄H=D 菄H= 胄H= H= kH=t H=H H= GH= ;H=$ /H= #H=l H= H= H= H=| w H= ۃH=D _ H= ÃH= G H=` 諃H= 蟃H= 蓃H=| H=p H= oH=x cH= WH= H=t ?H=( 3H= 'H= H=D H= H= H= H=t& o H= ӂH= ǂH=p 軂H=D ? H= 裂H=L ' H= 苂H=t H=( sH=< H= [H=d OH= CH= 7H= +H= H=H H= H= H= H= H=l ׁH= ˁH= 迁H=( 賁H=ܺ 见H=p 蛁H=$ 菁H= 胁H=l wH= kH= _H=h SH= GH= ;H=d /H= #H=̶ H= H=ԯ H=h H= H= ۀH= _ H=8 ÀH= 跀H= ; H= 蟀H=Ȩ 蓀H=| 臀H=0 {H= oH=x cH=, H= KH= ?H=H 3H= 'H= H=d H= H=̡ H= H=4 H= H= H=P H= ? H= H=L H= H= H=H sH= gH= [H=d OH= CH=L H=@ +H= H= H= H= ~H=d ~H= ~H= ~H=` [ H= ~H=( ~H= ~H=p ~H= H=x ~H=, w~H= k~H= _~H=H S~H= G~H= ;~H=d /~H= #~H=̋ ~H= ~H=4 }H=( H= }H=P }H= }H= S H= }H=@ }H=ԃ }H= }H=< }H= {}H= o}H= H= W}H=` K}H= ?}H= 3}H=< '}H=P~ }H=~ }H=} }H=l} |H= } |H=| |H=h| |H=x W H=x |H=w ? H=u |H=u |H= u |H=t |H=t s|H= t g|H=s [|H=Ds O|H=r C|H=q H=q +|H=4q |H=p |H=p |H=0p {H=o {H=Xo {H=n {H=n {H=tk O H=k {H=j {H=i + H=Di {H=h {H=h w{H=@h k{H=g H=f S{H=|f G{H=f ;{H=e /{H=Xe #{H= e {H=d {H=td zH=(d zH=c zH=c zH=Dc zH=b zH=b zH=`b zH=4] / H=\ zH=|\ zH=[ {zH=[ ozH=XY H=X WzH=X KzH=X ?zH=W 3zH=|U H=pT zH=$T zH=S zH=S yH=P { H=N yH=N yH=<N yH=M yH=M yH=8M yH= L ' H=K yH=tK yH=K syH=J gyH=pJ [yH=$J OyH=I CyH=I 7yH=@I +yH=H yH=C H=C yH=% H=B xH=XB xH= B xH=A xH=@ O H=H@ xH=? xH=? + H=> xH=X> xH=L= H=< kxH=t< _xH=(< SxH= ; H=: ;xH=D: /xH=9 #xH=8 H=8 xH=48 wH=(7 H=6 wH=P6 wH=6 wH=4 S H=4 wH=@4 wH=43 / H=2 wH=|2 wH=02 {wH=$1 H=0 cwH=l0 WwH=/ H=4/ ?wH=. 3wH= . H=- wH=d- wH=, H=L, vH= , vH=+ vH=h+ vH=* vH=* vH=D* vH=) vH=) vH=`) vH=) vH=' H=<' gvH=& [vH=& OvH=X& CvH= & 7vH=% +vH=t% vH=(% vH=$ vH=$ uH=D$ uH=# uH=# uH=`# uH=# uH=" uH=|" uH=0" uH=! uH=! uH=L! wuH= ! kuH= _uH=h SuH= GuH= ;uH= /uH=8 #uH= uH= uH=T tH= tH= tH=p tH=$ tH= tH= tH=@ tH= tH= tH=\ tH= {tH= otH=X ctH= WtH= KtH= ?tH= 3tH=< 'tH= tH=d tH= tH= sH= sH= sH=H sH= sH=p sH= sH= sH=,% ' H=@ sH= sH= ssH= gsH= [sH= H=8 CsH= 7sH= +sH=4 sH= H= sH=P rH= rH=x rH= g H= rH=4 rH= rH=| rH=p + H= rH= rH= H= krH=T _rH= SrH=| GrH= H=d /rH= #rH= rH= H=4 qH= qH=\ qH= k H= qH= S H=L qH= qH=T qH=H # H= qH= H=D oqH= cqH=, WqH= KqH=t ?qH= 3qH= 'qH=p qH= qH= qH=l pH= pH= pH= pH=< W H= pH= pH= pH= ' H= H= pH=( spH= gpH=P [pH= OpH= H=L 7pH= +pH= H= pH=< pH= oH= H=X oH=L g H= oH= O H=h oH= oH= oH= H= H=l woH=% H= _oH=H SoH= GoH= ;oH= H=8% H= oH= oH=4 nH= nH=\ nH= nH= nH=x nH= nH= ; H=t nH= # H=| nH=0 H=D H= cnH= WnH=` KnH= ?nH= H=| 'nH= nH= H=8 nH=, H=@ { H=Ի mH= mH=< mH= mH= mH=X mH= mH= mH= H= smH= gmH=ж [mH= OmH= H=, 7mH=@ +mH= mH=h mH= mH= lH=D lH= lH= lH=@ lH=ԯ lH=H lH=ܮ lH= lH=D lH=ح lH= wlH=@ klH=T H= SlH=| GlH= H= /lH= #lH= lH=` lH= kH=ȟ H= kH=И kH= kH=8 S H= kH= kH=T kH= kH= H= {kH=d okH= ckH= WkH=` H=ԋ ?kH= 3kH=< 'kH= kH= kH=X kH= jH= jH= o H= jH= jH=Ѓ jH=d% ? H=X jH= jH= jH= H=( sjH= gjH= H=d OjH=% CjH=l~ H= ~ +jH=4} H=| jH= % H=p| iH={ H=% s H= { iH= % [ H=z iH=H% C H= z iH=0y + H=$% H=x iH=,% Z f Sf4 Ht[HsH ]fC4H H Hg1H H gH Hg[H-) Hh u%1SHHGH H8`1H[UfAnfnSfA:"f:"flHHgHHgHH|$00 )$59Hgfo$ HhHX@ H[]ff. AWAVAUATUSHfnL$`fnD$Pf:"L$hf:"D$XflHegHHvgHH|$pH IIMM)$8HDgfo$ HhHXLpLx Lh(L`0@8H[]A\A]A^A_ff. HH D USHQHK H;x0uHo(HP 1HH XH[],ff. ? tSHo1[ USHAPHo(H{H H{pHt *1HspH8 1UH} RHE(HU(HXfH9fHx tfHH H9E0u1H}( HM0DfH} ]UH{HH$f{X tX[]1 UZH[]OFff. @ SHGHH@(H8 fH { (f[ff. @ AUATUSQHfLgHM fMl$(H I} QHHCHuhID$HtHI} TH} u.1H( H( HuX[]A\A]H Hw8 HHHwTH9u1HxTHBHCff. HHH=C %M ff. fUSH1H8HH*nH{ Ht <1HK H{@Ht (1HS@H Ht1H H1}H8[] SHHdH f5Hd HX[ÐUH SHQ=5HtH(HXZ[]ff. fAU1ATIUSQLoL(HdHH@ d1L!HHdH HH u3LHH== HOIHHZL[]A\A]IuLH=p 1NIff. HGHt1RHOH蘝1^1Ðff. SHHHt 1HShH{Ht 1HCT1[AWHBAVAUATUHSHH8H2fE1HLu G H-] LH[H$HeL% LL<HD$H;fH H@ HT$H4$ HHe1HeM9eHLHH HC [dH HH:dA1H. H HddHI1H5j LŕHH; HD$HdHΤ HA_ - H < HH 1S<LHD$Hc͛HśHD$LLH HD$ HH L PHHH5y H= 1APM(ZYsbH!IH_bH|$Ht$ HP L LI9MbH HH HD$(ISH HHtbAHL$(IHԥ HM-b0HaI|$HaH5% 0%t[H贚H|$誚H袚 LLbHH<$膚H|$|MPcH8H[]A\A]A^A_H:: H9D$`L7;HaLhHH5N: L`[ LHHH9H߅`H|$LHQQbbbHHG #c 'cHGH H1 HH9WuHHwH ff. AVIHAUATIUH/ SHH HncL$ 1ILH9 L1McHӡ HH@ H@p HH>cL Hİ []A\A]A^ff. H H@ H@Hx Hcff. f ff. AVAUATUSHHB cHGH ncz IIIc} I\$L9rtHEL9cMcL)L9IOJ+H9gcHt2HN cA ILLLHlbHH[]A\A]A^Vccf. Q*mc1Zff. AUH ATUSHHH7 fHnfH:"H Hc)D$01fHD$@ D$XHT$`D$ D$HD$hH[cHQcIHEcLd$0H;Lc Iu~\$ HT$h A1H55 H=87 Xxy/H|$PI`LCcH H HLX"HĈ H[]A\A]H{HjbBŃwbI[Kb\bcATHG HmUfHnHSfHnfH:"_fH:"HP) $)T$ A; % H- } HcDeH=\) L%-) Hk HO) HȮ) H H fo\$1H)n fHnH5) H\$ fH:"\$8D$(Ht$ sH1#tH efo$$LfHn Ld$ HfH:"d$8D$(rHtH5ɮ) Ht$ rH sE 1HP[]A\H| H5 H81*D> fUSH(H S ~ fH:"8 )${ U 1H5) *rH={) 莱< H=) ugbH) HI fo $Hl$1HT IH5sH=ss)L$fo $1IH H5tH") H=Ss)L$iH) H) A H=) Hڬ) H=) H=Ƭ) H p ) H HPU 1H=p) r) o H^) H1J) H5xV4 HiCB H1H| H#) 1H([]H{ H8KeHW H5h H8@H? H5T3 H8(a< ff. @ HH5] H=ޚ 1~ IfH:"> H )$HÐHH 1~˗ H5 IfH:" H=u )$HÐH AUATUHSHQH9#_HM_HuHu`H}WZIHtJHw6LȊI^1Hm H0 H^LhHE HhZ[]A\A]^^ff. SHHHtiH{ Ht[H{(H^HCH[H@ ff. fUHSHQH^H H} <^H H@ HE8HxH ~4H0H^Et HO Hc HH H9G8r̓H_(HukAHH\^H1HHH*Z H5<1 -^HZ[]1Z)^ D HGH@Hm^H f. ATUHSLg HI<$Ht HӅu>I|$Ht HӅu+I|$Ht HӅuI|$1Ht HH[]A\[]A\ff. fHHAPЅx H# H Z1ZÐH I t @ UHSQH_H_HJH_@ HH~H 1FHXH[H 1]cff. SH^H=m) Ht:HgHHt*H H)n) H5HȨ) H ) H9u[[H[H AUL-) ATIUHSHLQCHk^H5 LCHHL 1LH~CZH[]A\A] AUIATIUHSQH?UHw^H=§) Hþ Mt@?I9t L11LHL`A^H=) BZH[]A\A]?1LH`]H=T) B D AT1USHHHʹ HpHl$ HH]H]H]H]H;IH^H{1H%'u\C H]HL$0HT$ 1LpH|$ HD$4HH|$( tH(HpH[]A\]HG Hw8H H)Gh AVAUIATUHSHHpYu>H{pHE HkpHt諌Ls1MfL9}I|H H9GtH[]A\A]A^HLff. HBATIUHSHH5]HHu ~ HULdH7]H []A\0] SLX IIL_M9t H I9uIMYM9t H } I9u LL[OLLuHLuH: H [LLuHLzt @ AWAVAUATUHSH(HH9 I1 IH MD$L M9t H5 I9uw1HD$HEI9D$IHD$L|$HD$Hu(H} LHT$ HD$LHLpHLHT]\ H躊LyLLfL ZIHu HxL [HHtUHfIH \HHHT[tLHL[[HEI9E|HL & Hu-H(L[]A\A]A^A_LHLq[i[L̉E1H(H[]A\A]A^A_ @ IH5 H9uLRL 2 L9tPwZIDHLeR D HAUIATI?IUHSHAPH [H118`HHtXIuHu HHnZMu ZH[]A\A]E1M;l$}JT KtH&ZIZ H H1aUHHHSAPHVH H[HPHHHtHH+HHxHHZ[]ff. AWAAVIAUATL%) ULHSHAQ)=Hg[H5 L!=| HHLADYDH L1<ZH[]A\A]A^A_ @ ATIUHSH HjtHsL[H]A\[1]A\ff. USVH-^ HP z<HZH@ HH9tHjH1 Z[]ø USHH- HP %<H [H@ H9Z Zu H[]H[] H H1HGHt$HD$H H Hf. SHHZHsH;1du H H [Zff. ATIUHSHHHt HՅu!H{ Ht LՅuH{(H`Z1[]A\ff. QHtH Zff. @ ATI UHLSHhCZH}ML$HX Ht_HFL.iHHx HTH L9t H; t HHH hH H9tH9YH Hu1LHӅYHɎ H []A\ HHYHWHwH @ BIIA҃w!HH5$ ot Ixbu Hw H I@I9AtAu0H+ H IAHPI@H@Au H9tH H{ Hr H9XH ff. SHA H HH H H@HH$H HD$PHD$P1LL$H܅XH܌ 1HH H YH [ AWAVAUATIHUHSHH wXHh Hu1H[]A\A]A^A_1L|$IH$ZHD$LhI} ~JL;- tAI Ht HG tLrXuHLLZW1LLH袖ulf UHSHQH3HtHH蓐Z1[]ff. HO HG8Hw(LGH!HHHHMWL HHt+L9t&LIH@H)HLGHHG8HHH9HBff. @ AWAVAUIH=# ATUSHH L@ ՂHWH H=$ I蹂HHHWH HA(IH WLL HHWI` VHT LLV1I9tSHH藬HHVL$HHVH LH0UVLHQH H HHHT$TLLHT$HH[]A\A]A^A_ D HBAVAUATIUHSHHmWHM,$J E1E1{ WH{8 jW{, H{ H5 HLVH| LH04HHVAw"{ t HS0HzVHCPH H{h1 2U&{$ HCptHHHV9AUHDH HHUHCHwHHU{ tHCP1H{hHCp4[H]A\A]A^Hz>DVH{I|$o+AăU{ AƃTH{@II)ME&VHKHHVH)HHH)HHHH9I9H4H)HHs@HU[]A\A]A^{U+UH U1HSHH H|$Ht$Hh .HUH; HUH9uH~HH[]ff. AUATIHUSQH|UHcHHHH]UHH E1HI|$H0 1yNHI.~H&~M&UHނ LH0K2LH ~H UI\$0ZH[]A\A] HBAUATIUHSHAQHTHM,$~4I|$m) U} TAXL[H1]A\A]1 Uff. AUATUHSHL-$ Ld$ LIk h8H; HTHT|$ HH@HH}HH[]A\A] UHSHQ THGPHt3H+G@H9| H{@HH{8HtHk@Z[]H. H 1ff. APHHcTY$a @ UHSQ TH_PHu1HUxHu8HH)HH~HfHnflEHZ[] D RHGH1HH(H8 0H9MTHBH` Hp`X AUIATIUSHX=!) &THl$Hf#TH H@ HtH@Hp HT1H HHSL`H|$HHL(Hq HA1ESH|$HD$HX[]A\A]ff. SZ HS1H[f. 1\ff. USPHoH HZ1[]f D H= @ H H@ H@8H@f AWAVAAUATUSHXLd$0LKT$0SL=7 A T1A8 ֗HHSHRHHSH>IHSIW0H H LgT$0?SDh HLT$0!SHL胞T$0 SHLT$0RHXH[]A\A]A^A_ff. HkSHG0fAT1H5 USHo HHE H[S1H5 HHEH=S1H5C HkHEH SNJ4H5 HzS H5 H^RHHRHHH5 ^HAxER?HHRHHH5f "HAwxEoRH H5} H8 []A\QHG t H @R23HH;RHZUHSHHPO>YHHH[]^ff. AWHAVHAUH@ATIHUSHHHHH H9QA!RHl$ H聁 HHL HHĘ H[]A\A]A^A_ff. USQH>SHGHHh(H8 -HHDž@ HCHx(Hp`H` { SZH[] fAVAUATIԺ UH1SH OHHSLt$HHL蓻HI MeSHt$LBEHHhSL9d$HSHLHݳHe H H[]A\A]A^fAVAUIATUSHXHHoSHLHII1. L苿HHt HHuLL?HHSHuWLH RH]HuLH[]A\A]A^LHHIuMRLIgff. @ RHGHH ff. fL z L | ATIUHSLGM9tM9uqMT$M9tM9u7HLHHRL9tLH>uRH[]A\LLuLLuH oz HLLuLLtlf D H% H% L h >f. H% H% AWAVAUATIUSHH(Ht$B Lt$E1LHH5 H= IF HD$1ΩQ衽H|$LI1LHIHuLI8eQ;LD HsHNx HDe H8E1H(L[]A\A]A^A_LsH袯11 VP H1| SH@ HY QH{[ H?USQH9QuqHH4Hr1HwQH9 HH)ʃ H H HtgHtFHt%H Ht @u @0HHt @Z @0HHt @? @0HHt @$ @0HHt @ @0HHt @ H@pH9 Hyt;H@ H@0L@t L@ HO@0Ht @ HOApI@t @xuHOApI@t @x]HOApI@t @xEHOApI@t @x-HOApI@t @xI@@pH9'Z[]?Hʀ@pPHt @xH@p>SHH t2H{HG(HW`ǀ` H` =HU0O1[f Hix SHH8譬6u1 [ø [ff. fAUATUSHHH y H;BPug=) u^HC(HS`H߽ Υ) Cx H` 苔H{p ! ; VH{p$1) 1H[]A\A]ff. fUHSHQHVH~Hu Het H89Z1[]Vf. ATIH=c USHteHH5v HHH[oHt]1HH5RL H=_ x'H3HH'oHtHo[1]A\H=ts 1[L]A\ $ fAU1 1ATUHSHHxH|$ Ld$ LHVC L;U{ VH{h1. H{8 HCp {, HCx { {$ H{` HC@HKxHT$0H)H9 HK8Ht$ HH HHyHHHDHDH)H)HHHHC@HT$0{$ t H{`w HCXHЃ{ HHC@r H;C`~HC`HH1H{hHCpN"H|$( tL> HxH[]A\A] HtpDfDHC@HT$0aHHHVU#m{ {$ t H{`TLl$01L;kx6{ M 1Ƀ{ Lk`HKXLk@ 1HSH HT$0Ht$ HH)H H THSHI)辅ySfC@=H{P -H+SHs@H9sXvHSPH9HwPUH{P SHCPI97H-UHCPHt$ H{8LHLDDHC@HT$0H "RSRf ATUHSLg HI<$Ht HӅu+I|$Ht HӅuI|$1Ht HH[]A\[]A\USPHs H@ ( Z[H]; ff. SH~HHFH~THtTH H{TH=et $HHzTHHX,HH[ff. AVAUIATAUHSHFTHE1HH5 kTLDHH< AEAT[D]A\A]A^ @ UHSQEΨKTHOr DTZ[]ff. @ HH|$ t |$ HAWfE1AVAUATUSHhHWhHG`G`HT$HWpHD$ HT$LWpH= AHL$HT$HHt$ H|$ uHr H HD$Lt$Ll$LLX Hl$ fHnfI:") $H EtUL%q HI$Ȑ ZHULI$ BIULI$ * UI$ H IH PLH MAUIH5L H1RZYxjfo$LHt$@ Ll$P)T$@HHRjhHbhH|$HtShH|$HSHh[]A\A]A^A_2hSS AWAVAUIH= ATIUSH8T$HL$7_HiTH HH H5 HHmHVHULH5 HtUL=W Hq HLSUH=1 A -HHT1LA Ht$H^ H|$I1gMT|$ tI LDHu3H|$.L 蔰HuD$.A9xSLH5v LɠtH LH TPHٺ Lt$DL$IL ZYI1 MSLpfEt9E1L=# H5x H"RLHRHtH*fH8D[]A\A]A^A_ AUATUSH8 Hj HH8Q HT$Ht$ H|$(Hq H8覷H|$ Ht6L% o L9t*HG @THG t:ͮH|$ HHT$H|$(t] H8[]A\A]1~T S8x H؉W AWE11AVAUATIUSHHxH`; Ht$ H|$ 1HD$@HD$0HL$(HT$0HD$8 Ht$HHD$PLD$XLD$`LD$hHTILt$H1~C1LH E HHm fI:"H )D$ȚIŋE D$ MBTLMdL;-m tWHi LH0+LH'dH%TI9 THtHC0HtHHC0HxH[]A\A]A^A_T AVEAUIATIUHSH$ THTELLHH>H[]A\A]A^ff. fSHH HT$Ht$H|$D?rHtIHHl HX DHHt+H@ t HwHHxHGH9 u1aHT$Ht$H|$H [ U SHHk H|$Ht$Hl HHSHH$+HHbH)SH{ SHl HH0*HHxbHH[]ff. UH5SI SQHk H@ H@H HRHH5p HmHHbHRHQHHaHZ[]ff. @ AUIH5H ATIUHSQHj H@ H@H HRHHHHHaHRH1H LH5 #HHZaHwRHH5 LURH/a1Z[]A\A] D UHH H|$ tD$ E H ]ÉD$ VD$ f QHRHf H9GRH QHHQHQ迫Z D AWMAVAUAATEUHSHHHL$ IHtaPDE1E1AV1HHj t$hb H IEtH训Mt LD$PHT$LMLH ILMHL[]A\A]A^A_ff. AWI1AVAHAUMATMUHH=u SHH5m ARH i SPHLLL HHPHxH PM PH5 H[PH H|$@ DHF(LL$PLD$HH)HHtH+HIWLH̚ZH[]A\A]A^A_ff. fAWAVMAUIATIUHSH8H H;=3h Ht$^P HHrSHR%SPSH`IH SH|$HמIH@SH}H;=g uNH HEMMH9u6ILMM$LIm I ^L^1H8[]A\A]A^A_PRff. HGH@`HSH S|ff. AVIAUIATIUHS HS H!fHnHHSH LsHHC0L L CHoSH[]A\A]A^ USHHAPHe Hs Hh H9uHCHY[]H~y9HHtH{HeHH\HHZ[]AUATIUSH8 W S@HwH SIT$<uiHHZHH |$ Ll$$toL)H{HRID$8HLHI\$0 H 1H8 []A\A]<u<HHE1HA LH[H|H$Lh H HHE1HA LH H@ USRHd HoH@ H9-RHG8HHx ARET HCH H9]RH{ QHH H{X[]ù HHw HvHǝ HHu1HH[f. AWAVAUATUSHL/LgM)LHH9HLJ HG0L)H9| H[]A\A]A^A_L8HMYSH M)L)HLHL$LuL M)L$HDSM)J HHE IL$HL$HULuH]0M SIL}8HRHH MRLH Cff. AWAVAUATUSQ !HRI!HHRHb H8HS HHSHHH5l }HAYEuRHb` Hc8jHHbRHHH5_ <HAaYE4RHi] H8HgR HH HHH5^ HAYEQHa Hc8HHQHHH5^ HAXEQH] Hc8HHQHHH5| pHAXEhQH_ Hc8]HHUQHHH5G /HATXE'QHD` Hc8 HHQHHH5 HAXEPH;a Hc8HHPHHH5 HAWEPH_ Hc8HHPHHH5 lHAWEdPH] Hc8YHHQPHHH5 +HAPWE#PH\ Hc8HHPHHH5M HAWEOH[ Hc8HHOHHH5 HAVEOHf^ Hc8HHOHHH5 hHAVE`OHM^ Hc8UHHMOHHH5 'HALVE OH` Hc8HH OHHH5 HA VENH` Hc8HHNHHH5a HAUENH^ Hc8HHNHHH59 dHAUE\NHI^ Hc8QHHINHHH5 #HAHUENH] Hc8HHNHHH5 HAUEMHg\ Hc8HHMHHH5 HATEMHH5 L{MHTH\] H@ LhIm(HHzMHcX HIHZMHHH5 LA?TE4MHc\ IH MHHH5V LATELHc` IHLHHH5p LASELHcd IHLHHH5; `LASEzLHch PIHbLHHH5\ "LAGSE<LHcl IH$LHHH5/ LA SEKHcp IHKHHH5 LAREKHct IHKHHH5 hLAREKHcx XIHjKHHH5 *LAOREDKHc| HH,KHHH5f HAREKHH5M LxQHQI .HHJHH5 LJHQZL[]A\A]A^A_J{J AWAVAUATUHHSHH H OHNHNHNHE H}HD$D$$kOLeID$ H}IHSOHLIHD$PLH.OHE HD$H@ NHE(HD$(H@ NHC Mt$H8L艖HHM1fLpPHP@HP0@ MZ LE1A HtYHt)ID$H8@ HMEXA I9MID$J< HvMBDXII9{MID$J< HLMBDXI9UMIM9 ID$J< HMBDXI9"MID$I_IH< H DXI9LID$IJ<c HLBDXI9LID$L{J<9 HLBDXI9LL{M9MHܳ'HYLHD$H;jX UMH\$pH|$1HUHHL$4Ht$8IHD$pfHLH|$p HD$H HE0D$$E8HD$HEHD$Hx dHEPHT$H}XHH?KH9KxKHp KH H[]A\A]A^A_HsH HE HD$(Hx ~H HE({gKK ATIUHSHHHt HՅuH{(1Ht [LH]A\[]A\ D AWAVAUATUSH(H9)[HHH-H II 3 I @D I H9F HP w< HcL HH˃H([]A\A]A^A_H9ZL@L맾 H % L$H9jZHD H)HDL$L9YHpH9YHx rH9XHx9rXJtLH|$XDD$H|$A@HH9XL$L@ 5$Zq HLL H9YL@L9qY H9YHً2H)Hʉt$HH9XHHH4LHHL$ [XDD$HL$A@HH90X8L@w&XL H9 YHދ:H)H|$HH9`WHPH4HHT$L kXL$HT$A< MXAL1H9WL@K?HH9WH9WHً2H)HH9WHHLDH9VHp JH9}XHpH9hXHxsX5X/X L9@/W1 ItLLHL$LD$~WDL$LD$AAIH9W:HzVH9VHދBH)HH9VHL$HHHx HDH9 H9zWH؋2H)HH9eVt$LBEL9pVH9VHpRH9~VHx LƉH)HH9VL LLH)HH9wV1H9TuV9rLH9hVHً2H)Ht$H9UHHH9jUHH zH9RUHH9z=UH4LHHL$TDD$HL$A@HH9fT8L@mdUH9CTHً2H)Hʉt$HH9 THHH9HL$TH4Hx LSDD$HL$A@HH9 T8L@ TH97U: L@ UH9S2HHL9SH9SDBHH)ApHH9SDHx DD$HtLHL$HL$DD$t`SA@LSHH9D !HLIpLD$H YSLD$Ax LSA@HH9{SHڋ0H)Ht$H9ZSHHH4LHHL$*DD$HL$OSSSTf D USHRHoH@ ~TH H@ XH[]jFf. SHH Hu!H{(Hu%H{0Ht 1HC06F1[1HK 'F1HS(F UHSHHQ/ BTHtHH Z[]1ff. H SH HD$D$ /U1H [fAV1AUIHATI̹4 USHHH~H?H9+UHILH H UH 1HLC(H{(HT$Ht$LH +]H L$AVH MTHT$I9LOHTHT$H9HOHc$fnHCHǃ Hf:"fփ IHHHHKHCIE Lk LcxH HL[]A\A]A^ÅlHI H5K H8yH 脅1H{( H t H{(E1HI H5K H8yff. SHHF S~ HSH~ HH[陒HCH5K HPHKI H81H1[Ð u[buA ff. H H; ~GHUSHHQ H HH HH]H H 1Z[]1f D 1f HHGHtHuH鴑H= ] SH( HuTH{ HtH/t<H Ht1H H f Ń1H [HGP0H((f D SHH Ht苃1H f [ D AUATUSHQ P =p ]{` -]HDcVHHuB{` Dc]H8HH]Dc1ɋ P HZ[]A\A]H脖{` Iu HeHt1LHHɘHHu\ff. AVH 'l AUATUSHHHH H HD$PHD$ P1LL$ LD$(YY^#]H|$ 2]H5 l HH\L` M\H|$H;=KJ \h \H9J H01HH\L-U H IH\1H0 H\T$fHnLh8LpHP@HT$@fHHPX1HPPHPhI$Hh`HHPpIT$HHPxHT$HH H []A\A]A^L- 1Uf PHװZHcn$ff. H AWAVAUATUSH( HT$H `W IHm` N @ I@0HD$ I@AHD$AH:\Hl$`1Ht$ H LD$HDŽ$ [H|$LD$H[H5 LD$D$HAP 6[@s H$ HMhy[Mx0HL$`K/HD$A R[@[Li0LD$0Lt$XDd$(MHl$8LHD$I9s~A<$DAB< <uL1HHT$XH ZH|$XH;=G w H AD B< <A AE IIxMLD$0Dd$( Hl$8HD$`p @ Z@@ZH0LH)A@ H$ Z@ZI@0 HrH( []A\A]A^A_E11LD$8EE1HD$L$ MLt$(ML9|$~NHt$ LD%LHމA x H$ HuNDHX IH|$ Lt$(YMMZHqII@HHD$ <H;F 2ZHBH Y YHHHT$0HT$0YHM<mHGH uZ Z XH LD$0Hl$8MDd$(T$(LD$;LD$T$()MI)T$LH|$@ H|$@T$LHR\AΈ ;|$H \\BƄ< ;Lt$(X1H|$@T$LIJH|$@[T$LLD$0MHl$8Dd$(LD$T$(6;LD$T$(j\ ATIUHSHK\HHHhHH:Hu'HaB H8I\I,$1[]A\H;-2D tHEH u u[HH= v[ D APHHHc[Y @ Hff. AWAVAUATUHSHH(L%B M$@ LFHwI9t^IH`HV`HtQHH9AhuDH[L|$H9Bh LI$t LHl$H\$qH([]A\A]A^A_HF`H[H^H9PhtL-1? IE 6[L- ? L|$1D$ LI$\ LH\$Hl$L9up[LFZD$ L-> L|$ AVAUIATIUHSHHA HT$ H^ L@ ,HHt-|$ B[HMLHLUHHH8HH[]A\A]A^ H9[H~H A Iy(Z黪HcAH/u AuH~Zf WHGZ 1Y @ @ ff. AUATUSHH 苁ILIvLsZHC Hx@HHyZLHZHCH|$AHvZHC H$ HHZHC(H$ H$ZHC0H$ HYHC8HĘ H[]A\A] AUATAUHSHAPHjHP AD$wLHEH9uCH9tkE89C8 ZEH9CHYHSPE1H;UPt,AYIcY[]A\A]\HE< H Z[]A\A]HHuXH{Xhu}Y1A@ AVAUATUSHH8H{8IH{8IMIMeYM\YHC81HHPpLjL≰ { LhpF,YHC81ɾV HHPpLrLpp M^XU HHcXLHjFXHC8HPpLb1L`p []A\A]A^ff. USH(Ht$H|$H8H > H@ H HHt3H Ht$1H HD$tkHH9X5H HHt3H Ht$1H HD$-kHHW4H$Ht$H|$H([] AWAVAUATUSHH P =p <X{` "XHDcHHuG{` DcW HXHHuCDc1 Q H[]A\A]A^A_HHHtHH1C1HxHT$H L{0Lt$L,$I?HtLLstIH}ݳHHLWH虿HH8WMU DM DE Ps ZYH23SHXHG RXHG H_HHuHvH9hX1[Hff. Hw(H1H= ff. AUATUSHAS P =p Y{` XkP A=p ~X HVHZX{` Dc@X HVHuq{` DcY HVHX {` kWXH[ HSX{` k9XH= HXk1W H賎IH3W D USHQ P =p X{` X HߋkUHu"{` kX HUHuk Q Z[]ff. HwHǸ HMff. fS?rXH_H5F Hk^XH5 Hj[f փf D AWMAVIAUATULSHH(` HD$`Ll$hHt$HL$H$XC` I HW{< G H<$LSIHXHx W{< Hc L9 HpH8H9"XH)HqI kIMW{< A Ht$L HHWH~!HLHD$d HL$HHdWHLMMH= H P1UZYIH3WH¿ 1L LHu/H WH|$H?LW/HO/{< twH(1[]A\A]A^A_H<$rHx IlHHqVHf-stringfB: H<$HHT$SrHT$H4$HHB H$HBD" SH<$p{HcC\H)D$H)H H D IMH<yVHVff. UHSQH8WHHqHHHG HH9HNHHWHX .HZ[] AUATUSHHHH WHHT$(Ht$ H|$H HuCHSHHDhLd$8Hl$0 <VH;LHkuHT$(Ht$ H\$H_VHHH[]A\A]x SHH?HVH{Ht HC H9u1HCHC[in AUATUSHH(H2 H8tu%H1 H8aVH([]A\A]L- HT$Ht$H|$Ld$L{HH%VIH3 HLH H01V H~,H|$Hto,MtLb,H|$HkVff. @ ATLfUHSHmUMt#IH}HUHCH HEHHU1U D ff. SHvHCH[H@ ۂff. ATUHSHLfݴUM HEH{HH HCHHUI H} lHHAUfHCpHKXHChHSPLKxPHChLC`PH5Z 1sZYTHCPH HCXH HC`H HCxH HChHtH HCpHtH H*H{h t H{p T1[]A\ff. AVAUATUHSHHb3 H@ L`H_H I9$ ~#I$ HHD$Ht H[]A\A]A^Hm HmE111HHgHD$H H|$I9$ ~`HD$I$ HMt$(Lo I H]HyI HCI HIE I z3 H,I$ H9HLH4 HHSI$ HH)H41HHI$ I$ =jSff. fQH bHMSHǾ Zff. SHqh- CS"S1u'Ht$ HH)H HuD$H[AWIAVIAUI)IATK6UHSHHHD$I IH ~"SKDLHp^#SII9|LcIHSHHITHHHHHQH9|LL+?\SL (L L+H[]A\A]A^A_H|$ 0SH9}<MdLI4$> SIt$L"RH|$ /HH|$ SLi L{P E1j E1 L@&ZYuR D HHH ͞ff. fSHHHCH[HY AUATIH~USHHFHRHHRH H H$ H> HoH5,RH1 H5M HC HE } HIHt^HHHHE HoH HtzI1LA$0 HQLhHXHh H[]A\A]HtHH HE 1LA$0 HhQIкHxnH%1LA$0 H.Q1iH4" HC HIHt%HHHH- Hh Hh <1H#H- Hh HHh Hh HH- E1HH HH Hh Hh mHu- HHh HHoHtH3tFHEH H=- HH HH HE ~E1HH OOO AWAVAUATUHSHH(L%, M$@ LFHwI9ueHF`HOHH9Px L=k) Lt$1D$ LI$q LH\$Hl$SoL9 H([]A\A]A^A_I@`HtH[H9PxuHF`HiOLt$H9PxubLUpt$M$Xw LHL ODOD$ L=( Lt$THCH9Et<L#|$ t)LI$Xw LHl$H\$n?L=r( IL,f D AWH AVAUATAUSH H HDH H|$Ht$ HD$0H HD1HL$`HD$(G HL$XOHL$AAHiA / HL$LqH@ HPHD$pHHHD$k !IH 11ۉT$ AILH9 HLL[D D9rII9}LLDm D9s1I9|$ $ uH|$ L\$8SL\$8D$D$MHT HcHHT$H|$MLHHL\$8L)H$ / L\$8HI L0H|$`HkNH|$XHOH|$LHĨ []A\A]A^A_L9 HLD # IHAGLq0uLL$(HT$MHHt$0H|$X H|$UH|$`HLH|$XHth 1dHT$H|$MLHHL\$8L)H$ Ƌ L\$8HIIMcLAUIATULSHAQB IAAA NLbH@NHE1AIH9}?HLe = v= HHH LH)L9-NIHLLLEHH NH9 HLD\= H5G* AU H>QH>QH>QH>QH> HyQLAQHHHOHG7= w AxH5) HyZH[]A\A]H5) Au H>HyQLAQ|S10 HMH1fHC(CXHCHLH[f D S1H0HHHg$ H=`P) H% H1H1HCP) $NO H0[ D S10 HLHHS fHnH_LCfoE 111HCC(fo HS8H C@H[ff. SHGHH L ZHHLH[ S1H0HHH=N) H=N) 1HN) H=N) 1HN) H=N) 1H N) H=N) 1H5N) n1H=N) H=N) YH=N) E1LN) CH=N) E1L N) -E1E1H1LN) D N) H0[f S1H ޚ HfHn1HHH0HD$H$H\ fH:"HL$ )D$Hu<HGH2HGKHH{ HC@'KHt$HJ1H0[1HL$LD$IH 3JH<$H;=$ tHJ D S1H0HHNH=M) RH1(H0[fUSHVH# H@ H HJHd&HHJ1H~}HJH H~ H HZ[]f USHQ P =p gJ{` JHߋkkRHZJ Q Z[]ff. @ ATIU1SHH;k|H# H []A\HtL1 uH1 PH=" z1҉L) Yf AVAUATUHSHH9 JLFIH5*! I9 L j M9 Lf LLfuLIHu [HHRIHrLHHuLZuHuHMHE1HU H)HH9 H[]A\A]A^ID$E1L$HH;E I$Lt$I+HD$HHHPHH?!IHIt$(I|$ LLzxuLYHQ H H4 HHMH[]A\A]A^LHIHcf u f. % - H fHn P:ZHxATIUSH H-V H} eHH3IHP! H HI $1H []A\fUSHHHHHT$w&IHHC Hu8H{Ht$'IHkHC 1@H[]H9kuHPH9dIH HS H fAUATIUHSHASLoH LHd uHQIHHt$M4IAYLHH[E1]1A\A]H A SH7HS H+IH9C!IHBHC Hu1H{HCDH H [ AUHHATUSH8HHHYHRE1L 1HD$Pj j $,H H5IHIH(H L`M"IE1HHH5 H HH5{ L HH5s L HHt HH@ HXH HH L HH L jHH H H8[]A\A]HuHL`M*ZHf. 1HuS{H[ @ AWAVAUATUSHH P =p zH{` Hk9k Hw9HHSHcŃ{` HDhD`HH}IHt H8HuZ{` kfHH~HHt! HH[]A\A]A^A_Ék1HSHcHDhD`H){` IusH{YHHG@ Dz HLLHk D$ qHHGPDD UDD$ E sY^HHIMG Hu1UHSHAPH? u1HE HGH} HY[]酺 D HBATIUHSHHvGHHu H [L]A\ HUfAWAVAUATUSQH~ HLnHHIE1E1H IUH9 HLǃG1H0 HHGLhL HIE IH?GM@GHCMFHt?H} GHE Hk H{aIHtH HC8ZH[]A\A]A^A_=HC H{ wFff. USHQ P =p OG{` 5G Hߋk6Huk1 Q Z[]HHuf. AWAVAUATIUHSH8GHtGL-G HL9hu+Hx u$ID$L9Q H; H; tyLIH GL9kt' HHLFaLAEFLIHuH LH8H[]A\A]A^A_1 HHD$(IkD$HHH1HHHHpZFL|$(Lt$Ll$ LLLLJtHt$ HT$HHHHE etFLIH9HHLmLAEyFIkD$1ҹ HHT$ HHHIT$ HHHz HҍpEHD$L|$(HD$Lt$Ll$ LD$LLLL"Ht$HT$HHHHE &dt<EUE UHSH(HT$Ht$H|$H HT$HH` (Ht+|$HHHAHHEHHT$Ht$H|$H([]λff. AWIAVAUATUHSHHXHZ L@ HG Hx t HXHHH[L]A\A]A^A_ II?MH HCLxHpM Iu>Hy9H@L}IMHULHEHsL}IHXL[]A\A]A^A_K9HDHT$ J HJ HHsKL= LIHCHXLH[L]E1A\HA]A^A_{LI5fH@ 1H?HF8@ AUIATIUSHQH H lHHDMuEH{L IH H{HLdLH H ZH[]A\A]ú LHvVDH{LR IHuLDH{HLD3 HHt H{1HHH DDf D H$DHDUSHHHoHEhHDH@HCH[]ff. @ USHRHoVH0 2DH H@ XH[] f. SHHHt 1Hs H{Ht 1HK H{ Ht 1HS H{(Hu1[1HC( f D H16 f D SHHHHHHuH{ H*DH[H $HT$H $Ht$tD AVAUATIUHSHHHt HՅ LkML9 H{HHt LՅ H{XHt LՅ H{pHt LՅ H{xHt LՅ H Ht LՅuqH HRC[LH]A\A]A^I~(MmHt LՅu1I~0Ht LՅuBI~H2LՅ%BBBBBBBBBff. fATIUHSHHHt HӅuI|$HBHH[]A\BfATIUHSHHHt HӅu-I|$Ht HӅu I|$ HXBHH[]A\IBDBf. AWAVAUATUSHHH Ht$H@ HTBHChLc`f1C`HD$0HCpLd$8HD$(HSpMAIH HL$(HT$0HHt$8Ll$(H-- I9ICM6CL|$0H I9EuLL膽L|$0BHD$8HD$MBH=O<) zIHCE1HD$HHDH MIFHIEH MIF HIEH MIF(HIEH IF0HD$HHDH H{` IF8BH HH |HH@HD$M1HH H5 P'AHL$H9AHLHL$說LHoHHL$@HYH|$8HtJH|$0Ht;H|$(Ht,Mm@HHH11[1]A\A]A^A_Ho* HHH1ɻHD$(H?Hff. ATIUHSHHHHt HՅuTH{PHunH{XHu`H{`HuRH{hHuDH{pHu6H{xHu(H HuLHH[]A\u.A A)A3A=AGAQA[A D {=ff. AUfAnATfA:"USHfnL$@f:"L$HflHBHH)BHH|$PH IA)$gHAfo$ HhHXLhD` @8H[]A\A] @ AUIATUSHHHo(LgL9c RBH[0H9~ 1H[]A\A]I|HtHT$HAHT$uH @ SHhBH=( IHB1LI@HIXL[ff. AWMAVIAUATIUSH8L-z H|$I HT$LD$GHk H- HH9X LD$H I9M!M I9 HH=i + 1HL66 HH=j I9tMtHLB M I9 IPo L) IH H@ I L Jo IXn LJX L H~L3 ^HH= ? L/IH H@ L H"L HD$H9t6Ht1HH= H|$ H HH=;i I Ht$(1H H\$(8HHtV|1HrH8[]A\A]A^A_LYH|$111HH=z *0+L LH|$111HH=2 H|$111hHH= H|$111?HH= h HLPHH=s \14P HLWHH=| !1H|$111 SHHH> >}fHtH+CH>[4>ff. @ HHm H|$Ht$Hp mH D SHHHt$ IHtH= w H[lHt1H H5g H85 SHJ HCH[H@ SHHHHt E1L[HH{PHt E1LSPH{XHt E1LKXH{`Ht E1LC`H{hHt 1HshH{pHt 1HKpH{xHt 1HSxlH H=>H[铇 SfnfnHfA:"f:"LϾH flH)$ΕHtfo$ HX@8H[SHH~ H =HtH)[H[ÉHHHH9s8uSH臬HtHHH[ÐHG(Ht1RHO(H1^1ÐHHH9s"0HHV"wH5 2 HcH1H9ZEHPH9QEH H9FEHH9;EH9v1EHH)H EH${HsH9D1HHHH)H D1L9DHH uH H H)HH9DH f D USHHAPHo H9u HtvH H9FtY[]P ^[]kHtGHHHHDH10 HHDEH@HZ[]H HH _f[] AT1 USHH`Ld$LH{H taHZjHHADHHt$q HHt$IHL Ha LH%H]H`H[]A\é t.HsH{ IHL Hga i LHޗH5 耆C1LH軕vCHt$ H|$Ht$qHHx HAtCf. AWMAVIAUIATMUH_ SHHDHu HLHHL[]A\A]A^A_H}8HHIHH1LA@_t%HLtP<_u݃0@ w Iރ0< vY<LL1H H53 H81IHH[]A\A]A^A_HH9u@_t H)LH|$HAH|$H;f D UHSHHH9seH uvHHH9sHi u1Ht$W H9l$u(f. zt _H[]cHt1uH HH5 H81m1HlAWAVAUIATIUSHHTD1҉H|$D|$DfD9HfD$l$Lt$HLwhfD|$l$H;\$tnU HHD$Mt!H9t`" I$H[]A\A]A^A_H98H8 /H"uf(fT f/ rMtFHLH] H HH5 H81` HD$|f(fT f/ Z bMYGf D AUATUHSHR<-tHIE1<+ H5^ L u3H5O L| uGH] X[]A\A]LgA I\$H5 HD u& Et DI\$I\$Lglf. 1t L HEA9t1fUSHHHHHMH~2HpMHHdM1HH7u HH[]GHWHPA LP 1HD$Pj j_ H HHu)Mff. AWAVIAUATUHSH H;5 MHLl$P1LHא H|$` Ld$Ph H 1H$HD$Mn1L9IH MHx MHx(I~ LIv(HT$IEH MLH L1Ƀ HtrHt\HtFHt0HtH AHAHAHAHAHAHL9t{HQADADDADDHJADDADDADDADDADL9uHoK`K A1HHWH KE1HĨ L[]A\A]A^A_1H$ Mt7EDHH= uH $1H9~0DHBDŽ H$ HH= uLHHJH tHHT H5m H8)L5;uHIu#Ãu'HMHJH9sfHHLHJ H9sHf. HSHWHB`HuSH@8HhS SHH?HtH{HtH{[4 H @ GfW 鞙ff. QIH5 H}SI@H@Zf. 1SHH1PHHC[ @ SHHSRHSHz R[ AUATIUSQH-I\$HI=6 HHH)HHH9RH| HHRI|$ O ID$(' H " "]R'DHH9r1T HAT uHH; :HH@t @yHH@0I|$ A I|$(1G<'Q<\Q< < < p@^wRHHH9|DHqH u!HH)舕HHZH[]A\A]HHF52 L HfqMA42@qI1AxH2 H=& HAN HfA: HfA& HfA AVAUATUSH HPHGH PLmL軨IHP1tHPIT$HHI9L;mP1Ll$H\$E1HD$Ht$'ID$J0HD$IH HBHD$H HB E1LHHuH L[]A\A]A^f. UHSHAPHG@ u*P Z[]ËF,H PF(PH DN$DF HH Y^OHH*OHӯOf USHAQ4 H{Ht E1LCMHO1H Z[]f ATUSHHLgM}OH; u1HHsOH{F HHt4H{11L.JBOH;HH[]A\)O D UH1H={ SP|HHHvHHHZ[]ff. AUATIUHHSH8H H HOIHOMtkH] H HC OHHt$HHtOHQ1H;D$KOI 1H8HL[]A\A]b1H S PHE1L 11HD$(Pj jHt$(H HHNLl$JLiIRHE1Lu 1HD$(Pj jDH HHNH}HG NHt$ HNHHD$j0H;D$NHT$HH R D HGHNH@ff. G N@u H5i Ը 1}ff. f1 L A HH9|ff. @ AT1 USHH Ld$PHL HHNH;1L݅ C LNH{1H貅NC HmqNHD$H9D$`BN 1aHHBNHp 1҈T HH u1H;D$`}H$ HT$PH H|$X tL#H|$ tHHĠ H[]A\Mff. @ ff. HHHu1Hff. ff. USHRHoa5H MH{ H@ XH[] g8ff. fAWAVIAUIATUSHHO@Hp H HHIH NH{HHH=HtTHPHHHLh0HQHJHSHCfHnHBfH:"@HCPIE HL[]A\A]A^A_H:MHChH{XLL2IHU H{HLH~HM ~HLH{HHC`H9G}bH{xIsIHLL` H{HLHHh(HLh0 LHCLsfHnLpfH:"AFIE *LsI9tIVIFIv(H HBHPIV #OH;t ITLHKIF(Mf LLIn(H{HHH$IF0Mn0HD$+ KHCLsLfHnLpfH:"AFIE H<$H|$vkHiE1[HYN @ USHQHoH9 HGfHn1HPGH{HHt E1L[HH{XHt E1LSXH{pHt E1LKpH{xHt E1LCxH Ht1H H Ht1H HtH]HHZ1[]1Uff. AWAAVAUIATIUSHHHHFHuNHE1 Hu1HkHEH;z t H; uHE HHH[]A\A]A^A_HHLz MtK?H|E D$S"HHt1L[D$1HL$(1E1I9~ HTIHHJT ބtHD$(M 1E\I9~'HTIHHRHJTLHnM'1Ll$(HD$(HD$0HD$HD$8HD$HL$HT$LL|HD$0IH@H JDHD$01IE HD$HD$8HT$(HD$NlILl$(HL$HT$LLDD$ L $L $DD$ HD$8H JDHD$0IH JDHM|nff. SH_ H{Ht 1HK7H;Ht 1H%H{Ht 1HC1[ff. fATUSHHHHI11LSH8A t MI)DH@ƋM~@t t HA9tD)[]A\ff. @ HHHO 1HHH H H9O Ht,9 ff. SH_ H;Ht 1H3)H{Ht 1HKH{Ht 1HSH{Ht 1HC1[f ff. Gvf D SH7.HHt 1HCHCH[H@ fSH_ H;Ht 1H yH{Ht 1HSeH{Ht 1HCQ1[ff. fff. H= t @ USHQ5HMHPH5r HHOpM H5o HJTM H5n H.8M H5` H MH@ H5. H$OLH H5#q HOLH H5q HNLHH H5p HNLHx H5r HNLH H5r HNhLHp H5r HpNJLHUXH5r HUN/LH H5r H7NLH H5r HNKH H5r HMKHUHH5zr HMKHUpH5\r HMKHU8H5Kr HMKH` H5<r HMfKHUPH5 r HqMKKH H5r HSM-KH H5q H5MKH H5q HMJHU`H5q HLJH H5q HLJHx H5q HLJH H5q HL|JH H5sq HL^JHU@H5}q HiLCJH H5{q HKL%JH H5dq H-LJH H5kq HLIH H5pq HKIH@ H5q HKIHP H5Nq HKIH H55q HKqIH H5 q HyKSIHh H59n H[K5IH H5p H=KIH H5p H KHH H5p HKHH H5p HJHH0 H5p HJHH H5zp HJHH H5/ HJcHH H5Tp HkJEHH8 H5:p HMJ'HH H5%p H/J HH H5p HJGH H5o HIGHUxH5o HIGH0 H5o HIGH( H5o HIvGH H5o H~IXGH H5o H`I:GHh H5o HBI GH H5o H$IFH H5o HIFHUhH5o HHFH H5o HHFH H5oo HHFH H5Yo HHkFH@ H5@o HsHMFH H5'o HUH/FH H5o H7HFH` H5n HHEHP H5n HGEH H5n HGEH H5n HGEH H5n HG{EHU0H5n HG`EHH H5qn HhGBEHx H5^ HJG$EHU H5n H/G EH H5tn HGDH H5 n HFDH H5m HFDH H5n HFDH H5m HFsDH` H5m H{FUDH( H5m H]F7DHp H5im H?FDH H5Rm H!FCH H5:m HFCH H5#m HECHX H5 m HECH8 H5l HECH H5l HEeCH8 H5l HmEGCH H5l HOE)CH H5l H1E CH H5zl HEBH0 H5el HDBH H5Dl HDBHp H5,l HDBH` H5l HDuBH H5k H}DWBH H5k H_D9BH H5k HADBH H5k H#DAH H5k HDAH( H5qk HCAH H5r HCAHX H5;k HCAH8 H5+k HCgAH H5 ? HoCIAH H5D HQC+AH H5j H3C AHh H5j HC@H` H5j HB@H8 H5j HB@H H5 HB@H H5j HBw@H H5oj HBY@H H5`j HaB;@H H5Pj HCB @H H5?j H%B?H H5Hj HB?H H54j HA?H H59j HA?H( H5#j HA?H H5j HA Z[] H \? o?HG Ht$1H HD$Ho H Hf D E?H H1HGHt$HD$H) H HHc? ]ff. @ ATIUHSHHHt HՅuHH{ Ht LՅu6H{(Ht LՅu${KH{PLHXDu H{0Hu1[]A\[LH]A\ AWAVAUIH~ATUSHHFHm>HHHHc>HH H_HHH H; L` HC u>HwHH>>H?>IM9g>J< IL9>H< oIMe>H\>1L9t IH1H9tLH)IH1LA0 HG>1HhHP(1L9LpLx HX0P8H[]A\A]A^A_HHHtH]I L1 D ATIUHSHHH?H(H{ ?{ ?HH[]A\Hl? AWAVAUATUSH8HG8 LgLG H_(LhH$Ho0 IH6 Mi H;l H{HLD$IHB IF(HdLD$Hl$ J H]ILLLt$(MHD$IEM MHL$HD$H ID IyHpIt Hu<HT$IiL)H9\$HLL'HHD$IH(LH)ID HLIyHl$ H)L,$IH IIH:H9}"II|IDH IDHIH8L[]A\A]A^A_H IHt,IF(H $1H9}IHDH IDHLt$(AF8 E1H{ tIH: AWAVAUIATUSH8H|$HD$ H HHnHH9 >IHB IH=L IH=1H9}CI|H 1IDI<HHk1LHDH IDI4HL9|HD$1H0 H=11LpL`HP H(H8[]A\A]A^A_H E1HD$ LD$( HH HHL$ LD$HHx 1Es7=HHl$H<t:H1IuHHH9<ILLL9<HE11LLQ13f. SHHHt)H{ HtH{HtMHCH[H@ ff. SHgHHtH{(HtH{H{ HCH[H@ USHRHoH(HtH{0HtzH@ XH[]ff D U SHHHl$H% ;Hھ H͌H[]f D ATUSHH { - D$;; t&HD$Ht$HHH9u1H []A\HHff. @ HG@ =HGH =H ATIUHSHHHD$H=H~I<$Ht$ٲt { Ht$~ HH[]A\=<< =H HH off. @ AWAVAUATUHSHASH8 l=, 脊 { 4=ILcPHC@IL{8I?It`I)II9KL L HtFL)LHpHAIHt HC@HDHC@ZL[]A\A]A^A_Et<IE1I9<H{h1|3<q1HCp$IH M {$ tHBHH<III?HCPHFNIH<H5 EtH9LOH{8J?HH9 Hx uH)HH@IHb<Hk@LLqE;H LHh# ߆LI41H{hHsp~L HGx >;LL @IH;HLq;LLc@E;L?IH;I98HLp:LH;H< LHh# E1H{hLCpI~(i:: H ֭f D ˅ff. G(uHG@u H`GE D PZHk H Zff. fG(uHG@u Hc\Q D PH H5 H81Z D H=I @ U1H5n& HSQ; H5r H; H5r H; H5r Hk; H5r H|O; H5r H`3; H5% HD; H5 H(:H11H=Pr HuiHH:HHH H H5%r HHI:H HcSHH:H3HuJ\HZ[]ÐHGH8T @ HHwAH Hq D UHSVLOM MAH5 L:QuiA H MEHt LHH :H@ 9HEH=Gq HH1wHHdHZ[]HEH8Y[]鎌ff. HGHpH8AV1AUEATIHUHSHHH HD$HL$HT$HLD$HD$x9Lt$IF u8LD$HL$ELLH "9H Hc[]A\A]A^61I;^}0ITLD$ELHL$HA 9u HH H H []A\A]A^H H f AU1IATIUHSH˹ HhLl$LHB Hr HRI98IH8AtJLH)H9|GH9BLH)H9HLI)I9|-I< wu L[` Hh[]A\A]H)H9}L;`11LLDL$ L$!^48Ht$HT$ DL$ L$Qۀff. UHSHAP1H8H7YHH[]f. HWH Hg H HGHTHH2HHHpHJH9rfH= @ @ AVAUATUSYH8H貊HH7HH5Mn HDH7 H;n HH t>2 H#n HH H>q H n HH >* Hm HHx =u Hm HHY =- Hm HH: =3 Hm HH l== Hm HH @= Hm HH =& Hnm HH < HVm HH < H=m HH <K H%m HHa d<D Hm HHB 8< Hl HH# <W Hl HH ;' Hl HH ;i Hl HH ;G Hl HH \;B Hl HH 0;w Hjl HHi ; HSl HHJ :( H;l HH+ : H"l HH : H l HH T: Hk HH (:Z Hk HH 9a Hk HH 95 Hk HHq 9p Hk HHR x9` Hk HH3 L9\ Hok HH 9 H\k HH 8 HCk HH 8M H0k HH 8I Hk HH p8j Hk HHy D87 Hj HHZ 8l Hj HH; 7, Hj HH 7P Hj HH 7@ Hj HH h74 Hvj HH <7 H]j HH 7H HDj HH 6 Hj HHb 61 Hj HHC 6[ Hi HH$ `6 Hi HH 46 Hi HH 6r Hi HH 5d Hi HH 5v Hi HH 5 Hsi HHj X50 H[i HHK ,5T HCi HH, 5 H+i HH 4L Hi HH 4 Hh HH |4! Hh HH P46 Hh HH $4o Hh HHr 3 Hh HHS 3] Hh HH4 3 Hzh HH t3c Hah HH H3+ HPh HH 3F H7h HH 2E H h HH 2y Hh HHz 2/ Hg HH[ l2J Hg HH< @2 Hg HH 2R Hg HH 1 Hg HH 1C H{g HH 1f Hdg HH d1n HOg HH 81 H:g HHc 1 H"g HHD 0z H g HH% 0< Hf HH 09 Hf HH \08 Hf HH 00O Hf HH 0 Hf HH / H}f HHk /# Hdf HHL /k HMf HH- T/Y H7f HH (/Q H%f HH .% Hf HH .x He HH .g He HH x.e He HHs L.t He HHT .? He HH5 - He HH -X Hpe HH -V HZe HH p- HDe HH D-" H,e HH -S He HH{ ,. Hd HH\ ,h Hd HH= ,b Hd HH h,_ Hd HH <,N Hd HH , Hd HH +$ H{d HH + Hid HH +U HQd HHd `+^ H;d HHE 4+> H,d HH& +; Hd HH *# Hc HH *m Hc HH * Hc HH X* Hc HH ,*s Hc HHl * Hc HHM )A Hyc HH. ){ Hac HH |)| HLc HH P)L5>c } HHL $)~ H!c HH ( H c HH ( Hb HHq ( Hb HHR (L-b HHL0 T(L%b HHL (( Hb HH '} LHH '_ Hvb HH ' LHH ' LHH g'H1[]A\A]A^ @ USQHoHE H .H = H9-HHHE 1-H蜲HHHHZ[]ff. AUIHATIUSAPxH-HcH4;HH-HHLz-LHHd AHHZD[]A\A] ATUSHH ]-HGH;Z H-HD$Ld$1H H LHȍ HH'-H@ '-1HLHH5` I,H$HH aHT$HHT$E -H4$H=C_ 1X]H[]A\ff. @ USVH,HG -Y[]ff. H-HG ,HW1HuHuGH,H 1ɋtH H HsHf D ATUSHHPH?H HH,H? H H9GutI1HLJ,HHt$HhHH)H9q,HHTc,HH4$HL$HD( HLKHP[]A\HjAH;HHP[]A\ǯ HH} H|$Ht$H{ H D HQ SH@ HGHP0HGHH H Huۃ [f. H% H% ATIUHSHH,1HHHtXH|P[]A\ I4$HtHzHy, @ ATIUHSQ2H,LH-2H,HCH2H,HC H[]A\ AWAVAUATUSH(LwPH|$M IF ,-AF ,@ @n,Mn0MfE11HLH /LDI9M\,HD$IHxXH H7 H9G Ht$ cHHD$HpHH,LH= ] 1^HL袭H(H[]A\A]A^A_HXHt1Hж H9Gu$Ht$ HHD$HpHHt+h+HD$HxHH1,H([]A\A]A^A_+ ,+fuà ,V AVAUATUSH,,HWH;| H ,uH;3 u[]A\A]A^\ []A\A]A^` H; t@ |HH HH HIr[L]A\A]A^Lo1Lh"IH E1M~L; Ht]Ht,H}1sH+H= +AD$ A J|1tsH*H= *CD4 IJ|1IsH*H= *CD4 IM9 *H= *CD4 I^1H|rH H= s*AD Ls1J|rHJ*H= H*AD !Ls1J|rH *H= *LsAD "M9J|1qrHK)H s H;CJtHUHRH;H5 1AE1<)H : AWAVAUIH@ ATUSHH /-HH)H|$1 D$0 H|$Ht$4H|$HD$ [HH D$, Lt$E1A1HqHI Ij)I g)M9)D} IHLzHHu>Hu H|$H[HH []A\A]A^A_*)(ff. fHG K)ALWAA @t`HO0IuAuV9]HHcE1MtHM9~ DLH֑/t*IH H HHOHA(9HJ H (ff. @ HH H|$Ht$H8j H D AUATUSHAPLNIL' M9t H5˯ I9uYHL[]A\A]LLuLL=uLwIHtoLxHHt6HH>qHAE>(uL HY H !L=H(H H Z[]A\A]( D SHwHHHy H{HCHt 1HC蓧1[ Hn(Hk[f. SHHHuHCH[H@ Hf D UH[6 HSHAP E(HHۯ H HY[H@b ]:f. UHSAPH (H;5Q H'HF (IHH PV 1H5> H=> M(1 HH}8H]8H'1'HWHHt'QHN 'H;V'HDH ZH ATIUSHOH Hu^H 1H!saHH'HhH5 HgHCIT$ HD+ IL$H{ qxH[]A\HHHH9z'HH9t;HHvc'11HqH 11I9D$[I$LH H9Gtff. IIHH5 H9 'LLnff. HGHt^HAPHWH;P}=p @@ '@@L@H&L{HHQ^+m1HWH譤1Y1f D AWAVIAUATIUSHhH&Il$H HHD$HH&E1Ll$PI9 KLHAHL$P &A v&AHYAA &@&Hq0E11AH9}蠌. HE HL,jHD$HHT$PJTI^LHx]HH%HD$HHkHHCH@ HC GHhH[]A\A]A^A_1LD$H L H5 Uw%AHAyHt$(HcDT$ HL$DL$HD$Hb%DL$HL$1E1D$ Ht$(H\$ L|$IHl$HLt$(ELd$0ILl$8ADD)~XLHHDP.tHLL:(HD$XH$H|$XhHD$XHL$L[JDIH\$ LLL|$HLd$Hl$HLt$(Ld$0Ll$8'HD$XHL$H|$XmhHD$XHL$H\$HDHD$HJL-f. H AWAVAUATUSHXHt$1DD$LL$Ht$@Ht$8H9%H4 II1ߟI臠HH$I9 LH)ب IHAD = a ( lj? ?πʀ= UHE?ȀE@}I9 ( f?HMI܃HUE @uH@yAD = ( lj? ?πʀ= vs?HQ@q@}I9 IH[ADvq= vM ( lj? ?πʀ= UH@}Eh?HȀEUKE H?H|$@Hr$H|$8HZ$HXH[]A\A]A^A_Ã|$ uH|$;sD$L9}AD - = Q$1L9AF D$"H HcHT"LHH9H1L)I9H@HOHAD HH J?Ȁ?ɀJB D HHL$rH#1HuH1H|$ ff. ATIUHSHHHt HӅuI|$H#HH[]A\#fAWAVAUIATIUHSAPHu#MeHHt\IHt6HUdHHW#HHH5 - "HAEx-HLL?HMtLɝZH[]A\A]A^A_# D AWAVAUATUHH~SH(HFHn#HHHHd#E1HL7u L%. HI$p f5IH"I$0 HJ5HH"I$ H.5HD$H"LH5N \IHn"M MfI9 M9"L9"H@I1Mu(f"IV &"ITHITHL9|1LMLH}L9~Mu0H H KDIL^H(L[]A\A]A^A_HkL$LIk(H H4ƾHu:"M9F!IE M!Loff. @ UHSRH_H; ~ H; A t{ t H{xPC XH[]驛f ATUSHOHH!HH H H; H H [H]A\HHHH9}!HHI5HHtHSH@J HY!HSH*HHH9r-]H H9GuHH D VH8Ht 1HȚ1Z @ AUIATIUHSHH H8HN!H~I} DFÃ!1HT$T F?!Hߞ H8lHHH[]A\A]ff. Kff. AWHHAVAUATUSH8Hj#H"H"HH"HH "HOiIH 1"HHQ"L5 L9u L|$ HL |$ I HyL!jHHu,La|.H H8L[]A\A]A^A_ "HCH; tL9uU1D$ HCHu SMxHL)H9+I H!H9 Hۘ]L!IH HH'LH謘H褘H L- L9mtdL6iHHu(-H!LhH8H[]A\A]A^A_HHHI@H8M!LUHT$LhHHt.HCL9M H+L$XKL$uHۆLї,H D$H8[]A\A]A^A_=y HWHH!HzH+x SHHHtiH{ Ht[HCH[H@ f. Hu1tkHHT$H<$bH<$HT$Hx HHHk1HÐUSHRuH( t H{HtH{ j HkH@ XH[]鹖f USHQ%H 9 H{ tHH HsH< f1CH9kHHCHH@ Z[]H|PHf H u1AWAVAUATUSHVxfHnH8 HS(Lk@ 1LcHC8H)Cfok L9HKIlIOC(Lt I)L9tH} L}L蹕M LHc Z1[]A\A]A^A_ D AHHHLEu'H H9OuHuL;GuHHH)H<0HX HWHH HtPHHWH @ AUATIUHSHH(HD$H Hy 1{ Hl$Ht$^ { q HZ;% H9CF H H x !H{8 ( H2A H L%C HC Ht$1H I$ HD$HH H{8Hm<% H9Go H8IHLS HH HD$H H|$LH|$ H HD$H([]A\A]1H*IHZ HJLA葓E> Z m ff. HGxH H H W H W ff. fAUATUSHQ P =p X!{` !k9k H讷 !HSHcŃ{` HD`Dh!H IHu7{` k H IHtU LZ[]A\A]ËsH{jH H LK LDD@ D IHu kE1HSHcHD`Dh^ ff. ATUS HP =p {` HDci HHt HHu Dc1ҋ H[]A\HZ {` HuHHHH AVAUATUSHH P =p - {` PDk =p ~ 1HT$A H|$HL DcD;c HSIcă{` HhDp HH {` Dc1 HH 1DcHD$Hl$A DHH% Hu {` Dk HE HHt H H[]A\A]A^DkHP@ IHVsH{hhH fnfnH f:"H 8 fA:"H{ Ihfl)$~&Hl fo$ HhHD$@(HD HsH{gH fnH fnH{ 8 f:"H fA:"fl)$&HC fo$1 HHHD$@(ff. fE11Rf D AWAVAUATUSHH( P =p {` kP A=p D;k HSIcHDpDxH IHt} HѲH S`Dk P1{` kuH_ HtP Q H([]A\A]A^A_HԲT HSIcŃ{` HDpDxQ kH > IHYsH{%fHz fn@ fAnH{ 8 f:"@ fA:"flfInfI:"@)L$)$,$H fo$foL$ @H( P =p L HDcF H {` Dc H' H ff. fAWAVIAUATUSH( P =p A~` AnA9n4 IVHcHH@L$D$A PA =p LO H$H A PA =p A~` 7 E~HH HD$ En`E1E* L;H E~Iv L>IHs IcI9 HH4$LLA E HA@A H AvI~cHn H;h D` urHCH A QA H([]A\A]A^A_L HH7L9d$ JE~IH4IWAH4"I~ 8 !H fnD$fnf:"D$HXfA:" fl@(TA An1AHL$HHT$HHH4 HD$2H HT$HE^ f AW1AVAUIATIUHSHHHD$HBL$$Hh L6H H}Ht$) HtH}H) trH\$L$$HxM L9};I;]}5IE LH,HE HHA胉E'u!HH7 LH59 H81 1H H[]A\A]A^A_I] HHo1qMe LH_ D AWIAVAUATUSHX P =p N A` 7 E1HT$H. LLD$HP t A H\$HHXH[]A\A]A^A_AoA` A PA =p %A;_' IWHcHDhDpL IH5 A` A_ Lh IH A` A_ L6IHQ A` A_ Y L-H A` A_ X LH A` A_ Z LH A A` Ao PA =p ( Ic_A;_A IGH؋XD`Lg7 IH. A A` A Ao L; HHn A` A Ao[ PA =p W McgE;g IGJDhDpL< IH A A` AoPA =p L诪H A A` AoPA =p F"EgE;g!IWIcHDhDp LJH( A` Eg L%Hd A A` Ao-PA =p EgE;g' IWIcHDpDh LH L誩H AwI]H DH @ Aw D1E11P.{ Y^HA QA HtAwIP]HfnH fnI 8 f:"H fA:"M`fl)$fHHWfo$1 HxL`@(A Hٺ. LA A` Eg L螨H LM{ Htt LH$wA` u\ LcHtJAwIa\H H$DH DE@ 11HRAw Py A^ZH A` Eg LH L{ H$H LͧH L|z HD$H L衧A` L艧H AwI[HH @ Mg H4$D$(HD$LL$ H@HD$ IH;I H4$L\$0L\$0HHATD$0EDLPDL$0HT$(x A\A]HA` EgX L¦H A A` AoPA =p EgE;gIWIcHHDp $L@= IHt( LKHt L9H A` EgL< IH L H L> HD$Hw LԥA` _ L輥HI AwIYHAPP E1Aw LR1ҋ@ PDD$ Ht$8C H HxA Q1LH5~w iAwIDYH)H MO DDD@ L袣 HHA A Lx IH# LϤA` L跤HAwIXHH @ LD$IG $HHD$ G| IHI LL\$(L\$(HHPt$ D$ LED1PDL$u AZA[HLs A` H$ LHAwIWHH MO DDD@ H<$,u HA QKL<IH L胣HA LA` EgL3: IHY A` EgL: IHB A EgA /A Ao AwIVHH MO DDD@ LY HH^LPA` I L蕢HpAwIVHH MO DDD@ Ls H^1LH5y ^LAwI9VH^H MO DDD@ L藠 H#A H LHL`z HD$H{ L赡A` c L蝡HMAwIUH1Mg H Ht$@ LL$ D$(/y HD$0HHt$I HHI ;HHWE1LATD$8PD$8PDD$ HL$P> H HdA Q LՠHLT9 HD$ H L詠H|L(y HD$Hf L}A` N LeH8AwI_THMg H Ht$@ LL$(D$0w HD$8HHt$I HHI f:HHVELATD$@PD$@PDD$ HL$XHt$@c= H HA QNAwISHH MO DDD@ L HHfsAwIjSHH MO DDD@ H=a $ HH"AwI&SH3H MO DDD@ H= # HHGAwIRH~H MO DDD@ H=A # HH7AwIRHAQP E1Aw 1LR1ҋ@ PDD$ < H HA Q D H SHH= 1nHtHHX[ff. @ UHH1SHAP\YHH[]f AWAVAUATUHHLSHHH(M HHIHL/LwE1Iu.H袬MLLHx H(HE1[]A\A]A^A_ HcAIHWH LIxI: AVAUATUS HP =p {` DcD9cbHSIcHDhDpHHHu${` Dc! H蕜Hu"Dc H H[]A\A]A^HƲIHtsH{bPHHRDH D@ PDs DLֿ Y^HHH @ AVAUATUS HP =p ,{` dk9khHSHcHDhDpH IHuA{` kH IH k1ҋ H[]A\A]A^þ HdHtHws IHtsH{SOHH&DH @ s LҾ LEDP&^_HHu HH`H s IHLsH{NHH:DH @ s DLE LPHXYH AWHAVAUATUSHH8HGH D HD$H H,$H)H7- H E1H 8HE0HDE,U(9I AA #%L=c LiA$A} 'AE H! HcHHCL[L9d5L9 Av ш M9G5A6A 诈tMD1 L 1HH}0IWȋM,H H<$H D H8[]A\A]A^A_É览uuQf_ D낉vU跟Ff_ )1L9s AA n!AEIIHD$I9AA;E L 1IcM tȾ 9{,HcHH 9 AL4A AEIIHD$AU1L)HH9 L3AUIu HHL$ HH H<$H IH,>A}HE H9 L HL$"HD$I9 A6I}~;u AE AIIT A LjA$H H<$H,>H= Hc HL9sXL 1~ H f~fEtA} v AE HD$I9sA6I} : AE Ml 뵃}( t L3L AE AIT A LjA$HD$I9A> I}#:AE AIIT A (LjA$HD$I9*A>\ A9E )AIA (AEIIH HuHHHVL3L HxH DZH} HL)L9WRt H9 L9v ~ H>f~fE^H+ HH HEHPH HH HULxHL HBH LmL)Lu H7VHD$AU1L)HH9}L3,1HM AE A| \~ H L f~fEt AEPH L3LmL)Lu H7H AE LH 8ID HFE(F, F(H$L<$HF0AE Ml HHLHD$I9'AIA 'AE II *HEHH H LhL HP1HPH H L3L)LmLu H7H AE LH 8ID HFE(F, F(H$L<$HF0AE Ml HLmLu H H H& LmLu H H Ht.LmLu H H EH-HEL3Iu HH n H(H,$H HZ)HE L IH}H$HWH DkH$L HUJL>LmLu HJH HVH HG Ex)H H HHH)HHH) HEL H HE HUHHH L3HUL)HRH LmLu H7%H E(LH 8LnF(H$F, HF0HL<$KHMHHU H 8Ht$8 T$ M)?,HL$T$ AIA HAEIIHD$I9 AA;EL H L3LmL)Lu H7H E(LH 8ILnF(H$F, HF0HL<$dQ tHt$H)HHH9AH AE A| ~ H L f~fEt\(AM A| H@ AEH9E H L3LmL)Lu H7H AE LH 8ID HFE(F, F(H$L<$HF0AE Ml HtH L 11H<HL9s}( t 'L3L 1XL 1|L pEH)HEL IH Hm H^ EAD EAMHE H9Ht$I9s A6;utHIHE OLAEH+S1HH9R HLH)H HLmLu H H)H7 H HA IH 8HHF(H$LnHF0HH,$! D AWIAVAUATUSHH8H LH D IH)H7w,Ht$8 T$H,$%<L$L\$T$H H 8E1HE0U(HDU,L A;I AA ;AMcLA$Ic4$@t 9QHcHH 9 AL4A QAD$IH}( t O PL3H A LLE0HQȋ},H I H J, L Ic<LLAT$E1L)HH92.L3AT$It$ HL\$L$ HHB H L$M4L AT$L\$J, H9Hu A$A<? ~ H H f~fEt,A$A<HbQAD$H9E QH L3LeH)Lu H7PH A$HH 8IHPU(@, P(A$L@0IM$HD M9p+A$A9 AIA 2AD$IHM92A6I|$HL$L$.L$HL$LV A$AIIA *Lb$H HuHY1HH~L3H HPH D_HU II)L90 H9 HUH)HRH LeLu H7OH U(HH 8L`@, P(HL@0IHMpD H8H[]A\A]A^A_AC tLH)HH98ACM 9L9s*L;vG~ Hf~fEx:HcHI9PH HH HHH H H+ HT+H HUHJH H H HHHHEH HPH LeH)Lu H7*9+LeLu H H HO H LeLu H H HtKHDHULeLu HBH HH H8 UxHcHH)H HEHHU H g&H}H4$HGH `H4$Lv ?LeLu H H uH{AHEL3It$ Hߺ L$H HHL$H L LHBHE H IAD$=H L3LeH)Lu H7>H A$HH 8IHPU(@, P(A$L@0IM$H~ H f~fEt.A<$ .AD$,N M9s$A6I|$ L$e*L$L A$M$A$AIA )Lb$ L$8 Lь HHE@H L$H L`HP1HPH H L3Lu L LeL)H74@H A$LH 8IHPU(@, P(A$L@0MM$HL3H Lu L LeL)H7 JH U(LIH 8L@0MP(HL`@, ^E1ɃL H'H H E1uH E1fUx*H H HcHH)HHH) HEH H HE HUHHH L3oLAL$E1L)HHH9 *L3(1HM A$A<Y(~ H H f~fE'A<$ (8A$H HcH1L9st AA 5AD$IH6H9V?FKAWAVAUATUHSHh H|$(HH4$HL$LD$LL$ D$ 1 1H\$@HT$4HL$@Ht$8HL$0IvHHuM|$0HT$8M\ E1HAH|$@ 3 E H4$H 1H= H6 HHLHrD$ L$ HT$H4$1ILHL1IIHL1E1HT$8 H$ H$ Hc$ H)HHIH$ H)HHHM9}?HT$$ L?IH LHLA]E |$ HE IL;5g t LLLAr]E8 H$ 1HD$8IH9$ H$ $$ H|$ H1 LH$( 1H$P H$ LH$ H$HpXO HH HKL$ M9~GHT$H$ L$ HHJLHHA\EY LHk\HT$E11H$ $ HH I|$ J$ LH HH\L \HaJH|$ Hh H[]A\A]A^A_HD$ `H4$H|$( LhIH HHLI[MIHE H6 HKHD$H9D$8$HT$8HH= 1YH=uIpIIfIaI\IWIff. SHÃI 9u 19@[l? D AVAUATUS HP =p I{` IDcD9cIHSIcHDhDpH HHu${` DcHI H~Hu"Dc H H[]A\A]A^Hf IHtsH{b2HHyIDH D@ PDs DLֿ 臽Y^HH)IH @ AUATUSHLoL'LL)HH9~ H9uK'JH HcHFL= w L9sf9tQHL)HH[]A\A]HM,LLL9HLHnL9s3Hi!tHHf AUATUSHLoL'LL)HH9~H9eJ'#KHɐ HcHFLL9s9tHL)HH[]A\A]HLHnL9sً3H tJLLL9I AUATUSQHJIH=/ Hn HHJHHIXMJLLKLHWHJHH< HIWHWZL[]A\A]ff. USHAQ P =p PJ{` 6JHߋk*Huk1 V Z[]Ã8&JHPH Y] H9JuJff. pHB@uH ff. 0HB@uHЧ ff. SfnfnHfA:"f:"flHHILϾ8 )$EHIfo$ HX@(H[ WH'ǃI'HctY)I @ USHQ P =p I{` I HߋkVzHuk1 Q Z[]HQHuf. UHSQH0Q2HHt4HEPH}XH4 8HE83EHHH3EPH1H1H IHZ[]ff. fAT1UHSHHHPILHHt$HkHH)H9HHH`HH{ HT$H4$t$H{(HLLHHPH[]A\H=^ ff. HBATIUHSHHHI $ OHtH; ^ t HH[]A\H P] H@ H@x QHt iHHHX H D H Hubdff. fH AVAUATUHSHH L$6N4'L HA)IH P fA H@)HIH0IJ<#H9sqIIv%MIIRHH9 HH9 HH0HH@rp@rp@rp@rH9rIIJ J L9r [L]A\A]A^HHA߄uG@I@HzGHHLI Hfo' 1HHoCoLCfffgHH9uIIJ< JH4;JL)M9t@~ d' H~~WfffgfpfBHHH4VPVPVPHHE11?[]A\A]A^HZ L W H W Lf D H AVAUATUHSHH L4 N,7L{ HA>'HH H A A wu F@HBHEIHIJ 3H9 HLKE1H)HHHHL9IBHHL9IBHL9s0HHfHE@HBHEHHL[H]A\A]A^Ë?[]A\A]A^@GE@ Hz0IHHI#0HH@qp@qp@qp@qL9rLLC1H)HHHHM9HBHHM9HBHL9]0HH@qw DOIHHL DOHL DOHL IpHX H W H W HHzH!ff. ATUS HP =p D{` tDDcH5 H"'DcHuH1HHu Dc1ɋ P H[]A\1HH5 tκ HH%HHCf HIH H)HHAH9> f Pf Pf P҅9 HPH9 pf p f p f p HPH9 pf pf pf p HPH9 pf pf p f p HP H9 p f p"f p$f p& HP(H9sxp(f p*f p,f p.uvHP0H9sXp0f p2f p4f p6uVHP8H9s8p8f p:f p<f p>ƅt4f Bf Bf Bu HH9rHL9s u>HHЁ u A Dú A t o t˃LBA ff. @ HA H)HHH9s G G G uFHA H9s,#uH ttA A DÁ tu A A | @ u$uT A USHQ P =p A{` A HߋkpHuA{` kA HwpHu"{` kTA HXpHuk Q Z[]ff. fU SHXHH=AHt$1HH AHT$Hx C Ht@HDHXH[]f. UHSHH(T HT$ Hu oH@|$ HHHT}HH)KHH[]ff. @ AUATUSHH P =p @{` @k9k@HSHcHD`DhH5 HA"Hu"k1ɋ P HH[]A\A]ËsH{"HH@fnH fAnH{ 8 f:"H fA:"fl)$HH]@fo$f H@(uff. AWAVAUATUSHH( P =p -@1HT$HHt$: \t Hl$H(H[]A\A]A^A_DcEHl$: DHH? DcP =p ?{` ?DsD;s?HKIcHDx@D$H_ Hu- {` Ds Dk A HHD$;mHtHIHtsH{*!H?DH @ D LT$Ips PDD$Lh!ZYH? {` u SD9_HD$A>>ff. fAWAVAUATUHHSHH8HBHBHBIH{BL} IG AA AE1I C(@H{O $@ ?S\Ma X A DHs87 HH>LHH>Lx H|$ L IHv>Hs`H|$ HG D$ Pv<B2 HCHHIHH>} @=Aw>A l>?2`>H= HcH<$ H U H 8 HEHS`HShHLcPC\ HHCpHSPH4$H1HCx HFMH4$ H8H[]A\A]A^A_Ã<$ HU H HEHc1H9|OMIEH = =MuI@=>MZXHshH< =HLmHC8Ds\LcPHD$E=L{hMcHI9~iIE u=I|HG >H4$HH=H4$H=HHIH9=I LHME<H|$ L9cH=H<$ Hx H p HE9D$ P<B<ff. USHQ P =p x?{` ?HߋkHu {` kb?H1Huk Q Z[]f D UHSQHF?H HtAo@8S oKPXHS(HHH ?HP`HSHHhH HE HEZ[]ff. fH;=K HL t HX H H0Y ff. f>@><c+H<>~ P$wH } HcHHHÍH wH H% u$u,t HԺ ~ c> Hff. @ AWIAVAUATUSH( P =p >A` A 7>AOPA L$=p =L讳HH A PA =p =A` L> Ew HH>HD$ Eo`E1E&> LfHuoEwIw L6IH IcI9wHZLHLA $A HtiA QA H([]A\A]A^A_L迲HHtL9d$,=JEwISH4IVAH4lA D$AG1X=ff. fAWAVAUATIUSHHH Hl=H HB>HH6>IL31H=Hl$0LLHbH9=1IH I=Ht$8HD$0Hc$ $ H)HHIHD$@H)HHLHHHy LHHA@E<HD$01H9D$@$ HD$@HD$@H9D$H H HH$ 1H$ HD$@HIt$XHD$0wH/H6<H I|$HHu& L H HH/;>{HH;E1M;|$ I LHL H;JD;HH L[]A\A]A^A_HRHA 1Lԃ HD$Pj j%UH HHv;K;ff. G(uHG@u HPg2vfQG(u HG@u\ ;HGhH ZHC H5 H8&tHZSG(uLHGH@u?H` IHtDHcC\Hs8;LCxHKpHSh;H[m H C H5G H8s1;SHHHcH[H f. H1:f D AUfAnATfA:"USHfnL$@f:"L$HflH@;HH|$PI8 IH)$pH.;fo$ HXL`LhHh @(H[]A\A]ff. fUfAnfnSfA:"f:"flHH:HH|$0HH )$H:fo$ HXHh@8H[] ?@:H8 :x :AWIAVIAUATULSHHH:H $LL$H:IE1:LH|:Aw(IHL$6 HQ:IUJH$IL0L9#HL[]A\A]A^A_ @AP:G:?<2[:IH;v HcHA8^A8XIc8AXA8 AVAUATUSBB;B :HHӃw'Hv IHcHHH$:k []A\A]A^HHtHu:Lo111MtIE H9~HcI|HB:HLO HcLwE111MtIH9HLm111MtIE H9\HcI|H9HL$ HcIcI|H9HL# AIcLoMv911IE H9HcI|H29HLx HcHH,#]9LuE111MtIH9~)IcI|H8HL t^AIcHm E11Hu21H9KIcH|H8HLt AIcHE 888888ff. @ AWAVAUATUSHHHH(H` H H HH H H?AŃ8DK E8ELsAAA A@8Hk0M A$ 1HM.1I$1LH)ȃX HtlHt3 L97HH R I H L L97HH H L97HH HI9 AHQHу M9@7HH AH L9 7IwI{ tj teBHJ g L96IwI{ t> t9HJI9 3 L96L~L_LL߃ /1HL9^$ D< HHj6@ ?6@g6L0H<$E1E1E1Ic4L҉LI裵I IM9 LHDR uE~LILLHHI)к LD$MBLD$M뫋$(H(H[]A\A]A^A_闬A E5HMcHMIHL)HI)H9O5$ LLE12H<$H([]A\A]A^A_x"11A I11 t)HI9t$DM t6L94HH u1Ӆ#A@ R4E}4HMcHMIHL)HI)H94LLߺ tI11 t(HI9tcD tL9?4HH u1E3HMcHMIHL)HI)H93LLߺ 딅CA@ r3PE1L1; 11HD$ Pj j^JH HH3HRE1L: 1HD$ Pj j*JH HH33HiH AUATUSHAPGHGH;GL3Hw!Hn HcHHvn3CHP SHZ[]A\A]HvH HuHtԋE4HK HPE0PDM,DE(wY^LfMt11I9$~HcHItA%3HcLfMt,E11I9$~!IcHIt n2AIcLeMt,E11I9$~!IcHIt2AIcHuH,LfM11I9$HcHItX2HcHvqm42LmMt>E11I9E ~3IcHItEx2AIcHvHmHm H`E11H9E QIcHHt 2AIcF2 AWAVAUATUSHG 2ALwAA @ Lg0I E11Mu\HI9~=DHL&lj} u8R u-EủE1 AIcH[]A\A]A^A_H8 H H[]A\A]A^A_LgHkAt%AtA<$9 1@H1A<$A<$ff. AWAVAUATUSHHHH H]1Ht H1HH0HE1HHD$ Hl$0HT$1HIHH01XIH0HL$@E1Mt M9C H HHL$H$ 1H$ HD$@HHsXHD$0JHHT0HHL$ Ht$8HD$@Hc$ H)H)HHIHHHHT$$ HH0LHHD$H|$Ai/E/E1L;{|$HL$01IH9L$@$ HL$@IHT$1HLM H/HLHD$4H|$D$.D$yd/Y/Ht$8Hc$ L$ H)HHHHT$$ H HH LHHA.E.HH L[]A\A]A^A_HHH.HHI?.I.HRA Lr 1HD$(Pj jCH HHp.o. @ @fff. @ LA7 HIHL9taHc H9~UH HHtELDMt;HwLc H)HIHLH)HIIH9+. Lɗt HwE11ILfUHSHAQH= H.YHH[]vf D @fff. @ HH HtH t tH1f D [@fff. @ AWE1AVIAUATE1UHS1QHOHHWHH9}>M,Mt/LI荮tH5b4 I9utDHHMHUIHH1LL HMt HtBZH[]A\A]A^A_1I} AWIAVAUATUSHHhH8oN( B-Hf IHcHHv-L&, LB,HL Hh[]A\A]A^A_H~ { Hv HhHL[]A\A]A^A_ HnH Lm 1E1A H$I9 HL 1u 1Hy @A!HHFLnH$HZ H$HM Im H9o.MrHC LLt$R+HL +I H . LR\+H藭IHH+HL A-L * LA+HL; +HEH=,1謜IH*H\$E1I9 H$J\H',+HsLV Hs2,L謧m HL9$_ IH$E1E1A HC LQ:*HL] "*H<$ LMQ*L=IH)HL?)L( L?)HL )HC HPHS EM E H)HM LiA IID$H95 JT: II H\$L (Hf L* )! LUP )HC x L(H5/1 L>( u L(HL (H\ L(HC E1HDHC HC I9 HH|$ HC LOD( LzOEuHʾ\ L H(Lm Lk E1M9~#Hk JtHLb NIظ >HKtHLHC 2 'I$H4$HD$H'L$IBH}'HHKHT$1Lso[E1H HD$ HB $HD$Lt$(M)\$0HD$H9 IF1LdIG8AoT$( H H;H%H9l$fL1<$ C1ɾx !HK C HLL5 HHBH\ I;E H HT$L5@ HLK HHFLnH$HF HD$M H<$ Im p H|$ F H9'HUH9'IE1IrLLD$ %H|$ `IH%LD$1L9 LL;R'Lf$H꾘 L{% x Lla%H5- L5;J% u L;0%HC HLN %L\ L$HC E1IDHC M9Hk I9 Kt>u H~ 'HL7 IHvHLJ HvLa:v$ LL:\$HX HhLH5B 1[]A\A]A^A_ HIH;Lt$("HD$ $Lfod$0Ls HKcH 1K#HL #IG8HL$1MuHPpHJ1҉ HS HHpHH@LdHLMMII9f H|$ L"HD"(HC LH4$x TI#L$HLIr.#L$Hk IrzH<$ E#E1Hy H$AE!II L%J"I}IH"HL8r%L}! L8"H\$Hk =11ME#H= d#HL)H= R#L^ LH $7,"H $A LLU "HCI<$H4H4$"H4$w"I<$"H=1Lt$XHHIHl$PHIEH;H4A IHy#H9uHEIH HH@H;1HHD$@| HD$HH#HT$@H;11f{T#HH;L)Lt$HHLE{3#L Lt$@LLIA 5#Mu_Hl$PLt$X`HkHL$HJtH $HTHITH1H$L 1H|$ L9! H9B"M$(IT$H90"E1MsLT$ Hl$LLd$MILH9}NH$ LtHD$HDLoh( L, HHH9b I|$8LT$ ILHl$MLd$Aor( E1HD$H #1Ҿi L c L Lxm H\ L`U HHu.Ht$HH<$ H E11E10Hx L c L = LH Fu HC H9H\$Lu E1H $M9NlA} u I} I9 x L|q I9}jL觠H[ HLH$/4H$ H LnE# HT$LL IN L8E LL)%H HLH$3H$ H z Ld H$LHT$(HtHT$( HiLt$(r L M E11^F A Lt$(H Lt$(> Lt$(4 Lt$(* t o j Lt$( HhHL1[H5 ; ]A\A]A^A_霻 ff. AUAATUHSHQHLf L`L- tHCDHJ&,Z[]A\A]f D ATUHjSH9n}SHIH4 H{[Hs HCH9k})I|$8~H[ HSHKHrHsHѸ []A\ D H~ tzUHSHHHCHU8H{HHJpHCt*H1 HA HHBpCu HHAHBp1 1Ҹ HSH[]ø f USHQjB Ktk Z[]ff. ATIUSHtlHպ H'{ H} H0g h HE HU LH@Ht9 @ H} H[]A\þ B @ UHHSQc HHZtHH Z[]ff. USHQHocHHt 1HS-H@ XH[]f UHSQ%HHt)HH2 HHHHHZ[]ff. fAWAVAUIATUSHHHL5j! HT$Ia 1p6 Ld$Mt LLTLj HIH] HoxyL$$Mt#L1}HH H9uL 1H[]A\A]A^A_HL-IH LH-LAE H{ v f ATUHSHHHt H;=f HH?HuKH} IHt51H0 Hz HU fHnHfI:"@H[]A\* fUSHQaHWHH9B0K bHHH bu=H{HtH{HtHCH@ H ZH[],b S1HH CB HHH} HLD$/HC HxsHHHD$1HH HCHs,{HH[ U1HH A SHHH HLD$.\H}HHGHEHH HCHD$H HCzHH[]ff. @ USHHGH9FnHWHFHOfHnfH:"HjHaH H)$HH:H1 HHH HHMHH[] USHPHo_wH@ ZH[] wff. H HH@b I.f H1H|$`H|$ Hf ATI UHSH HRoHT$H4$ L4^Hu H []A\H>5 Ht$ HE H HEX\)ffH*D$Y H*L$XE _ff. PZ @ H>H>ff. SHHtHߺ [t @ SIH H H|$HH4$HtVA@D$L$HIx̝u(Ht$HKrx?D$\D$FH [A@D$Ht$H|$ryHD$H$fATIUHSHvf.v ztnsxIS;1HHQ HVHHu"HEI$HS1[]A\þ HHHAy 菧Ht D S Ht X@ [f wQ ww?wx @DÁ Ã1 HGH H ff. SHHHF <!Ht$} HH !HTH;D$2!H5 H\u.P, @! C!HH= [}H5ov HN\ P, ff. AV1I AUH5k ATUSHHPLd$HD$1HLHL$L Ht$H{ H H 2 Lv L D$0 ~ H<$1 HH HA MIJ< MHHJ LHLHLHHHtIfHIKQLH@QHPH[]A\A]A^1aLH讅H1LHI9s ff. HcS1HHHH;H{H{Hu H[Pxf D H(H=<(( H H8迮 1H(USQHG HFH CHH HH HZ[]ff. fP:HK H Zff. fAWAVAUATIUSH8HGHt$T$ HF B HFI9D$ IT$ 1Hz Q HkHHLhHXH0H) HH|$HHL$(IE LLt$(M IA L9tEHߺ L艜HH) HV H9G E1H;= AH/ Im H+ttI.tbE IT$ HH9j J HB Hz HHHHL(MtGIL$(IuHu0HXIFLP0HCHP0IELP0kH HH;j| 1|$9uH H H8[]A\A]A^A_H- HT 1Aff. S1H HH[ @ ATfAnfnIUfA:"HH SHHf:"L$0H|$8fl)$Htfo$ L`HhHX@8H[]A\ AWHcAVAUATIUSHHHFT$ HDHWH$HG8 x_ H{82H{8I&H{8HH{8IIM H M H H$HH0X 4 H3 Hi H5 H2" Hy HHa HC81MHHHPpLrL Lpp4+ H$HpH( H 3 T$ ID$HcHH H9Mt$M HC8H߃hx2 AoD$8HC8H 計 H>zH5w H!c HbN H=29LHu!HC81ɾHHPpHjLHhp E# H11 H1 HqH5 H: HLHHC8HPpLj1Lhp H[]A\A]A^A_11I9jHcH߉$Itv"$Hc f HY x tUR1H51"( 1H_H=!( H5<"( B- H5!( H=!( "( 1H5p!( _ff. fPH=!( 讹H=W!( H=C!( H=g!( 1HV!( HG!( 蚼H=3!( H= !( YHH=n!( %!( ff. AWAVAUATIUHSHHHD$H?HT1zHHt@H# H1HH@ 1HHx4HH[]A\A]A^A_df AVAUATIUHSLo0HHFH HVH~nLvLw Hw HHhMtIH{ HLHLu0( H߉~M:[]A\A]A^þ H HHE1ff. ATUHSH>HGL`pM6I|$ *HH8 HH/HHAT$HHH[]A\ff. ATUHS4HHH HH1HHHIHL[]A\ff. AU1IATUHSHHHHD$HH$HL&H3HWE1H9HHNI9J| L!LaH[]A\A]f D ATH^ UHSHHHC Ht$HIHHGH;D$LeHP HHP f1H[]A\ff. HH H<$Ht$H e HxqH 雷ff. ATIUSHFH t"H-"` Hu Ht!HahuHHL[]A\鸶I|$H[]A\ UHSHAPH~AH5 uH H Z[]A@wAC08E0HsH} nHsH} Y[]ˑff. ATIUHSHHHt HՅuEH{Ht LՅu3H{Ht LՅu!H{ Ht LՅuH{(HR1[]A\ ATIUHSHH0Ht HՅ-Hf LHH[]H A\ATIUHSHHHt HՅu H{Ht LՅu H{ Hu1[]A\[LH]A\ AUATUSQH L@ MHHID$H HP(HH uH H} H HG |ֹIHXHsH}EHH?HL1LHw !H߉`H HHQHZ[]A\A]H( f8 td AUH( ATUSHHHH fHnHhfH:"HHC )D$E1fD$8HD$ LL$@D$(D$HHNHHHHl$H?H& HT$HH 1H5o H= 6qHC HxHHX1H@ HHPHH1 HrJ1ɉ{8uJLk0MILICLHCX[H{X H躋HhH[]A\A] Aă6IDIQLHCX[H{X uf AWAVAUATIHLUHSHH MlH4 HtIHhLu E1II LLD$Hl$0{2LD$LLHHL` AHHsXH,HHHLH]EHHһH H[]A\A]A^A_H}Ht<HHHD$ H|$I\IIH}HHHˢHHD$ LD$ItIPHA 1LDB HD$Pj jH HHMHH AWAVAUATUSH(HX HGI1A$!GH}XI5OLHzYH LsL@{.HD$B H}0SH H@ T$HxHL$HH> fL}0@@ E8. C@MLP@IHD$I|He:IHLHHM9C|,/K<,t/K|,LiHH}0 tH}H$ Ht$LDLHC訲HCML=HCH}8 H{ D$C0HD$HC8H(H[]A\A]A^A_Hn{.HZA<$ Hn 1봉C@Mt3H}H#u<Ht$LHCE1HHCH hHt$LbHC( ff. @ ATIUHSHHK1HHH|PHW[]A\~I4$HtHHy3ff. ATUHHLSHHHMuIH H%H H @ H HcH[]A\KM`IASE1LH 1HD$Pj j wH HMtH8譱 yAPE1L 11HD$Pj j 3H Hum D AUATUHHSAPF0< ZtN< tf @<Z[]A\A]ff. @ USHRHoHHtH{HtH{ HH{(HuH HXH[]|w D ATUSHoXHt+1HHGXB{8IuHtG[L]A\8U[]A\HBf PH H Zff. f+ff. f AUAATIUHSH APHJHsDYL[H]A\A]H9w( ATIUHSH H8 HۃH9t 91HEHHHEL9HcHIH< 5HEHH} Le(u1[]A\JHE 1HWHH HzH+xS{ AWAVAUATUSHHH_LI9 >HH F D^ LH)HH9 M BL$A AunH] LH1҉ Hu>A<$ L5 %L9s%HL 1LH] HH]πHtHH[]A\A]A^A_E1LjD 3L0u6HL9r1ŃHI)L9LC7AD$nj H]1LHH] QHu JDBHuLB A= w1Eމ L9sfD9+u#K H]HHE A *HHLR HD$LH)HH92E1IC< IAH9uLMkAH)D\$LpMLMMMMIHL9E Hf9CR L91LHl$ A IHL9HHt A f9 HhL9uwLHl$If. USHQHo1HHZH[]SHH HT$Ht$H|$ĕH{X H{HT$Ht$H|$H [ǡ WHgHcvYp}Hi <8 WH7v1YHJ H1@ff. H1H|$ H|$.Hf ATI1UHSH HH2fHT$H4$ LUHu H []A\H8 1Ht$HE H HE;#ffH*D$Yw H*L$XEff. fSHBHH[E D HGxH HH9tHtHPHtHf P4ZHc{AWI1IAVAUATMULSHH(H> Ll$hLt$pHT$uL$L$HH6 HD$`I>ME HU HI4$H/ H)ML II6HH;螕HHH@ 1HL$HT$HH5# ;JI>] HH6Lu M} M+4$HwLL)H4$HD$HG I$HHE HT$H4$HH9Ht$HE I$H~IH)HtH9D$H$ HD$HIE HD$xL u1H([]A\A]A^A_fHnHhLfI:"G\ gH$ HHy(H9D$cH$ @4DF DH$ H$ L$ H@(HI A9{rI{II)H<$H)I9H9 dH)ȉH$ HjHt$ PH AQIHH5iX APIHH81 HfATUHSHHPmyH{HHUH{PH7H{hHHChWLK`HPLCXHKP1HSHH5x 8AXAY@HCHH{PH HChHH HG 11!f. H ff. HQH @F1ZfSH: HCH[H@ SHHHHt 1HKH(H{PHt 1HSPH{hHt 1HCh H[7w AUATUSHHHHH H HHHHt}L'M HteHHHKH!HIvI L;% t4ID$ &LLHH[]A\A] IIL1HiHRE1LF 1HD$Pj jH HH@PE1L 11HD$Pj jH HHL'ML%' g D IAWIAVIAUATUSH8HxIAz `M AF dAJ IZ@IVAσAAA4$9K H9B "@A Mb0 @ IF0HD$9,$ A @AF @H I9INHH HD$LD$ LT$D8蟤HLT$HLl$ l$HE1HLT$H M I H E:< uH)I| q HH I " HEJHIHEQA H! I9INHxH HD$LD$LT$D0ȣIH] LT$Hl$E1Hl$HHxHrfE;4\ Hsl$Ml H|.HpL)HH I IEJ IM}L ; AhH I9INHxHA HD$LD$LT$D0IHLT$Hl$E1Hl$HHxHrE;4 Hsl$MH|.HpL茘HHaI !IEJ IM}L yb6ILT$l$MPH|.HL^ HH"I K IEJ IMuLP 9,$r H8L[]A\A]A^A_MbHAR < IZ@ Mz0 LT$I9L$INHx耡HLsE1H,$HMLML9 H[ A4cH < tHL~It C<^ H x < uII9L)K|< HH I HCJ ILd< Mb @IZH LT$I9LD$INHx胠IHIL|$1L$$MH9l$ M BsfJ Mf#Bcf% IIuIFHHD$LD$(LT$HT$ܟIHLT$LD$(l$E1L|$LT$ LD$L9t$t^HT$ILHA L蜫HHx9I<HH)LHH I 9 IEJ IHLT$ l$MHL^HHI WIEJ IMuLP RMIMeL1 MMIHHxA H < HrE AA\E1H|$' $Ht$LD$ LT$HT$ HT$LT$HHD$LD$ AuAJ 5HL8cHHHL$HH$I IEJ ILD$ LT$HT$蹝IHNL|$l$E1Hl$ L9t)HT$ILHA L芒 HH LT$l$MHLHHI EIEJ IMuLs #eHHH$'H $_H L$IHL$H@ILLD$ E1LT$HT$詜IHL|$l$Hl$ L9t)HT$ILHA L] HH LT$l$MHLDHHI zIEJ IMuLf HHHD$ HT$ HIHHT$ H)HI<脏HT$ HH I IEJ IHH)I|\LT$H@LT$HH I IEJHIHIHHT$ H)I<5HT$ HHV I IEJ IHwH)LT$HIDHLT$HHt"I r IEJHIHl$ Il$ l$ Mb @IjH LT$I9LD$INHxcIH IL|$1L$$MH9\$MxQB| 2 MfB| uIIux_l$oI l$V ~l$ HHG HWH~&HGHTH9sHH2HHHpHJ1 u HH H Ãu H H 'f S1HH=v H HL$HT$HD$LD$HD$HD$\mtH{ 'HL$HT$A HHt$HtHy Hw H5K H8H 1[H H[cff. AWAVAUATUSHHH(H$'LaIMl$PHA 1L HD$Pj j%H HH-'L3Ml'HkHt'MI H{H6']IH'HyLII&IutL%/ H LH35g&&H;- &H3H[W&Hn&H(LLH[L]A\A]A^A_ &&AWAVAUIATUHSH(H|$Ht$] H&IL HH&HLpd IHg H W H MK&IGLLpH@ HhpHE X L$H^ LHH~ HHD$萔IH H H1 LHp jH; ItH%H@ %IPMHLAUj AWDD$ HT$(Ht$0 H HHLLH(H[]A\A]A^A_M LL<$ H<$IMLy uHL LH$L<$HHMu$H{` %zIH%Ht$HL~- %$ff. SfnfnHfA:"f:"flHH%LϾ8 )$sH$fo$ HX@(H[ H H@ H$Hx $ff. fQHG8HxH$Et HW Hc HH H9G8$HG(HuH$H Zff. Ht_USQ7HXpHHt'HC tH- HH@ G1Z[]H HG1f HGHu<HGHx0HtEEt HW Hc HH H9G8#HG(HtH Q@Ht H Z11Zff. G(#H<Nff. AWAVAUATUSH H- LH|$`L$@ Ht$HT$HL$PDD$pLL$I9k&MtIF H|$ (HD$H H|$H HH02bp)(Ht$H|$}HD$XH%HcD$pHHD$hAcHD$ H H9$P HL$ HT$ 1Ht$j5HD$@H$#MI9 T$wt$HT$@1LLV *#3 H 1LH0 H I I M M-(IE1 (L|$HLL$@ IL;sg(HCN,IE "I}"MeIE8IE I} It$ME(HD$0IM0 "D$, H9% A H9 H|$LχR"H|$0D$8x}t$8HH"|$, @Dž@!E!HT HD$hH9!L|$HL$@ LH5x L<I!H5um L<: H5 L< $HD$`1H$P LhH LH` ^ IHL HH!H 1LHhY * IH"RHI1j $` ULD$@HL$pHT$(Ht$x蒴H LIM:!LLzLItLlMR L[HE HHE ; L|$HL$@ LI9]#1H$P HE HHt$HLD$8 LD$8Ac#Ht$HL$xLD$8 LD$8HL$xD$, ="B"%fAVAUATUSH'L5P HHIHAI }HudkH HOH &_HHC'HI Hh&!'H1E '[]A\A]A^H M H9HuH? H; zLH`H&jHt&&f. UHSH(&Hx 'HR HР nHH&HT$HH-HZHD$H([]ff. USHH H9G&H H<$1H Ht$HHؒ ^ HH&H*H߉H[] AWHBAVIAUATUSHH8H 'I.H 1HT$(赛HHz Hb H9E8'Lt$ Ll$Ld$(LLLHtAHt$HFH u< &HT$ He$y%M'H8H[]A\A]A^A_H~&V 7&@Y&H0x%>\IH%HT$ HH#L$$(`%MfID$ o%A|$ M%E1H' 1HD$(qHH!%HEM $ID$H9E&U D$ AD$ AAA &@t&L}0 %@%ID$0H$1HT$(H;U|$ L_[HD$Hn$HT$(H4$D9b[HD$ HHL%Ht$H"H|$AWH|$ ME$HD$(HPlINHA T$y 4$I#f. ATIUHSHHHt HՅu H{Hu1[]A\[LH]A\ D ff. ATIUHSH0H;= _%HV%WHHv%HLH;X%H[]A\ff. fSHH0Ht 1HC03H H[H@0fPBH H Zff. fHHH ? ?9H ~? ?yH ~? ?yH ~ ? ?y H ~? ?yHtm~? ?yHtLV? ?yHt- DA?DA A?DHH9uf ATUSH H{ H IH;$HLHH $HEH HP UHIaM#HCH; t0HpLH= 1VHL+HkH[]A\LH= 1*HkHCH=ς Hp[1]A\#HCH= Hpff. @ HG #ALOAA t|@t$HO0Iu AuJ9AHHcHOHE1Mt6M9#DLH tIAd#9H H H#ff. H=2 D @ AU1ATUSHHHD$H$H#H;Ht$S H{HSHl$Q#L$$H] = HMl$ H#1LH5 HH=d " # LH"H H HHtH7H<$Ht)HH[]A\A]"f D AU1ATUHSHL- HH$Ia HD$$"L$$M ID$ "LLHH $H}"HT$I_ H'$"Ld$Mi"LH観G"HvwLHKHCHH[]A\A]PHff. ATIUSHFH t"H-b% Hu HtHq0uHHL[]A\~I|$H[]A\' P]ZHcTU1H1SHHH5rt HH $ILD$ 苟!H H9D$t1H$H9!Hu1H|$ n!Ht$HH[]1HT$ff. WP f D USHHcQHt;DCL11A9~.HKh@"| tHK`HcHLHcHHLHZ[]ff. SHH1H >z H5: H=: = HC8Hu H H [H [f ATIUHSH^H8 HL[LH8H]A\ff. fSHH1H ~ H5,: H=(: T HC@HN HY H [ff. ATIUHHSHNH; H HLH HH 1[]A\ÐAUATIUSHQHt4HVH Ht!HnHE Hj HA?ExIHuH H Z[]A\A]H{ tH3HHtHL H߉u1ff. fAWAVAUIATUSHHH H9F L5| Hl$HHI = Ld$MuAHIp H Hl$H HHL[]A\A]A^A_ LLH7HtiH誗HI MtQLHHtFHHo^IHt}HHLILAHEtLL\HH[]A\A]A^A_HHHtLH H|HrAWAVAUATUSHH|$HՖH IE1qtLHH H襖HH HIH_ H譗IH H虗H [H H|$LL"HAHLL[HPLEx[HH[]A\A]A^A_Ãf D Ht 餱 @ ATIUHHSHˢH LHH[H]A\ff. @ AVAUATIUHSHH fAŅulHE LHH IH HC@J< uX KHO HS81H(L`HPHHHu%HC0HS@HCXHC8JH D[]A\A]A^HBHe HHHH\ HS HI H@ H?pt Z HcHMf D AWAVAUIATIU SHH(Lw ANHL9wPuFL|$H9oHu;LLLHfHHHIH H(H[]A\A]A^A_HH9& A ILIH L1L|$H:LK0Mu H{@xLs@Ls HkHLsP\IQHC LHI1L $HD$贱HL $HHIHt H M MIIV2HD$HP D H H1HGHt$HD$Hc H` Hf. H5 A @ HH ff. AUAATIAUSAPH=} }H HÉtV1Hs8kEutID$0HtbH HC0HtH ID$HHC ID$XLcHC(I$ZH[]A\A]H55 1H.!HC8HuY 1HK0ID$8느ATHv UfHnSHHH fH:"HpH )D$ 1fHD$0 D$HHT$PD$ D$8D$XHHA HHl$ H;HFI t$ HL HHMHpH[]A\1LaHD$0 D$HH|$PID$ )D$ fD$8D$XPHA 1Lp HD$Pj jYH HHO$H{Ht$ Vf AUATUSHASDgHAH Hs0H HC(H9GX HGH9C 4 H Hk0E H@H H HC0H H Ct-H{HIIHH CuHLxZH[]A\A]Lk8I} tbCIHBfHnLfI:"AEH H5e H8H{Ht E1LC1E1LK0LIE I}I} I} uH@ THuH Hs0H8蔉H{0HtE11LS0蝿 ATUSHHW8uf1H5SI H=s H{ ILEuH H []A\H Hs8[]H8A\JHH=>s 1H5H xHs 1I\ff. @ USQH0 FHHHDHH+HHHHS@HZ[] SH' HHu(H{0Hu&Ct H[&H{8HA: USHQHWHH9B0uTHHH u9H{`Hu8H{h tH1 H HP0Ht ZH[]$ X[]1跽 D UHSRH@1fH]0HM@HMHHMPE0HtH;HkvHHX[] D AWAVAUIATUSHxHGLd$0LxLMr HD$(1H$IEHl1H;-< HD$HD$ \ H H$HHhr H|$(HE H HT$HHt YILt$MN Hd HT$ HHPo (RHL$ H; H HA HH5 HL$ HL$L HL H|$ HtHLH}XHAEHI9~! H5 p LLfLHx[]A\A]A^A_ú H5À LA芻HK H$HH\ H|$(HUH=Lt$HM SHH褊HHH[fSH1H0 H1HXHpH[ SHWHHu!H{HuHCH[H@ 诺診f D S10 HHt1HCHH[f D HYR$ UHSHAPH9HHʼnHHt YH[]"ff. fAVAUATUSHH~HHFHIHH-o E1M CH Lk8L H{XH H{`HH{PHtHHHCXH} nfCJ } E1LC Mt L;% uI1H pL`C0 1Z HsfCH1H[]A\A]A^L; H~1H| 1C0 LH{H HyL'MI"L-- M9ID$ H9M$ UHSHAPH95HuHsHu(HS HsHY[]'HH= HU u5f. ATIHUSH螇H1HLA$0 HHHXHh[]A\ff. SHHHt 1HSȷH;H[f. AWAVAUATIUSQLoIEL LAHHI|$H;= tVH;= tMHZHHlHnHLcCMtH6MyJZH[]A\A]A^A_HUnLcSHHHtH{HtHCH[H@ f. UH%k HSHQHC HH` H` 苶1Z[] D HUSQHW(HHHHH9r%H9rYffH*Y d H*f/s?H^H?H9oH}H4 q^HsH](HE1Z[]HHHHZHwHZAUATUHSHHHGHHLh`}0 SHuH H5j HxtE1M~;HEHJta xfIM9~# H5 Hy H5X Hx HaHH[]A\A]fATUHSHHPHHS`HH!} LeHSHL)H9k{0HC uAH9H{8HaZHCLHCH;C ~HC Hl1[]A\I4H;s ~H HSHC H9&HC(HKHH)H41Hb Hu AU1ATUHSH(H;5j HD$HD$ L- HLd$LHIhr i KH|$HaHT$It H? Ld$MeHT$IPo H Ll$L;-ټ 7M.IE H5 LLHLH|$HtHHHtOH߉H([]A\A]H= yHff. HH ff. AVAUATUSHHG AAA @Lw0LgLHHH9A LO&LHHI<H9s-DHHDIDHDIDHDIDHDIMVE1H L9IBH HIB1LH4L9sb44HAK$LHMHI<H9vMVE1H L9IBIBH L1H4L9 Hff. fAWAVAUATUSH(HBH|$L$ oHHHIH81H(H[]A\A]A^A_1#IHt1hIHM H5? HIH H@H; MFE1M9f M9 KLHAH; 1H|$MHHLL$ޔ Hg HLHD$eWHT$fH*LL$IH Lt$H0Ḻ ḺI @BI# HLV Mt I.E1H$L;`|5LvI/Hu IGLP0Im zIELP0kH$H|$MHHJLݓ IHtqHLjVWI.>IwIL W H LEHKPH H ATH|$H01" ZYMt I.wIm u IELP0I/IGLP0A L uW ff. HHM H|$Ht$Hpq H D ATIUHSHHHD$HH~I<$Ht$詔 {H Hl$~|{I HSHC H)HxWH9R{0Ht H9HE HCHS H4HHHCH[]A\51HHI0u1ATUSHH8G P HHL`HLHs1LH|HH+1[]A\ @ SHGH HHt E1H{H{8H{XHt 1HsXH{`HqH{PHTH{hHu H{p 3HCH[H@ 1HCh蘬f D HW1 D HHI~ff. UHH1SHQ]t'HHtZ[]VAHuH H81ff. ATHHH` UH fHn1SfH:"H`H' )D$fHD$ D$8HT$@D$(D$HHHHHHl$H?H%0HT$H1H5 u H=X` |$8IăH|$0<L2bH H HH7H`H[]A\ HUSHVHH9u-HkH:Hs H>H6HCHZ[]HGHCY[].f. QHW@H" H H Zff. fH(H0?t6LG HGHO0HHHGHO0ItH9HG81H(HT$Ht$H|$HH|$HT$Ht$LG L I IHG HG0 @ ff. AWAVE1AUIATUSHH(HOLOL(LG8M9 Nd LLD$LL$I$LHL$7LmHL$LL$LD$L9C8"t3LH- H H H([]A\A]A^A_ATUHHSH> H1 HHI LԨ[]A\ff. fHOH1AWAVAUATUHHHHH9HH9HG8Lw1L Lg(Lo0H2HHy1LwL Lg(Lo0H]A\A]A^A_ D USHHWHHG(HwHH\HHG8HG(HWH@t HH[]HH|$H H|$1HoHG(U1H S H5\ H0HD$HD$P1LL$ LD$({ZYNH|$t&HD$H@ HD$HH H@ Hhh M JHH-HKHHHD$H HCHD$H HCHD$HHCH=< H*HHH([]ff. ff. UHSQHK H H@Ht H9LH HH ^ Hv HCH}HUHuH@vHHHc HCHHh_XH[]. HGHHx(H8 f SHHZHCHHx(H8 ZHn[ff. HGH9HHW(HGHDH H! ATUSH@ H@h 11H=#[ @ tD HŅ Hc[]A\-ff. PH H@ H@H Zf D HATA1UHSHWb HHvEtH1H;k}'HCL$L1hHH8PHH[]A\>ff. HG H0HGH9HOH9HGH9HOf, HH uHG@HHW8ø ATUSHopH0JH9B A*H{hHE UHx ff. H! H@Hff. R:H 1H@ H@H XaAVH1HAUH$Y ATUSHHL$LD$ 1Dt$Dl$Ld$ t$ TDDLH#Hx,l$ Hcy+H=X HƉ1NH[]A\A]A^8 H H8tf. H HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ IHA HD$HHD$ H1$ D$0 HD$@H SH'HH{ iH9C_Hk H [ D H( HCT$L$H=W $dMH(ff. @ USVH_ HfHoGHUYHHH=6W [1]: @ ATUSHH@HF ~ HIHLYLC1HL tLH@[]A\Lzz 1f D AT1USHHH5V HHL$H,H{1QH ~D$fH:"$H CH[]A\ff. ATUHSHHHH@L9uH@HH[]A\ IPLE1j>MH3Lt/|$0nwDv-H OHu"HCHpy H@[]A\Åt%uHLH fAWAVAUAATUHSH1HHHHT$LD$L $E1)D4HD()t6DAAv5t1E L A euEHHD$8iHCL A MQIcH9bHE Hl$(MHD$8HD$HHD$E9~gLHHAGD$$HHt$8DHI$ $ LL$LD$ HT$!HI&XZMtHl$(HD$8E1HE HHL[]A\A]A^A_ff. fUSVH2HG =Y[] ff. AWfAVAUATUSH Lv(n0D$ )D$0)D$@IE1~ IHAEA~ 9O n f.s z % E r@ DHL$ @DɃIH9 LEHAG+tH tCIu<A0nt5A u.HL4LHĸ []A\A]A^A_ALHHT$LHH 1HcHT$-A E1E1HL$(LD$$LHHT$u A0nHT$1A Ll$0HT$L\B2H|$PHD$ 1LHT$H|$PAWIDAUD$<PLL$H0CH HHT$ 9SHtH PHE1E1j ALHAUPHt$(KH HlL脧A o0H EDHL$ f YIs DHDIHtWHmHA%HAf.{q zt.D1 gEDHg k a ff. @ H HG HGHt;HuGHy!HЃ1ɋtH H HsHcHH 1ff. @ ʚ; f AUIAATIUHSHH~H5 j$ Lf.G D$fL$DH*YD$D$ D$D$f/p D$ {p f/v|D$1H,I$H[]A\A]Lljm HHt!H|$HHT$R xHD$I$N.Ht H H5 H8~H H5# H8cH(H HG tdHGHt &HtDHu1HD$HD$H(ËGHD$Ht$A $yH͋GHHD$`HHtH@Ht /H Hu 1HT$>넋GHD$/rHt$A H|$k$H|$D$D$j @ HHt' H?HHH9| HHHH9 H1HHHH HIȃ AWE1AVAUATUSH8LD$(h DyAθ ADH H H6 HH\$(H) H; C @ HS0LKI :E1EIc@-AAE)E H DHuhD9 H\$(HC tyC T @C HC0H9u\H9sO HH8[]A\A]A^A_þ 1H EUHBEa@- HD9mAXt7IcuHSHHH떾 i H1IcH9~ q@w HEE SHH裕H{蚕H{H1 H[d; @ IЉO HI@ * @t Hp0LޠHpH AVE1E1E1AUHH _ HATHK USH HDD$LL$D$P1Ld$ATLL$LD$(ZA[[ Ht$H|$ H|$ dHH| HS㥛 H9f P HHn L, Aą[ H=A' H=+' Hع@B HH< H1HI1HIH{ Ll$ Hd 1HJ Ly,LIH? HMI HD$HtH H=`' HY' H D$H=' D%A' H B' D' HEL-Q' H:' $L5H' 2' E1H= wHN HΜ H HĐ []A\A]A^fUHSHQ[xH H Z[]H{H5d H9t H H8c2 @H= H[HH HHZH߉趒y ff. fH(D$tF u D$YD$D$H(L$ff/D$rF 7T$f(T$T$f(\fT g f. i zt%D$D$D$|gi Y~X H=' HtlV~FH=' MCH=~' aFH=j' 0CH=' Ht1H ' vH=/' HuX1H' X SHĀHH`1H H5ʯ' H=' 1BH=ܯ' EH=د' EH[ D USAPH_H9u:11HOhHOPHH. HuH: H Z[]HkH讐HHGfHn1HpGATUHSH HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H L@ HoHfcHHtKHHHA H$ L$ HD$HD$ D$0 HD$ΰHHÏHH H[]A\ÐSHHHHH,HHHH8H5 H@ H_P dǃP E1DP HH+H[H H@ H@XHuHz H ff. fATUHSHHVx$tHF H H[]A\H詖1H{H5 H91AUHBIATIUSHHH~I} &:Ń H~ I}H;= u&1HHeH1[]A\A]aHG Ht$HHHSH;D$HHHuff. ATIUSH HHtD@ Cfn % f:"-3 fBA$=tJ u[H]A\A$tQHz tJA$)}I)A$ :t!rz ) rz z uB A $B B1B -R uff. H AUIATIHUHSHH(DHH LLH1} L%N I9,$udHT$Ht$H|$<-w-H|$I4$+H|$t"HH uH HH H|$HHT$H|$ 9H([]A\A]H HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ H$ HD$HD$ D$0 HD$A1H ATE1IUSHHHHLL$HsHtD_HHHLD$1LH f H*B /YHHD$HaH{HHCHHF16ff. fATH UHSL@ HLH!HHH[]A\ ATIUHSHHHt HՅu)H{Ht LՅuH{1Ht [LH]A\[]A\ ;ff. ATIUHSHHHt HӅu7I|$Ht HӅu.I|$ Hu I|$0HHH[]A\ff. HHHG HGHt5HuGHú Ht$E1 HD$yHc1ATUSHH+ ^fZ(Te_ .e wGL$ t%1Ht$ HHHu1H[]A\HHfTm^ f.M_ wff. UHSH1APHt/1Hp LH HuHtHHE HZ[] SH+ /1u+Ht$ HH)H HuD$ ZH[ff. fAUATIUHSHH5*? AQHHt'LhHIE ڇAXLHL[H]A\A]Z1[]A\A]f. AUIATIHUSAP H 1HLHWHHtHH@ >H{3LkHIE LLDH<ZL[]A\A]LH5> H=`> 1) HMtLE1ff. @ UHSHHu) XHHHE HhHH[]ÿ Ht$*Ht$HHt!HE HHkLHtHC ux ATHBIUSHH HI,$HE } 1H4HH]~ HH7H HH=# 1[]A\2I|$H;=e tHG Ht$谒HHHD$H;D$6Ht$xAW1AVAUATUSHh1Ht$$HGHL$@HL$8 kG HAԄAAA LsH@tLs0Hk1A H?1E@H)H)H9H1HHHD$PHHP HT$HE H^ A EH+< H< HHIE1HL$HHI9 IM)A LK K4?HLHHHE~e| DPEf fA D!DXfA D!DXfA D!fv)fD PHHfQPfQPfQH9rH9sC8Hfr HfyDHDffA f9HH9rMHL$HI9 HHD$PHP H)H;pH|$@H H|$8H HD$PHh[]A\A]A^A_DPEf fA D!DXfAfA D!DXfA D!f\fD PHHffQPffQPffQH9r"HP"f@ HT$HHUL9: A $HT$HHL} ,蓂"HD$8IILHD$Ht$@IH H|$PHD$`PWAWH|$(LT$@ H IHH@LT$ H AC wMK@ LD$XLL)LH IC AC !@I{0 $HT$HLL\$ LT$LD$ L\$ LT$LD$LLT$LD$膁LD$LT$rKJ4E H9H fH f $f@(fQfy뫁 GfH f $f@(ffQffyH9 8Hf wf9HfH8I LH9_Hx vH q H)IHHI)MKA Lȹ LD$XHHLL)HH<L|$HLIs LHL HHIL|$H\A v HD$PL|$H HpHP HI)H)HHH9cHH|$PL\$(HLT$ LD$LL$]$L\$(x#HD$PLT$ LD$LL$JD8 HD$HqjeLD$H|$ff. AWIHAVAUATULE1SH HT$H7H|$XLD$0LD$(H|$@HT$8H_ @H@@ A L9P H'6 HD$H!6 A HD$L|$`1L)ʹ LHB DŽ$ HHH$ Ht HLGkEL\$8HT$@LHH)H D$pHt$hMKH$ A HD$`H@ @(Dt$EEL9 B*B<LB D (A A LHHAHLBI MLDHI(H8ED EAD ؉AHBI9sDL9XDt$1H)HT$@HH$ HuI9 Ht H+D$XHE H|$0H H|$(H LHĨ []A\A]A^A_HBI9H ILH)@u HxL HIIHH0I EIED D DHBD ljyI9L\$HTHxHL HIIHH0I HEIED D DD A<$HzL9 HILaIH0I EIED D DHBD lj9LI9QL\$4 LHT$@H)HH$ HЅ9 ~ L"M L\$8Dt$L HAEH6t_ :FD LBD (A fLHL9rH)HT$@HH$ HL\$HEI LuTHLHLBM9rAIH~I Lu*I HHHL!I L!H L93dA1 t= I LL$@L9i H@1 E1HD$"ILL$@L98 H1 A HD$DH H9 1Dt$H)A M9 LD$@H$ HD$@HHD$@H1HT$XH H)I)HD$PHt$0L\$HPAWHD$PPHD$@PHD$hPHD$xPHT$8H|$HLL$hL$ ԅH0}H|$`HtxH|$0HtxH|$(Htx1 ILL$@L9HtHE H+ H W H W KxbAxfLAEL9 :B IH ȍ ( wQ L9 :B IT$D $A > % IHA IkC(C4H $ % HT$@ H$ ǁ "LD$@H$ HD$@H . HH+D$XLX 1HT$XH . H)I)HJI9L911L9jHK. 1A HD$#HT$@H$ HD$@H Q. HH+D$XLX @ ATHBIUSHH HI,$HE } b1H6 HH]HHpH HH= 1[]A\7"I|$H;= tHG }Ht$H%HHD$8H;D$:Ht$vff. ATHBIUHSH H`I $HC { 1H4HHkn HHH HH=! 1[]A\Y!I|$H;=~ tHG Ht$HHHD$ZH;D$Ht$xAWIHHAVAUATUSH AG8D$AG<D$ AG@D$ AGPD$$AGDD$8AG0D$ AGHD$<IGHD$HIG HD$PIGpHD$(IGxHD$0I HD$`I HD$@IG(HD$XHJLaIPE1L^` 1HD$xPj j H IHrM)I} HI}HmI}H4I}HI} HI}(H q D$ {I E111E1L\$|$ :|$ |$ |$$ |$8 |$ r|$< JMLIHm RD$LH5+ H=+ PD$HPD$<PD$@PD$DPDL$H1LD$`HL$X萨H0PMH|$ ^AWP L褧HD$IH+H;AWX@ LyHD$hHHHAW\ LNHHIt$Xt$HD$LPt$xt$Pt$PULSt$P$ $ AVDL$lD$ $ $ t$||$x H`HMtLqMtLqHD$hHtHqH aI}0HMu8MIM@HIMHHIEPHD$H2I]XHIm`H/IMhHIMpHTIMxHI HHA NIHL$@m[ AW1AVAUATUSHh1Ht$$HGHL$@HL$8 G HAքbAAA ~ @ Lk0EHkH H HEH9AHH 1HWHD$PHHP HT$HEtUHt&L) Au-Au] $HT$HHL HD$PHh[]A\A]A^A_L( AtL( HP$@ HT$HHuLkH1E1IHD$HHI9k IM)LHA K K<?HLHHE foE _ DJf83 fA f D!DJfofrfrfA fD!DJffA D!fv HHH9rH9 H ( H H DJf83fA f D!DJfA D!DJfA D!fv HHH9rH9s+ H ( v HHH)IHI)MHD$HI9u?HHD$PHP H)H;p(H|$@HA H|$8HmHD$8I_MLHD$Ht$@IH : H\$PHD$`PSAWH|$(L\$HLT$@b H HH"H@LT$ H L\$( C LK@b LD$XLL)LH HC C h@WH{0 $HT$HLL\$ LT$LD$) L\$ LT$LD$HL\$ LT$LD$lLD$LT$L\$ lKT J<L E3L9` H9] H ( l HHL9s(2J !ًZ!ًZ!ـ-H9 H ( HɉHL|$HLHs LHL HIHD$HLKABLȹ LD$XHHLL)HH~HD$PL|$H HpHP HI)H)HHH9H4H|$PL\$(LT$ LD$LL$FxdHD$PL\$(LT$ LD$JD8 LL$HD$H2J !ًZ!ًZ!ـx>ZUI~LLD$H|$IWATHBIUHSH HI $HC { E1H6 HHkHHSH HH=_ 1[]A\I|$H;=s tHG aHt$.wHHHD$蘭H;D$ Ht$vff. AWfnfn1AVf:"fA:"AUfoATflUSH H$ L$(DL$,L$ HD$HL$( HD$@)T$HHE MIE MID$ IEI\$L}\$$DD|$ LcD$ L跤HHD$HHD$0]L1*HL$0HHD$@I! 19D$ 1EAIA19D$ 19D$$_HcH;Y&H$0 fo\$H\$PHHD$PH$8 $ HD$XH$@ HD$`D$,D$hH$ HD$p$H D$xH$P H$ H$ H$ H$ H$ HD$HH$ HD$@H$ H$X H$ ۯxPHcD$(H;E9HIHL$HHtHgH|$@HtgH L[]A\A]A^A_ fUSAPHWHm HH9FCHIH1H H5 H= ,HEHDC\1H!IcH9 H}01ɉ HH]0Ht%g1Z[]ff. @ HGH@(H8@-ATIUHHS.-HHHH1LH艇HHf1Hf[]A\ PH`o H H@ Hl H0[1Z U1SHH(H|$H|$H|$H9H-Y R H HHD$P1LL$ LD$(.:Y^t'H|$ H|$HT$Ht$#H([]ff. AUATUSHHHHHHHgHH[H1Lk8C(uVHC@uLAC HHsH1|HHt@HSHAHx L0}HH[]A\A]Hi H5$) H8蔚1SHH+HsH;[ AU ATUHSHAR0H;lj tZ[]A\A]HSHLbhHULjhdMI|$HHtAYHH[]A\A]dI|$Hu D SHHHSHsH;Qu1[ @ SHHLHsH;u1[X ATUSHHL%l HT$I$t 蜻Hl$HKHHI$Po {H $H H; ?m u8.H=N H1HIHHL[]A\ú I$ HtGHHH= 1zHI묅HH= 1THIYHH= 16HI;ef D QHHh H9FnH~ uZHhh HH5 H81 1Z AWIAVE1AUIATU1SAP2HHߺ LHAxbE(+HI;m}IEH L9uIYL[]A\A]A^A_f ATIUHSH H&Et*1HsLՃtHsk H []A\ Ht1 @ SHHHt&nHH{HH9[ [ H=k_ g SH \HGH&$ H9tHz$ H9dHXHHtH{ t HH[H8a1 @ SH Ht HxH膖1[fQH=8 sGHHpHoZ U1Hչ S HHH5 HLD$4t+H)j H|$H0 (HH2Ht 1H[] V誄HtZY齅ff. fUSQHi H@ HGH@`HmH _H1'Ht H Z[]H}` tP SHH1H H5 H= }$HCH@ H [ QG(u HHcXnff. AVAUATUSH HtH []A\A]A^HM IIH\$H H HH{L4HL)H MtzLH L1aLE1FI<CD XHHH H)H 1'I} (H;d LH8,ItHP L1LҡI<ff. U1SHQ;k{ uZ1[]H;{f Hf HE111H@ 8 UISARH_HtH{H5=d `tI@H8AY[] $I@H(Hf H AXHHH[H= 1] 1If SHHH HkHHHHHHwHtHWH H[iHf D HHe H|$Ht$H(i ZH D AWIAVAUATUSHH(H-e L@ LFHwI9u`HF`HYHH9P L5<b Ll$1D$ LH{ LH\$L|$%L9tnH([]A\A]A^A_I@`HN`HtH]H9PuHH9QupL0tD$ L5a Ll$L5a ILHCI9GtL \|$ tLHx LL|$H\$}XLl$ؐAWAVAUATUHSHH(L%}d M$@ LFHwI9udHF`HHH9 L= a Lt$1D$ LI$Z LH\$Hl$L9 H([]A\A]A^A_I@`HN`HtHXH9uHH9u9LD$ L=` Lt${L=u` ILLt$LI$Xt LHl$H\$ZjHCH9EtLZ|$ uf. HWHwHtHO1H= qH= 1c UHHSQHHt?H}Ht'ۿHZHGHH9HOHEHc H Z[]%Ht#ff. SE1HH B7 HH HHb L$ILD$H@ 1#rH|$! HH?H[f AUATUSHQH-7b L@ HZHz HnHHHHI)YMLLH YHHHCH HHH HHD Z[]A\A]ff. HBUHSHWHq1HH} Y[] AWAVAUATUSHHGL MfIHIIL|$I<$LLμMt L;-a H $H(H=h^ HH+1fHhHH@ HP@(HC[HC8躼HHb I $LLHCH=H,$HD$HH^1HK0HC(HI $HH[]A\A]A^A_f ATL% b UHSHGHL9t H;] u H{d ^H[H; XHEL96H;] )HHHHE `pHIVHVL[]A\ D H? ~H;=K` tPH\ H5 H8$1ZSHHHHH[ff. fSHH HRH[ff. H_ H@ QH] H0H~ 1s1Zff. @ USQH/H} HEu HHEZ[]H}HHGHHX[]U @ S?(HHHeH;._ L tH@L@HH H1H[ff. QHNHG /IHu ILZH9Iff. ATUHSHӃ H?H9H<葒HH}LD HHHHH9_ HH}1H)HHHHH9HBHHH9HBHH<0L9r[H]A\<0f<rHH H9AH< HHAtnLD HHHHH9 HLM1H)HPHHHL9HBH4HHL9HB1HH<L9T<<HHHHLD HHH9r|HLM1H)HHHHL9HBHL9HBH41HH<L9<<VH0HHfrpfrpfrpfrlf83 HHBi0HHrprprprAQHHE1 1HHIILZ AWAVAUATUSH H9o HIIHEu MU HiI AAt=11Au HI9~f9TE uHI9uHĨ H[]A\A]A^A_HĨ LH[]A\A]A^A_ A I LoLKt- H)E3HLl$11A MuA [MIL fA9u LH)HL$HL9uL1E1HDHrHHH9LHfD9uHD$L| E1CcfC9gTIM9uEIM9ZLLEHELO MLDHA CHHHH fD9LDHuLH)&HHT fD;t HtDHr,H)HHyLE4KfD94JvHuPH AVAUAATIUH,6SHHH()H9s fD9+tHHL)H[]A\A]A^HDtHDHH)pHHfD9(L)H빐AW1 AVAUIATUSHH HWH|$Ht$4D$0 H|$H|$HD$ H D$, Lt$I1I;m}GIE1L$I$L-LHOHt>H wQL9PA HIH|$L`HH []A\A]A^A_yHtH|$H31HT H54e H8蜄f. HH;w D7 HW HHH H HGHtQHWHHH9}1HH@(HJHOHW HHH H 1RHOHN1^1 Uf D P誼HW H Zff. fA AWEAVAUATUHSHH(H D$ E1E11H?H)H9DLl- I1H9DCDCEE Lo#HHr@ @xHN0E* HV HLX 1 HtVHt'M AIA;MAyIDyH;MAyIDyHH9 ;MLWAyIDyD;MABQIBDQD;HMAyIDyBDIzMAyIDyIzH9MH(H[]A\A]A^A_HIAHHIEH AE < 1LHMD$|$ y AEAEHEtH~HEDHH1L1HH0HH LUDLHHE" HkMeME1LMHI9 H|$L )MHL$HD$DD)D9s;IH=3V IBLHIAFEQH? AIH|$HL$HIDT$HD$I)DT)rE1HMIHHHI)LMHMMIH U HBTL HA<9@xH P뾩 mAE D$jL ?IE11MYII9}rHD$L 1D9sGE$0H*U HIEH AEFHU EQML AGEQt$LHD$II@t1HLHHHIHH9QHLT HT;MуA HIPJf SHwH1aIHtHSHs Hx \L[ HHwA H H AT1IUSHH HD$`Hl$PHD$H$1HHHT$Ht$`HH)H9 H1HHH@ HL$`Ht!Ht$PHHD$`HC H4$HL$HH|$`tH H|$tHHĠ H[]A\ff. fAWHAVAUATUHSH 2p H"p Ll$P1HLI1HLd$`L{Hl$I9 I9HH|$PH4$IN]LABL:EuE'H HcHI9 H,O HHQHHĨ []A\A]A^A_HɃ HcHCoDHA u HE t hHlL HHQHI9tH N HHSHoEUEJE?E4I9}(I9~ G$HO8HwPHcHH4HyHW0HTHTHH H Hw8DG$HlHW1A9~ HO0H H~H9uHHݸ 1fSL(M IIL_M9t H bJ I9uLMYM9t H MJ I9u LL[錭LL聒uHLruHK H [LLVuHLGuӐUHHSQHGH苻Ht!HHH(+uHZ[]HE1ATIUHSHH H~I$[H ]A\&ff. fAWHG AVAUATAUSHHxH;)N HD$HGHD$ HHt$ 1Ht$ILl$ Lt$01Au{L|$MIL9Bt; LLmHuH|$Hu HD$I9t(H|$LH)H,HHxH[]A\A]A^A_HL H9CuHHD$H9 t+ LLH H1t"HL$H9}lL HN tZHHT$HHH9|| H qN uHuHL$H9H|$HxH)[]HA\A]A^A_ZEuHt$ELd$ff. ATIUHSHHH~I4$[H ]A\ff. fAWAAVAUATUHSHhH;5=L Ht$ H1Ht$kcLt$Ll$ H]H7Hm(E1At&I9} Bt% LL艀HtIEt%ILIM9|Bt= LLYHuHD$H;K t H|$L)J|% HlHh[]A\A]A^A_L5 A Rff. USHHHHHH~2HHHy1HH7u HH[]GHWHPA L8 1HD$Pj j_WH HHu>ff. AW1I AVIIAUATUSH L$ Lt$0L LHF HFLF H= e1M I_1LL$HT$HLD$ֶHD$(HHHT$LD$L` Io LL$H 1Mu) E IHHA 8AD$ HEHyHt*LL L|$(H L[]A\A]A^A_HH I9GuIH@L|$(H;5I HT$L1LL$ H$ LL$IA IQI M 1H$ A HH= uLLL$HT$Ht$3Ht$HT$1LL$H9}A HDŽ LHt$Ht$HLE1A @8ψLHMELH-M HHϋ uIA E11H$ HH= u8fPHPD HOLFH59B H811Zff. SH H;H[N D SHH?Hu0HH WAQMIHH8H1H5 lHAXAY[HOXLHhLG耩 [f D UHSSHBH{HHH{PHH{hHHChVLCXHPHKPHSH1LK`H5s {_AXSHCHH HCPH HChH 1Z[]fH 1 @ HB1 @ QHWHBHNHHH9r)H93ffH*Y E H*f/s"HH:H Z- Z HHHH HHHtff. SH1ղHH{HK HP Hw Hs'uKHt9 @x t(tft H{ H|H| HHHHH{HCZ<1[Ë x tt H{fff. SHHQHs HCHFH{8 ;HH;ptHH{x HCH [ff. @ USHH lHF ~ Hm{I u(HnH~H{HDHH[]Ծtff. @ ATUSHӄLd$ LHwH$IT$ t$H= 1&H[]A\ff. fH7HH9s H8uH)HHHH|$XHt H|$H)HHAWAVAUIATUSH(*H=IHL9<J HHD$wHHHD$1H$iHLL| OIHH4$1HIFLxLwHD HHt$HLHL9L9uHD$1HTH(H[]A\A]A^A_P1 >1 Z>f D UHSHRzH;HHuXH[]zf UHHSHH$HHHH?Ã+观HvHxHpB H H[] PHA H@ EZHf D USHH HH- B H9u.HZ HHHHHH= 1[]tHsHHt$# Ht$HHHDHHDff. HA HtH9uHHHtHHD$8HD$HHATUSHHHRH;Aă H{> HHt{H^HH7Ht]HLH1読HD$HH Hp HDHHH9t H|$.HD$H[]A\ HHHHHHHH?1@Hff. USHHWHHG0Hw HH\HHG8HG0HWHHH[] SH [ D USHHG Ã(*H[] SHGH t H WHeH= cf [ff. @ AWAVIHHAUATUSH(H1 HYHAPE1L}- 1HD$ Pj jKH HH{ H1 H?;D$ 1M~In oHHB 1I9 H < tHI9tcAD6 < uI9|5 Ln |$ u7H)HIHHHL4LLH I9u~HV= I9FQLH H(H[]A\A]A^A_HxKH:HH)M9R|5 GLn>1҉T$ I2PE1L, 11HD$ Pj jJH HH1i D H H t H54 Hf AVE1AUATUSHHG DL$ AAA LwH@ H LoL9Ik qHHgDLD$ HLLӋt$ HHIH @ H Ht MD$H@ <u~HHLHH9 HLM1H)HHHHL9HBHLL9HBHH9sHHfJLHHsHL[]A\A]A^<tHHHD LH9rSHLM1H)HHHHL9HBHLL9HBHD H9sHHQMD$0 :HH@yz@yz@yz@yLw0_x DHHHHL DHHL DHHL Hzff. AWAVAUATMUHSH(Ht$H $ >Ll$L 19|1҅A HLcI9 Ht$LLMHA) H $1J491҅HIHIfAnL fAn$f8?fA~$f~ HfAnL fAn$H<$Hf8?fA~$f~LUH(L[]A\A]A^A_HD$8 I6P@@u ʸ Éй H5e H4IHcHsu5tAHIH|I|IxHI)DL)HËATATÐA t DL AVLqAUUHSH(I LLL$HL$Ht$vAg Ht$HL$LL$u`DLL$HL$Ht$g HL$LL$LqHt$L9 AH( []A]A^ø IWP@@u ʸ Éй H= L IHcHsu;tAIHI|H|H~HH)ILDL)HAɉAT Tff. AT 1UHSHPHHH H} 3AătnH}1H uWC HSHT$H4$DHH葱HH|$ tHHPH[]A\ ATUSHHHHt$ X-HkDd$ HH9HuHH{ HC(D$(H6 H H[]A\f ATUSHHHHHHH|HHpHt>L'MtHt)H0HsHH{ L[]A\ E1f. E1 HBUHSHHARHHHuHKLCAYH[ ]Hd1E1 D AWAVAUATUSHH8HT$HL$LD$K3H HD$H-5 H9.HtH !5 H9H8H|$HT$HHtHHtH HOH tR @tIH|$HT$Ht$H|$HT$Ht$1ɺ HH3H8[]A\A]A^A_é @ Hv H|$HHH|$HH|$ uHH|$HD$HH5 ALPH|$H0t A^HEH;/ t H;1 H3 DHL@ HT$LD$HL$IF8LhL LxD{KCK TD{KIV8Lj1H HH$*H$H HHØ *H H|$(BHHHH QtH53 1ɺ H2Hl$(11HHn2HH$"*H$gH9H/ H5c H8j_H|$)H|$HuH|$H1 )H[/ HQH5c H81ff. SHHHH5/ tHCHSHfHnfHn[H褄 Hu%zHuH fH~1 fPH)$))H$HT$ff. USHQGHCHHHHiCB HHH9HGZ[]QIH5. H A@Xff. IH5. HA@ff. SHHHsH; [SHHHsH; [SHHHsH; [頶HATUSHHHL%. L9t7HG`HtEH Ht+HHHtZL@M9uUHH[]A\HHH L1HH[]A\*艼H 1LLtWHCM@ HY5 HHH. H81 EHD$ 'D$H[]A\HCIHH54 HPHt, H81"H1&H+HHOHHfH~&fHnf. zHfHn[]A\ HH-/ H|$Ht$Hpc 蚓H D UfSHQGf.zt|111r HHC 11ɿr HL H5 HHHH= 1HHfHfHZ[]~ fTfV f. b\G111r @ HH)L5 1LLxH. HHG H5' H@ H@H 1Dff. @ AWAVAUATUHSHH(L%- M$@ LFHwI9tI@`HtHH9 thHF`HHH9 L=/* Lt$1D$ LI$| LH\$Hl$pL9OH([]A\A]A^A_HF`HYH9 u6L1qVD$ L=) Lt$L=) ILLt$LI$x LHl$H\$off. @ AWAVAUATUHSHH(L%, M$@ LFHwI9t^I@`HN`HtQHH9PuDH=L|$H9Q LI$w LHl$H\$oH([]A\A]A^A_HF`HH^H9PtL-( IE LL-( L|$1D$ LI$o LH\$Hl$nL9ulLoD$ L-_( L|$ AWAVAUATUHSHH(L%m+ M$@ LFHwI9uhHF`HHH9 L=' Lt$1D$ LI$c LH\$Hl$mL9MH([]A\A]A^A_I@`HtHXH9 {HF`H:H9 u9Ln7D$ L=f' Lt$oL=U' ILLt$LI$v LHl$H\$:m^ D QHGu蛶H%H3* H@ H@ H* H Zff. fAVAUATUHSH|jHHH}fjIH3H} PjHH- H?H9H HH9ryL9}fLH)HHu]HIHxHH=* H)HHHOIH1HXHh Lh(HP[L]A\A]A^1E11H fUHHSQ貣HHtHH HH$ HHZ[]f. HG @t H!f Hq% HVHH81 AWMAVIAUATUSH8H|$HLL$HHHH IcV8Hr HD$H)1IE1L9}0I< u#IF`H|<7H+H{JIHLCHCIupH(H HE UH\Y PH$ LL$HL$(H|$ H01HE HHE ZYHt_H+HCHH@0H8[]A\A]A^A_Iu@HPH01H= LD$ LD$ HH HgHEHP0Q UHSHHHOH# H9tH8 H98 u HHuHwMH} HC H1.HuH HtHHHt 1H[]ff. @ SIH@H # H|$HHt$H uaHt$0H|$h LD$HIxߧAoX)\$ f(T$ fXT$0)$$L$<WH@[Ao`)d$0f UHfSHQLIx u&H5# d?L褀1Z[]L2|f.Z zuݱHt HBATUHSHHHLe ~+HuHF %~ [L]A\#i)ff. SH7s H߾ [ off. SHs H[)HHG 0G u$Hw HWH@tHW0HH H AW1 AVIAUIATIUSH H$ Hl$0H HHBHI} 1HX C H@I}1HܴC H@@I H$ L$ MT$LL$0H$Lt$@M9 IM M I M Mt$(H$LMLLLT$+ LT$H L IH$ tHH|$8 tHH L[]A\A]A^A_EH H$ L$ IMT$LL$0H$Lt$@M9'L ItHD$IL1H) IH/Hx LT$LL$tbLX(Ll$MMHl$LH\$LMIM)M~>H$E1HLL Ht#LLHHIIIL *# MLLLl$LHl$H\$H$ $M8M|$($LLLLT$ IHoHt$1H)-IH<Hx LT$ L`(KLl$MMHl$M,$H $H+LLIVHt HLLL)L`IIM)MMMLLl$LLHl$H $I}IHH購LH$L $IH$ L$ MT$LL$0H$Lt$@M9ML ILM9 I H$LL$L\$D8MMt$(LDL$LUHHD$LL$H4$1E!觧IHHx L$HT$L\$KH@(HLLL)HMD H<$HxIH$DH)UH{D HxM^M9~MZHL)HIL9L1LL$IL\$L$LIHI|$ L$L\$LL$GID$(I} +IU(N2II HLMfLIPM9 B 8HLIJLLL% KIQ MID$(HD$H$H|$MLLLL$ LT$j IHALT$LHL)L)HIH9yI1L\$J4ԥIHHx LT$L\$LL$ ZL`(HD$Ll$MHl$LJ H\$ HHL$LT$I)MD H$E1LLHLT$(i LT$(HH HLH9' HJ 8HLIIMOMt$(H$E1LLLLL$ L\$LT$ HHD$Ht$1ФIHHx LT$HT$L\$LL$ H@(HLLHLLHl$H\$LLIHIH LH$E1LL)L` H ILHLHIHLLLl$Hl$H\$ NHLLIH$ $MWM|$($LLLLL$LT$ IHLT$INHL)HIH9+I1LD$J4膣IHHx LT$LD$LL$L`(KHl$LHD$H\$LMHL$L)H~o4$HLHL$ PHL$ HtRHI9PHLLL)LxLHI1MLHMLMLLHL)LLHl$H\$Hl$H\$Hl$H\$A LIVM9}B48I@1A1@qH1MLHILIp]fHwHt H(.H= D AWAVAUATUSH H<$HHH H H HHH] L'M H HHHHHH6H H$HXLp H5 L;% HD$01LHHD$質HD$0L|$@HD$M H9HNHI HD$D(IHSHE1HHH HH E:, t#HsHH$HXLp <H)I| VHHI ID$JHIHHHH$HXLp H9HNHIH|HE1HI9 H H A6LntLItC.uIH9kL)K|.茅HHI ID$JIL{HLUHHI ID$J IM|$Lu-HĈ L[]A\A]A^A_IHE1L9tfHT$ILHA L HxDI<HD$H)LH趄HT$HHAI ID$J IHM7HLuHHI ID$J IMl$L, HH A6HM%H|/HLHHI ID$J IM|$L,VH|$`HLHT$軴[H{ HT$HLHD$葴HT$HL HLHD$gHT$H" HYHRE1L 1HD$(Pj j"H HHmE1HPE1LX 11HD$(Pj j"H HHtL M?L% 3ff. AWAVAUATUSH H|$HHH+ H H` HHT H H H H IHD$HhL` H; w HD$P1HHHD$袥?Ht$`LD$PH I9INHxHd E8H E111HMH9~ZIs RHH9tE:< uHHT$H)LoHT$HHu I HBJ4H{IHMIM) H9|:HLD$H)LHH&LD$I ZIFJ IMFH|$蓦HĨ L[]A\A]A^A_PE1L 11HD$HPj j H HH HHuH HHH HHIY IZ HD$HhL` M3I$IHD$HhL` I9INHx1I1MSLl$IMIHL$I9 L9 H AtHHXL9}H A uHHu L9HI<H)HHw I IEJ,IHiHt$8LD$0JIH`Ld$1E1Ll$(Hl$ Hl$8H9\$(tcHD$Ht$ A HHT$0IN$8L)L HHx0LLl ~IH H ^IFL HMLd$Hl$ HHK<<L)~HHH IFH,HI^HLHD$8~LL$8SL9LLMH9}H5 A tlHH9uIV2NLMHL$H H9AHBHA HHL HVHI<HT$H)}HHHT$H QIFH H]HHT$HD$ 艮HT$Ht$ fHHT$:HT$HiHRE1Ln 1HD$HPj j H HHE1"MEH IAWAVAUATUHHHSH Hz H HWHHKH~ L'M HH HIHHLHGH LUMy L}(H L;% * HD$01LLT$HHD$躟.HD$0Ll$@HD$M LT$H9HNHIn LT$HHyLT$E1L9 HT$ILLA LLT$R LT$HIv I| LH)L讕HHI HEJ IMLUMo HL}(LUMe L}(H LT$H9HNE1HLT$HIrHI9 H H A7LftLItC'uIL)K|'ɔIHI HEN4ILHL薔HH^I HEJ ILmHh"4HĈ H[]A\A]A^A_LL@HHI HEJ IHLe"vH|$`HxH A7AHeHHHD$藪HL$ HR HD$D(OLT$HHMbE1LHMxRHHtIG:,'tIsL)K|'XHHI HEJIIHLH|.HLHHxI HEJ ILuH IHH袩LbHHHD$}HT$H8YHYHRE1Lq 1HD$(Pj j H HHr1PE1L> 11HD$(Pj jH HHtL MTL%4 HL= L= HrL=~ HW D AWAVAUATUHHHSH Ho H H HH H L'M H HvIHH蒥LHH$ HH LuMh H](H<$ e L;%+ < HD$@1LHHD$ VHD$@LL$PHD$M{H$ H9HNHI HD$([HH HD$MIH $E1E11HM9N HHA C: &t/IM9uLuM5 HH](H$!L $H)L*HH I $ HD$H@J,IIHLjLuMx H](HH$H$ H9HNE1He1HGIMH$I9 L9}lH ;tHHoL9}H +uHHH)HMIH I IEN4IHuMMgHĘ L[]A\A]A^A_LL$(讶IHtH\$1E1Lt$Lt$(Ll$HD$M)J H9,$tXHT$LILA H* HHx3HM,薎HH+ H IGH HMHLdHHH "IGH HIoH|$ 蔙LML|$L90LH)HHHI IGJ IMoMML9H5c ;tNHL9uHL耤H@#HL`L LLH)HmHHI GIGJ I%H|$Hƈ $H $HH H$PE1L 11HD$8Pj juH HHtfL M^L% RH J HH$HRE1LD 1HD$8Pj jH HHE1NH L|$M{HYH D HBAVIAUIATUHSH(I>IHtuH9LHH#I 'HEH9~0H߾ H)HH!HHHHH4[]H)A\A]A^ [H]A\A]A^L AWAVAUATIUS1HHI1HAPHIHH IHw1IAHH9HHtrM~Hz AHr(HHIL$HIt$(Hz HB(HHM~#Hz AHr(I\$HHHHZ[]A\A]A^A_AQHHE1 1HHIILZ HH9|:Et"H~8At H =HkMuXH HH AAH7HH9s H:uH)H븐SLHIA THxH[f. AUE1ATIUH,7SAP IM9tHxHH)O7HuZL[]A\A]ff. @ AWAVAUATUSHHHH(H H H HH H H?耤AŃ7LcMQHK(McI1E1HIM)H93H< t:< t6HL9sC< uE~HHII1M L9H)HHH)L9I1HH)I9L1eIH Hx HH(H{ }H[(1McHHQ< tQ< tMHHL9s{< uE<HMƾ HHLD$II)LLp4LD$J01HiHRE1L/ 1HD$ Pj j> H HHmE1H(L[]A\A]A^A_A jPE1L 11HD$ Pj j H HH(H|f D USHHHHHoH$Hub1ILD$H F H" #xHuH<$ x61H0 HWHT$HHPH$HPH[]Hj1H$SH@HHt9HCH[H@ AU1ATIUHSHHH:HrH HT$HL I H$I9HT$IHSI4LLLkBC(1HC H9HN1T,HH@uHuH)A)H?L,H9|H[]A\A]f. UIH1S HA E1I4H9}OI<E1B< tA8A8u#HH9uI1A8}LV1LL)MӺ I1HU L[] AVIILZ,AUMATUSHz LBHjH)z( H2IL9 L9?AHфt L9rE1M9LHIMHH9}$D,D8,tL)HLB B8&uIM9|L)[]A\A]A^IHI)L9??AHtELb L9K ILH9HOI H)L9r ;L9sO?AHфuH)LH9JHH9*1D4D84HL9| @ HHwH-H( f. APHA H Ht%Ht HYvH H5 H8~(1Zf. HwHH( ff. fHHt HHH9s H uH H H H ff. HwHtH(H=j HdHt HH9s"H? tHH H DfHwHAH( ff. fHH9s7@t? x8HHH#Gu"HHH9sH9tHH H H H f HwHtH(H= HHt*H1H9s,H] uuHH H Hc HwHؿH( ff. fHǿH t H H HH9sH H HwHH( ff. fHxHtHH1E1t6t6AHH9fHe tׅu A 1H H ff. fHwHtH(H= HHt,H1H9s.H u HH> H HcqHBAVIAUIATIUSHI>HHt]H9HHHI IEH9~H)L1H[]A\A]A^4[L]A\A]A^dkff. @ AU1 1ATUHSHHXHILHĈC LHkH4$Ll$HH[(I9?LH;u0HJ<+L) HH|$ tLWHXH[]A\A]HH~Hf AU1 1ATUHSHHXHILHC LYHkH4$HT$HgH[(H9?II)J<+:u,HLJ~HH|$ tL藉HXH[]A\A]HH ~Hf HHwH H( f. APHAH: [Ht%Ht HYpH' H5ݨ H8"1Zff. HBAVIAUIATIUSHI>艵HHt]H詑HHHI IEH9~H)L1H[]A\A]A^[L]A\A]A^Lff. @ AWAVAUATUSHHHHH H% HK HH? E1HHkH1H[(MIH 1H9 H3< t< tLvL9 LH99<3 Lvt>EIEH)H@|IHHLLLI9}|3 uLvHiHRE1L 1HD$Pj joH HHE1HL[]A\A]A^A_HgPE1L 11HD$Pj j$H HHHff. fATIUHSHH}H~I4$[H ]A\鄼f. ATIUHSHHoH~I4$[H1]A\§H5 f ATIHUSHHH HHbHtID$H9[L]A\bbff. fATUHSLgHHHHL9H1IHSzH} IHU(MtHtI{ LHx[L]A\ATIUHSHH_H~ I<$[ƃk[H]A\mfATAUSHq HsHKHHJHS(A~HsI[H=$ ]1A\UHH*,HsI[H]H *T 1H= A\' 1 ff. ATH AUHSHpf 3HHtMHxH5 H9uEHC@ HSH9u7H]" H9Pu*HD, HHH~H[]A\a5uH5HAWAVAUAATUHSH8 H 1HIH LuH I Hz sHHtxHi H9HS ԼHE H{ [ HH8L[]A\A]A^A_L% I$vHGHx( A\|H2m fHnIfI:"HH 1Ht$ H )D$ H LH!HػH H9HS E$Ho HJ HUH t M H tHHR H91HCHH9HLHEH5g HPH H81|E1H$HkHD$ LsE1HD$M9}uHCHT$HN<IL=HT$ H H<$LHT$96LD$H|$D$3L;sIH$Hx ~)HL 1*DLHIHH<$L}HfHGH t* tGHWHHuHHt Hx ø Hh HH1H9~H< 41zH H SHh H HHH[ ATUSHHHHF ~ L% 1L9@" HL9u HH[]A\f AU1 ATUHSH8 ILE t$Lm@ ŹH]0L Ht$$LHD$ HHD$ H蓕HH J+4H w_{ 9HHʈVH9s#H tKHuH9rLmH8 []A\A]E r@aH0H)HH H5c H81yH<$H1뫄ɸHH1҉L9}H5wH HG0SHgHk0[ff. %ff. H'f AT1I UH SHPHHHHC|C H,1HL) HH|$ tH~HPH[]A\f. AVAUATUS HrH8 IAF, /HGx { tHkPH 1H{h1qiD{$ HCp9 1Mt$HCPHS@I)M&HeH1H{hHCpA[H]A\A]A^L9sx}:I4$LHHFHtHtHxMEkHI)H~AtHuHdHxHHeH龹(Hs@H)HIT$I<$Hs8H9xHr HHH1@t @t fH@tHk@] ATH USHHH fHnfH:"HpH')D$ 1fHD$0 D$HHT$PD$ D$8D$XH{HqA HbHl$ H;Hzd+I(t$ H, HHkHpH[]A\ D H; IL tHALHH HHH5 H81u HHwHH(A Hk f. HWHHHzH+x HHzbf. AUATIUHSHQHH LeM HL L9 H}0C H} HE(LH<HtH)D/'It$HxH2 IIH H Z[]A\A]I<$蹦IH*HՂLH*HtLeMtHOAHA H5% H8b1H' H5s H8H1wHHwHH(AHq |ff. HHH1ff. fHG HtH USHHHGHH@ zH HHt HHzH@ qHSHH=F 1"HHD$HD$HC H.H H[] ATUSHHHHHHH<HH0HtJL'MtHt5H;HsHjH{(HL[]A\o ع E1ff. Lm f. AQIIHH5 hfXIpHXIx( LAX AWAVAUATUSH H|$(HT$HrH|$pH1I H|$HLH$ $ DŽ$ HD$x IHu DŽ$ HD$HxH = HD$`HwpHD$Ht$0H 1H\$(MT$HII ;%Lkt2L% LH H)LHHH)HI1HD$hC<%<( LE1E1Il$Mt:HKPwH5' HcHD<* HE HD$ HIcDA&AA. H AM wH H)Ht$H|$HT$` IHWHu 1$ Ag~_AMw' HA \ d HD$(LCDDH5 I)H; H81oAD~AE"wHJ HcHHD$MH9D$`} H|$0 )|$H H|$LHĨ []A\A]A^A_ICH;E pH|$ dAZAPHP EHcAH H|$LLH$ IH ICH; AH|$ A|AXhEA I{ IMCMK L\$hE\ HD$ A L9IMLIpH|$LIT$D\$@LL$8LD$ uIHILD$ LL$8E1D\$@DθM9 A ELLLIM9ټH|$0 YH|$hH[QQHD$0 H~ /% I!X hAbLLDML)IVH'HD$H@HD$1HD$`HD$0H|$Ht$HT$`HL$ HH,H@ HL$ HL$8,{HL$8HD$ H&H|$ $Il$IǴD)HA.CA-Hl$8HD+A*H|$Ht$HT$` HHH@ 证Aă{1EDHHD$8HhH DkHIcL9Ht$ IA H9HMI鑴H|$0 HH{IKI <(TIIrAE <)uIT陳Lh HD$hH]yff. @ H H9 HHyH:HyHHi f HIHHt$ t*PDE11HD$PsZYлHD$HLD$L11q%ff. @ SH0 HH IHSHH9HKH= 1[Vf D SHHxHHSHtH HRH9HOHCHj H [ff. AUATUHHSHHHH H2IH&Lm I H]H HC ͼHHt$OHHHH;D$~IuQ1HHHL[]A\A] IPHA 1L-[ HD$(Pj jH HHV=HMHA Ht$HHHHD$!H;D$<HT$H`H 8 Tff. ATIUHSH1H) H*LHH[H]A\Jff. SHtHcHH\3HH[f. ATHBIUSHH HI,$HE } 1H1HH]ѵHHH HH=o 1[]A\}I|$H;= tHG ƻHt$cHnHHD$H;D$Ht${* HWHHHzH+xTff. fPHGH5 HPH H81OgHZf AWAVAUATUHHSQ* HHdZH[]A\A]A^A_ff. @ U SHXHHZjHt$1`HHHx HT$Hx(C H9sH lHXH[]ff. @ AWAVAUATUHHSQjHHZH[]A\A]A^A_ff. @ AUATUSHHHHt$ VLcT$ MvLk(LLHH;H{04@LIt-I|- H)It$HpH H H[]A\A]ff. Hx&H;w} HG(H 0HHH H PHM H5rw H8n1Zf. ATIUHSH HH{L[H]A\ff. HBAVIAUIATUHSHۼI>IHtuHsLHnHI ̼HEH9~0H߾ H)HH!HHHHH4[]H)A\A]A^ [H]A\A]A^l4頼 AWAVAUATIUS1HHI1HAPHIHH ͼIHw1IAHHCHHt?L@ M~ LHDIIL$It$ HM~I\$HDILHZ[]A\A]A^A_ AWAVAUATUHHHSH(H H HL HH@ H{ H?xAŃ1LeH] Mc1HHE1IIM)H9H< t:< t6HL9sC< uE~HHII1M L9H)HHH)L9I1HH)I9wL1kBIH HH 1McHHQ< tQ< tMHHL9sw< uE HM HHLD$II)LLLD$J01HRE1L 1HD$ Pj jH HHE1H(L[]A\A]A^A_A PE1L 11HD$ Pj jdH HHLHYHxf D HHwH HwH S HwH HwH HwH s HwH HwH 3 HwH HBAVIAUIATIUSHI>HHt]H9oHHHI IEH9~H)L1H[]A\A]A^T[L]A\A]A^0鴹ff. @ AV1 1AUATUHSHHPHILHcAC L}Hl$LkLs H4$L9HAH[ H9Cu$HH|$ tLieHPH[]A\A]A^LL?HHLNuLI<.H){?Hf D AV1 1AUATUHSHHPHILHbC LcHT$HkLk H4$H9GH~BII)K|5 u.LL>HH|$ tLdHPH[]A\A]A^HI H9CuHHL>H D HHwH HBAVIAUIATIUSHӸI>ɐHHt]HlHH>HI ĸIEH9~H)L1H[]A\A]A^[L]A\A]A^T.鰸ff. @ ATIUHSHHH~I$[H ]A\߂f. ATIUHSHHݸH~I$[H1]A\颂H f ATIHUSH HHkHH2HtID$H9[L]A\r-ff. fATAUHSHHt,HHE1HP H5 HHHH[]A\ D HWHw 1H=w rf. UHHSHHF ~ 1H;- Hu HH[]馸 1f HHFH ~ H AWAVAUATUSH8 HG VH_HIG @ +LgH@ HT$0fv@ H9H)D$HOH)D$ HոA$ E1E1HH9}LLp = t |4t|0uDl0ADt4AA A DDHcHcH|?HT$H $+IHoHH5 foL$H $MG8LEw0MWAOfoT$ M HT$Eo4AW HHs{H 1 HcA1HH9}9LӬ= t AHL8uH8 L[]A\A]A^A_1LILHJHHtA kff. AVHBAUATUHSHHHLm IE A} OH H}L5 L9)HG Ht$IHԶHH;D$HHuL9t8LLI]OHHHHH=` 1[]A\A]A^n1Mֶff. @ AWH AVAUATUHSHAPL2MfH9Fu< H3AHFAI9HFHEl6 1Z[]A\A]A^A_D IH_H; \H@H3 ZHL9LHm S HHHHH T L HA A TtCD2= LHD8= 1J0DHD81ÐHHH 1ff. fUHHSHAP莖HYHH[H] @ SHHdHźHPHH[Uff. H Ht$(HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ H$ HD$HD$ D$0 HD$ H ff. @ AW1 AVAUIATUHSHX Lt$ LHHt$DLD$@ HD$( HqH D$< HL= E <%tIHIl$H LeA $1.A$:<%2 1<lm E1A<$z HA $L)HT$0HBHD$0%A<yIcLHLqHX []A\A]A^A_AE u8E / IUAE HHH5. 1H!)/w^IUAE HHH5{ 1HHHHLH HHH|$ H1KIUHBIEIUHBIEe/w(IUAE HH5e 1HuzIUHBIEAU /wMЃIEAU HH5 1H6H>HHLH HH;IEHPIUAE Eta/wNIUAE HHH5H( 1HH HHLH{ HHIUHBIE뱃/w%IUAE HH5' 1HdIUHBIEڃ/w)IUAE HHH5' 1H+bIUHBIEAE /w?IUAE H*H8H HHHL HHIUHBIE1ɀ| tHH9uAE /wcIUAE HHH5hs 1HD$<X[<x*HtHHLH# HH,qIUHBIEAE /wMIUAE HH5o 1HHHHLH HH IUHBIEAD$<dt<u IA AE /w'IMAE = w HT$0HCdIMHAIEH H5 H8{AD$<dt<uI sf D UHHSHAPnlHtHHHHZ[] HG(H+GHCHGH YHw1H ff. fSH0 HH /HSHH"HKH=v 1[Vff D SHH^HHSHtHHRH9HOHCHj H [ff. HWHH۴HzH+x3= QHH H9FŹH~ Z HQ SH@ H H9u11, HH[HH5 yv AUATUSHAPD-& EnH IHH5(v & 1H@ 1N1HKXHHsHHsXHu(Hu*HkXHLcH1O& ZD[]A\A]HE H)ոf SHWhH'H{ H{Ht 1HCXHCH[H@ VjHcYɜf H S1HH H|$Ht$H RHt!HH<H~ HH[H̷1 HG(uHWBuH AWAVAUATUSH G(} HGH@l Lw8H`HIQzIHc {X a M Lc{\EHUHB`H` A H; Ll$0 LLPyL$ HCh LLH HD$HD$fHnHD$fH:"HCp)$ H HD$HCxHrHL H$ H H$ H$ HCC(@LL LL H$ H$ Pj $ $ LL$PL$ H$ H$ CH LQH []A\A]A^A_H AkH HH0}HH9Hs81L_ H H LLHH[]A\A]A^A_ HHT$臉 HT$HukH; H踉 H H5UJ H8zHɹ H5x H8bH{ H5 H8DL;}HL- HHtH LLH[]A\A]A^A_V H' H5q H8댃f D AUATUHSHQLoH(LfHv(?@2>@ \u#M9u HH8 ¸ tZ[]A\A]Hָ H5 H8o1ff. W$;V$յ19~HO0LF0H I; uHHu 1f. G$HO@HHHN@HHW8HOH9 F$HV8HNHH9 ҉ff. @ Q蚮H H Z D HBAVIAUIATIUSHԶI>y{HH HWHHH 1ISI|$Nu_HytDO"1HHIID$H[]A\A]A^5I~<^ŃuHIT$H)H9XHkGH۵HYf ATIUHSHH7H~2I<${zHHHVHII { H{8 e{, MHkp H{h1HcX{$ HCptH)HHx{ tHCPHHCPH4HHH1H{8HS@>'H1H{hHCpeH[]A\駵 D H HN H f SHH8csH{Ht 1HC跰H( H [f. H f. Q sH[ H Z D SHHCdH|$HHD$HD$H[f D SHHHchH߃[H* @ SLIL7HIHHLڅu, HHfJHfJHfJHfJH9rHH_1H)HPHHHH9HBHHH9HBLH4L9 I)1MI9LBLI[HHfJHfJHfJHfJH9rHH_1H)HPHHHH9HBHHH9HBLH4L9r(I)1MI9ICHp4f4HH@4f4HHff. AUATIUHSHH5l AQHpHt'Lh HIE 芮AXLHL[H]A\A]Z1[]A\A]f. AUIATIHUSAPZ'H1HLH~HHt@H@ teH{u^LkHIE LHZL[]A\A]H="e 1LH5Wk A HɭMtL輭E1HH H59 H8H虭MtL茭H脭fAU1 IATUSHHhHl$HHBHjI} 1HG C HHײI}H;= HG Ht$йIHH<H;D$oHuhH|$Ht$ LD$LHL$Ht$D$r-HT$HHtHH=hJ 1XHH|$ tH1HHhH[]A\A]I}XӱH|$Ht$ uLD$E1xff. @ SIH@H ! H|$HHt$Hk62Ht$0H|$ĎLLD$HIx;6AoX)\$ f(T$0f\T$ )$$L$H@[ffG fW)D$D$L$if ATBUSH H|$R IIH5J H5AoP)T$MD$A tjff.D$zt,E11D9 H-IJ HE H H[]A\D$PHHtLHS9HH訪HH5 L5AuWH5 L4 L$fA.L$AD$`Z1f.D$DDFH- RHl$L fHnf.E1f f.D$ADEH-~ HE @ SHcGLG M EQMYD~)lj> ~VxM9 AAMYtqD҉) 1 ?H M9r H [fHnAq D)Ɖ ?H M9sEAyHD 1Dҁ ?H 뮃 tD҉1)1 ?H 1 H HH9WuHGNATUHSHH H t(H+]E1Hx9L;e}3J|HIHH5& H9h H H[]A\ @ AWAVAUATIH~USHHHFHH H H* L/M1H H_IEL5 L9 HtHC LL HH <H MEI@`H4LE1H Ht LKIA`HH [ LL1AŅ HNEH# HHD$ H|$$ HD$ H H{Lr1ˮH~HH H HD$ЦD$E $1Lf) $A$0 IHt f( $HHHL[]A\A]A^A_IEL5 L9 u1HlLHHt<Ht$(HHt$(MLHL Et H> YHHHImD$7H ZLLO0G鵬L@I@`HA U]$\$EtH蔥A rLH M9A 1HtA iaHZQE1L HHL$8Q1j jH HHE1{H 3H L5 HP L9WLH u1 D USQH~ H_ *Hu 1HZ[]HHahHH膤HtLEH5 I9tL.H IPH5 H81:H1;f HGO- D$r8"kD$H Jf. H~%ty Tz f(fTf.rGf(fTf.r9f(wH(z fHnf. D$1D$Hf.D$wfT{ f.L$vƐff(f(Hf$f(fW5x fEf(fL$fW=x f(,$f8f(f(Af(f:f8f/rQfA.zf(^YfYXf(fXf\ff^),$$L$Hf/r6f(^fYYf(fXf\Xff^)$$-z ),$ff. UHSQHHHH>H߉$Z[]ff. ff. fH fD$Bw fL$fWD$)D$L$D$ @ fD$fL$f(d$fT$f\$f\d$)d$L$D$f. AVAUATUSHH H9GHI IH1HT$HH|$Hx Lt$MIH=K ZHHI$L`HE HhI1Ls H߉s(H|$Ht̠LHa +HH[]A\A]A^f Ha SH@ H H/[ff. @ S: Ht#H HHCHt |bH[B1ff. H SH@ H@ u,H= YHHt11fC(HS CH[H 1ɉ HS HH HK naff. USVH V& Ht HHZ[]Q HHt1r HEHt!1H= & HM u HE H- & HHPff. SH=He# #YHHt1fHHC CH[USAPH˨HHH=n# HHt31HH]H} HI1HH1HM`HZ[]ΨP Z D H èATIUHSHH0 H{M[H1]A\ AUATI1USHQH Hw L@ HlHxLHH? HQH}HE Lc 1Ao f:C(Z[]A\A] ATE1IUHSHHHDL$ o H{HLL$ M1 HHݧH9CCH|$ HS HhHP H[]A\f. QyHHH 1ЃZff. HG8ff. AVAUATUHH l# SHH0HGH9kH0H[]A\A]A^ f AWAVA AUATIULSHHGHL$T$$AՉt$(ALL$A A^!D DkHL MuN<H[H|$ HHL$k*4HL$L9L IHtHE J<J, HHL[]A\A]A^A_PVHD$<Dk IH19r<Ht$DHIt IHE Il AT$9ܩE t$EwwIT HtHIT H SH HCH[H@ SHHHt 1HK(H{Ht 1HSH{ Ht 1HC 1[ff. ff. kff. H Hh Hh f. HHHHXff. AUIATIUHSQH_HxH| HtLAՅt1Z[]A\A]f D SHHHHHHH{HH[AVAUATUSH H H{ H H{ 1O G H HHGL`tzHHHLhMx MLpfIv@LqHH HC LuLm L`Hg* HkHHW* HC[H]A\A]A^HkHHLhMx M$fLpHpH@@yHH H5 H8h1 @ AUIATIUHSAPH`HI]0H;Ht LՅu)H[HuH LHLH Y[]A\A]éff. fH ff. AUATUSHHH LGH0L" Ht$HX HH uH HHaH<$H+|$ HmHH6@ !@HE0HL$D ut H9 $~=T H= fDHHL@@A40@pH7PHvH$H1H= U a1H[]A\A]ÉH LH0!Ht$H }HHj jH IH L,$H\$H LH)H9I9Hc VlHH@ @H]0Ll$L9,$"L菖H$H1H=7T z0LL* \= ا= HZ Cu H2 KH:HK47@sH:HYI47@1HAWGff. @ UHSHQHP> HwHPHHCX1HHHHE H9^蟕1Z[]f QHMHWH _HZff. UHSHQHPHSHS`HǸ HHNHGH9HOHU 1Z[] HPw HwX1f HwX1f Hw`1f Hw`1f Hhf. Hh f. SHHZHH;HHt{1[ AWIAVAUATMUSHAQB IAAA LrH@xH1AIL9}>L| Ec2 = wyLH)H9=HHHLLEmEL=P HH%L9}(HLDHS|HL1HHZH[]A\A]A^A_=' = gff. AWAVIAUIATMUHSLHH> uHE H { LD$XHL$PLMHLL{TI4$H H} 6HH}H@ sHL$`1HT$HH5 tHD$HPH VHL$`HHL9H H\HD$H[]A\A]A^A_7f UHSHH5 L QHP7 H"HUX1HHHH@HHHH91Z[]QHHWH HZff. UHSHH5K QHPHHU`HǸ HHHNHGH9HOHe1Z[]ff. @ HPH5BK `W Љu@HGHpÄk@HGHff. SHHHF vHt$蝝HH}H H;D$rHH[AZff. AV1 AUATUHSHH`Ld$LHBH;H} 1L* C L輵4HH}L5 L9wHG =Ht$˜IHH7H;D$H,HUL9tYHt$ H|$L HT$ HHH=l- 1;HH|$ tL5+H`H[]A\A]A^i1ff. AT1 IUHSH`H\$HHBHI<$1H( C H萴H~EI|$H;=^ t7HG Ht$詛HHXH;D$OHt$ H|$HT$ HH(H=c, 1:HH|$ tH,*H`H[]A\ff. AT1 IUSHHpHl$ HHBHI<$HG ' 1H',C H HUH|$ Ht$011Ht$yHT$HHtHH=+ 19HH|$( tHX)HpH[]A\I|$H;= HG Ht$?HHHD$H;D$XHT$Ht;I|$HT$8HT$H|$ Ht$01Ʌ/HL$%H|$ Ht$01遥fAU1 ATIUSHHhHl$HHBHI<$HG 1HR&C H QH I|$H;=ו -HG Ht$ IH,HH;D$ H I|$7H|$Ht$ ubHL$LHt$ HT$HHtHH=) 17HH|$ tHq'HhH[]A\A]H|$Ht$ E111H|$Ht$ 1ff. AU1 IATUSHHhHl$HHBH`I} 1H$ C H记HͦI}H;=y HG Ht$IHH,H;D$eHuhH|$Ht$ LD$LHL$Ht$D$ b HT$HHtHH=X( 16HH|$ tH!&HhH[]A\A]I} 6ɥH|$Ht$ uLD$E1x٥ff. @ AU1 IATUSHHhHl$HHBHI} 1H# C HNKH*I}H;= oHG ?Ht$`IHHH;D$¥Hu[H|$Ht$ HL$LHt$*HT$HHtHH=' 1A5HH|$ tH$HhH[]A\A]I}43H|$Ht$ 1ɅuHL$IfATHBUHSHHHLe ID$ A|$ H H}H;= ݥHG Ht$<HHoHH;D$gHLIl$ͺHH@HHH=% 1[]A\(4醥鈥ff. ATHBIUSHHHI,$HE } aH1HH]c HHvHHH=f% 1[]A\3I|$H;= tHG Ht$5HH(H;D$tD ATHBIUSHHHI,$HE } 8H1HH] HHMHHH=$ 1[]A\2I|$H;=* tHG ZHt$uHHH;D$t̤ AUHBATIUSHHH,M,$IE A} H I|$H;= {HG Ht$ےHHHGH;D$)1HHLI]! HHHHH=# 1[]A\A]1 ATHBIUSHH HcI,$HE } 1H511HH] #HHH HH= # 1[]A\81I|$H;= tHG "Ht$ϑHʤHHD$9H;D$ߤHL$w醤ff. @ ATHBUHSHHHܤLe ID$ A|$ %H H}H;=Ս HG ΤHt$ HHHH;D$HLIl$EHHfHHH=! 1[]A\0鬤鮤ff. AWAVAUATIUSH HL$HF H H\$`1 IHߺ Ht$HH$ DŽ$ \ H I9FLd$(Ld$0Ht$HD$P HD$X E~ EIFHD$A MnHA@AM44ALt$8H|$ A AAA!HL$(Ht$8IH9^ E D$p H$ LT$hE1DL$tL HI)HL 1Atu A9O HA4EHHH Ht!1Atu A9: HIA4HH1Atu A9 HA4EHHhHEAtE A9 HOC4HHAtE A9 A4GIPHoAtE A9 CtHOIPHAtE A9 LBA4HyLM9nH|$(L$ H|$PH H|$XH HsHĨ []A\A]A^A_H H W H W ׃LD$hH$ 1fAPHHDH9 ADE fu@tHL$(IH$ L+L$0Ht$PH _' LL$@ILL$HRH= SHD$8PHD$pPHD$hPHD$hPH|$@LL$hLD$`_H0H|$PHtDH|$XH 1 AH9T$jLDhƁ t+H xHD$(&EtHl$(H$ LL$( @sHt$(H$ aHL$hT$t!H$ HHl$(D$HH$ Hl$(L9CE AD A9s!HĨ []A\A]A^A_RM CHD$8IL=)< HD$HD$0Ld$8HD$Ld$(L;d$8A<$IH LHZLH~H HO H87 ta+L+d$0Ht$PH j% LLd$@ILd$HPSHD$8PHD$pPHD$hPHD$hPLL$8LD$HH|$@nH0GH|$PHPH|$XH8H|$`Ht7~1H;- HEH uQ g} JH}uv1Hˌ= tQHxRHI}Ld$(HH= t H= Hy鴞H}颞骞 D USHQCH|HHHHHA}HH H9HCH :HYH= HZ[]f D SHLD$AHHL$HHu HH[H[ H:P̀w 1Ht Z y3H; 1 ; y#fAV1 AUIATUHSH`Ld$LHBHɠI} 1LÅ C L誡|H[I}H;=u BHG Ht$輈IHH(H;D$̟HI}j'ÃH I}L'>H|$Ht$ u`LD$HL$L\$Ht$*HHt L$HT$H1H=9 X'HH|$ tLH`H[]A\A]A^E1+f D UHSQDHHt HH H蛥HHzHHZ[]f D UHSQeDHHt HH H[HHzHHZ[]f D HG HGf. AUATUSHH~HHFHK LbIQA L= HHL$Q1j j H HHIH/ٟHcBIHH LIyI L% HC HLHLH*H{LHHgH{HE HkH)HO LkxHHC *2foN 1HC`HC@H=&# CPH9C؞H+# H9EC C,1H[]A\A]HHIH馞ff. AUHBIATUHSHHMe ID$ A|$ H I}H;= HG Ht$:HHH覻H;D$r1HBHLIl$/HH`HHH= 1[]A\A]$鉞鍞ff. SL IL 7HIHHLʅu( HHJHJHJHJH9rHH_1H)HHHHH9HBHHH9HBI1H L9 A HHHJHJHJHJH9rHH_1H)HHHHH9HBHHH9HBI1H L9s A HI)1I9[J HBIM D AV1 AUIATUHSH`Ld$LHBHH} 1L!Å C LڛIH}H;= uHG EHt$IH(HXH;D$IH}!ÃI H}|!qH|$Ht$ u`LD$HL$L\$Ht$HHt L$HT$H1H=,4 !HH|$ tLH`H[]A\A]A^E1^f D AU1 IATUSHHhHl$HHBH I} 1H C HnH I}H;=9~ HG ٜHt$老IHHH;D$uHuhH|$Ht$ LD$LHL$Ht$D$貹HT$HHtHH= 1T HH|$ tHHhH[]A\A]I} H|$Ht$ uLD$E1xH|$Ht$ E1LD$a鵛 AU1 IATUSHHhHl$HHBH@I} 1HC C HH I}H;=| <HG Ht$IHH|H;D$HuhH|$Ht$ LD$LHL$Ht$D$ BHT$HHtHH= 1 HH|$ tHqHhH[]A\A]I}Z H|$Ht$ u LD$H|$Ht$ E1LD$iE1a̚ H ff. ATUSHHH| LGH0LuJHw LH0yHHH$H H=01 []A\ Ht$HӚHHL$$? LH+l$H GHH@ @H{01H? HIHFHLHH=. [1]A\: f. H ff. HHm{ LOIH0LsuXHv LH0]Ht$LxuCHy HT$H=y. H W H W H1 Ht$Ltpkff. QH UHy H ZfAUATIUSAQH H-HM1H9 HULkL9$u)H HtrAXLHH[1]A\A]JL D AWAVAUATUSHHH̙H{L#I?IH5 H-~x I|$L LH={u LH I|$Hz H4$IH4$H=Mu IH+ L9" M I9 ID$ Lh ]HkHtpLHHHHttLnIHBHHHLQLnHnLq?HHtOHBv H9CtH4KHH{HԘHLHLy麘LbnHxtHcHw H H[]A\A]A^A_H L肇H$H~HH HD$jHT$H<$H11JIHAHHh GLImM LHL[ߗLmHmLE>HHu雗 AUATUHHSHHHH H0IH$Lm IH]H HC ˗HHt$yHHH[H;D$|IuQ1HHHL[]A\A] IPHA 1L HD$(Pj j螂H HHV;H}HG Ht$ZyHHHD$įH;D$=HT$HcH : Wff. @ ATIUHSH HƙH(LHH[H]A\阽 SHH Ht$XHT$`HL$hLD$pLL$xt@)$ )$ )$ )$ )$ )$ )$ )$ LD$(HT$LHt$ Q H|$(H5# HO H9a HH9( W HH98 C H# H9G(2 L7 LD$ I@Hx8 uH@H r H9H! LtHt$HtL1 H|$jH$ HHt$0D$0 HD$8HD$PD$40 HD$@HHĕLD$ H|$(HH5) I@HH1 H|$(QjHIjHt$H|$H R Ht$HD$ H~8F@HF8H5H$H|$HD$H [H HT$Ht$ 1HH9uHT$H|$(L1 D AUIATILUSQHHt;H1I;\$| ZH[]A\A]ItI9t HI3uHHWi1 H8 AUATUSHAPH~ HHE1L;e| ZH[]A\A]JtHHIHthILh1HhHHu1Hff. AWAVAUATUSHHHHXHH[HHH|HfHq HD$1HT$@/HHHC(Hx HL$8L|$HHL$HL$0H $HL$@HL$^Ld$0HT$HI$LHD$8IHHL$HHLHSLAgLgE|HC(Hx HL$MH$Ht$){uHXH[]A\A]A^A_ AT1 IUHSHpH\$ HHBHfI<$HG 1HC H迌1HDHt$0H|$ E11G HT$0HHH= 1HH|$( tHHpH[]A\锓 @ SHHL$QHHL$HHu HH[H+n H:P̀w 1HD * ybH$ 1 yRfH HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ IHHHD$HHD$ 1$ D$0 HD$ H ff. AUIHATIUHLSAQHHHHLLH HHtMe1HCeZ[]A\A]f ATHBIUSHHHMI,$HE HH H]H9ɒH4 1HD$HHx 1HH9~ED <'<\z< ^< B< &H^ߑHH H)H|$. Ht$HHHH= []A\Q镒ff. HG8Hu Hm H H f D AWIE1AVAUAATE1ULSHH(H4$Lt$L9H(L[]A\A]A^A_H4$LDLT$MLVLHA3LT$1K491҅HIHIfAn fnE f8?f~E f~ Hf. AT1USHHPHGH H HHt Hx ̑HH7 ÑH$HLd$HHPL[]A\ff. @ ATI1UHSC HH[]A\f AWAVAUATUSHH8Hl LFH0L H h LH0Ht$ Hj Ht$(H HIH HLh IHpH)HHGHt$ LaőLt$ ID$KT5 Lcl$ L)L9% H HcH*< BRу ?% LFa (= .rHH K.H= 1H8[]A\A]A^A_Ë**몋*Ht$ Hf Ht$(H Q HpIH= H\ HHHHH_Ht$ R HAw`A'HHcL$ Lt$(HHl$ HLH)H9L1H)H?IHHKEL E II93LLH=) 1LHD$_L_HD$HL ( 5AwKcLfA IHfA IfA@ L_H{HW)1`Lh_L^_ff. HHH5 `;ff. SHi H<u<W<t.W<f W-t _H8 1tj32 W- HW<e͎ Îb l [À6 W-t _HW<eg ]bt8 ltB 8 1[À_F< [ø [ D t+w w1 Á( 1à 1ø HBAVIAUIATIUSHpI>%HHt^HHHN]HI\A|$H ֏A|$I dHxIl$H[]A\A]A^x|龏ff. ATLg8UHLSM E0 HLHriHLiE0 H[]A\ USVH? ԏ1H_HOHmHHf\HHZ[]ff. H ff. AWAVAUATUSHH( H}f LGH0LHt$H˒Ht$H<HIHH=X& sLl$E1HLH9l$~kHL[ AHD$ HD$HH & D A A HHH)L9| IH뎾 LHl$0IH @ @M~0HD$ HD$L94H= HL1LHZH( H[]A\A]A^A_LLwA\Ht$ ÉH.& ې K *He AGu HAWH0IW AOH0Lz H BI @ AUATUSHHHTd LGH0L]ƐHt$HHHHeHHH $Ld$H HL)H9YLE1H9 L.IH@ ܐ@ːMA0f5 L9LHMXfA: Xc?= $=' A ' = ϏELA 1H0шGAAsMcICD+;OD+^ff. AWBAVAUATUSH IAHAE( IE@ Ha I]8H9F Lt$P LLt$( LH"` ME`H|$OL9H"Iv(H|$N"T$OH_ D$N8E1E1LL$<_AE\DT$OI.I]8IN@MMxMEpM^8HL$IMhE1 Lt$0ML|$ILMDd$<IDT$8L\$ FHMH|$ LLD$HL$T$8 J HD$ I] HL8I;,$|Lt$0L|$ Dd$<tQAuGHD$(I9usH ^ H|$(~L H|$ gD$E1E1ҋD$LT$uAtHD$(I9 H ] I9urAug1E1HL$LT H|$J H #^ HHĨ H[]A\A]A^A_F(,HFHL$PLv8HL$(@ I9tAu 1E1HT$1E1Hl$L H|$ H %] Lt$0L|$Dd$<HD$(zI9u H "[ E1E1L\$Lu H|$k H Z f. U?SH2HH5y HcH8H[]Ë9f. Hkf D ff. APH I o0u^HW Hw Y;ff. H mHI,9ff. S1HGI[H{8耜H{XHt 1HKXLTH{`HHH{PH+H] H [ D HG(Hp H8hHG(HpH8hAQHHtWH9 H~ H JE1CE1HLILZ 11HH9t: uHI9uL9}LFHcAH/u AuH~鍎ff. USQHHHF H~Hn Hv'HHbH HHǺ 'H߉RZ[] 閏f D HH[ H<$Ht$Hj HH ATIHUSHHHHT$2x\Hl$HtfI|$HHx6L$$Mt: HLwLMRHERH[]A\H2RH R1f. SHHHsH;1[ 1 Yf SHHHsH; [` Xf D Xf D SHHӍHsH; [ Xf D H~ t/ATUSHHvIIH H;k|L[]A\HGHH{HtL 7|HHHY H<$Ht$H(g H8H SHHPHsH;[E D AU1ATUSHQHw(HvH_Y H{Hh IHSHs H{,HH2H{HƐHIKPM"H{Lk5PZL[]A\A]f. SLhW IIL_M9tH T I9tLLtIMYM9tH ~T I9tLL辜t LL[1HL覜uH;U H [HL芜t @ UHSQHHjHHH HHHYOHZ[]fAW1AVAUIATUSH8HD$H9NLFL;U I L S M9t H5XV I9tL I$L|$(Lt$PHD$(LHHhHHHH\$ Hl$uHHL2 HNIt$(I|$ LL=uLqNHW HHQHH8[]A\A]A^A_LL6KI}LIH89HD$L|$(H$HD$ Lt$HD$HML$HT$LLLcat=H\$ Hl$LHHH#uHHL; t雌HW H 2fATUHSHHH LcI 1LD$ Hߺ H56 [!tzH菀H8'HHH|$HHxL`H@ H[V H9GuHHC H, HHC(谱HH[]A\H\$邌 UHSHHHvH?HHuH3HH[]逌f. AVAUATUHSLwHIu2HG HxjHhT H9Vu]H;F}WLdI$[L]A\A]A^L讇IH?E1M9}HEHJtyHKDIHuH[]A\A]A^QUSHQHoQHHt 1HSKH@ XH[]Kf H)" UHSHAPH9Hu HsHu+HS HsHY[]4HH=> Uu騋酋 ATUHSHHG Ht5HH,S H9CtH}1HdHHJH[]A\1ff. f˓ff. HǸ E1L c H9GfA D u 9u E1 Hd H|Gff. AUATAUHSHQL-aR HL؊HC NJAD$HO DHH IHH{LX A L;/Q t~LIHm0H[07G?H3H} - HmH[HHHH u 1A9 L3Q I ZL[]A\A]L; Q tif D AVIH~AUATUSHHFHωHʼnL'HjHHHHHHH LHHL`HÉHH9ډH< I1MH9t ID H1LA0 H11I9HhLhHp HX(P0H[]A\A]A^'ff. ff. SH臒HHtGH{ HtGH{Ht HCH[H@ ff. HH}P H|$Ht$Hhs H D HOHW1HwH= vf D HGHt1RHOHXG1^1Ð11O ATL%M USHGHL9u HH[]A\H-vK H9t`HPPHtfHHt^HHHt>HHL9tuH9tfH ,uHjL HQH57 H81 HF1HWB1tyHPH/L H58 1H81ZH@@1tHL H5 H8{H1UF+UHSQH J H;HtHFH D1Z[]ff. H5O T @ H5M D @ Kff. ATIUHSHHHGHD$HH`{H Hl$~P{I ݈HH;k }'HHHHk HH[]A\骈齈fAWAVAUIATUSHHL% N I$ M$@ aHHHEH N I9 HI$Y HI$ LIH9H1HLT LI$W 0LI$Y HJHHHHHH[]A\A]A^A_f D P@1Zf D SIH0H 1K H|$HH4$HA@D$(L$HIxh܉Ht$ HL$ ff.zD$(Ht$H|$ ; D$H0[ff. @ SIH0H J H|$HHt$H`A@D$(LD$HIxuuHt$ H|$3oL$ ff.z<D$(L$DfL$f.zt3ff/f/8H0[A@D$ ~ fTf(ff. fSIH0H H H|$HH4$HAo`)d$ L$HIx݈Aoh)l$行T$\$H1D$ L$(轞;!|H0[f UISHHHH-G H|$HHt$HG Ao`)d$0LD$HIx# Ht$ H|$|$H; K a1ff.D$(H# L$ f(L$0L$f. R f(fT f/ H,HT$0HD$8H fHnfHnHB f(f( uf.E 6 E f. D f.Dutf.Duf"t[! czHH[]fHnfHn sT$ \$(D$0L$8 QAoh)l$ 1먅׆!"uHsI H5 H8Tu1zHt$0H|$"kpff. f( f(Ѹ fH~SH9NHt$f(f(YYYYXf(\f(f(HYYYf(\Xff. Sf(f f(H@f.$Etf.Ef f.Etf.E f(f(\$(d$ l$m $fH~^l$d$ D$f(f(z\$(f $Yf.z:u8f(H|$8Ht$0fL$0D$fY)$$L$H@[YL$ $(||$^fHn|$ $L$YXf.z8 ! f)<$ AWAVAUATUSHQ P =p {` { Dk{IHDE1{` A H)HHDkMk`Hs L)IHNHcL9|&LM~ LZ[]A\A]A^A_I IUH ff. AUfAnIATfA:"IUHH SHHfnL$@f:"L$HH|$Pfl)$9Ht fo$ L`HhLhHX @8H[]A\A]f. AVfAnAUATUSHfnL$Hf:"D$@f:"L$PflHt\HHtnHH|$XH IIM)$HtFfo$ HhHXLhLp L`(@8H[]A\A]A^H@ H5 H8 q1Hk@ H5 H8q1V@Y@ @ SHW6t Hc[ff. ATUSHHtt@H[]A\HnH Le 1L9}uHtH|$tiH|$HHvHtH|$fH|$tBHsHtH|$JH|$t&HsHt3H[]A\ø 1 AWAVAUATUSHHXH8Ht$HH{8IIHvH{8IHaH{8IHLH{8}HH7H{8hHD$ H LHJ HC81E11ɾ HPpLjLꉸ HLhpbՁHD$1Lh1Mt Hl$HLAH9HHl$HC8H߃hxNLHSyHD$H@H[H HD$HC81fvHHPpLbHL`p I$# HQa11L HbL|$8E1Lt$@Hl$HHD$H{8I9X HD$H@JloM IHH{8IHH{8HD$HtMuK x HWU1Ҿg H@> c H& HuHtYH2 % H8` x HHT$HTH9 H{8IH H{8HHuHD$(H H_LL$(oLHLL$(GRHC8LL$(1ɾ LEHHPpLJ1҉ LLHp9`HU11Ht5Ld$(I܉L|$0MIHH9E R LLMLd$(L|$0HC8fvҾH߃hx ^~H} LH G~HC8fvHPpLzLxpE1H} D ' HB@~ Hm^+~LHF~HC8E1۾ HHPpLrLppD &^}LH^F}HC8HL$E1H߾ HPpHJHHpD ]}HC8E1HPpLbL`pD HD$HL9u4 HXV}HT$ HE IVH5n> HK }HuHߺ DHu HDH50> HK|HuHߺ wDHu HfD HTDLL$(1||HcLHt~|HcoxfvL|$8 Lt$@Hl$HIHD|HC8HL$ E1H߾X HPpHJHHpD R\| x H{LHpD{ H \{H[{Y H[{LHD{HC81HPpLb HL`p[Z{ c HB@{Y Hm[+{1Ҿw H{HC81HHPpHjHhp >zHC81HPpLz HL$LxpHiHu(HPpLr1Lpp HX[]A\A]A^A_E11H9E czHC8zzf ff. H98 H9GtGOlHHff. ff.GzLz f AWAVIAUATIUHSH8L-< Ht$AAD z( IAAD zA Ht$(1LH4$g7f. H4$f(z: H\$(L9 PՀ 1H $#7f. $zyHD$(H9$z߀J HXfAD yyEt ) HAD yHD$H)) $H9uy1LA$0 Ht f( $HH8[]A\A]A^A_E1f<Jzf(HfiA PՀxA<JxH 5 H5t H8e1@HH4 Ht$$H8nt%Ht$ $f D w& wn tfv' t\1 Á_ w3' w1à v/ 1H H1 0 1ø ff. SIH@H Q5 H|$HHt$H蛹dxAo`)d$0LD$HIxwaxAoX)\$ f(D$ L$8T$0fYT$ f:fYf)$$L$hH@[ @ SIH0H 5 H|$HH4$HxA@D$(L$HIxظ*xHt$ HS xL$ ff.zwD$(H|$Ht$% L$D$H= H0[ff. fATUSHH@HF w~ HwIHLY=LC1HL( tLbH@[]A\Lz 1f D AWAVAUIHHATUSHH L9 H$ AQLE1j>ILmAZA[t7D$ EtCAN)wH Hu)IEDHp AH D[]A\A]A^A_L$ f HL$ D$d L)$ )$ Iw$ 0Dw$ =vL f(f.zwLf.f(z E1탼$ AA$ E 1|$ |$$AnvE HHL$hD$Df(HD$8IHu$HL$lDDf(HD$@HHuLMnHInLLHD$(I^HD$IHuLH^H$HuL1K=Aƃ-Z 1E1Ht$H<$1*=Ń-H 11HL$Ht$H|$HL$pLLD$\Z HT$(Ht$HL$xH<$LD$`= $ nu$ L$ LuH DM1H$ LT$dHDŽ$ H$ H|$HARLT$8AWAUD$tPL$ HL$8H IHEu|$$ LT$0tDŽ$ + L$ 1ARLAWAUD$xPL$ LD$HHL$([H HtL$ H$ $ D| McIǸ MIIH9 HL)>] ^- E1HV T$dE19StHtHib CD$ D$(HCHD$0M HtL{ H;DHK47贓LC M|$ LC l |$$ u1PE1E1Hj AUj HL$8HT$0Ht$h3H RLE1E1j HAUj HL$(HT$ H Aă HS Ht$0j |$(mHC |$ HPHS Hk H|$8iH|$@iH|$d(H<$[(Ls4THI1fnD$dfn$ f8?f~f~D$dff.z E1D$ A D$$A AgEHHD$ HD$ Hs H;DL7cHt$0|$(( LlHC tHt$0|$() OHC H HHIH)HH HL[]A\A]A^A_~r>uLT$dE11L^u1xrFrqq~R fTfVV f.N E1D$$ A D$ A AgEHf. IW HI@ q@qHp0M9}BLHP1 tIL1.u I M)A L1f E1n HHu1HH%f. H* HH8B߃^EqH5j 1 GO H= 饿 D LN f. S1HH=C# xHt?H HHXHqHQ KH@ HP0HH(HP8HK HP1҉P@[ AVE1HD" AUATUHSHH LD$LD$L$H9pL% H H L PHHD$P1LL$ LD$(Y^tHgH|$L-. H L9- H- E1H0HHoMR HH H<$L9tHuSA H|$IHu1*1H0 Hp1LpL`HX Lh(HP0H []A\A]A^Hk- H0cIHoHoL9 L5<- I64IHtyH|$HL93I6HH 蟸HtH6( H5h H8X1YHE1HLA\13MHtSH|$L9tI6HtH' H5h H8eX1H|$L9tL5], E1< D AVAUATUSHo@;o }GLwLLoHLgDH5HS Mk@IHH= P1AVVAU胼H []A\A]A^HG8H9G0inLwLLoHLgDLHLL AVAUIATIUHSHWHOHBHG2fntqf:"f m ~9ODGGAE HBHGBA$HBHGBE []A\A]A^HJHOOROAM ʃ A$U ȃt5t| CCCAE E A$| AAu`DsHDsDs^ HAEu O H߃A$@ E BAE GE A$ Agf D HW1HHHW0?@@uHHHW6AA?AD SHkHHuHCH[H@ h f D SHHS HCH[H@ fHG0Hu H) H H f D AWAVAUATUSQHqI;FqHIփ6rH^ HcHHP IHF Ic~8蔨HHsrH( HLf`rH Ic~<]HH<rH HL/)rHO Ic~@&HHrHH HLqH Ic~DHHqH@ HLqH Am ZL[]A\A]A^A_Hp IHpI^HqHHX HLbqH IVLHB HH:H HL$)HC IVLHH IHHH HLߩXH IV LHH ?HHH@H HL蚩/H IV(LH?HH H HL\.mH{ I^0HuH & HH HL% mHD H@ sIHoIVLH?HHlHH HLʨH 'Hx IHnIVLH>HHiHP HLo<H IVLHo>HHH HL1HP HH肳IH#nIVH >LHGHH^hH HLҧ4hHIVLH=HHgHH HL蔧gHI^HuH % HH HL]gH|_mfAVIAUIHATILULSH.HH苙u HL4H[]A\A]A^鹀 D USHAQHF ~ HA1HHHt#u YH[] HUHsHAX[]X鵀 1f U1HSHHHD$HuNHC1LD$ HHp1jt?H{ vHt$HC0Ht'HH[]HH= u1ff. ff. UHH1SHAPHHHY[]*f. H H SJHHH薢HHpHH)[Mff. fHHHHff. ;Gff. AWAVAUATUSQHH;FIH I7IHIL= HLLCHHgI HL腤+HIVLHLCHH&I HLD~HcIVHLT HH~IX HL~H%IVLHLCHH~I HLţk~HL=9IV LHLBHH_~I HL}#~HIV(HL HH!~I HL?}H^IV0LHL<BHH}I( HL}H m ZL[]A\A]A^A_f. AVAUATUSH I;F}IH I HH}I H}HI$x HHkW}HIVLLk8HH-}I$p HH,}HKI^HuH HI$ HH|HIc~HH|I$( HH軡|HIc~ 貞HH|I$ HH胡p|HIc~ zHHL|I$H HHK8|HkIc~$BHH|I$@ HH |H3Am [H]A\A]A^H- HE @ AWIAVAUIATUSHH L%d I_fHnH)$SPHH E1I9} K|5H JDIHPIH{H 11H2H9}IT Ht1HHHHH1LA0 H{fo$Hh Lp(PI$L`0H[]A\A]A^A_H H9B={HBH~1H {H HH ߞIHzL%? H1f D SH'^H HtH{(HtH{0Ht}HCH[H@ ff. HHWH@HzH{H;x{驖f UHH SQ= H;{HHH* {H Z[]ff. fATAUHSH@HHg"H=gH& D$4HD$( zDHH tHGH@[]A\zfAWAVAUATUSH(zAHQ IIHcHHvH([]A\A]A^A_鴮 @ AT1IHUHHι SHHE HHJHT$ WHC LKHPHC LC PHCPHCSP1H0<D$ =l sCV fnC f:"fnf:"HEflCI9$uH}`L% L9uH}hL9u! H[]A\qHC0Hu魌~ZHC(EHf. APGta G tX ;?= G t=m Ɍ Z1ɉO 1wG D SH=7 }HÌH2RHڄHZuHH H [ff. @ ATIUHSHHHt HӅuI|$ HSHH[]A\DfAVHBAUATUHSHHHsHLe A 2KHH L HH HS HT$HLP` Lg؋H|$ u8H HIQMɋLLL(HD$HH] Ld$LL9|HH[]A\A]A^HJHDHH}OHHHkHIIt4Mx*L-JHHtMH1z[LATUSHHteH-x" HxH̘DHL IHJH(HH.L`11HEHU rHH H[]A\fUHH=e" SVHHt 1H@ HHH HE HhrHZ[]UHH=œ" SVHHt HE1HH HCEHK CVrHZ[]ff. @ USHHH56 HXHT$C t5W1Hl$H|$Hd uHC HH8 HX[]1f D SE1H1HHT$LL$t4H|$Ht.H;=W t%1H3 tH$H H[11^H$ff. ATIAUHSHHH5 tqL3p$$f.$DyH|$$$>[D$f/8 r= f/v/H,1HE H[]A\LljP HE HuCHj H5 ; H8KAf D HH|$H|$mRH1Hff. fUHSQ赯H Hc}HHl YHc}HCHHHc} HC ;Hc}HC(.Hc}HC0!Hc} HC8 HC@EHcHc} HCHHHc} HCPܓH}0H5̈ HCXxH}(HC`軓HChHQHZ[]fSH7U H[Isf HH HGHt1HWHz 1H AWIAVIAUATUSH(H L@ LFHwI9udHF`HHH9P L- Hl$1D$ HH b LLt$L|$UL9pH([]A\A]A^A_I@`HtH]H9P uHF`HdH9P u:LVdD$ L-% Hl$zL- IE LHl$HHt LL|$Lt$Th @ USHHH5 HXHT$#t,Hl$H|$H~uHC HH8jHX[]1ff. @ UHSHAPH H9tH( H9( u HHuHwH} ~HuYH[]! 1և UHSHHL$$J $fL$f.f(\^zff/f/8·ff.錇ff. SH pO H@H HHHD$DHfH*խH@[ff. @ USQnHHtHZ[]賜H SE1HHHt$LD$VH\$1H5 H=R H<dH{ 0UZH H HH|$Ht HH[fSHH5 HPHT$(H\$H|$H|H HP[ PHcWH HcwO HH H4Gl PPDO1DGH= 茷H AUATUSAPHG І HHIAHnusHlC @t<D9LSI)M9MOMDLHH^pZL[]A\A]3 Eff. fAT USH H[kUH $H21H|$4H\$Ld$HLM N1ɿ L H9MH aH H H []A\ H ʚ;HHHy H ʚ;HH1HVf HH H|$Ht$H`Z qH D AWIAVAUATUSHH(H-M L@ LFHwI9udHF`HمHH9P L- Lt$1D$ LHo LH\$L|$OL9 H([]A\A]A^A_I@`HtH]H9PuHF`HąH9Pu)LPUD$ L-U Lt$zLt$LHv LL|$H\$:OyL- IE LeSHHHsH;[e} D Aȹ@B f D AVIIAUATIUHSH HH5- 蘍 LEff.E fH|$I*T$QDD$D$YD$D$D$,pD$D$f/D$D$ ff/D$wpf/ x f/ H,D$1HE H,I$H []A\A]A^LωHE 1I$H} uUHL$\ XL$D$L$k\D$D$e XD$D$FH] H50 H8;7bH 1H50 I$H87>fATUHSH HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H L@ HgH^c HHtHHHHE1H$ L$ HD$HD$ D$0 HD$!HH HH H[]A\ @ SHHHHH[ff. @ AW1AVAUATUSHHD$H$HG HFH ׂHHT$LfL3g}NL,$L5 LIh +HHdM HH{}IHl$H} EH{ xAMAMuu8CHT$H fHnfH:"$@H[]A\A]A^A_MyIh HMxoL HIqLd$M HLHLMH $H|$Hs騁HnHI#MoL ]HILd$Mt HL H1>9,fH(1Ht$=UHT$Ht$1H|$ 7HD$H(SHHHt$ HD$H1H[f D UH SHӉAPJ@B HHHx HE 1Z[]H@B Hf1f ATUSHHH HT$@HL$HLD$PLL$Xt:)D$`)L$p)$ )$ )$ )$ )$ )$ Hn L@ H]HTHHS1HT$HHD$4Hl$H1 LHHDH$ HL$D$ HD$HD$0HD$0 HD$ HH H H[]A\ff. USQHG G HHk @tOHHHS H uJHsHx @ @@HPHtHP0HZ[]} E됀@HsHt3fATUSHG PHG CHHH;w|A`d"{ @@A \A HsH@ t@DHwz[]A\ff. fAU1IATIUHSHHH$Hty1HT$HH Ht$HF Lwu0H~L H HT$HH53C H81QH[]A\A]H$I;E~ITHH$HT$|z~ff. ATIUHSHHH~1H=H H9CHT$H~HD$H~H[]A\~ff. ULʼnSPHL " HA HHCJL9~DK! HHL H\ H~ H~~H] H[] @ +Xff. SHDH ~H{Ht 1HCxHCH[H@ ATUHSH_CHGHH9P0a~&DHHI8Db~H~HrH| HtHEH@ M0~[L]A\BDfATIUHSHHHt HӅuI|$H}HH[]A\}fATIUHSHHHt HӅu7I|$Ht HӅu.I|$ Hu I|$(H}HH[]A\}}}ff. SHHYHt*Hs1H9}HL HtHHL HSP[fAUATUSQHG }L_(HHMuwIH L9}Ml$J< IHs}HLHC L[(@L} D}HtHCHE ZL[]A\A]HtC @} | SHH }H~ H H5k? H8x H[:|ATUHSHO(1H@HL$L9s=H9rډ vH| H5@ H81" |HHEHHH|E |HM(LHH)HHHH9s)D HHDBD@DBD@DBD@DBHLIE1H)HHHHL9IBHHL9IBHL9sHHJU {HEHHU@ E HU@HUM {DE HEHHE8H}(HU01H}(H}@M 1[]A\ff. @ AWIAVAUIATIUSAPHGHHHHH9HNH)HHHVH|HIVIH|HIGIPHs Ht&AWAPHLHHHLHKHHH IVH4Hsu^Ht!AFHDHHD HHHL覝LIE 蚝I$1Z[]A\A]A^A_AOAHLL뇋AFDD f D IIHQ L11 H H HtsHtNHt)H +)ȉ ? H+)ȉ ? H+)ȉ ? H+)ȉ ? H+)ȉ ? H+)ȉ ? HL9 f D +LF)ȉ ? BHB+)ȉ ?B +)ȉ ? Ip+)ȉ ? Ip+)ȉ ? Ip+)ȉ ? Ip+)ȉ ? Ip+)ȉ ? IpL9M9; 3 BLHуLɉ?BI @' M9 H HtJHt"B?BI @ B?BI @ B?BI @ M9|^ËLQ? @t_B?BLQ @tAB?BLQ @t#M9}?BIJ?B @uË+ ?ff. fIIH 11 H H HtmHtJHt'H A A?DH A A?DH A A?DH A A?DH A A?DH A A?DHL9 D LNA A?DB HB A A?F A A?DIq A A?DIq A A?DIq A A?DIq A A?DIq AA? DIqL9 M9 BLщHLف?BI M9 H Ht@Ht B?BI B?BI B?BI tmM9|OLQ? tPB? BLQt7B? BLQt M9}:BIJ? BuË AȉA? Df. AVAUATUSHoHuH8L`HL \x11<HH,x&IHx1 <IHwLH7 Le1LXIH HH5 Hzq:wE1LH} 1 IHwHH5 H>q%vL^H}(1IHuHH5ϯ HquL%H}01調IHauHH5 Hp)uLMuL-H}8 IHwtHH5r HptLH}@1)IH>tHH5F HKpuLkH}H1IHtHH5 HpuL2H}PtIHsHH5 HoauLH}QsIHsHH5 Ho uLH}RsIH]sHH5 HjotLH}S`sIH%sHH5g H2otLRH}T(sIHrHH5> HnMtLH}UrIHrHH5 HntLH}VrIH}rHH5 HnrLH}WrIHErHH5 HRnzrLr1HT$HH4$Ht$H 0rH$H5ڬ H n rH<$+HT$H5Ǭ HmqH|$H} HHqHH5 HmqHHH[]A\A]A^}sL18H}14IHt HH5Ӭ HZmNshs SH+HHs1[f D AVAUATUS? Hs1Hcǃt<uHc0HHsAAMcN,3I} pH~sHUJAE t<u[H]A\A]A^ÐAWAVIAUIATUSHQL?L+LcHL+H HwMA1A $xAH;1IH H{1IE HH(Z[]A\A]A^A_117HHr HHr1 6IHtHH'2rL16H;1{IHzrH{1dIE HH16YYrf D AWIAVAUATUSHH8H; srH-P L@ LFHwI9udHF`H?rHH9P( L- Lt$1D$ LHs LH\$L|$1L9VrH8[]A\A]A^A_I@`HtHPH9P(uHF`HrH9P(u:L20rD$ L-X Lt$zL-G IE }qLt$LHw LL|$H\$,1h SHHĺH>rHH[ff. @ H H@ H@Hcx hfHHHHrHrH{rHrrH?蹐rH H@ t = rHRx H: H Hf L ` 隮f. HHar )!f HHFr !f HG(HpH8ATIUHSH HHt HӅu-I|$(Ht HӅu I|$0HqHH[]A\qqf. H!$ FHcHH H ÐHG <rALOAA @t.Hw0IuAAu$>@x)H <8HHwHAt\>voHc1Mt/I9qDqH <8 tHHm H Hq>fuAVAUATUSHqH;FqIH IyIHqI HqHIx HL\nwqH{IVHL\HHNqIH HL n9qH=Ic~kHHqI( HLmqHIc~jHHpI HLmpHIc~jHHpIH HLxmpHIc~ ojHHqpI@ HLAm]pHam [L]A\A]A^ÐSHHHpH{Ht 1HC+1[ SLH{pIA $HxH[f. @B Ff D @B @ AVAUATUSHHHH HpHpHpHpH?KŃpLt$*LI'LA^<EpLHqHĠ []A\A]A^f. ATIUSH萨HHHt$ H)HHD$ [HNH ^VA $ H[]A\ff. USQ6)1Ҿ H1s(H;!Z[]ff. ATUHHLSHHHMM`IASE1Lm 1HD$Pj j H HMH8N HHH[]A\ @ SHHHHH[ HF(Hu%SH>1HH! HC(HtH [H ff. fAWAVAUATIUHSH H}Ht$YdLt$}@M~ 'ً}@H\$ ILH*LA :{(LIŋ D$ E}HLFoHĸ []A\A]A^A_ @ ATHf USHHH fHnfH:"HpH1LaHD$0 D$HH|$PID$ )D$ fD$8D$XPHA 1L HD$Pj jCH HHHl$ H;HaItH{Ht$ w3 \$ HT$Xuf1H5f H= l&H|$@I_ L8~H. H HHhHpH[]A\1H5of H=V 4x &Ht$@ߺ I+7~2~-~ @ PGZ?ff. @ PG,Z ff. @ SHHHsH;Hl [>ff. +Rff. HG(=H= 1Ռ D UISHHH5 H|$ Hf"A@D$(\$(f.f(fT f.ұ ܁ff.z H|$ \$l$ )H)H fDD ,DD$ H|$0G H2\$*Hcи D$1.T$0\Yf,*Hc H\HuD$? + Ey Aغ- DD$ fL$ Hf/wH=u 1膋HH[]H=_ 1qfT fV f. ǰ zuHHH=% []aHHH= []Off. @ ATfAUHSHf.zf(fT f f. F 3 f.ff/ H|$ C f/ƀ f/|$ XGD$ \Y f҉|$ ,ȉ*\f/wMf.ztAD$ ø Eu} \ 1H[]A\HHfWC 1tPf=HD H5e# H8%벃 H! 1fHnGfD$ f/1\ff. S tHH % t.f*Y t'X zj[Åt[i Q[ UHSHXHF ~ H { yAHl$1 LBHHHD$@ +tH HX[]ff. fAWE1AVAUATUSH H;5 HT$HL$LL$h HHD$hH( HHHH$. Ll$hM L% LZ! R Ht$dLR AM E4 1H|$hLH H$HB. Ll$hM4 L Ht$`LR A E 1LHt$hOHH H$H-J Ll$hM L;- L y Ht$\L R At E[ 1LHT$hH@ H$Hi- Ll$hM L;-$ L Ht$XLQ A E 1LHD$hiHp H\g HsXH\J H H\Aă' x H H\ ' H Hj\ I HsHHM\ @ H H$H9, L|$hM I MgHt$LaIH| Hl$E1HLMM9Y I1HHl$LHD$h!HH H$H+ Lt$hM L=' LY HL$H$ LH P AA E 1LHD$hH H$H6+ H\$hHt H; E H= 1H\$hdE1L$ t$D$`LPL$tDL$lDD$pH$ H$ HL$ HAXAYH< HĘ D[]A\A]A^A_H H5& H8ZA HCH=w& N$I$9 HL$H$ LHN D$ LD$ L9{ H$ KDI(H$ HL$JDIHD$ I94 HEH=e/ N,IE uRHL$H$ LHD$0 LD$0u!HD$ H;EtH` H5/ H8IH|$hHH2 H5s% H8H5% HH+ H81gH H5$ H8HspHXm Hs8HXP H` HX0d6 HsPHX*# H HvX' H HVXAƃ H H3XAă- Hs`HX H HWAămg$ Hx HWMU H HW-- H HW 7! Hs@HsW H HSWAă H H0W' H HW H HVm H@ HVM HH H$H&*Hl$hH] H= j L|$H$ HHLK AO E1HHD$hL$\T$`MDD$Xt$dH$ vHL$HHpH H$H &{Lt$hM_= I~ i= MfHt$L5HH E1LI9Z? IFH= N,IE q i HL$H$ LL!J $Y L$6 I9^B H$ JDIH: H5;5 H8HP HU L$XLD$T$\t$`|$dD HL$HHjE1&H` H$H$6H\$hHG H{ Q LcHt$LPFHHT E1L-4 II9 ID$LN<I) ! HT$H$ LU $ L$ I;\$ H$ JDIH HSat0L$XLD$T$\t$`|$d];HL$HH>H HStuL$XLD$T$\t$`|$dFHL$HHH\ H52 H8%H52 HH2 H81aH|$hH HH5E3 H81aH H$H"aLl$hM L%F L MHL$H$ LHNG A E$E1LL|$hHp H$Hz"Ll$hM] L, HL$H$ LHF A EE1LLt$h{HH H$H"vLl$hM5 L;- L \HL$HT$xLH`F A E6E1LLL$hH H$H!H\$hH L> Ht$pHE A1 E1H|$hHAPt$D$hPD$tP$ D$ D$ H$ H$ H$ EHL$0H HH+bH H$H 6Ld$hM L-c Ls "HL$H$ LH#E A[ E1H|$hLHh H$HP Ld$hMN L HT$xLHR A E1LHt$hZHH H$H UHl$hH! L HL|$H$ HHLFD A~ E 1HHD$hAWD$`PL$tDL$lDD$pH$ $ H$ *HL$ HZYHH. H5o H8H H5 H8}H H5 H8bH H5 H8GH= E1L\$h E1LT$xH H5 H8j H H5W H8OHP H$Hg Ll$hM L;-" H=% HL$H$ LHB A EE1LLT$hWH H$H RHl$hH} H;- \ H=2% 4HL$HH$ H5B n 1H|$hHRt$L$pDL$hDD$lT$tH$ H$ {*HL$ HY^HH= 1HL$hD$dD$\H H5U H8nH H5j H8SE1LL IHT$H$ HsL %E1HLT$hH=Z E1Ll$hE1L$ nH=6 E1LL$hE1L$ HX H$H. Ld$hMY L5 L HT$H$ LM A Eb1LHT$h,H H$H'Ll$hM Lk HL$HT$xLHAV E1LHD$hH H$HKL|$hM I IGHt$HHD$<HD$ HH$ Hl$0E1LHD$(HD$I99 HELN<I EHL$HT$(LHD$8 LD$8HD$H9E) H$ HL$ JDIzHH H$HOHl$hHn H;- R H= HL$HH$ H> x1HHD$hBL$\LL$DD$XT$`t$dH$ HL$HH0H=z 1HD$hD$`D$X1LHT$hL$\T$`HLL$DD$Xt$dlHL$HHhHX H$H3Ld$hM L5 L HT$H$ LJ A Eg1LHD$h1H H$H,Ll$hM Lp HL$HT$xLHA[ E1LHD$hH H$HPL|$hM I IGHt$HHD$9HD$ HH$ Hl$0E1LHD$(HD$I9 HELN<I JHL$HT$(LHD$8 LD$8HD$H9E H$ HL$ JDIzHX H5 H8!H H5' H8HX H$H Ll$hML L= L xHT$H$ LH A ERE1LLL$hH H$HLt$hM I~ IFHt$HHD$qHD$ HH$ Hl$0E1LHD$(HD$I9 HELN4I HL$HT$(LH: D$8 LUD$8pHD$H9EE H$ HL$ JDIzH H5Q H8yH H5 H8^Hz H5 H8CH_ H5 H8(H5 HH5 H81SH H5` H8讐H5 HH H81SuI1Hl$0LHD$h7H H$H2Ll$hM! I} + IEHt$HHD$oHD$(H H$ Hl$8E1LHD$0HD$I9F HELN,IE HL$HT$0LH8 D$@ LpD$@HD$H9E H$ HL$(JDIy1HHT$h+1H$ H H5v H8vI1Hl$0LHD$hH H$HwLl$hM I} IEHt$HHD$nHD$(HH$ Hl$8E1LHD$0HD$I9 HELN,IE pHL$HT$0LHt7 D$@ L#D$@>HD$H9E H$ HL$(JDIyH~ H5W H8G H5~ HHT H81QH> H57 H8͍H5^ HH H81PIE1Hl$8LL|$hUH H$HPLl$hM} L;- \ L 6HL$H$ LH76 D$n D$ E1LLL$hҹH H$H_H\$hHM H; , L HT$Ht$pH@ 1HHt$h\Qt$D$hPD$tP$ P$ PHL$XL$ L$ HT$PH$ H$ NHL$@H0HHH H5 H8NH5 HH[ H81 OH% H5 H8I1Hl$8LHD$h肸H H$H}Ll$hMM L;- - L cHL$H$ LHd4 D$ D$6E1LL|$hH H$HH\$hH H; G L1 HT$Ht$pH ? E1HL\$h舷ARt$D$hPD$tP$ P$ PHL$XL$ L$ HT$PH$ H$ HL$@H0HHFH= 1HD$h 1H$ Hn H5 H8W H=S 1Hl$h϶1H\$p;H=4 E1L\$h诶E1L$ H H5 H8IE1Hl$0LLD$hlH H$H gLt$hM I~ IFHt$HHD$|/HD$(H5H$ Hl$8E1LHD$0HD$I9c HELN4ID HL$HT$0LHD$@. L覵D$@HD$H9EY H$ HL$(JDIzH= E1LD$h\1H|$pH H5 H8\Hƺ H5 H80UH5 HH H81JK Hf H5 H8OH` H$Hg Lt$hM I~ MfHt$L-HHE1LI9 IFH=a N,IE HL$H$ LL 8$ L+$I;^ H$ JDIH H$H Ll$hMP L5C L; HL$H$ LH/ A# EE1LLL$h芳HP H$H Hl$hHI H;-Ҽ ( L kHL$HH$ Hl/ D1HHt$hPt$L$pDL$hDD$lT$tH$ H$ 2HL$ HZYHH[ H5L H8$H5c HH1 H81HH H5 H81LHD$h`L$\T$`HLL$DD$Xt$dBHL$HHBH= E1LD$h1H$ Hz H5 H8c^H H$H{ Ll$hM H=%w ) HL$H$ LH- A EE1LLt$hxH H$H sLt$hMS I~ ] IFHt$HHD$*IHCH$ Hl$(E1LHD$ HD$I9U HEH=Rv N4IN HL$HT$ LHaD$08 L谰D$0HD$H9E7 H$ KDI{H` H$H zH\$hH~# H{ ! LcHt$L)HHE1L- II9&" ID$LN<Im eHT$H$ L@9 $X LЯ$5I;\$l" H$ JDIH H$H4Lt$hMR I~ \ IFHt$HHD$(IHrHl$ E1LHD$I9 HEH=O N4I 9HL$H$ LHFD$(q LD$(HD$H;E% H$ KDIxH H$HELt$hM I~ MfHt$L'HD$HHl$ E1LL-M MIM9 HELJ H HL$H$ HLD$( HD$(]L;u H$ HL$JDIH H$HXLd$hM L= L HL$H$ LH) A E1LHD$hSH H$HNLl$hM# L AHL$HT$xLHE) A} EE1LLt$hH H$HqLt$hM# I~ # IFHt$HHD$ %HD$HH$ Hl$0E1LHD$(HD$ I9% HELN4I kHL$HT$(LHD$8 L D$89HD$ H9E& H$ HL$JDIzH H$HuLl$hMB H= # HL$H$ LH' A E1LHt$hsH H$H nL|$hM2 I < MoHt$L$HHCH$ Dd$E1IH$LMIM9 HEH=@ J HK HL$H$HLD$ 6 H讪D$ L;}?" H$ KDI1IHl$8H|$hLnH H$HiLt$hM I~ IFHt$HHD$~#HD$0H7H$ Hl$@E1LHD$8HD$I9 HELN4IF HL$HT$8LHYD$L0 L訩D$LHD$H9EZ H$ HL$0JDIzH H5d H8m|H5{ HHٮ H81?YH H5 H8>H H$H Ll$hM H= R HL$H$ LH% A: E1H|$hL袨H H$H/ Lt$hM I~ * IFHt$HHD$!IHmH$ Hl$(E1LHD$ HD$I9" HEH=% N4Ix 'HL$HT$ LHD$0b LڧD$0HD$H9EK H$ KDI{HH H$H6Ll$hMt L;- T H= HT$H$ L0 A E`E1LLt$h)H` H$H$L|$hMD I Y IGHt$HHD$9 IHHl$ E1LHD$I9C HEH= N<I HL$H$ LHa*D$( LkD$(HD$H;E H$ KDIxH˫ H5 H85H= 1HD$h E1L$ H H5~ H8V yH5 HHc H81<HM H5& H8IE1Hl$(LLl$h艥H H$HLt$hM I~ ' MnHt$L H$HXH$ Dd$ 1MHD$MIL9S ID$H=fj H Hb HL$HT$HLuD$(L HĤD$(M;t$p H$ H $HDHwH52 HH H81:IE1Hl$ LL\$hYH H$HTH\$hH H; H=l 6H$ H x E1HLD$ht$D$`LPL$tDL$lDD$p$ H$ rHL$ H^_HH= E1LT$h膣E1D$ H H5K H8Hϫ H58 H8jHԨ H5M H8>cvH5\ HH H81X9*H H$H L|$hM I MgHt$L HD$HDt$ E1MLIM9 HEH=h J H HL$H$ HLD$( HGD$(bL;u H$ HL$JDIH H$HLt$hM I~ MfHt$L.HD$H0Hl$ E1LL-Og MIM9x HELJ H HL$H$ HL D$( HZD$(L;u[ H$ HL$JDIH H5 H8'LtH5 HH H81A7H} H5 H8F tH5% HHS H817 I1Hl$ LHD$h蕠H H$H"Ll$hM I} IEHt$HHD$ HD$H^Hl$(E1LI1Hl$ LLHD$h I$ H$HLt$hM I~ MfHt$L!IH%Hl$ E1LMIM9 HEH=1e J H HL$H$ HLD$( HRD$(L;u H$ KDIH H5 H8$IrH5 HH H81>5YHZ H5k H8C>H_ H5H H8(qH5_ HH5 H814I1Hl$ LLHD$htI$ H$H nLt$hM I~ IFHt$HHD$ IHHl$(E1LHD$ I9 HEH=c N4IV NHL$H$ LHfD$0= L赝D$0HD$ H;E H$ KDIxIE1Hl$(LLt$hlH H$HgH\$hH$ H; H=W IHT$H$ Hs$ %E1HLL$ht$D$`LPL$tDL$lDD$pH$ Ht$(BHL$ H_AXHH H5 H8H H5 H8oH5 HH H812H H5h H8H= E1L\$h E1L$ !I1Hl$(LHD$hHp H$HLt$hM I~ MfHt$L H$HLLl$ M1IIL9w ID$H=a H H HL$H$ HLD$( H:D$(M;t$o H$ H $HDH|H H5 H8c)nH5 HHp H81 19H: H5{ H8# H H$H;Ld$hM L=_ L HL$H$ LH A El1LHt$h6H H$H1Ll$hM Lu $HL$HT$xLH( A` E1LHL$hșH H$HULt$hM I~ IFHt$HHD$HD$ HH$ Hl$0E1LHD$(HD$I9 HELN4I OHL$HT$(LHD$8 LD$8 HD$H9E H$ HL$ JDIzH] H5V H8&kH5m HH3 H81.H H5 H8IE1Hl$ LLL|$hVI$ H$HPLt$hM I~ MfHt$LjIHnHl$ E1LMIM9( HEH= J H< 4HL$H$ HL=D$(# H蛗D$(L;uv H$ KDIH H54 H8mHȟ H5q H8H͜ H5 H87\jH5 HH H81Q-lH H5 H8V jH5 HHc H81-IE1Hl$ LLLl$h衖I$ H$H-Lt$hM5 I~ ? IFHt$HHD$ IHHl$(E1LHD$ I9 HEH= N4I {HL$H$ LH蓾D$0j LD$0FHD$ H;EP H$ KDIxI1Hl$0LHT$h蚕H H$H'Ll$hM I} IEHt$HHD$HD$(HcH$ Hl$8E1LHD$0HD$I9 HELN,IE q HL$HT$0LH脽D$@[ LӔD$@HD$H9E H$ HL$(JDIyH. H5 H8gH5& HH H81*HΜ H5 H8iHә H54 H8=bgH5K HH H81W*rI1Hl$8LHD$hH H$HxH\$hH H; 3 L HT$H$ H 1HHD$hrt$D$`PD$lPD$xPHL$HD$ L$ HT$@H$ H$ HL$0H HH=IE1Hl$(LLd$hHp H$HLt$hM I~ ( MfHt$L H$HLLl$ M1IIL9. ID$H=~ H H HL$H$ HLD$( H@D$(M;t$ H$ H $HDH|H H5 H8idH=e 1HD$h1H$ `HC H5 H8,HH H5I H8鲾dH5` HH H81'H H5 H8E1LLl$ LT$hGLLASt$D$hPD$tPD$ D$ HL$ H|$8BTHL$0H HHH H5b H8RdH5y HH_ H81 '(ME1Dd$ LL\$h蠐t$D$`LPL$tDL$lDD$pHT$H$ HL$ H[]HL郾I1Hl$@LHt$hEH H$H@Lt$hM I~ MnHt$LBH$HH$ Dd$81MHD$MIL9 ID$LH H" ѽHL$HT$HL D$@ H脏D$@M9t$ H$ H $HDHH H5 H8A E mbH5 HH H81b%41LLl$ HD$hLLPt$D$hPD$tPD$ D$ HL$ H|$851LHD$h豎L$\T$`HLL$DD$Xt$dHL$HH?铻H H5 H8xaH5 HH H81$H H5 H8IH H5 H8| H H5 H8a1LHL$hݍL$\T$`HLL$DD$Xt$d_MHL$HHk鿺H H5 H8H H5 H8鉺`H5? HH H81#uH H5 H8H H5 H8?H H5 H8r8`H5 HH H81-#Hi H5 H82ӹIE1Dt$ LLLT$h袌I$ H$H.FL|$hM I IGHt$HHD$ IHlHl$(E1LHD$ I9 HEH=Q N<I 3HL$H$ LH蔴D$0k LD$0HD$ H;E H$ KDIxM1Dd$8LHL$h蛋t$D$`PD$lPD$xPHL$PD$ LD$ HT$HHt$@H$ OHL$0H HH5lIE1LDd$LLt$h*AWHt$L$pDL$hDD$lT$tH$ MHL$ HZYHڷH[ H5 H8D?H@ H5 H8)۸H% H5 H8 H* H5 H8>]H5 HH H81 逸H H5{ H8賿Ty]H5 HH H81n @H H5{ H8sI1Hl$(LHt$hH H$HtLt$hM I~ MnHt$LH$HH$ Dd$ 1MHD$MIL9Z ID$H=m H H oHL$HT$HLӱD$( H"D$(=M9t$l H$ H $HDHH H5 H8N\H5 HH[ H81 ۶HE H5n H8鯵[H5 HH H81 零H H5 H8ν逶Hʐ H5+ H8賽eIE1Hl$(LLL$h&H H$HH\$hH H; n H=lM T HT$H$ H-@ ߵ1HHt$h詇t$D$`LPL$tDL$lDD$pH$ H|$(-HL$ HZYH0錵H= E1LD$hQ1H$ H H5 H8蟼QH H5 H8脼6M1Dd$ LHD$ht$D$`LPL$tDL$lDD$pHT$H$ ,HL$ HZYH۴IE1Hl$0LLl$h蜆H H$H)Ll$hM I} IEHt$HHD$(HD$ HeH$ Hl$8E1LHD$0HD$(I9 HELN,IE s "HL$HT$0LH膮D$@] LՅD$@HD$(H9E H$ HL$ JDIyH H5 H8髳H H5 H8XH5 HH H81kH H5> H8螺PIE1Hl$8LL\$hH H$H H\$hH H; Y LC HT$H$ H / βE1HLD$h藄t$D$`PD$lPD$xPHL$@D$ L$ HT$8H$ H$ HHL$0H HH+bH= E1LT$h'E1L$ H H5 H8t&ff. @ SHG ,H/,1[ D AWAVAUATUSHxL5# H $1HT$HL$PL9r,HLl$PH( HLH5L|$PMtML%NI L 5Ht$LLKD$ D$41LHD$PH LH4L|$PMLLW 4Ht$HLD$I D$4E1LL\$P譂HH LH;94L|$PMLM9LL =4Ht$DLoD$ D$4E1LLL$P:H@ LH3L|$PM.M9-Lq 3Ht$@LAd E31H|$PĹH HM Z35MH H- :3KH H 3 H H2z-H0 H2 0H H2\.H H2x1H Hmz2*H8 HMZ2BH H-:2@H H 2=H H1E<HsxHAă1AGH0 H1D?H( H1%EH Hmz1]*H HMZ1j Hh H-:1 H H 1PH H0 HshH0cRH H0 H H0&MH Hp}0'H LH]'Ld$PM'L5 E L 9(H$Ht$hL A E(E1LL|$P^~H LHL'Hl$PH('L 'HT$`HH A E'H1H\$P}Ut$L$XDL$PDD$TT$\t$pH|$x1VHL$HA]A^HtHxD[]A\A]A^A_R'HH LH7)L|$PM)H= Aą'H<$Lz)I E1LLL$P=}H LHxfH\$PHtL9IOE1LLD$P}1H|$hPLt$L$XDL$PDD$TT$\Ht$x\HL$HZYHj&(H LHJILd$PMIL5 L &&H $HT$hLHA E&E1LL\$PH|Hh LHKILd$PM`IL %HT$XLH` Ax E%E1LLT$P{H LHmHHl$PHHL P%L4$HT$`HHLA E(%1H|$PHp{AVD$HPL$\DL$TDD$XHT$pt$hH|$xHL$HAXAYHs$HH LH=NLd$PMTL5' Lg $H $HT$hLHAS Es$E1LL\$PzH LHHMLd$PMUL +$H $HT$`LHA E$E1LLT$PMzH LH\MHl$PH8ML #HT$XHH A} E#1H|$PHy4$D$HPL$\DL$TDD$XT$hHt$pH|$xHL$HAXAYHK#HH LH0QGLd$PMGH=3 #H $HT$hLHA E"1LHD$P2yH LHFL|$PMFH= n "Ht$XLAa E"1LHD$PxHx LHWxFHl$PHtL9pFE1LLl$Px1Hl$`4$D$HPL$\DL$TDD$XHT$pt$hH|$x蜶HL$HAZA[H!H LHVNLt$PMNH=b> ~ !H $HT$`LH2Aj E!1H|$PLwH LH`ML|$PMNI MMOH4$LLL$*IH!!LL$E1M9M1LHt$PXwH LHlMHl$PHHMH} ML}H4$LoIH E1M9dL1HHD$Pv4$D$HLLPL$\DL$TDD$XH|$ptHL$HZYHS f. UHSHAPH ~ H9GH u&H9t*HHQHH] 1Z[]H9Q1ff. @ ATIUHSHHP HtL tJA$1[]A\H Ht$ uH{ HH5e H81# H HMtt ff. fATIUHSHHw H uMH H u!H H tA$1[]A\ú H H] uH H< uH He uH` HD fH( H AHp H H H H Htj H HtI HX Hnt( H]y HH5s H81 u AWAVAUATIUSHHH TE1I$L9SKlHSU8DM@D9TE<TND9u MD9S A;CsPE DPH HcHHu H" P+t IZNLuH H57 LK N1ɺ LHq NHu H t+sNf. Ht H? tPH w HHH5"9 H811Zff. AV1AAUAATIU1SHHtHH9 []A\A]A^HtHXDL tHX D ATAUSV DN(D9XF$HH]X]D9u K,9&]E E ;E\PwH U HcHAZ]XHG HcH m []A\Hs HOXHs H6Hs1ɺ HyMXHs HJXHs1ɺ H/XHsH ZHs HWHs^H{( WCD9n[ff. fATIUH-# SH] Hn\HLHt`\ff. fH;5iy tVH;5hy tMHVH;3y H;v H;u H;At H;Ew u H;?x \ ff. Ht U1SHHH9+ H[]ø HD H|$HptH|$Hf u}AWAVAUATIUHSHQD.EuAv~AH=- 1# IMt_HAL$E1E1LH H|v H82\xLn1Z[]A\A]A^A_1HPv H8u LnH=` 1 IL Aw Hcu HH1 HH01$ HCu AH, HH01 덐H IHL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ ` [G H Hu HWHHB[LIHI H9[HtI H)HcɋB IW[H$ $ LcB HD$HD$ HcRHD$HD$0 PART<XZ1H *[ USQHY[H@ @tHZ[]HH5\ 萟HHH&[HuH} 1}HHHff. USHQ P =p Z{` .[Hߋk+H {` kZH-Huz{` kZHFHu`{` kZX HtHuA{` kZY HUHu"{` kUZZ H6Huk Q Z[]ff. USHQ P =p tV{` uC8 Hߋkޏ{` u HˏHu6k1ҋ HZ[]Ë 1҃G` HHHHt HVHHu6 Ht C` ff. @ HP .ZATUSHHh襹IH ZH{H萹HHYHCPHSXHK`H;P} HrH9t3H=: HM1HLHvjHnjH[]A\D HMHH= 1hLH=jff. H HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ I$ H$ D$0 HD$HD$ HD$ H ff. AWAVAUAATAUSHHLHΌH H HsL= ILH)HH AuD`H AH5 EDHHT$lHT$HHCHt$H)H9t$HhH Ht$L'HHtK IELH AUH=/ 1QHXZHtHo HH8l2HhL|hC@ H< []A\A]A^A_ÐAUATUSHAQH-q ` ZLcAD$xMl$`ukAD$htHL8 1L H9ZLHH` ɱH HL HwZH 1H ZZ[]A\A]~Zff. HG(HW`Gh H` D HH HH HGHLG`HOhHWPLHH I ZH5. 1)ff. fHGhHX7fAWIAVIAUATUSHQO@HpHYHI|CIHYH{HHLHHt H LHCPfZH[]A\A]A^A_HYHChH{XLL6HHsYH{HLHLmYLXff D H5 @ SHHHG YHwHt Hh r9HY1HCHsHCH[ D A VHG(Ht(HWHwQPLO 1LGHH=- HH o D USH(HF 6 H1HIHL$HT$LD$H5W 3[ H|$Q HD$HP H|$H-n H9tHO H;m XH H9 YHj H9GXHH$H9twH HD$H{H HCdHD$H{HCdHD$H{ HC dH{(H$HC(Hu0H{衛HtHUHE HC8HH([]1H$UdHi H5+ H8譙1f AWAVAUATUSHH(JrBXH= F*HHFXHC1LhHT$L9|r1Lt$Ll$HD$Ld$H{ LLL.w HCHSH=;+ HHp1HIcH H(L[]A\A]A^A_HCH=* HHT1zHIOcMWHD$LHPEHL$HT$H1H=* H6HI cH|$cMDWL SHHWHw$G R`)9?W{( u38Hf C( HH H01k(C [ÃV1[f. H16^f D UHSHAPHm5HVH HWHtHS VHH8HHtb1Z[] AT1H U H5) SH(HD$HD$P1LL$(LD$ 5ZYVHD$HtH H|$41IHV#HHVH;WL52HHt[HD$HVH{HCHt]aH{ Hk HtKaH|$1H1HD$H)VH{ uYV=Hu*HaH|$ VL`HD$H []A\Uf SHHxVHsH;[5 D HG Hx< ATIUHSHHHt HӅuI|$(HNVHH[]A\?VfHWHB Hz8H H)H=WHcH% D K XHg H f. ff. ATUHHSH HT$0HL$8LD$@LL$Ht7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ H$ HD$HD$ D$0 HD$IH HE8H} HHu H h HHE8IH=' DFLR HU P1LH_XZH XHe HH8(H^H^H 1[]A\ff. f1 ff. HtEATUS~4Hbg H5z HL@ HW111LO[1]A\1 USHQ P =p nW{` WHߋkYHu {` kXWHcHuk Q Z[]f D AUATUSHQ P =p )W{` ~WHDcfrHHuF{` DcNWHhHHu({` Dc"W HŁHVDc HZ[]A\A]ff. AWAVAUATUSHH P =p V{` W Ds荚HHWDk`H$ E1䋃 EWP =p sW{` WH IHt HHV DsHs LxIH_VIcL9=VH蘝 P HL[]A\A]A^A_ QBrXH HcHH ZH# Zff. @ HHHHEYff. ATIUHS1H;]|H/e H []A\HtL%uH1 HHHu1Hff. HG XALWAA HwH@tHw0It\E1E1MtaM9~@DLCljS.uD-u9EtI͉E1,AIcH{?AtAt(>H$b H H>,HHcG?>,Xff. fE1114 @ SHGH t H W_HHXH [ SHGH t H W_HHWH [ HG WLG tuHwH@tHw0Iuu@>1mHHcU>E1Mt-M9WLJBmtI܃t>H` H H>Wf D UHSQHWH^ 1H0 HHeWHE HHh HHYHZ[] ATUSHH_H,WH{8 HCHIHK AuH8&HCE1HLHP HC81H[]A\HH߉T$ DL$ VHK D HGHh8f D SHHHt 1HCSXHCH[H@ fARLOIMtMQH5o^ LtI@H= H01AY$ I@IRLH=Z H01AX f D H` H@ H@Hx D H1H|$ qYH|$CHf AUATI USHH Hl$H軕3YHYHL H []A\A]f. HVH6 _wff. @ ATHBUHSHHH[1HLe "LHH[H[]A\6 [HHE[]ff. fATUSHH~HHFHuvHHHHwpHL'uNH-_ H10 HHtB1HhLHp Hp(Hp0HE %HCHtHH[]A\HoHV1HjHAPA Ll HHL$Q1j jkH HH]1 @ ATIUHH=p! SHHt HhHHE L`I$HE8dH[]A\ff. H! ATUHSHH9ZHuZHuHugH}$HHtR1O IH2Z1H0 H+Z11HhL`HP H([]A\HH=G u1%Zff. USHVHHu2HKHQHtqHC HIH,HH9}8HC HE HZ[]J%HHt {( uH{HtY1HuH{Ht1HKUT1ff. @ SH跞HHu H{Ht THCH[H@ T AWAVAUATUHH~SHHFH_YHUYL/H8 IHvYHTLHSH LIH>YLhHRYHH9_YL< LIHCY1HL21H0 Ht41ML`HP 1HLp!HX(P0H[]A\A]A^A_XX @ H! UHSHAPH9ZHuHsHu(HS HsHY[]'HH=yE uZ}Zf. ATIHUSH!HZ1HLA$0 HcZ1HHXHhHP []A\ D AUATUSHQH{ HtbHG HHtPH{H=IHZH9 LLcQM~ ZH[]A\A]HQMuHC 1 D H)! UHSHAPH9YHu HsHu+HS HsHY[]HH=ZD uuYY SHכHHtIQH{Ht;QHCH[H@ f. AWAVAUATUHSQLgID$L LAHHXYH} uZH[]A\A]A^A_H}HIH"YHLLcPMtHPMy YHE ff. ff. ATIUHSHHHt HՅu<H{Ht LՅu*H{ Ht LՅuH{(HXH{01Hu[]A\[LH]A\ @ }ff. SHgHHtOH{HtOH{ HtOH{(HtOH{0HtOHCH[H@ ATUHH~SHHFHuSHuMLgH? HHtgL IH X1H0 HWHXL`H[]A\VA L HHL$Q1j jdH HHu1 ۗff. AUHFATUSHH(LVH IJH IH~teLf M L-X HHlW1H0 HPWL;%W u/1HhHPMtIE Lh(H([]A\A]L%W MI$L` HjLQA LHLÞ HL$Q1j jcH HVH8HtL`Mt H<L%HW Lh1LfATH/W UHSH_(H9 HHG IHyVH}Ht>HE HuBLHLfMHKVHH}H]LMH[]A\H HHEH1HL1*HH H_HG(Hff. SHwH Hu;H{HtLH{HtLH{(HtLHCH[H@ Lff. SHHUHsH;[( D AVAUATUH-U SLg(HI9UHoL9t6HG HHWIDHw[H= HLEI1]LA\A]A^BL5 ! LM%UL-4! L|MUHSHKL1H5Z {zHHTHC H{H5 HHE1HOzHHT[M]LA\ A]1H= A^fAVAUATUSHHLHTH{(H{ HH{.IHTH{ IHTH=fS HLHؐIHTHS H[H %HL[H]H=w A\1A]A^f D HOHW1HwLG H=Q fSHHHZTH[THS(H9HOHCHS H [ D HGHHwH3THS H ff. @ HWHwH THOHuH= 18H= 1*f. SHR HH HSHHSHKH=I 1[f D SHHTHSHSHtHSHRH9HOHCHR H [ff. SE1HHFL $ SH1HHHT$H5 sSHt$HR.HSH $HuCH{HHsHtHH $HuE1H{HKHBSHPR H H[H-RH{HHsHuH USHAQH-ZQ H 趽HSHHRHKH= AX1[]SHHHRHSHtHRHRH9HOHCHQ H [ff. ff. ATUSH HHO(uHWHw1H= []A\0 zRHBIHR1HK(H9}!HCH<H^RIDHHSHsM1[H=s ]A\ff. fAUATUSQHGHhHF RHIH(E1H;~RL9~CK|HH RHH+C(HKLH9HO1HHHJIH{(\HQH{(1H9~ HsHKH4HLHHLHH{ HC HQHP H Z[]A\A] @ AWAVAUATUSHHG0 LoH_ LpLg(HD$ IH H; H{L=HH IG HFI\$IH M9t tMID HL$L| LpL9} Mt H|IL|HEHE HH[]A\A]A^A_HL!HHt(IG M~HD$HP1L9}HHTHAG0 1H{ tHAH~ff. ATIUHSHHHt HՅuH{ 1Ht [LH]A\[]A\ D HHHOHff. SHHOH{ OHL H [ @ AUATUSQHF OHIH(H;~OHC1L`IH9~/I|I9HINHOHCHHH{(HtOH{(1H9~ HsHKH4HLHHLHH{ HC H?OHiM H Z[]A\A] D ff. ATIUHSHHHt HӅuI|$ HOHH[]A\Nfff. HOHW1HwH= f D SHHHL H uHNHSHHNHKHH= 1[ D SHHHNHSHtHNHRH9HOHCHJL H [ff. HATUSHoHH9 Ho HE t(HًHHt?H{LcHt=Hk H{Lc[HLH]H=v 1A\a\HtbLHH=H [1]A\8HOHH=" HHWHwHH9uHO HW1H= H= 1 D USHARHWHOHt'( pMLH HsH= AY1[]HHH9MHK Ht0H)J HH HHz 1HHL8AHKHsHH=b LH ff. fSE1HHFLL$ LHHPF H1HL$LD$H5 蝉LHD$H{H HCHt@1|$ 1C(H J Hs H H[f D ff. HOHW1HwLG H= rfff. SHHt#LHHC HI H [f HOHW1HwH= f D HG HOHWHwHuH= 1LG(MtLO0MtHH= P1H HWH9z8KHOHw1H= ff. SH HF ~KH1HL$HHT$LD$H5, iKHD$H{(H HC(H`KHD$H{0H HC0HPKHD$H{ H HC H"KHRH H H [Hy! SHH9KHLKHsHu*LCH5! Ixt Hs L[J,Kf. ATUSH HtHH H&KIH%KHKHSH= HsP1s0LK(AZY[]A\1#HHJH HI=MJHsL[E1]1H=: 1A\ff. fSHHTHHJHG HS0H [f D USHVHGHhH}xHnJHHC1H HBH9}HCHDHH HDHsH=f> Y1[]-ff. fH! UHSHAPH9 JHu=HuHuJH}n HHt51H0 HI1HhHHZ[]HH=. u1I AUATUSHARHHkH HGH HtQHGHE IHt_H¿ H1˚H{LcIHt6<H.<ZL[]A\A]H{HHCHu[H{Ht?HuKIH{Ht 1Hs;H{Ht 1HK;H;E1HtE1LK;;ff. @ 鋄ff. iff. AUATUSHUH( u!HO0HW1Hw[H=J []A\A]n8 HHG1LhLvIH I9~!HCH<脾HHIDHH{0wvIHtH1HK0H9}!HC H<CHeHIDHHSHsMMAZH= [1]A\A]'Hf D AUATUSHHF "HH~B H1HHL$IH5 I HHEL`HD$L9`HH$1Ml$H@H9E0GL9}0HD$H|I9HINHGHEHH1H}0H9~8H$H|iHGGLH)H9HOHE HHuHTGHu01H9~ H}HMH<HLHHLHH}(HE(H GHB H H[]A\A]ff. @ HGH4GH@H9G-GH(|ff. AUATUSQHGL`HF FI1L;fFHL9}BI|_HFHSHTHRH GHH9HOHCHHLsHF1L9|*H{ HC HFHA HHQHZ[]A\A]HKHsHLH4HLHHLHAUATUSHAS( u%H HWu4Hw1AYH=BF []A\A] Hw1AZH= []A\A]LjLDsIHAF1I9!HSHsL1AXH= []A\A]HCH<HEIDHff. @ USARH_HoH HHtAXHH[H= 1]JAYH[1H=@ ]5 D HOHWHwHEH= 1 ff. f[ff. ( HWHw_E 12fH! SHH9PEH`EHsHu H{['`Ef. KKff. OHW1HwH= g SHHcCH2E{H19~Ht(HAHH4HLC MuLo? HSHsH= 1[ ATUHSH B! H9DH+EHuHuzLe H}ID$ t_Hm('HDIt$1H9DH9~IL$H HL(HHpH9xDH;-> D[]A\DD SHHF DH1HL$HLD$Hq! H5H }D|$9DHD$H{H HCHt4D$CH1> H H[ff. @ SHG HHxpHDH{ H1HcH;O} HHDHfDH HDHK0HsH=! 1[]ff. fHG0HHw0HtRH4H= H YHz= H ff. fSHHCHCH9t H2; H [H; ATIUHSHHHt HӅuI|$HvDHH[]A\gDfff. ff. VH=DHY8O AWAVAUATUSH8LgLoM9E >HHEV NFELL)HH9 MEELt ueEL# LH71҉ HuuA>EH-9 Hu_M9sZIH 1LL#HLcDEDMIu@1m M9stA9,$u$KLcHt6 H8[]A\A]A^A_IJLU HD$(?BK41H߉L$L $nL $L$HuhC1 QHDH}: H@ HDD@$D+@ D9D H: H ZHA: H@ H@x`H@HuËP H$x$)ʉP H@ff. AWAVAUATUHDDDDDDDSHQHGIILHI9INMA HE H H HtmHtXHtCHt.HtH 1DHH1DHH1DHH1DHH1DHH1DHHH9~a1DH1D H1D H1D$H1D(H1D,H1D0H1D4HHH9iIHt1I9'ZL[]A\A]A^A_1 C H 1B*Cff. H i H i H H4C 1HHAUATIUHSHAPH CH I<$H HHCHx H [ HI/MBH7 Hq8 LH H H -LI.H.MBHL(.LH.HBHs HHH.ZH[]A\A]}.YH[]A\A]ff. u @H fHnÉ% jwH= ff. H HD 1HHG(tPH2 H5 H8Sc1ZHG@uHwh\ ff. HtNAUATIUSHcQ'iIH)D19 ZL[]A\A]I<HHCIDi G(tPH2 H5C H8b1ZHG@uHwp\if G(CHG@CHwx\<ff. G(uHG@u HcXwdfQ(]CH36 H Z D AUATUSAQG([CHGH@JCLo8H`ImHHtDC\ C9CHs81LL0 HHts(H{HAX[]A\A]Z1[]A\A] APHG0LcJHx!H9}!HG8HW@J HHBZHyH!3 H5 H81 1Zf HW1 uHOH9})HTHRHR`HtH BH1ø HW1 uHWHt1H9ZBHLH54 H9quH1ÐATUSHHo H Lg8HG( BHG@BX ;BHw`H|$#H BD$Pv<BAH{@Ht GHt#HsHC( t%L HC HL9c8AHH[]A\Aff. fATH3 USH9GBG\H8BBH`+IHAH=@" HHAL`(HHHC 1HCHE Hk H[]A\ HGHttAQHOH;O }Vp(@AL@A@ALHpLQHP8H@xM LWIHHAHt HO(LAX1HOHg)1Z1SHtHHAH[AVAU?ATUSH<2AHHIHj HcHvIHuhHCH-. H} P DH} H1H5 []A\A]A^ IHuNHu@HLI(I{E(@H0- H5Y H8]HqLID(ItE(tH, H5" H8]_HE@u<iu! LH9AE4$10 <bA<ht M4$1^C舋f.P zCE(tHs, H5 H8 ]CfAVAUATUSLnHcG$H L9DHIE1M9}=H. K|H0HHDHDHHHtIH[]A\A]A^C QG(CHG@CHw8HHC@X Zf AT1 UHSHHPHILHcCC L LCH{CHSHC Hl$H)H9@HCH<$Ht HwHkH诩HH|$ tLHPH[]A\1HHI D AVIAUATAUSHHPHc~$H~cHtYIA HLHL4$LHD$8AAu:K1HLHD$@9 HfHP[]A\A]A^;臏ff. @ ATUHSHptqHHqH{LS0C$uZHI<bIHt9H{0HSHcs$Pu@u8u LK@LC8H T H L8f1[]A\j HHcLu@u8u LK@LC8H H ff. fAWAVAUATUSHHHLMH8LL$pLd$xH$ L$ Hu%L$ Hl$xLd$pH8[]A\A]A^A_N1H\$IMH$ID$MHHD$LMIIH$I9$ H H;H I?H HM LEH ILKLT$(HD$ASHpID$L\$(APMEt$QHHHT$8LT$HHD$ H M} HT$M2L\$ _H8[]A\A]A^A_HtHM LEHx ILE1wLE1LE1fLLE1XLH4LE1=L5 SH' H2@HsHH= $ 1[ AU1ATUHSHHHD$C^H @I1Ll$H9]~%HELH|9 H?IDHH|$HuHL[]A\A]h"f D USHAPHb* H9Gt HHZ[]H> HuH= lHE HtH} HY[]鄪 @ ATUSHH00O?H{umHC1Ht$Ht$HxxHHt'HCHH= Hp1HI!LH|$HuHHH[]A\!HHHtHCHH=J Hp1{HIP!Lff. UHSHHH>H?HHuH3HH[]>f. AVIAUIATUSLgItLL`\HH>1L9}%IFLHt< H{>HDH[H]A\A]A^HG[L]A\HpA]A^ AVH( AUATUSHH9Ft []A\A]A^9LnHHE1M9}*JtH9HI0 M=IL[H]A\A]A^fHHWHwuH= 1 1g~ USHV.=H{H H= HSHDHCHp1HHHZ[]ÐATUSHH~ =HFHHD$H@ `=IRHx?HHY=HEH|$H HD$HD$HCMu6Lc HU HHCH1=HăHH[]A\I$ÐATUSHHHG H Hx H= IH<Hf' LH 7LH H<oCHK HH )$ <HIS HSL1H=L >H[]A\HCHhH}YHtHSHHP1H9| HsHH1[H=& ]A\HKHLHHHL AWAVAUATUSHH8+'<HC E1HN HCMLhM LE1YHH<M9 M H= IH;HH貥LI7 M;HCHSH=+ LHp11LI H HvH8L[]A\A]A^A_HCJ|4H);JDIH1Lt$(Ll$HD$HD$ HD$H{ HL$LL 0uAM9 :HCHSH= Hp1HIٸ^LpHT$ Ht$(1H=> SH:M9:JDIo UHSHQH:HuHu7H}HsG5HHt'HS HsH/HHHZ[]:u: USHPHo!f H@ ZH[] SHHHt 1HKhH{Ht 1HSTH{ Ht 1HC @1[ff. SHHu HsH;[Hֹ H=p u1[ AWAVAUATUSHH4$H ;H;H|$AE11:HL$HH HQIH:H4$HǺ 褨LAyE:u"AuHH9Ÿ DDHAu#E:H5HH[]A\A]A^A_A:HH9uG:H H $H8btH $H=ˠ HqH @ SHHuH;HsR;HHt'[Hֹ H= "u1[襮Huff. SHH<H;Hs& HHt[鷜bHt1[f 6f D QZxZff. AUATUSHHHHHBH~PHBIHBE1IH/tLgHAHHyBHLHH[]A\A]?IPA Ln] 1HD$Pj j].H HHu1Bff. AUIATUHSAQH0 tKHHI-SHx8HS@H4Ht+LHH] xJAXLLHH[]A\A]~ Hu'MtIE ZL[]A\A]H HH8E1f. H0 t]UHSHHHAPRHmAHU@HHt&1HHH. H;fHX1Z[]HHu11f H9w0u-HFHG0H9w8t2HFHtHVHPfFHGXHFHtHVHPHFHG8ATUSHHHHH HiHAQL[ E11HD$Pj j,H HH@H H?@HS0Hu@ H*HJH1HE H HH^@HH 1tHI2H*HL[]A\Hy4APE1L=[ 11HD$Pj j+H HHQ?H?HH-?H{0 ?HS8Bf D ATUSHHHHH?H~sH?HH?HL'?HoH{ LHH9Ctp蒝xcs?HLHxKHE HHE HH[]A\HARA L|Y 1HD$Pj j*H HHp1Hu HuHLHuNy1H H @ ATIHUSH.H>1HHLH>HHL[]A\駙 AVAUATIUH-g SHH9 H 11H8 IM>I\$0I9l$u<Ht{H+LHHHe>HKHLMj>H[Ht?H3L9HHH>H3LHHAE&>H[[L]A\A]A^TIRff. AVAUATUSHHH 1 !=HZ H9C H Ht$1H H\$Hp oIIH=H;ELHH=H{ HH= H1IHH7HL[]A\A]A^H{HHP=Lk0E1PMe HLzHH4=L 1pIH5=L;u3=HEN$MmIMuL;uC<H\HH= [H]1A\A]A^ ff. @ AVAUIATUSH(H<HMHH<H Ht$1H Ll$Hp GIH<HLIwM<IuL M1HH lLICH;H3HL[]A\A]A^ USHHHHHF<H~8HL<HH@<HH7*<HQ HH[];HPA LjU 1HD$Pj j&H HH; UHSHHHH;H{0Hu H{8Hu 1H[]HHH[];f SH H@HHHT$HtHHT$0HtHHGBH|$HH;H|$0H;Ht*H H HH= H1輩HH@H[ATUSHHHHH;H H;HH;L'H H{0 j;HC8L; tPLH{PHHk;tIH;C8t/HHHC81HyHAHr;HHHCXHK8Hw H H[]A\H;C0tHHHC01HqHAH ;HHHCXHK0HŅ:HC0H:8/HAPA LS 1HD$Pj j[$H HHs:f D SHgE:HH[f D UHISQLOH54 L脘{:HH@ t1LL!HHh:HHDM:HZ[]H T Hff. SHH`H):HHO1[ff. ATUSHHH:H?HHt'HCHH=p Hp1`HI5 LH誩H[]A\fSH' HSHH{0 H<9[nff. HGH( LH HG 9H8u H軦IL @ PZH!HW1HJ(Hq9HB HATIUHSHH蚵:H[H; :HHHL"H߉H []A\ÐAWIAVAUATUSH P =p :A` A :AOPA L$ =p :LnzIHt A PA =p :A` :AG $*IHH:Eg`1A E: L/H $Iw HAGPIH IcH9 HpLLLLA :iA HH LI/A` A PA HH[]A\A]A^A_LSyHHTI9t+AGHT H$$Ht IVAH4CMHH$J4 вHE9H$HA D$ 1AGYv9fSfnfnHfA:"f:"LϾ8 flH)$辠Htfo$ HX@(H[ATfAnfnIUfA:"H8 SHHf:"L$0H|$8fl)$`Htfo$ L`HhHX@(H[]A\ ff. USHQ P =p 8{` 8 Hߋk-Hu"{` k8 Hg-Huk Q Z[]ff. USHQ P =p U8{` \8# Hߋk-Huk1 Q Z[]HHuf. AWIAVAUATUSH( P =p 8A` A y8AOPA L$=p 8LN HH A PA =p X8A` 8 EwmEHH7HD$ Eo`E1E7 L+HuoEwIw L薺IH IcI9wHHLHLA eA HtiA QA H([]A\A]A^A_L_ HHtL9d$6JEwISH4IVAH4lA D$AG1Q7ff. fAWAVIAUATUSH P =p 7A~` A 7EfPA D=p 7A APA =p B7A;n IVHcHDx@D$ LpHH 1LH5{ A A L:*H LvHHn I~ oHHx6HHhA PA HH[]A\A]A^A_A~` AnD L貍HH! A~` An 6LOHHtEA 7L)r7IVHcA~` HDx@D$ =7A~` An7Y L6)H86A~` An6X L)Hj6A~` An 7Z L(HufA A~` A En 5L_HHuA Ef1A GA 56AvI~HtDH D@ PDAv H=h 1L$ ZYHH6A USHQH6H.HH#}Ht 1H9~HKH HIHLHZ[]ff. USHAQ P =p 6{` 6Hߋk >H68t6HPH5M H9r_6 Q Z[]AWIAVAUATUSH( P =p ^7A` A B7AOPA L$ =p 6LN HH A PA =p 6A` 6 Ew @HH6HD$ Eo`E1Eq6 L&H EwIw L2IH IcI9_HVCLHLA `A Ht(A QA H([]A\A]A^A_A D$ AG1Ht IVAH4L4 HHVL9d$$5JT EwI#m5f D AUATUSHQ P =p 5{` 5HDkIHt] Hq%HtKHrHHt;H{ 讗HH5L Hh HZ[]A\A]Dk1f AWAVAUATUSHxLzH|$8Ht$HT$ ML6HW H|$1HT$HHL$HH 7Lt$HD$,M51IsHH5H= HH5L;H$HT5HD$PE1HD$0M9 HD$ ~D$HNdfI:"L)D$Â4LH ~ foL$|$, H\$`)L$P4Ht$01ɺ LUH4H9tH $JDIfH+O4H<$HH$HHuHGP0L% I$L$$I.5Hm u HEHP0H+u HCHP0H$Hx[]A\A]A^A_ 4ATH7 USH9F4Ճ4 HIH94Hv(H( u`H{(4It$H{ 譌u7HI H{( Hh 茌4It$ H{ q_4-4-4H H []A\wH HHQ3 4ff. fAWAVAUIATIUHSHHHy H 4HC8H O6H)H HD9 Icfw4 rHD<BLs(M A3A~, 4A9u9HS8HH+C H- HA93A~- 41H[]A\A]A^A_L= HLLA HM A~- tɅu`3fY3HDD$ L$譭L$DD$ HIB3 ATfUHSH0H WHL% D$ILP T$LT$LPf~LT$ L$$L-fnL$f8=f~L9T$r1= Í\HcH}9H IH H UHL$$D$LP T$LT$LPLT$ f]6HL9T$s@HHc$HcT$|$HHHHL9}2f0H1H0[]A\2ff. @ AWAVAUATUSHHz, 2IIIDM~(LMt}HC8C,k0S0 I~ H `2IF8L H L)Hf6HueFLAG(LAH߉1AG(k,Wk0H[]A\A]A^A_LLL$DD$螫IH1T$HL$W1ff. @ USHAPIȅtH~ HtFHJ HHH@ H H1H; 1H{ HC HtC1Z[]ff. fUHSHQHHHt HsXE1HHL % uH{@H{11Z[]1f 1AVfAUATUSLbpHLr`LjhHBpB`&_1LLLH߉+[]A\A]A^UHcH_ fHnSHHH8fH:")D$MZ1{. LD$ W1HHT$E1 ; HH H8H[]ÐHtUSHH. 01H[]AVIAUIATMUHSHFHH; t~H; tuH H91H1H2HHV HH1I~@H1HSIuLHnNHHm u HEHP0H[]A\A]A^I~@H0LHL[H]A\A]A^(N ATIUHSHHHHt HsXIA HH"uH{@H11[]A\1 D SH HHH1H HD$HL$1LD$HT$H '1H10 HH{11H|$Hs HCHC`+N1H H[f. QHGH; 81H HGL1Zff. fSHAH` A1H{ÒHCH[H@ fUSPH HoH_H lAXHHH[H= 1]鷐 USPHGH_HhHb H kAXHHH[H=q 1]s AUIATE1UHS1APH;]} H| Le~IHYL[]A\A]ya0QHW1HHHIy H~H:HH= 1ZH H9O'0ff. VH0HH= 1Yϡff. @ HWHwHt HOH/ 1Sf. AUIATUSHHw0Ht H;5 /h1HH/H Ht$1H Ll$Hp s+HH/HIHi/IuIH ] 1Hڿ IPLIHHHL[]A\A]f. H=Y Ժ @ H(HH/1ff. fATL%/ USHoI$p H H.I$ HgiHH[H]H=! 1A\ ff. G(.HG@.HG@H.H f D SH .HP H.HA H.H8Hj.HPHH @\ HPhHPPHH`H@P HPp@( [ff. HH=.ff. P H= ZH1( AUIATUSQQ%H.HHÿ 1RHH-L IH-IuHH 1 NHIHLZL[]A\A]f. ATE1IUSHHH- LL$H9tH( H9( uPHusHs11LD$ LOtKHD$H9Z-HtH9Xt6HHH[]A\Hw11LD$ Lu%1H HH=W v1,f D G H= 骋f. H= Է @ 1*f AWAVAUATUHSQL%3 HI$0 jH,H}I$ H]IIIHr,H}H15IHZ,0IHA,MkHuL9}*Hk(H HTLJ4(u ,HLLH=Ƽ 1蹊LHLZH[]A\A]A^A_ AWAVAUIATUSHHLwI^H31HH貅H+IHLHIkUD$4LHCHDHD$(訌+H( L ci+1L=[ H~ LL` Hk(I H(H H3H1HHH+HL#+H= Lxb*I|VHH*HLϋ*HH;I;]<) L$b*LT$HH[]A\A]A^A_u*a*ff. USH$ % Ht H-P 1H9lhu*HHuH[]f. AUH6 ATIHHUH SfHn1fH:"H H )D$fHD$ D$8HT$@D$(D$HH*H*H*H)Hl$H?Hr*7|$8IŃ&*H|$0Ht$`!3LI)$ L$ $ $ $ $ L$ L$ H$ H$ H$ % H0HHfyH H[]A\A] D AWIAVIAUIATMULSARHG Hx(XHn)LHvHR)HCLuH)HC LuH)HC(LuHh)HC0HuHI)HC8H|$@uH()HC@H|$HuH)HCHH|$PkuH(HCPH|$`TuH(HCXH|$h=uH(HC`H|$X&MH(HChZH[]A\A]A^A_f. AUAATIUHSQ苳HHt=E1A HLAA Hx 1H1脳HHHZH[]A\A]ff. ATIUHSHHHGHD$H6(H^H{Hl$uGH{8I(H%(H;k }Hk HH#(HH[]A\n(( @ H: Hw: AWAVAUATL% ULHSHH8(HE k(LUE1M(M9}[NDI@ (HL~7c(IX t"L9P(M MuH; 7(IH<IH(H LH 'HP 1H$H HE HP IE L HD$ IH(HH "(LH9P (H4$HE1E1A9LmM9'HH- 7Hu0HH8hH} ux(ff. AWAVIAUIATIUHSHH@ H9@ uQH^ LHK H9uMI$ I3 uEH[]A\A]A^A_Hv HNH5q LGH811H H; t@HB IMLH5q MD$H81~1H ZH ;Lx L; tLL9 tR t tHX HX HtHu7L9} vL;{ l L; uIL; uI럺 HHL$v.HL$HAM<H 1Ht\Hp H9w uRHp(H9w(uHH H9 u8H H9 u(H H3 @uHO0H5 H9u1H9H0 AWAVAUATIUHSHHt$kÅ~jL|$LX MZ&LLH 1BBIMS&LLL6&MtLHh uH[]A\A]A^A_H IH &Lh1 IFLH<5Å%HL9|%ff. fG('HWB'ǃff. fAQH|'H{'E1 1HHIILZ AWHAVAUATUSH H9; HIHMEu M! H A1 H= F'L^H)GJT L\$11A MsA MIL D9u LH)HL$HL9uL1E1L HrHHH9JH D9uHL$Ll E1C C9L &IM9uEuIM9&LLEuEHĨ H[]A\A]A^A_u.A At+A 119L HH9HHĨ HH[]A\A]A^A_ ELN MLDHA IHIL D9LDHuH)HHtDHrnH)HH{H HT D;uLE4D94&HuHI95HĨ HH[]A\A]A^A_' Hff. @ SLH'IA HxH[f. AVAUIATL$USHH(~&HL9s9+uHL)H[]A\A]A^HtDLDHH)E!H 'H9(u L)HHPHH)HH &LH)H= ~뫐AVAUATUSHLgL5 Ll$HoLIt LN:'H\$H&HC &HH= H1H 茓HHaHH[]A\A]A^ÐH AVAUATIUHSHH0 tZHH}HHtXID$HHk HL@H H01UH+u+HCHH@0[]A\A]A^H HH0u []A\A]A^Lehf1Lu`LmpE`HEpMtID$ tI|$t[LLLH]A\A]A^H=H5}HHt3HH MD$HHj H01*UH+u HCHP0MtI.u IFLP0I,$u ID$LP0M.Im #IELH@0ff. @ UHH=E! SQ螚HHt1HEHHCHE(HCHE8HE HC(HEHk HC0EEHZ[]ff. HG Hw(H9p8\&HG0Ht5HWHwHHLHHG0HWH@tHHH~&1ff. SHw*H HtH[HAVAUATIUSLw@H95&H@HH&M%I|$ ufo AD$(HEL LHL 5%HAHHu%ff. SHgtHuH:H H [H~ H8~tEH 1[ AWH ] AVAUATUSH(HGH; H<$HL$ H<$y&1ɖHH_&H$L`I$L踉HD$H,&HHHux8%IG j%I _%LLNiHH:%LH=> 1QIH$HHJLALEu'H誮IHy$H@HD$ $f D QH=&H;57 P&HG1HwHtH1Zff. AWAVAUATIHLUHSHH M&HK Hn&IHb&L} E1II LHl$0MLLHHL` hH&HD$@HsXHDŽ$ HD$0>HqH%HLHo#HHH H[]A\A]A^A_H}LT$HtGLT$HI%HLT$LIcILT$%IF%H}豤HHc%H̀HI"IA%ILT$HA 1PL HD$Pj jH HH-%LT$ff. @ 9t,USQ. ¸ 9t< 9Z[]ø f. S w 0(H [f D S w H [f D AWIAVIAUMATU1S1H(|$Ld$Ht$I9H(H[]A\A]A^A_Ht$|$HLE I<191HHHHfAn fAnE f8?fA~E f~ H 9@@u ʸ Éй H=i+ L IHcHsu;tAIHI|H|H~HH)ILDL)HAɉAT Tff. @ AWAVIAUATUSHH Dg8uD%$ uA1ݑIH H j L kD HL9uE$LH H=r 踟HH$HLaHHVH$Iv0H= H1XHH-LI"HL[]A\A]A^A_H;HH4$HLHD$ HT$$HA!)Iv0H= 1މHf H@H$\ff. HH HH HH HH AUATAUHSHQH(#HH+ HfD9 tH9rHZ[]A\A]H)Hf. AWAVAUATIHLUHHSH(M %Ha%HW%HHK%L/LwH2%HHH*%H,|HIIt1L MLLHx H(HA []A\A]A^A_w$ D H ? @ U1HSQH \HHt/HEHMXIH=:a HUPHp1HHHHZ[]ff. AVAUATUSHs$HHMY$+ LkLp $ǃ H{( \$H 1LH H HC(LHCHCHpX誒IbkHH$HsLLL Mt1HkH9k( 1Hk( []A\A]A^ HH4L @ AWAVAUATIUSHH9= HFH;[ HtxH; toH%IH LAHH LH蚞H߉ps#tL^H HHQHH[]A\A]A^A_1HD$ID$H9CLILt$It$(I|$ LL4tjH$HH(HPHE H譞HAE"tH0 H zLiH"H HHQNHw H A"H ff. UIHSQLNH5 I9t L M9tL3!U"LHHHHt+HH- HHH= HHE HZ[]f D H HVIIHGII(HWHVHFHGHWHV HFHG HW IQ@HF Hw(HG@H9ugH9u~HG(IQ(I HL HH HLIxH5 II? !MX0MQ0HĈ H9HDHO(Iq(H9G(tH9tHO(IQ(뀐SILNHH5N I9t L M9tL ?!LHҸO!HH[ÐSLX HILNM9t H5 I9tL !LH2HtHuHH[ff. SH H0HHHT$HtHHuH|$HH Ht*H H <GHH= H1kHH0H[ff. HY H9G H9F H H9H98uH H fUHSQUhHHt HHHzH HHZ[] AVHBIAUIATUHSH D$ Hq I>蝙IHtaHuLHHl Iu } L$ y+HEH9~ H)1HH+ H []A\A]A^s S # ff. @ AWAVAUATIUS1HHHIE1HLIHL 7 HIHHH)H9< HH)L9- AD$ IAξ @1 A9LD$ACL败HH @ LD$AAA @ LU0M~AI1DLgM~IL$AMDLHHMD$E11LHH@HH[]A\A]A^A_ff. HcUHSQHlH3"" Z[] S1H1H H5 HPHD$LD$14tDHt$H{ H"H\$H Z HʼtHtH2HP[1 SHF "HH5HHtH1[cHtH H;mtH;H5 [fSHHHT$Ht$~D$HcD$fH:"7"1H[Aȹ ʚ; ATH= IUS=;HU"HH HH KHHH("H1L*HHH[]A\ AVAUATIUHSHH tHՅ!H{HB E1H0 {eIJ|Ht LՅuIM9|!!H(HH5 1HT$ !|$ Ht$` !ffH*D$Y H*L$XrH(ff. UH1H5k SH8HT$ "H}u H\$H5H HD$ HD$H HHD$ H5! H H5 Hi H5 HR? H5 H;m!Ht$H { HH]!H|$#HH~!HH50 HPQ!HHc|$JHH)!HH5M H\P!H{Hc|$ HH HH5R H#P HBD$ GqHH HH5# HO HH`dHHH8H[]Ht$HNsA Ht$H' Ht$H Ht$H ff. ATUH SHH ILu Hu+LHs H []A\H H8胜HV Ht$ HHC HCuffH*D$Yנ H*L$XCff. fATHUSH0H\$HT$Ht$HvfHc|$.HHtTH|$H!H/DHH!HH 1'HIFH>H0L[]A\E1ff. fAVHAUATUSHpH\$Ld$0HT$Hl$PPLIHHD$PLL$ "ZY!HCHH!L{CIH!|$ H!H\CHHEIH!|$ u H HݐHHe!ILLH 1#HI>L6L.HL#HpH[]A\A]A^ ATIUHSH Hj!LHsHcG![]A\pku@f ff. @ Ku@f ff. @ AWMAVIAUATE1U1SHH(|$Ll$Ht$M9 Ht$|$LLB H<19~!fAnL fAnf8?fA~f~ H1HIHH D APIt@@u LY飗ptLH H5 HcH4Zff. fAVHBIAUIATUHSHD$ H I>ݎIH HjLHNH I } Dd$ yIHEH9~;Hپ HH)HH!HHH4H)HDHH[]A\A]A^ ff. SHHG H Hu1 H[ ff. fS1HH=- H HL$HT$HD$LD$HD$HD$QtS{ HL$HT$AHHt$SHt(Hx H H[{HH H5x H8eH 1[ff. fUIH1S HA E1I4H9}OI<E1B< tD8rA8u#HH9uI1A8sLV1LL)MӺ I1HU L[] AVIILZ,AUMATUSHz LBHjH)z( H2IL9tzL9= ?AHфt L9r* E1M9LHIMHH9}(D,D8,tL)HLB B8&6 IM9|L)[]A\A]A^Lb L9K ILH9HOI H)L9r K L9sO?AHфuH)LH9Q HH91 1D4D84 HL9| ff. E H5 :f. AWIAVAUIATMU1S1H(|$Lt$Ht$L9 DT$Ht$HDiAuYD賔 LDI 191҅HHHHfAn fAn$f8?fA~$f~ HMHLD1H(H[]A\A]A^A_ff. f H5 :f. AWAVAUIATMU1S1H8HL$L|$$1ɉ|$ Ht$1҅DHHHH L9}fHt$|$ HQAƅtBMAHLyHt$1H 9~fAn fAn$f8?fA~$f~ HL讐H8H[]A\A]A^A_f. HG LO tsHwH@ Iu% >eHHcyE1Mt$M9d Ln7tIH H Hz HG ALOAA trHwH@S 1It%I9K DHnlt&HAt*Au)>PlHHc鴤Hm H H>ڋ> f D AVHBIAUIATUHSH D$ HI>-IHtoHMdLH袿H4 I} L$ y9HEH9H H[]A\A]A^5H H)H1H[]A\A]A^SHG AL_AA HwH@tHw0ItrMt}E11E1(u:t EtXDDIAM9~)DLoljtEu) HcH[4AtAt8H H H[Y=蚑1@f D USHAQHF ~ H 1A HHHt%u YH[]:4HUHH+S1AX[]Cc ff. @ ATH IUH)IIS*HYIщIH BLHIxHI @8HHDH CLHHI Ix@8HDHt}CLHHI Ix@8HDHt^CLHHI Ix@8HDHt?CL HI Ip@8HDHt A 1IHIM @8HDHuHxI @:)tHu,H[]A\HH~YA<1@8<1t/Hu0H)HyALLHHt%HHHALLHHuL)tff. fAUATIUSHQH(JH9(tUH9rtDJ DHHHHHH)HHH9*sZ[]A\A]H)Hff. @ ATIHUSHHH-`HH肻Ht'A|$ ID$H9 [L]A\1VUSHH(HGH; t@H; t7H- HT$H Ht$H1H([]1H Ht Hff. H` u,HF`HcHLFPFT9H HEG H0-H H H0-f D H H @ SH S HcH H|$Ht$1H H HH'1HC C Hs H[ QHv|H_ H ZÐHOHAHPHGH=F H@(H01jff. SHHHqH[H闝 Sp Hu[@ HHqH1[H3f Sp Hu[#HHzqH1[HLHff. SHHHSqH߃[H$H @ SHHH3qHߺ [HR3fUHSHHAP.H YHHH[]D @ SHu[1҉Hs 1H{H C [ HA H@ @ ff. fHHHHj ff. ff. ff. Hu H H f. HY H @ ff. 1ff. fAU1ATIUHSHHH:HrHHT$HL IH$I9HT$IHSI4LLLk<C(=+1HC H9HN1T,HH@uHuH)A)H?L,H9|H[]A\A]f. HH ff. HQ H @ HA H @ H1 H @ H! H @ ff. ff. ff. kff. SHHNH[ D HwX1f Hw`1f AUIATAUS QLƉK~t Z[]A\A]D9tL1#~ff. 雼ff. Hh! ff. HQ HH@ کf. H=; 4T @ k ff. USHQ P =p >O{` SO HߋkfHu"{` k#O HGHuk Q Z[]ff. USHQ P =p nO{` O HߋkHuB{` kiO HHu#{` k<O HH O Q Z[]ff. AWAVAUATUSHH P =p P{` Q k~IHJQDs`E1A EQ HHHPkHs LfHHoPIcL9NPL HH[]A\A]A^A_ H t7)D$P)L$`)T$p)$ )$ )$ )$ )$ H$ $0 HD$HD$ D$0 HD$HtHItIHP$ 1H f. AWAVAUATUSHH P =p '@{` @ Dc HH@Ds`E1A EN@H#pHH#@DcHs L7eIH?IcL9?HW HL[]A\A]A^A_f D AWAVAUATUSHH P =p @{` @ Dc=HHU@Ds`E1A E @HsHHuMDcHs LkdIHR@IcL9|=H HL[]A\A]A^A_M9t#JT DcIHL IT$AH MHHT$J4 NYIHt?HT$H AWAVIAUATUSH8 P =p NA~` NAF D$ HHxN1A~` HD$ A PNPA =p NA~` }NEfE;fV LMIVIcA HH@ $D$AF`LA~` Lz L/H LH LؖIH LĩA~` I LH LHD$(H AvI~轇HKfnH fn$f:"H f:"D$I~ flMtMm0 )$EHHjL fo$LxLhHD$(B HBA A H9\$ AFHT HD$ A XA EfJA A D$ AFH*KEn`E KIv HjaIHJIcH9}HL IT$AH HzA PA H8L[]A\A]A^A_HL$ HH$HHH4 HD$ SVIHZKH$HIVIcA HH@ $D$JAWIAVAUATUSH8 P =p iOA` MOAG D$ IHON1A` HD$ A (NPA =p NA` MAoA;o& LzMIWHcA HH@ $D$AG`~LA` Nz LH LΓIH L躦A` I LH LHD$(H AwI賄HMfnH fn$f:"H f:"D$I flM` 0 )$BHHM fo$LpLhHD$(B HBA A H9\$ AGIHD$ A oA` AoMz LH A AoJA A D$ AGHJEo`EJIw H<^HHLIcH9|+L`A PA H8H[]A\A]A^A_I HUAH IWHcA HH@ $D$oJMmHL$ LH$HHH4 HD$ RHHIH$I LHLIHAwI褂HuIfn$fnH 0 f:"H f:"D$I fl)$@HH!Ifo$f LhH@ A HH setopencodehook PYTHONINSPECT Python %s %s __main__ <stdin> out of memory sys.addaudithook sem_init memory allocation failed decoding error invalid -X utf8 option value failed to LC_CTYPE locale PYTHONCOERCECLOCALE PYTHONUTF8 POSIX PYTHONMALLOC 646 ansi_x3.4_1968 ansi_x3.4_1986 ansi_x3_4_1968 cp367 csascii ibm367 iso646_us iso_646.irv_1991 iso_ir_6 us_ascii initialization config is NULL can't make first thread can't make main interpreter failed to read thread state PYTHONDEVMODE PYTHONWARNDEFAULTENCODING expected long option unknown option %ls -J is reserved for Jython Unknown option: -%c LC_ALL pymalloc pymalloc_debug LC_CTYPE cannot decode string 3.11.9 strict <prefix>/lib/pythonX.X Python %s cannot decode PYTHONWARNINGS PYTHONDEBUG PYTHONVERBOSE PYTHONOPTIMIZE PYTHONDONTWRITEBYTECODE PYTHONNOUSERSITE PYTHONUNBUFFERED PYTHONDUMPREFS PYTHONMALLOCSTATS PYTHONDUMPREFSFILE cannot decode PYTHONPATH PYTHONPLATLIBDIR PYTHONHASHSEED PYTHONSAFEPATH PYTHONFAULTHANDLER PYTHONPROFILEIMPORTTIME PYTHONNODEBUGRANGES PYTHONTRACEMALLOC PYTHONINTMAXSTRDIGITS PYTHONPYCACHEPREFIX PYTHONIOENCODING unexpected end of data invalid start byte invalid continuation byte error getting getpath results error evaluating path posix os_name WITH_NEXT_FRAMEWORK /opt/alt/python311 EXEC_PREFIX VPATH lib64 PYDEBUGEXT VERSION_MAJOR VERSION_MINOR PYWINVER EXE_SUFFIX ENV_PATH ENV_PYTHONHOME ENV_PYTHONEXECUTABLE ENV___PYVENV_LAUNCHER__ real_executable library executable_dir py_setpath winreg __builtins__ reading getpath results bad leading pad byte bad trailing pad byte negative argument not allowed /dev/urandom sem_clockwait sem_trywait sem_wait sem_post PyCOND_FINI(gil->cond) failed PyCOND_INIT(gil->cond) failed PyCOND_WAIT(gil->cond) failed Can't initialize bytes type Can't initialize int type can't init int info type Can't initialize float type can't init float info type Can't initialize tuple type errmap insertion problem. Can't initialize types can't init context types failed to initialize a type can't initialize sys module can't set preliminary stderr can't initialize warnings __stderr__ __displayhook__ __excepthook__ __breakpointhook__ __unraisablehook__ hexversion CPython (szz) _git _framework api_version copyright linux platform maxsize maxunicode builtin_module_names stdlib_module_names little byteorder abiflags final cpython cpython-311 cache_tag x86_64-linux-gnu _multiarch implementation float_repr_style meta_path Ellipsis True bool memoryview classmethod complex enumerate filter float frozenset property reversed staticmethod builtins.ExceptionGroup EnvironmentError __import__ _frozen_importlib import _imp # builtin _imp {sO} _install non-string found in code slot utf-8 Immortal interned string died type MRO must not be empty duplicate base class %U duplicate base class %s() method: bad call flags ) -- too many digits in integer uncollectable collected {sisnsn} gc: %s <%s %p> in tp_clear of in garbage collection unnamed field nameless module assign to %.80s (%.80s) %.80s %s%s%s, %.20s, %.9s 00:00:00 Apr 12 2024 unmatched paren in format Unmatched paren in format Bad dict format an integer is required list modified during sort dict mutated during update pthread semaphore embedded null byte sy#nns unsupported error handler type() takes 1 or 3 arguments cannot create '%s' instances UO!O!:type.__new__ __slots__ must be identifiers at least exactly at most excess ')' in getargs format missing ')' in getargs format %.200s%s takes no arguments bad format string: %.200s str or None str, bytes or bytearray a byte string of length 1 a unicode character (unicode conversion error) embedded null character (buffer is NULL) (encoding failed) (buffer_len is NULL) (unspecified) read-write bytes-like object contiguous buffer (impossible<bad format char>) bases must be types super(): no current frame %U takes no keyword arguments __path__ __origname__ width too big precision too big %lu %llu %zu %u %li %lli %zi yO no import module dictionary iso-8859-1 utf-8- iso-latin-1 iso-8859-1- iso-latin-1- encoding problem: %s encoding problem: %s with BOM backslashreplace was were %U() keywords must be strings , from %zd to %zd y# marshal.loads marshal.load unexpected indent unexpected unindent incomplete input unexpected EOF while parsing invalid syntax drop_gil: GIL is not locked EOF read where not expected recursion limit exceeded size must be positive surrogatepass expected ':' Async with statements are Async for loops are Exception groups are Pattern matching is marshal data too short lost sys.displayhook bad RAISE_VARARGS oparg lasti is not an int __build_class__ not found no locals when deleting %R name '%.200s' is not defined no locals when loading %R __import__ not found XXX lineno: %d, opcode: %d unknown opcode byte string is too large invalid token unknown parsing error invalid kind # type: tokenizer beginning of buffer tok_backup: wrong character %04X invalid character '%c' (U+%s) invalid hexadecimal literal hexadecimal invalid octal literal octal invalid binary literal binary invalid decimal literal imaginary too many nested parentheses tuple index out of range code: co_code is malformed <metaclass> __orig_bases__ Variable annotation syntax is illegal target for annotation expected bytes, %.200s found unicodedata normalize NFKC Os object.__getattr__ bad memberdescr type string to parse is too long at least at most Assignment expressions are <> != The '@' operator is hasattr getattr setattr Await expressions are readonly attribute Truncation of value to char Truncation of value to short Truncation of value to int bad memberdescr type for %s This object has no __dict__ __class__ / may appear only once / must be ahead of * ( Async functions are must be str, not %.100s Async comprehensions are %.200s() takes no arguments expected '%s' unable to get sys.modules check_hash_based_pycs module '%s' has no __dict__ expected an indented block f-string: expecting '}' module has no attribute '%U' \U%08x truncated \xXX escape truncated \UXXXXXXXX escape truncated \uXXXX escape \ at end of string malformed \N character escape illegal Unicode character unicodedata._ucnhash_CAPI f-string: unmatched '%c' f-string: unterminated string invalid %s literal isinstance in __instancecheck__ in comparison |$OO:AttributeError keyword this function Empty keyword parameter name Empty parameter name after $ %s: '%s' in __subclasscheck__ Trailing \ in string property has no deleter property has no setter property has no getter empty separator is_frozen is_frozen_package is_builtin LockType TIMEOUT_MAX __weaklistoffset__ __dictoffset__ __vectorcalloffset__ Py_tp_bases is not a tuple invalid slot offset filters _onceregistry _defaultaction no symtable __future__ nested_scopes generators division absolute_import with_statement print_function unicode_literals barry_as_FLUFL generator_stop braces not a chance runtime core not initialized fail to reconfigure Python can't create __main__ module initializing zipimport failed _install_external_importers unable to get sys.path_hooks zipimport # installing zipimport hook # can't import zipimport # installed zipimport hook failed to enable faulthandler Python path configuration: PYTHONHOME = PYTHONPATH = program name = isolated = %i environment = %i user site = %i safe_path = %i import site = %i is in build tree = %i stdlib dir = _base_executable sys.%s = %A (not set) base_prefix base_exec_prefix platlibdir sys.path = [ %A, ] filesystem_encoding filesystem_errors can't initialize signals can't initialize tracemalloc __stdin__ <stdout> __stdout__ <stderr> can't initialize io.open __annotations__ __loader__ BuiltinImporter warnoptions _config_init isolated use_environment dev_mode install_signal_handlers use_hash_seed import_time code_debug_ranges show_ref_count dump_refs malloc_stats pycache_prefix program_name parse_argv pythonpath_env home module_search_paths_set module_search_paths site_import bytes_warning inspect interactive optimization_level parser_debug verbose quiet user_site_directory configure_c_stdio buffered_stdio stdio_encoding stdio_errors skip_source_first_line run_filename _install_importlib check_hash_pycs_mode pathconfig_warnings _init_main _isolated_interpreter orig_argv use_frozen_modules safe_path _is_python_build no current interpreter .%d Max string recursion exceeded unexpected '{' in field name unmatched '{' in format spec %.200s is not a sequence Missing ']' in format string <NULL> <%s object at %p> (iO) <class at %p> <class '%U.%U'> <class '%s'> __module__ named expression yield expression await expression writeobject with NULL file can only assign an iterable failed to make path absolute string index out of range |= requires tuple of arguments failed to join paths uui encoding error surrogateescape (iOOiO) (iOO) xmlcharrefreplace compile.c compiler unit OSError unknown symbol table entry dict expected invalid config value: %s invalid config type: %s << missing config key: %s negative shift count += argument must be iterable _xoptions _stdlib_dir lost sys.flags dont_write_bytecode coroutine already executing generator already executing Empty module name module name must be a string level must be >= 0 '__name__' not in globals globals must be a dict package must be a string __name__ must be a string %U.%U OOOOO %s arg must be None or str 'return' outside function inplace 'break' outside loop 'yield' outside function 'await' outside function keyword argument repeated: %U (Niiii) can't allocate lock cannot assign to __debug__ cannot delete __debug__ not holding the import lock no current thread ident timeout |iO:acquire timeout value is too large release unlocked lock argument 1 find_frozen argument 'name' get_frozen_object argument 2 string, bytes or code DEFAULT_BUFFER_SIZE UnsupportedOperation s(OO){} BlockingIOError -= replace string is too long sem_destroy JUMP_IF_TRUE_OR_POP JUMP_IF_FALSE_OR_POP malformed control flow graph. too many constants environ F_OK R_OK W_OK TMP_MAX WCONTINUED WNOHANG WUNTRACED O_RDONLY O_WRONLY O_RDWR O_NDELAY O_NONBLOCK O_APPEND O_DSYNC O_RSYNC O_SYNC O_NOCTTY O_CREAT O_EXCL O_LARGEFILE O_PATH O_TMPFILE PRIO_PROCESS PRIO_PGRP PRIO_USER O_CLOEXEC O_ACCMODE O_FSYNC SEEK_HOLE SEEK_DATA O_ASYNC O_DIRECT O_DIRECTORY O_NOFOLLOW O_NOATIME EX_OK EX_USAGE EX_DATAERR EX_NOINPUT EX_NOUSER EX_NOHOST EX_UNAVAILABLE EX_SOFTWARE EX_OSERR EX_OSFILE EX_CANTCREAT EX_IOERR EX_TEMPFAIL EX_PROTOCOL EX_NOPERM EX_CONFIG ST_RDONLY ST_NOSUID ST_NODEV ST_NOEXEC ST_SYNCHRONOUS ST_MANDLOCK ST_WRITE ST_APPEND ST_NOATIME ST_NODIRATIME ST_RELATIME POSIX_FADV_NORMAL POSIX_FADV_SEQUENTIAL POSIX_FADV_RANDOM POSIX_FADV_NOREUSE POSIX_FADV_WILLNEED POSIX_FADV_DONTNEED P_PID P_PGID P_ALL P_PIDFD WEXITED WNOWAIT WSTOPPED CLD_EXITED CLD_KILLED CLD_DUMPED CLD_TRAPPED CLD_STOPPED CLD_CONTINUED F_LOCK F_TLOCK F_ULOCK F_TEST RWF_DSYNC RWF_HIPRI RWF_SYNC RWF_NOWAIT RWF_APPEND SPLICE_F_MOVE SPLICE_F_NONBLOCK SPLICE_F_MORE POSIX_SPAWN_OPEN POSIX_SPAWN_CLOSE POSIX_SPAWN_DUP2 SCHED_OTHER SCHED_FIFO SCHED_RR SCHED_BATCH SCHED_IDLE SCHED_RESET_ON_FORK XATTR_CREATE XATTR_REPLACE XATTR_SIZE_MAX RTLD_LAZY RTLD_NOW RTLD_GLOBAL RTLD_LOCAL RTLD_NODELETE RTLD_NOLOAD RTLD_DEEPBIND GRND_RANDOM GRND_NONBLOCK MFD_CLOEXEC MFD_ALLOW_SEALING MFD_HUGETLB MFD_HUGE_SHIFT MFD_HUGE_MASK MFD_HUGE_64KB MFD_HUGE_512KB MFD_HUGE_1MB MFD_HUGE_2MB MFD_HUGE_8MB MFD_HUGE_16MB MFD_HUGE_32MB MFD_HUGE_256MB MFD_HUGE_512MB MFD_HUGE_1GB MFD_HUGE_2GB MFD_HUGE_16GB EFD_CLOEXEC EFD_NONBLOCK EFD_SEMAPHORE pathconf_names confstr_names sysconf_names posix.waitid_result os.stat_result os.statvfs_result posix.sched_param posix.times_result struct_rusage st_mode _have_functions ordinal not in range(128) can only join an iterable __code__ argument 'byteorder' to_bytes int too big to convert can't concat %.100s to %.100s Object is not writable. from_bytes {OO} OOOOi unmarshallable object marshal.dumps too many objects <unknown module name> CLOCK_REALTIME CLOCK_MONOTONIC CLOCK_MONOTONIC_RAW CLOCK_PROCESS_CPUTIME_ID CLOCK_THREAD_CPUTIME_ID CLOCK_BOOTTIME CLOCK_TAI _STRUCT_TM_ITEMS invalid GMT offset timezone altzone daylight (zz) tzname slice step cannot be zero cannot decode %s unknown encoding: %s encodings handler must be callable string, bytes or os.PathLike sOnns byte string is too long |Oi:enable unable to get sys.stderr sys.stderr is None |$OO:min |$OO:max %s() arg is an empty sequence |$OO:ImportError impossible<bad format char> ... truncated & os.listdir rstrip latin_1 iso_8859_1 iso8859_1 surrogates not allowed endswith argument 'encoding' argument 'errors' int() missing string argument argument 'path' open_code _io rb argument 'mode' argument 'newline' invalid file: %R invalid mode: '%s' invalid buffering size unknown mode: '%s' OsssO negative file descriptor invalid mode: %.200s Osi expected integer from opener opener returned %d I/O operation on closed file can't allocate read lock I/O operation on closed file. raw stream has been detached read of closed file readall() should return bytes read() should return bytes compile(): unrecognised flags eval single func_type Module Expression Interactive expected %s node, got %.400s impossible module node string, bytes or AST lstrip __doc__ __match_args__ _attributes _fields argtypes asname bases cases cls context_expr conversion ctx decorator_list elt elts end_col_offset end_lineno exc finalbody format_spec guard ifs is_async keywords kw_defaults kwarg kwd_attrs kwd_patterns kwonlyargs operand ops optional_vars orelse posonlyargs rest returns simple step subject targets type_comment type_ignores vararg Interactive(stmt* body) Expression(expr body) FunctionType stmt AsyncFunctionDef ClassDef Return(expr? value) Return Delete(expr* targets) Delete AugAssign AnnAssign AsyncFor While If AsyncWith Raise(expr? exc, expr? cause) Raise Try TryStar Assert(expr test, expr? msg) Assert Import(alias* names) Import ImportFrom Global(identifier* names) Global Nonlocal(identifier* names) Nonlocal Expr(expr value) Pass Break Continue BoolOp NamedExpr BinOp UnaryOp Lambda IfExp Set(expr* elts) Set ListComp SetComp DictComp GeneratorExp Await(expr value) Await Yield(expr? value) Yield YieldFrom(expr value) YieldFrom Compare Call FormattedValue JoinedStr(expr* values) JoinedStr Constant Attribute Subscript Starred Name List Tuple Slice expr_context Load Store Del boolop = And | Or boolop MatMult Mod Pow LShift RShift BitOr BitXor BitAnd FloorDiv unaryop Invert UAdd USub cmpop NotEq Lt LtE Gt GtE Is IsNot NotIn excepthandler ExceptHandler keyword alias withitem match_case MatchValue(expr value) MatchValue MatchSingleton MatchSequence MatchMapping MatchClass MatchStar(identifier? name) MatchStar MatchAs MatchOr(pattern* patterns) MatchOr type_ignore TypeIgnore sub-views are not implemented memoryview: invalid slice key s(O){OOOOOOOs} _fix_co_filename Key __all__ Item lookup_error pop from empty list pop index out of range argument must be callable signal.itimer_error NSIG SIG_BLOCK SIG_UNBLOCK SIG_SETMASK SIGHUP SIGINT SIGQUIT SIGILL SIGTRAP SIGIOT SIGABRT SIGFPE SIGKILL SIGBUS SIGSEGV SIGSYS SIGPIPE SIGALRM SIGTERM SIGUSR1 SIGUSR2 SIGCLD SIGCHLD SIGPWR SIGIO SIGURG SIGWINCH SIGSTOP SIGTSTP SIGCONT SIGTTIN SIGTTOU SIGVTALRM SIGPROF SIGXCPU SIGXFSZ SIGRTMIN SIGRTMAX SIGSTKFLT ITIMER_REAL ITIMER_VIRTUAL ITIMER_PROF SIG_DFL SIG_IGN ItimerError default_int_handler super(): no arguments super(): arg[0] deleted super(): bad __class__ cell super(): empty __class__ cell items() returned non-iterable __bases__ is not tuple OsO object.__setattr__ _abc_register Can only register classes _abc_subclasscheck __subclasses__ weak object has gone away module filename missing expected a message argument wb OOOsOO isiOOOO codecs.open() illegal newline value: %s incrementaldecoder incrementalencoder | ST_MODE ST_INO ST_DEV ST_NLINK ST_UID ST_GID ST_SIZE ST_ATIME ST_MTIME ST_CTIME S_IFDIR S_IFCHR S_IFBLK S_IFREG S_IFIFO S_IFLNK S_IFSOCK S_IFDOOR S_IFPORT S_IFWHT S_ISUID S_ISGID S_ISVTX S_ENFMT S_IREAD S_IWRITE S_IEXEC S_IRWXU S_IRUSR S_IWUSR S_IXUSR S_IRWXG S_IRGRP S_IWGRP S_IXGRP S_IRWXO S_IROTH S_IWOTH S_IXOTH UF_NODUMP UF_IMMUTABLE UF_APPEND UF_OPAQUE UF_NOUNLINK UF_COMPRESSED UF_HIDDEN SF_ARCHIVED SF_IMMUTABLE SF_APPEND SF_NOUNLINK SF_SNAPSHOT issubclass list.remove(x): x not in list negative count byte must be in range(0, 256) rlcompleter Python %s on %s cpython.run_command cpython.run_file PYTHONSTARTUP cpython.run_startup Could not open PYTHONSTARTUP cpython.run_stdin unable to get sys.path cpython.run_module runpy _run_module_as_main // |$p:zip expected 'str', not '%.200s' repeated string is too long decoding str is not supported % format requires a mapping incomplete format key * wants int %c arg not in range(0x110000) %c requires int or char incomplete format mode out of range sorted lstat <frozen importlib._bootstrap> _call_with_frames_removed read1 not readable OO;illegal decoder state raw readinto() failed readinto intern can't intern %.400s ascii_decode Nn utf_8_decode in atexit callback locals must be a mapping frame does not exist flush of closed file builtins.id # clear builtins._ # clear sys.%s # restore sys.%s # cleanup[2] removing %U gc %s # cleanup[3] wiping %U # cleanup[3] wiping sys # cleanup[3] wiping builtins # destroy %U writing OOii os.rename # clear[1] %s # clear[2] %s unclosed file %R # clear sys.audit hooks NULL interpreter remaining threads remaining subinterpreters tstate %p is still current <%U.%U object at %p> PyInit PyInitU create_dynamic spec.name must be a string punycode cc __file__ replace bytes is too long unknown dlopen() error ./%-.255s %.20s_%.200s how_many cannot be negative os.mkdir cannot allocate lock call stack is not deep enough sys._getframe argument 'source' source_hash setdefault delattr pop from an empty set lost sys.path_importer_cache lost sys.path_hooks %.200s is not a mapping whence value %d unsupported seek of closed file rfind wrong thread state no interpreter provided MAGIC CODESIZE MAXREPEAT MAXGROUPS &= ** or pow() not writable ,) __interactivehook__ cpython.run_interactivehook write to closed file ??? Error in sys.excepthook: Original exception was: sys.excepthook is missing sys.excepthook in audit hook .pyc __cached__ SourcelessFileLoader Bad magic number in .pyc file Bad code object in .pyc file SourceFileLoader __len__() should return >= 0 _RAW_MAGIC_NUMBER [] [...] thread is not current thread still has a frame not the last thread lost sys.stderr Py_FileSystemDefaultEncoding Py_UTF8Mode Py_DebugFlag Py_VerboseFlag Py_QuietFlag Py_InteractiveFlag Py_InspectFlag Py_OptimizeFlag Py_NoSiteFlag Py_BytesWarningFlag Py_FrozenFlag Py_IgnoreEnvironmentFlag Py_DontWriteBytecodeFlag Py_NoUserSiteDirectory Py_UnbufferedStdioFlag Py_HashRandomizationFlag Py_IsolatedFlag global_config configure_locale coerce_c_locale coerce_c_locale_warn utf8_mode allocator pre_config +- ... (max_group_depth is %d) in print_exception_group and %zd more exception%s argument 'code' argument 'groupindex' argument 'indexgroup' invalid SRE code Buffer is NULL found File "%S", line %zd ^ <unknown>. <unknown> : <exception str() failed> . Did you mean: ' '? <__notes__ repr() failed> <note str() failed> __format__ OOpO:lru_cache character maps to <undefined> {...} <function %U at %p> (OnnNnn) unicode error value error (%s) %U (%s) unknown error OOOO|OO a number is required ordinal not in range(256) maxlen |OO:deque maxlen must be non-negative ^= before after_in_child after_in_parent '%s' must be callable, not %s fromkeys divmod Exception ignored %s sys.unraisablehook __round__ %s0%se%d Exception ignored in: <object repr() failed> iter index too large bytearray index out of range ~ tracebacklimit File "%U", line %d, in %U inf nan int too large to format non-ascii grouped digit (b maketrans argument list must be a tuple input(): lost sys.stdin input(): lost sys.stdout input(): lost sys.stderr builtins.input builtins.input/result PyCF_ALLOW_TOP_LEVEL_AWAIT PyCF_ONLY_AST PyCF_TYPE_COMMENTS Expected int as r r must be non-negative EOF when reading a line |n:product repeat argument too large frexp() result out of range readline of closed file join() result is too long LC_TIME LC_COLLATE LC_MONETARY LC_MESSAGES LC_NUMERIC locale.Error startswith %S.%s errorcode ENODEV ENOCSI EHOSTUNREACH ENOMSG EUCLEAN EL2NSYNC EL2HLT ENODATA ENOTBLK ENOSYS EPIPE EINVAL EOVERFLOW EADV EINTR EUSERS ENOTEMPTY ENOBUFS EPROTO EREMOTE ENAVAIL ECHILD ELOOP EXDEV E2BIG ESRCH EMSGSIZE EAFNOSUPPORT EBADR EHOSTDOWN EPFNOSUPPORT ENOPROTOOPT EBUSY EWOULDBLOCK EBADFD EDOTDOT EISCONN ENOANO ESHUTDOWN ECHRNG ELIBBAD ENONET EBADE EBADF EMULTIHOP EUNATCH EPROTOTYPE ENOSPC ENOEXEC EALREADY ENETDOWN ENOTNAM EACCES ELNRNG EILSEQ ENOTDIR ENOTUNIQ EPERM EDOM EXFULL ECONNREFUSED EISDIR EPROTONOSUPPORT EROFS EADDRNOTAVAIL EIDRM ECOMM ESRMNT EREMOTEIO EL3RST EBADMSG ENFILE ELIBMAX ESPIPE ENOLINK ENETRESET ETIMEDOUT ENOENT EEXIST EDQUOT ENOSTR EBADSLT EBADRQC ELIBACC EFAULT EFBIG EDEADLK ENOTCONN EDESTADDRREQ ELIBSCN ENOLCK EISNAM ECONNABORTED ENETUNREACH ESTALE ENOSR ENOMEM ENOTSOCK ESTRPIPE EMLINK ERANGE ELIBEXEC EL3HLT ECONNRESET EADDRINUSE EOPNOTSUPP EREMCHG EAGAIN ENAMETOOLONG ENOTTY ERESTART ESOCKTNOSUPPORT ETIME EBFONT EDEADLOCK ETOOMANYREFS EMFILE ETXTBSY EINPROGRESS ENXIO ENOPKG ENOMEDIUM EMEDIUMTYPE ECANCELED ENOKEY EKEYEXPIRED EKEYREVOKED EKEYREJECTED EOWNERDEAD ENOTRECOVERABLE ERFKILL ENOTSUP OK;illegal decoder state span no such group %S (%U, line %ld) %S (%U) %S (line %ld) >> <<= s 1- __defaults__ object.__delattr__ repeated bytes are too long get_terminal_size cannot use '_' as a target invalid pattern target %R is not in list _subx text_encoding @c @P @? @d @f @N @n @Q @q @L @l @I @i @H @h @B @b argument 'format' cast memoryview: internal error new string is too long float division by zero O:cmp_to_key O:K %+.02d Infinity NaN module definition is NULL module %p already added __getformat__ double unknown IEEE, little-endian IEEE, big-endian U|O:strftime readlines __name__ os.scandir %5u %6u %11zu %15zu %13zu # arenas allocated total # arenas reclaimed # arenas highwater mark # arenas allocated current %zu arenas * %d bytes/arena # bytes in allocated blocks # bytes in available blocks %u unused pools * %d bytes # bytes lost to pool headers # bytes lost to quantization Total arena map counts # arena map mid nodes # arena map bot nodes # bytes lost to arena map mid # bytes lost to arena map bot search search() takes no arguments unclosed scandir iterator %R clock_gettime(CLOCK_REALTIME) UOnnU substring not found <string> always argument 3 %s(...) %s() %s({%U}) {%U} os.putenv __kwdefaults__ os.system invalid wait status: %i unlink os.remove | %S.%S illegal newline value: %R __qualname__ new buffer size too large [ new position too large garbage DEBUG_STATS DEBUG_COLLECTABLE DEBUG_UNCOLLECTABLE DEBUG_SAVEALL DEBUG_LEAK os.chdir %R is not in deque pop from an empty deque start_new_thread first arg must be callable 2nd arg must be a tuple can't start new thread in thread started by non-NULL old thread state i|Oii:register deque index out of range signal number out of range os.fork <ascii(self) failed> reentrant call inside %R ii:waitpid Ni ddd kk (kk):_acquire_restore couldn't acquire lock is not retrievable precision too large O|iOi:dump_traceback_later Timeout (%lu:%02lu:%02lu)! invalid generation setlocale unsupported locale setting locale query failed |$O:NameError thread.local.%p codecs.encode() %s with '%s' codec failed utf_16_le_encode utf-16-be utf-16-le utf-16 truncated data illegal encoding illegal UTF-16 surrogate utf_16_be_encode utf_32_le_encode argument 'co_code' argument 'co_consts' argument 'co_names' argument 'co_varnames' argument 'co_freevars' argument 'co_cellvars' argument 'co_filename' argument 'co_name' argument 'co_qualname' argument 'co_linetable' argument 'co_exceptiontable' OOOiiiiii code.__new__ utf-32-le utf-32-be utf-32 utf_32_be_encode integer modulo by zero argument 'order' tobytes order must be 'C', 'F' or 'A' missing 'getdata' func imul setitem delitem %S.%S() os.chmod follow_symlinks f_code %.200s() argument %zd , item %d %.256s cannot pickle '%.200s' object N(Os) \Uxxxxxxxx out of range rawunicodeescape O(O)n O(()) O|O:getsizeof _abc_instancecheck must be %.50s, not %.50s sep must be length 1. sep must be ASCII. sep must be str or bytes. UUnnU (ii) value must be positive %s%s%sj%s _module_repr positional keyword-only %U and %U , %U, and %U str() on a bytes instance str() on a bytearray instance center result too long O|n:repeat subsection not found ljust removeprefix removesuffix rindex rjust __reduce_ex__ (O()N) (O(Ns)N) (O(y#)N) cannot pickle %.200s objects fromhex readinto of closed file pop from empty bytearray %= a real number prec too big %c arg not in range(256) N(O)n N(()) latin_1_encode unhashable type: '%.200s' value not found in bytearray _reduce_ex (y#) charmap_build charmap_encode charmap &#%d; %ld rpartition sys.settrace cannot delete memory fileno negative seek value %zd peek peek of closed file codecs.decode() decoding utf_16_le_decode absolute value too large //= (Nn) %.200s attribute not set lookup charmap_decode latin_1_decode raw_unicode_escape_decode utf_16_decode utf_16_be_decode utf_7_decode ascii_encode raw_unicode_escape_encode utf_16_encode utf_7_encode utf_8_encode invalid escape sequence '\%c' utf_16_ex_decode Nni ill-formed sequence unexpected special character utf7 unterminated shift sequence utf_32_encode utf_32_ex_decode utf_32_le_decode utf_32_be_decode (Cn) _count_elements %U (%s: %S) string is too large to encode read-only bytes-like object CP_UTF8 readbuffer_encode Negative seek position %zd utf_32_decode gt or_ and_ can't delete attribute can't set attribute (O(nO)) %s(%zd, %R) Negative size value %zd lost builtins module float floor division by zero float modulo complex division by zero complex modulo complex exponentiation except handler float divmod() (dd) (O&O&O&O&) mappingproxy(%R) 1e%d and or + - * @ / % << >> ^ & // ** lambda lambda == != < <= > >= is is not not in . unknown binary operator unknown unary operator , / ** if else { (yield) (yield (yield from await unexpected comparison kind , := unknown expression kind day of month out of range hour out of range minute out of range seconds out of range day of week out of range day of year out of range n must be >= 0 |O:gmtime |O:localtime mktime argument out of range os.unsetenv |O:ctime %s %s%3d %.2d:%.2d:%.2d %d character out of range O|$O:ContextVar **= failed to get LC_CTYPE locale currency_symbol mon_decimal_point mon_thousands_sep mon_grouping positive_sign negative_sign int_frac_digits p_cs_precedes p_sep_by_space n_cs_precedes n_sep_by_space p_sign_posn n_sign_posn int_curr_symbol >>= os.utime os.listxattr os.getxattr argument 'value' OOy#i os.setxattr fd is greater than maximum fd is less than minimum os.rmdir <released memory at %p> <memory at %p> -0x0.0p+0 -0x%sp%c%d instance must not be None while traversing 'stmt' node while traversing 'For' node while traversing 'If' node while traversing 'With' node while traversing 'Try' node while traversing 'Expr' node invalid integer value: %R while traversing 'expr' node while traversing 'Dict' node while traversing 'Set' node while traversing 'Call' node while traversing 'Name' node while traversing 'List' node Negative ImportFrom level unexpected statement empty %s on %s Compare with no comparators unexpected expression (O(OiiNii)) tstate mix-up orphan tstate nnOn nnnn cannot delete __dict__ O(O)(OOOO) invalid partial state %U, %R %U, %S=%R %s(%R%U) reduce ag_frame cr_frame gi_frame (iii) i|ii:set_threshold O(OiiOii) subscript starred function call generator expression list comprehension set comprehension dict comprehension dict literal set display f-string expression ellipsis conditional expression <generator object %S at %p> <built-in function %s> <_io.TextIOWrapper name=%R %U encoding=%R> mode=%R <%s> <%s name=%R> getrusage(RUSAGE_SELF) _SC_CLK_TCK is too large times() clock() length_hint len() of unsized object (O)O O(NO)O O(NiO) O(OO)O N(N)l (O(OOO)) O()(OO) O()(O) O() state is not a tuple O|O Arguments must be iterators. N(N) O(On) O(()n) O(On)N invalid arguments O(OO) %s(%zd) %s(%R) %s(%R, %R) O(n) O(N)(OO) O(O)(OO) O!i O(OO)l O(OO)(OOO) O(Nn)n O(OnNn)n O(On)(NN) O!O! OON %s(%R, %zd) O(O) O(())(Oi) O(ONO) teedataobject Invalid arguments Index out of range ONO is_ %s%R method name must be a string %U=%R %s(%R, %U) contains count exceeds C integer size index exceeds C integer size countOf getitem iconcat indexOf iadd iand ifloordiv ilshift imod imatmul @= ior ipow irshift isub itruediv ixor is_not @ dictionary is empty O:PickleBuffer N(OO) N(ON) (d) (O(OO)) negative size value %zd __bases__ <bound method %V of %R> %s(%U, %U) %s(%R, maxlen=%zd) namespace %s(%S) range(%R, %R) range(%R, %R, %R) traceback loop detected 0x%x re.compile(%.200R, %S) re.compile(%.200R) _expand match() takes no arguments padded string is too long [Errno %S] %S: %R -> %R [Errno %S] %S: %R [Errno %S] %S asctime expect int, got %s _strptime i:clock_getres i:clock_gettime iO:clock_settime s:get_clock_info monotonic perf_counter process_time thread_time unknown clock adjustable resolution k:pthread_getcpuclockid expected str, got %s wstr legacy UCS2 legacy ascii legacy latin1 legacy UCS4 <legacy invalid kind> <invalid compact kind> xb+ xb ab+ rb+ %d %ss * %zd bytes each %48s free %d-sized PyTupleObject free PyDictObject free PyListObject free PyFloatObject \x \u \U File " ", line API '%c' FORBIDDENBYTE, as expected. at p-%d: 0x%02x *** OUCH at tail+%d: 0x%02x Data at p: %02x ... <tstate is freed> <no Python frame> ... File tstate is freed interp is freed Current thread 0x Thread 0x (most recent call first): Garbage-collecting input line too long can't re-enter readline Fatal Python error: <message not set> Python runtime state: finalizing (tstate=0x core initialized preinitialized preinitializing in new thread deallocating <dummy key> deallocating NotImplemented deallocating None deallocating True or False <object at %p is freed> object address : %p object refcount : %ld object type : %p object type name: %s object repr : %s:%d: %s: Assertion "%s" failed Assertion failed _PyObject_AssertFailed kind == PyUnicode_1BYTE_KIND ascii->state.ready == 1 ascii->state.ascii == 0 compact->utf8 != data ascii->length == 0 ascii->hash == -1 ascii->state.ready == 0 ascii->state.interned == 0 ascii->wstr != ((void *)0) data == ((void *)0) compact->utf8 == ((void *)0) data != ((void *)0) compact->utf8 == data ascii->wstr == data ascii->wstr != data compact->utf8_length == 0 compact->wstr_length == 0 maxchar >= 128 maxchar <= 255 maxchar < 128 maxchar >= 0x100 maxchar <= 0xFFFF maxchar >= 0x10000 maxchar <= 0x10ffff mp->ma_used <= 30 (-2) <= ix && ix <= usable entry->me_hash != -1 entry->me_hash == hash <Token.MISSING> not a weakref NoneType takes no arguments __cause__ may not be deleted Cell is empty unlocked <%s %s object at %p> <DirEntry %R> <weakproxy at %p to %s at %p> <super: <class '%s'>, NULL> slice(%R, %R, %R) %s(%ld) <staticmethod(%R)> <classmethod(%R)> <coroutine object %S at %p> <member '%V' of '%s' objects> <method '%V' of '%s' objects> <cell at %p: empty> <capsule object %s%s%s at %p> %s: %s state is not a dictionary in __issubclass__ %S (%zd sub-exception%s) try sending as bytes non-tuple default args non-dict annotations <instancemethod %V at %p> type->tp_dict != ((void *)0) type->tp_new == ((void *)0) !_PyObject_IsFreed(op) detach File not open for %s invalid module index Module index out of bounds. sys.setprofile missing interp missing new_object func cannot delete attribute characters_written sched_priority out of range closerange uid is less than minimum uid is greater than maximum gid is less than minimum gid is greater than maximum isn deque.rotate nO:insert unable to start the thread unsupported langinfo constant dgettext dcgettext bind_textdomain_codeset DEF_GLOBAL DEF_NONLOCAL DEF_LOCAL DEF_PARAM DEF_FREE DEF_FREE_CLASS DEF_IMPORT DEF_BOUND DEF_ANNOT TYPE_FUNCTION TYPE_CLASS TYPE_MODULE GLOBAL_EXPLICIT GLOBAL_IMPLICIT CELL SCOPE_OFF SCOPE_MASK makedev O|O&O&:index stack to deep to analyze stack is too deep to analyze incompatible stacks lineno must be an integer lineno out of range _remove_dead_weakref tb_lineno tb_lasti tb_next tb_frame [ssss] O(OOO) length should not be negative (NNN) OiO Unknown signal sss call_tracing %R has already been used once no mem for sys.argv can't assign sys.argv can't compute path0 from argv note must be a str, not '%s' getgrouplist {snsnsn} can't create sys.path can't assign sys.path argument 'tb_frame' TracebackType depth must be >= 0 %R is not in range anext <weakref at %p; dead> instancemethod args may not be deleted <_io.FileIO [closed]> getpwuid(): uid not found getpwuid(): uid not found: %S pdb.set_trace PYTHONBREAKPOINT Struct unpack_from calcsize \' %c \x%02x \u%04x NNNK while traversing 'arg' node interpreter not initialized N(N)O N(O) (OnN) many few %R is not a generic class tokenizeriter Extension modules: (total: can't use MatchStar here unexpected pattern strcoll truncate of closed file readinto1 |Oi:dump_traceback setitimer resource NiN iiO:sched_setscheduler iO:sched_setparam i:sched_getparam iii:waitid too many groups groups must be integers sigtimedwait timeout must be non-negative set_inheritable i|$p:set_wakeup_fd set_blocking strxfrm siginterrupt pidfd_send_signal siginfo must be None i:sched_getscheduler i:sched_rr_get_interval iO:sched_setaffinity negative CPU number CPU number too large i:sched_getaffinity setreuid setregid i:getsid ii:setpgid ii:tcsetpgrp lseek fpathconf setresuid setresgid pthread_sigmask pread preadv pwrite pwritev posix_fallocate posix_fadvise <Token var= used <ContextVar name= default= in PyEval_SetProfile in PyEval_SetTrace (OiiO) _compare_digest east_asian_width { !a !r !s async for OOUi|OOOO:warn_explicit bindtextdomain chroot mknod mkfifo readlink %s=%s initgroups getpwnam UO:BaseExceptionGroup.__new__ UU i:setstate :getstate OU|i |n:stack_size size not valid: %zd bytes |i:signum O!|n |i:_sigsegv i:unregister |O!O:super <nil> <refcnt %ld at %p> register_error derive subgroup ((OK)) isisssO isisOOO ((yi)) Oi;illegal decoder state EOF (NiiiiiN) O()N (OOnN) negative seek position %R iy O()NN O(()n)NN sys._current_exceptions sys._current_frames O&|$p:InterpreterID.__init__ posix_spawnp %s: argv must not be empty os.posix_spawn gc.get_referents gc.get_referrers string or bytes '%c' was never closed cannot assign to %s cannot delete %s init_frozen lost sys.breakpointhook builtins.breakpoint >>> ... ki signal.pthread_kill OIIi os.chown os.removexattr iIIi lchown os.link os.symlink execv os.exec execve in:kill os.kill ii:killpg os.killpg iiL os.lockf os.truncate ftruncate (i) gc.get_objects argument 'globals' arg 5 (closure) must be tuple function.__new__ argument 7 argument 8 argument 9 argument 10 argument 11 argument 12 argument 13 argument 15 argument 16 argument 17 argument 18 failed to set autoTSSkey failed to create a new lock not main interpreter missing main interpreter os.forkpty (Ni) _stderr Exception in thread <failed to get thread name> in print_chained _frozen_importlib_external _collections_abc _sitebuiltins genericpath ntpath posixpath os.path importlib.util importlib.machinery __hello__ __hello_alias__ __phello_alias__ __phello_alias__.spam __phello__.__init__ __phello__.ham.__init__ __phello__.ham.eggs __phello__.spam __hello_only__ importlib._bootstrap importlib._bootstrap_external <__phello__ <__phello__.ham abspath basename dirname hassuffix isabs isdir isfile isxfile joinpath realpath getstate() -> state setstate(state) classmeth classmeth(*args, **kw) staticmeth staticmeth(*args, **kw) bench xxsubtype xxsubtype.spamlist xxsubtype.spamdict pw_name user name pw_passwd password pw_uid user id pw_gid group id pw_gecos real name pw_dir home directory pw_shell shell program getpwuid getpwall pwd.struct_passwd _symtable S_ISDIR S_ISCHR S_ISBLK S_ISREG S_ISFIFO S_ISLNK S_ISSOCK S_ISDOOR S_ISPORT S_ISWHT S_IMODE S_IFMT filemode _stat __reduce__ truth neg inv invert not_ _operator operator.methodcaller operator.itemgetter operator.attrgetter localeconv nl_langinfo getencoding ABDAY_1 ABDAY_2 ABDAY_3 ABDAY_4 ABDAY_5 ABDAY_6 ABDAY_7 ABMON_1 ABMON_2 ABMON_3 ABMON_4 ABMON_5 ABMON_6 ABMON_7 ABMON_8 ABMON_9 ABMON_10 ABMON_11 ABMON_12 RADIXCHAR THOUSEP CRNCYSTR AM_STR PM_STR CODESET T_FMT_AMPM ERA ERA_D_FMT ERA_D_T_FMT ERA_T_FMT ALT_DIGITS YESEXPR NOEXPR _DATE_FMT __setstate__ __class_getitem__ See PEP 585 obj cache_info cache_clear __copy__ __deepcopy__ functools._lru_list_elem functools.KeyWrapper functools._lru_cache_wrapper functools.partial user_function typed cache_info_type _functools mycmp get_cache_token _abc_init _reset_registry _reset_caches _get_dump _abc._abc_data getweakrefcount getweakrefs tm_year year, for example, 1993 tm_mon month of year, range [1, 12] tm_mday day of month, range [1, 31] tm_hour hours, range [0, 23] tm_min minutes, range [0, 59] tm_sec seconds, range [0, 61]) tm_wday tm_yday day of year, range [1, 366] tm_isdst tm_zone abbreviation of timezone name tm_gmtoff offset from UTC in seconds clock_gettime_ns clock_settime_ns sleep mktime tzset monotonic_ns process_time_ns thread_time_ns perf_counter_ns time.struct_time acquire_lock release_lock locked_lock __enter__ __exit__ _at_fork_reinit _is_owned _release_save _recursion_count Thread-local dummy Thread-local data exc_type Exception type exc_value Exception value exc_traceback Exception traceback Thread start_new allocate_lock exit_thread interrupt_main get_ident get_native_id _set_sentinel _excepthook _localdummy_destroyed _thread._ExceptHookArgs _thread._local _thread._localdummy _thread.RLock _thread.lock groupindex The regex matching flags. fullmatch subn findall finditer scanner lastindex lastgroup regs endpos groupdict getcodesize ascii_iscased unicode_iscased ascii_tolower unicode_tolower template maxsplit repl indexgroup _sre re.TEMPLATE re.IGNORECASE re.LOCALE re.MULTILINE re.DOTALL re.UNICODE re.VERBOSE re.DEBUG re.ASCII _sre.SRE_Scanner re.Match re.Pattern from_iterable __sizeof__ __length_hint__ selectors initial itertools combinations_with_replacement times itertools._tee_dataobject itertools._tee itertools._grouper itertools.groupby itertools.repeat itertools.product itertools.permutations itertools.pairwise itertools.zip_longest itertools.count itertools.filterfalse itertools.compress itertools.chain itertools.starmap itertools.islice itertools.takewhile itertools.dropwhile itertools.cycle itertools.combinations itertools.accumulate newlines line_buffering getvalue tell seekable __getstate__ initial_value newline _io.StringIO _io._TextIOBase reset _CHUNK_SIZE write_through reconfigure flush isatty translate iso8859-1 _io.IncrementalNewlineDecoder _io._BufferedIOBase raw _dealloc_warn buffer_size _io.BufferedRWPair _io.BufferedWriter _io.BufferedRandom _io.BufferedReader True if the file is closed. writelines getbuffer _io.BytesIO initial_bytes _io._BytesIOBuffer _io.FileIO readall True if the file is closed closefd String giving the file mode _checkClosed _checkSeekable _checkReadable _checkWritable _io._IOBase _io._RawIOBase append appendleft copy extend extendleft popleft __reversed__ reverse __missing__ default_factory _collections _collections._tuplegetter _collections._deque_iterator collections.defaultdict collections.deque _codecs is_tracing clear_traces _get_traces _get_object_traceback get_traceback_limit get_tracemalloc_memory get_traced_memory reset_peak _tracemalloc si_signo signal number si_code signal code si_errno si_pid sending process ID si_uid si_status exit value or signal si_band band event for SIGPOLL alarm getitimer raise_signal strsignal getsignal pause sigpending sigwait sigwaitinfo valid_signals warn_on_full_buffer signal.struct_siginfo protection bits st_ino inode st_dev device st_nlink number of hard links st_uid user ID of owner st_gid group ID of owner st_size total size, in bytes integer time of last access integer time of last change st_atime st_mtime time of last modification st_ctime st_atime_ns st_mtime_ns st_ctime_ns st_blksize blocksize for filesystem I/O st_blocks number of blocks allocated st_rdev device type (if inode device) f_bsize f_frsize f_blocks f_bfree f_bavail f_files f_ffree f_favail f_flag f_namemax f_fsid sysname operating system name nodename operating system release operating system version machine hardware identifier sched_priority the scheduling priority user time system time children_user user time of children children_system system time of children elapsed columns is_dir is_file is_symlink __fspath__ ttyname fchmod fchown ctermid getcwd getcwdb nice getpriority setpriority copy_file_range splice umask uname _exit register_at_fork sched_get_priority_max sched_get_priority_min sched_yield openpty login_tty getegid geteuid getgid getgroups getpid getppid getuid getlogin setuid seteuid setgid setegid setgroups wait3 setsid tcgetpgrp device_encoding dup dup2 sendfile fstat pipe pipe2 major minor fchdir fsync fdatasync WCOREDUMP WIFCONTINUED WIFSTOPPED WIFSIGNALED WIFEXITED WEXITSTATUS WTERMSIG WSTOPSIG fstatvfs confstr sysconf abort _path_normpath getloadavg getresuid getresgid cpu_count get_inheritable get_blocking fspath getrandom memfd_create eventfd eventfd_read eventfd_write waitstatus_to_exitcode initval out_fd in_fd fd2 policy target_is_directory src_dir_fd dst_dir_fd offset_src offset_dst file_actions setpgroup resetids setsigmask setsigdef which who effective_ids HAVE_EVENTFD HAVE_FACCESSAT HAVE_FCHDIR HAVE_FCHMOD HAVE_FCHMODAT HAVE_FCHOWN HAVE_FCHOWNAT HAVE_FEXECVE HAVE_FDOPENDIR HAVE_FPATHCONF HAVE_FSTATAT HAVE_FSTATVFS HAVE_FTRUNCATE HAVE_FUTIMENS HAVE_FUTIMES HAVE_FUTIMESAT HAVE_LINKAT HAVE_LCHOWN HAVE_LSTAT HAVE_LUTIMES HAVE_MEMFD_CREATE HAVE_MKDIRAT HAVE_MKFIFOAT HAVE_MKNODAT HAVE_OPENAT HAVE_READLINKAT HAVE_RENAMEAT HAVE_SYMLINKAT HAVE_UNLINKAT HAVE_UTIMENSAT posix.uname_result posix.DirEntry posix.ScandirIterator os.terminal_size i:getpgid ii:wait4 i|O&:pidfd_open SC_2_CHAR_TERM SC_2_C_BIND SC_2_C_DEV SC_2_C_VERSION SC_2_FORT_DEV SC_2_FORT_RUN SC_2_LOCALEDEF SC_2_SW_DEV SC_2_UPE SC_2_VERSION SC_AIO_LISTIO_MAX SC_AIO_MAX SC_AIO_PRIO_DELTA_MAX SC_ARG_MAX SC_ASYNCHRONOUS_IO SC_ATEXIT_MAX SC_AVPHYS_PAGES SC_BC_BASE_MAX SC_BC_DIM_MAX SC_BC_SCALE_MAX SC_BC_STRING_MAX SC_CHARCLASS_NAME_MAX SC_CHAR_BIT SC_CHAR_MAX SC_CHAR_MIN SC_CHILD_MAX SC_CLK_TCK SC_COLL_WEIGHTS_MAX SC_DELAYTIMER_MAX SC_EQUIV_CLASS_MAX SC_EXPR_NEST_MAX SC_FSYNC SC_GETGR_R_SIZE_MAX SC_GETPW_R_SIZE_MAX SC_INT_MAX SC_INT_MIN SC_IOV_MAX SC_JOB_CONTROL SC_LINE_MAX SC_LOGIN_NAME_MAX SC_LONG_BIT SC_MAPPED_FILES SC_MB_LEN_MAX SC_MEMLOCK SC_MEMLOCK_RANGE SC_MEMORY_PROTECTION SC_MESSAGE_PASSING SC_MQ_OPEN_MAX SC_MQ_PRIO_MAX SC_NGROUPS_MAX SC_NL_ARGMAX SC_NL_LANGMAX SC_NL_MSGMAX SC_NL_NMAX SC_NL_SETMAX SC_NL_TEXTMAX SC_NPROCESSORS_CONF SC_NPROCESSORS_ONLN SC_NZERO SC_OPEN_MAX SC_PAGESIZE SC_PAGE_SIZE SC_PASS_MAX SC_PHYS_PAGES SC_PII SC_PII_INTERNET SC_PII_INTERNET_DGRAM SC_PII_INTERNET_STREAM SC_PII_OSI SC_PII_OSI_CLTS SC_PII_OSI_COTS SC_PII_OSI_M SC_PII_SOCKET SC_PII_XTI SC_POLL SC_PRIORITIZED_IO SC_PRIORITY_SCHEDULING SC_REALTIME_SIGNALS SC_RE_DUP_MAX SC_RTSIG_MAX SC_SAVED_IDS SC_SCHAR_MAX SC_SCHAR_MIN SC_SELECT SC_SEMAPHORES SC_SEM_NSEMS_MAX SC_SEM_VALUE_MAX SC_SHARED_MEMORY_OBJECTS SC_SHRT_MAX SC_SHRT_MIN SC_SIGQUEUE_MAX SC_SSIZE_MAX SC_STREAM_MAX SC_SYNCHRONIZED_IO SC_THREADS SC_THREAD_ATTR_STACKADDR SC_THREAD_ATTR_STACKSIZE SC_THREAD_KEYS_MAX SC_THREAD_PRIORITY_SCHEDULING SC_THREAD_PRIO_INHERIT SC_THREAD_PRIO_PROTECT SC_THREAD_PROCESS_SHARED SC_THREAD_SAFE_FUNCTIONS SC_THREAD_STACK_MIN SC_THREAD_THREADS_MAX SC_TIMERS SC_TIMER_MAX SC_TTY_NAME_MAX SC_TZNAME_MAX SC_T_IOV_MAX SC_UCHAR_MAX SC_UINT_MAX SC_UIO_MAXIOV SC_ULONG_MAX SC_USHRT_MAX SC_VERSION SC_WORD_BIT SC_XBS5_ILP32_OFF32 SC_XBS5_ILP32_OFFBIG SC_XBS5_LP64_OFF64 SC_XBS5_LPBIG_OFFBIG SC_XOPEN_CRYPT SC_XOPEN_ENH_I18N SC_XOPEN_LEGACY SC_XOPEN_REALTIME SC_XOPEN_REALTIME_THREADS SC_XOPEN_SHM SC_XOPEN_UNIX SC_XOPEN_VERSION SC_XOPEN_XCU_VERSION SC_XOPEN_XPG2 SC_XOPEN_XPG3 SC_XOPEN_XPG4 SC_MINSIGSTKSZ CS_GNU_LIBC_VERSION CS_GNU_LIBPTHREAD_VERSION CS_LFS64_CFLAGS CS_LFS64_LDFLAGS CS_LFS64_LIBS CS_LFS64_LINTFLAGS CS_LFS_CFLAGS CS_LFS_LDFLAGS CS_LFS_LIBS CS_LFS_LINTFLAGS CS_PATH CS_XBS5_ILP32_OFF32_CFLAGS CS_XBS5_ILP32_OFF32_LDFLAGS CS_XBS5_ILP32_OFF32_LIBS CS_XBS5_ILP32_OFF32_LINTFLAGS CS_XBS5_ILP32_OFFBIG_CFLAGS CS_XBS5_ILP32_OFFBIG_LDFLAGS CS_XBS5_ILP32_OFFBIG_LIBS CS_XBS5_LP64_OFF64_CFLAGS CS_XBS5_LP64_OFF64_LDFLAGS CS_XBS5_LP64_OFF64_LIBS CS_XBS5_LP64_OFF64_LINTFLAGS CS_XBS5_LPBIG_OFFBIG_CFLAGS CS_XBS5_LPBIG_OFFBIG_LDFLAGS CS_XBS5_LPBIG_OFFBIG_LIBS PC_ASYNC_IO PC_CHOWN_RESTRICTED PC_FILESIZEBITS PC_LINK_MAX PC_MAX_CANON PC_MAX_INPUT PC_NAME_MAX PC_NO_TRUNC PC_PATH_MAX PC_PIPE_BUF PC_PRIO_IO PC_SOCK_MAXBUF PC_SYNC_IO PC_VDISABLE PC_ALLOC_SIZE_MIN PC_REC_INCR_XFER_SIZE PC_REC_MAX_XFER_SIZE PC_REC_MIN_XFER_SIZE PC_REC_XFER_ALIGN PC_SYMLINK_MAX disable is_enabled cancel_dump_traceback_later _read_null _fatal_error_c_thread _sigabrt _sigfpe _stack_overflow all_threads Bus error Illegal instruction Floating point exception Aborted Segmentation fault _run_exitfuncs _ncallbacks atexit isenabled set_debug get_debug get_count get_threshold collect get_stats is_tracked is_finalized unfreeze get_freeze_count marshal _ast _tokenize _string .abi3.so INF NAN __dir__ sys.thread_info firstiter finalizer modulus imag hash_bits seed_bits seed size of hash algorithm cutoff -d -i optimize -O or -OO -B no_user_site -s no_site -S ignore_environment -E -v -b -q hash_randomization -R -I -X dev -X utf8 -X warn_default_encoding -P -X int_max_str_digits Major release number Minor release number micro Patch release number releaselevel serial Serial release number audit _clear_type_cache exc_info getdefaultencoding getdlopenflags getallocatedblocks getfilesystemencoding getfilesystemencodeerrors _getquickenedcount getrefcount getrecursionlimit is_finalizing setswitchinterval getswitchinterval setdlopenflags getprofile setrecursionlimit gettrace _debugmallocstats set_asyncgen_hooks get_asyncgen_hooks get_int_max_str_digits set_int_max_str_digits maxdigits depth sys.version_info sys.hash_info _aix_support _asyncio _bisect _blake2 _bootsubprocess _bz2 _codecs_cn _codecs_hk _codecs_iso2022 _codecs_jp _codecs_kr _codecs_tw _compat_pickle _compression _contextvars _crypt _csv _ctypes _curses _curses_panel _datetime _dbm _decimal _elementtree _gdbm _hashlib _heapq _json _lsprof _lzma _markupbase _md5 _msi _multibytecodec _multiprocessing _opcode _osx_support _overlapped _posixshmem _posixsubprocess _py_abc _pydecimal _pyio _queue _random _scproxy _sha1 _sha256 _sha3 _sha512 _socket _sqlite3 _ssl _statistics _struct _threading_local _tkinter _typing _uuid _weakrefset _winapi _zoneinfo aifc antigravity argparse asynchat asyncore audioop base64 bdb binascii cProfile calendar cgi cgitb chunk cmath cmd codeop colorsys compileall concurrent configparser contextlib copyreg dataclasses difflib dis distutils doctest email ensurepip enum fcntl filecmp fileinput fnmatch fractions ftplib getopt getpass glob graphlib gzip hmac html http idlelib imaplib imghdr ipaddress lib2to3 linecache logging mailbox mailcap mimetypes mmap modulefinder msilib msvcrt netrc nis nntplib nturl2path numbers optparse ossaudiodev pathlib pdb pickletools pipes pkgutil plistlib poplib pprint pstats py_compile pyclbr pydoc pydoc_data pyexpat quopri reprlib sched secrets select shelve shlex shutil smtpd smtplib sndhdr socketserver spwd sre_compile sre_constants sre_parse stringprep sunau sysconfig syslog tabnanny tarfile telnetlib tempfile termios textwrap this threading timeit tomllib turtle turtledemo unittest urllib uu venv wave webbrowser winsound wsgiref xdrlib xml xmlrpc zipapp zipfile zlib symbols nested symtable entry C.UTF-8 C.utf8 ps1 ps2 last_type last_value last_traceback siphash13 extension_suffixes lock_held create_builtin _frozen_module_names exec_dynamic exec_builtin withdata delete hamt hamt_collision_node hamt_array_node hamt_bitmap_node err_msg Error message Object causing the exception UnraisableHookArgs run var old_value Token.MISSING _contextvars.Token _contextvars.ContextVar _contextvars.Context 0123456789abcdef strict_errors ignore_errors xmlcharrefreplace_errors backslashreplace_errors namereplace namereplace_errors __build_class__ bin chr aiter oct round sum ndigits closure dont_inherit _feature_version fromlist _tokenize.TokenizerIter ast.AST _filters_mutated category stacklevel module_globals __callback__ __bytes__ weakref.CallableProxyType weakref.ProxyType weakref.ReferenceType __parameters__ __args__ types.UnionType rsplit join capitalize casefold expandtabs splitlines swapcase isascii islower isupper istitle isspace isdecimal isdigit isnumeric isalpha isalnum isidentifier isprintable zfill format_map __getnewargs__ formatter_field_name_split formatter_parser keepends tabsize string helper module fieldnameiterator formatteriterator str_iterator str_ascii_iterator EncodingMap __abstractmethods__ __text_signature__ __basicsize__ __itemsize__ __flags__ __weakrefoffset__ __base__ __mro__ mro __prepare__ the object's class __subclasshook__ __init_subclass__ __thisclass__ the class invoking super() __self__ __self_class__ __getattribute__ __repr__ __hash__ __call__ __str__ __lt__ __le__ __eq__ __ne__ __gt__ __ge__ __iter__ __next__ __get__ __set__ __delete__ __del__ __await__ __aiter__ __anext__ __add__ __radd__ __sub__ __rsub__ __mul__ __rmul__ __mod__ __rmod__ __divmod__ __rdivmod__ __pow__ __rpow__ __neg__ __neg__($self, /) -- -self __pos__ __pos__($self, /) -- +self __abs__ __bool__ __invert__ __lshift__ __rlshift__ __rshift__ __rrshift__ __and__ __rand__ __xor__ __rxor__ __or__ __ror__ __int__ __float__ __iadd__ __isub__ __imul__ __imod__ __ipow__ __ilshift__ __irshift__ __iand__ __ixor__ __ior__ __floordiv__ __rfloordiv__ __truediv__ __rtruediv__ __ifloordiv__ __itruediv__ __index__ __matmul__ __rmatmul__ __imatmul__ __len__ __getitem__ __setitem__ __delitem__ __contains__ __weakref__ tuple_iterator structseq indices discard intersection intersection_update isdisjoint issubset issuperset symmetric_difference symmetric_difference_update union <dummy key> type set_iterator longrange_iterator pickle.PickleBuffer NotImplementedType NoneType == types.SimpleNamespace moduledef builtin_method builtin_function_or_method nbytes itemsize ndim shape strides suboffsets c_contiguous f_contiguous tolist toreadonly bytes_per_sep memory_iterator managedbuffer popitem move_to_end last odict_keys odict_items odict_values collections.OrderedDict odict_iterator dict_valueiterator dict_keyiterator dict_itemiterator dict_reversevalueiterator dict_reverseitemiterator dict_reversekeyiterator real numerator denominator conjugate bit_length bit_count as_integer_ratio __trunc__ __floor__ __ceil__ bits_per_digit size of a digit in bits sizeof_digit default_max_str_digits str_digits_check_threshold signed sys.int_info x.__getitem__(y) <==> x[y] list_reverseiterator list_iterator anext_awaitable callable_iterator force InterpreterID __closure__ __globals__ __isabstractmethod__ __func__ __wrapped__ argdefs f_back f_locals f_lineno f_trace f_lasti f_globals f_builtins f_trace_lines f_trace_opcodes max_exp max_10_exp min_exp min_10_exp mant_dig epsilon radix rounds is_integer sys.float_info Encoding of the file stderrprinter name of the generator gi_yieldfrom gi_running gi_suspended gi_code name of the coroutine cr_await cr_running cr_suspended cr_code cr_origin name of the async generator ag_await ag_running ag_code aclose async_generator_wrapped_value async_generator_asend coroutine_wrapper async_generator_athrow async_generator __origin__ __unpacked__ __mro_entries__ generic_alias_iterator types.GenericAlias __traceback__ __context__ exception context __cause__ exception cause __suppress_context__ with_traceback add_note generator return value exception message nested exceptions module path POSIX exception code exception strerror filename2 second exception filename attribute name exception msg exception lineno exception offset exception text exception end lineno end_offset exception end offset exception print_file_and_line exception encoding exception object exception start exception end exception reason UnicodeTranslateError Unicode translation error. UnicodeEncodeError Unicode encoding error. UnicodeDecodeError Unicode decoding error. TabError ConnectionResetError Connection reset. ConnectionRefusedError Connection refused. ConnectionAbortedError Connection aborted. BrokenPipeError Broken pipe. UnicodeError Unicode related error. UnboundLocalError RecursionError Recursion limit exceeded. NotImplementedError ModuleNotFoundError Module not found. KeyError Mapping key not found. IndexError Sequence index out of range. IndentationError Improper indentation. TimeoutError Timeout expired. ProcessLookupError Process not found. PermissionError Not enough permissions. NotADirectoryError IsADirectoryError InterruptedError Interrupted by signal. FileNotFoundError File not found. FileExistsError File already exists. ConnectionError Connection error. ChildProcessError Child process error. I/O operation would block. UserWarning UnicodeWarning SyntaxWarning RuntimeWarning ResourceWarning PendingDeprecationWarning ImportWarning FutureWarning EncodingWarning BytesWarning ZeroDivisionError OverflowError FloatingPointError ValueError TypeError Inappropriate argument type. SystemError SyntaxError Invalid syntax. StopIteration StopAsyncIteration RuntimeError Unspecified run-time error. ReferenceError Name not found globally. MemoryError Out of memory. Base class for lookup errors. EOFError Read beyond end of file. BufferError Buffer error. Attribute not found. AssertionError Assertion failed. ArithmeticError SystemExit KeyboardInterrupt Program interrupted by user. GeneratorExit BaseExceptionGroup BaseException __objclass__ fget fdel __set_name__ wrapper_descriptor getset_descriptor member_descriptor classmethod_descriptor mappingproxy method-wrapper __complex__ co_lnotab _co_code_adaptive co_varnames co_cellvars co_freevars co_code co_argcount co_posonlyargcount co_kwonlyargcount co_stacksize co_flags co_nlocals co_consts co_names co_name co_qualname co_firstlineno co_linetable co_exceptiontable co_lines co_positions _varname_from_oparg line_iterator positions_iterator cell_contents PyCapsule bytes_iterator __alloc__ bytearray_iterator continue nonlocal finally return assert global except raise break elif for ENDMARKER NAME STRING NEWLINE INDENT DEDENT LPAR RPAR LSQB RSQB COLON COMMA SEMI PLUS MINUS VBAR AMPER LESS GREATER PERCENT LBRACE RBRACE EQEQUAL NOTEQUAL LESSEQUAL GREATEREQUAL TILDE CIRCUMFLEX LEFTSHIFT RIGHTSHIFT DOUBLESTAR PLUSEQUAL MINEQUAL PERCENTEQUAL AMPEREQUAL VBAREQUAL CIRCUMFLEXEQUAL LEFTSHIFTEQUAL RIGHTSHIFTEQUAL DOUBLESTAREQUAL DOUBLESLASH DOUBLESLASHEQUAL ATEQUAL RARROW ELLIPSIS COLONEQUAL TYPE_IGNORE TYPE_COMMENT SOFT_KEYWORD <ERRORTOKEN> <COMMENT> <NL> <ENCODING> <N_TOKENS> failed to change existing open_code hook the __main__ module is not frozen invalid PYTHONUTF8 environment variable value PYTHONMALLOC: unknown allocator Encoding changed twice while reading the configuration preinitialization config is NULL Unknown PYTHONMALLOC allocator main interpreter already initialized failed to get random numbers to initialize Python cannot decode command line arguments Argument expected for the %ls options Argument expected for the -%c option PyWideStringList_Insert index must be >= 0 Error setting LC_CTYPE, skipping C locale coercion PYTHONTRACEMALLOC: invalid number of frames -X tracemalloc=NFRAME: invalid number of frames PYTHONINTMAXSTRDIGITS: invalid limit; must be >= 640 or 0 for unlimited. -X int_max_str_digits: invalid limit; must be >= 640 or 0 for unlimited. PYTHONHASHSEED must be "random" or an integer in range [0; 4294967295] --check-hash-based-pycs must be one of 'default', 'always', or 'never' cannot decode PYTHONDUMPREFSFILE cannot decode PYTHONPLATLIBDIR cannot decode PYTHONPYCACHEPREFIX cannot decode _Py_StandardStreamEncoding cannot decode _Py_StandardStreamErrors cannot decode PYTHONIOENCODING environment variable cannot calculate path configuration without GIL error reading frozen getpath.py error evaluating initial values /builddir/build/BUILD/Python-3.11.9 bad value for option -X frozen_modules (expected "on" or "off") bad ID: Allocated using API '%c', verified using API '%c' /dev/urandom (or equivalent) not found Failed to read %zi bytes from /dev/urandom Can't initialize threads for interpreter cpython.PyInterpreterState_New failed to get an interpreter ID interpreter already initialized timestamp too large to convert to C _PyTime_t thread state already initialized Couldn't create autoTSSkey mapping PyMUTEX_FINI(gil->mutex) failed PyCOND_FINI(gil->switch_cond) failed PyMUTEX_FINI(gil->switch_mutex) failed PyMUTEX_INIT(gil->mutex) failed PyMUTEX_INIT(gil->switch_mutex) failed PyCOND_INIT(gil->switch_cond) failed PyMUTEX_LOCK(gil->mutex) failed PyMUTEX_UNLOCK(gil->mutex) failed PyMUTEX_LOCK(gil->switch_mutex) failed PyCOND_SIGNAL(gil->switch_cond) failed PyMUTEX_UNLOCK(gil->switch_mutex) failed Can't initialize bytes iterator type Can't initialize tuple iterator type Can't initialize unicode types failed to initialize UnraisableHookArgs type can't initialize builtins module failed to add exceptions to builtins failed to initialize an exception type failed to create a module object failed to initialize deep-frozen modules import _frozen_importlib # frozen failed to initialize importlib /builddir/build/BUILD/Python-3.11.9/Objects/listobject.c Python memory allocator called without holding the GIL invalid maximum character passed to PyUnicode_New Negative size passed to PyUnicode_New /builddir/build/BUILD/Python-3.11.9/Objects/dictobject.c deletion of interned string failed /builddir/build/BUILD/Python-3.11.9/Objects/unicodeobject.c Type does not define the tp_name field. type '%.100s' is not dynamically allocated but its base type '%.100s' is dynamically allocated method cannot be both class and static type '%.100s' participates in gc and is a base type but has inappropriate tp_free slot type %s has the Py_TPFLAGS_MANAGED_DICT flag but not Py_TPFLAGS_HEAPTYPE flag type %s has the Py_TPFLAGS_HAVE_GC flag but has no traverse function mro() returned a non-class ('%.500s') mro() returned base with unsuitable layout ('%.500s') Cannot extend an incomplete type '%.100s' /builddir/build/BUILD/Python-3.11.9/Objects/tupleobject.c /builddir/build/BUILD/Python-3.11.9/Modules/gcmodule.c attempting to create PyCMethod with a METH_METHOD flag but no class attempting to create PyCFunction with class but no METH_METHOD flag cannot create weak reference to '%s' object object already tracked by the garbage collector gc: collecting generation %d... gc: objects in each generation:%s gc: objects in permanent generation: %zd gc: done, %zd unreachable, %zd uncollectable, %.4fs elapsed /builddir/build/BUILD/Python-3.11.9/Objects/structseq.c module %s: PyModule_Create is incompatible with m_slots Python C API version mismatch for module %.100s: This Python has API version %d, module %.100s has version %d. module functions cannot set METH_CLASS or METH_STATIC attribute name must be string, not '%.200s' '%.100s' object has no attributes (%s .%U) '%.100s' object has only read-only attributes (%s .%U) '%.100s' object has no attribute '%U' '%.50s' object attribute '%U' is read-only type object '%.50s' has no attribute '%U' /builddir/build/BUILD/Python-3.11.9/Objects/moduleobject.c sequence index must be integer, not '%.200s' type '%.200s' is not subscriptable '%.200s' object is not subscriptable [GCC 12.2.1 20221121 (Red Hat 12.2.1-7)] PY_SSIZE_T_CLEAN macro must be defined for '#' formats NULL object passed to Py_BuildValue bad format char passed to Py_BuildValue Negative size passed to PyUnicode_FromStringAndSize PyUnicode_FromStringAndSize(NULL, size) is deprecated; use PyUnicode_New() instead Missed attribute '%U' of type %s /builddir/build/BUILD/Python-3.11.9/Objects/longobject.c Python int too large to convert to C ssize_t '%.200s' object is not iterable iter() returned non-iterator of type '%.100s' %R returned NULL without setting an exception %s returned NULL without setting an exception %R returned a result with an exception set %s returned a result with an exception set character U+%x is not in range [U+0000; U+%x] /builddir/build/BUILD/Python-3.11.9/Python/import.c '%.200s' object does not support item assignment PyState_AddModule called on module with slots list assignment index out of range PyErr_NewException: name must be module.class '%.200s' object is not callable while calling a Python object %.200s.__init__() takes exactly one argument (the instance to initialize) type() doesn't support MRO entry resolution; use types.new_class() nonempty __slots__ not supported for subtype of '%s' __slots__ items must be strings, not '%.200s' __dict__ slot disallowed: we already got one __weakref__ slot disallowed: either we already got one, or __itemsize__ != 0 %R in __slots__ conflicts with class variable type name must not contain null characters type __qualname__ must be a str, not %s __classcell__ must be a nonlocal cell, not %.200R Error calling __set_name__ on '%.100s' instance %R in '%.100s' new style getargs format but argument is not a tuple too many tuple nesting levels in argument format string %.200s%s takes at least one argument old style getargs format uses new features %.150s%s takes %s %d argument%s (%zd given) unsigned byte integer is less than minimum unsigned byte integer is greater than maximum signed short integer is less than minimum signed short integer is greater than maximum Python int too large to convert to C long signed integer is greater than maximum signed integer is less than minimum getargs: The '%c' format is deprecated. Use 'U' instead. (unknown parser marker combination) encoded string too long (%zd, maximum length %zd) encoded string without null bytes (invalid use of 'w' format character) metaclass conflict: the metaclass of a derived class must be a (non-strict) subclass of the metaclasses of all its bases type '%.100s' is not an acceptable base type multiple bases have instance lay-out conflict super() argument 1 must be a type, not %.200s super(type, obj): obj must be an instance or subtype of type '%.50s' object has no attribute '%U' descriptor '%V' for type '%.100s' needs either an object or a type descriptor '%V' for type '%.100s' needs a type, not a '%.100s' as arg 2 descriptor '%V' requires a subtype of '%.100s' but received '%.100s' %U takes no arguments (%zd given) type.__init__() takes no keyword arguments type.__init__() takes 1 or 3 arguments character argument not in range(0x110000) PyUnicode_FromFormatV() expects an ASCII-encoded format string, got a non-ASCII byte: 0x%02x maximum recursion depth exceeded during ast construction AST constructor recursion depth mismatch (before=%d, after=%d) frozen object %R is not a code object unbound method %U needs an argument Loaded module %R not found in sys.modules descriptor '%V' for '%.100s' objects doesn't apply to a '%.100s' object %U() got some positional-only arguments passed as keyword arguments: '%U' %U() got an unexpected keyword argument '%S' %U() got multiple values for argument '%S' positional argument%s (and %zd keyword-only argument%s) %U() takes %U positional argument%s but %zd%U %s given XXX readobject called with exception set NULL object in marshal data for object error at start before reading any input multiple statements found while compiling a single statement the function must be called with the GIL held, but the GIL is released (the current Python thread state is NULL) PyCOND_SIGNAL(gil->cond) failed PyCOND_WAIT(gil->switch_cond) failed EOF read where object expected bad marshal data (long size out of range) bad marshal data (unnormalized long data) bad marshal data (digit out of range in long) bad marshal data (bytes object size out of range) bad marshal data (string size out of range) bad marshal data (tuple size out of range) NULL object in marshal data for tuple bad marshal data (list size out of range) NULL object in marshal data for list bad marshal data (set size out of range) NULL object in marshal data for set NULL object in marshal data for code object bad marshal data (invalid reference) bad marshal data (unknown type code) bad marshal data (index list too large) expected an indented block after 'if' statement on line %d expected an indented block after 'try' statement on line %d expected 'except' or 'finally' block cannot have both 'except' and 'except*' on the same 'try' expected an indented block after 'case' statement on line %d expected an indented block after 'match' statement on line %d read() returned too much data: %zd bytes requested, %zd returned Negative size passed to PyBytes_FromStringAndSize 'async for' requires an object with __aiter__ method, got %.100s 'async for' received an object from __aiter__ that does not implement __anext__: %.100s 'async for' requires an iterator with __anext__ method, got %.100s 'async for' received an invalid object from __anext__: %.100s 'async with' received an object from __aenter__ that does not implement __await__: %.100s 'async with' received an object from __aexit__ that does not implement __await__: %.100s coroutine is being awaited already no locals found when storing %R Value after * must be an iterable, not %.200s no locals found when setting up annotations bad BUILD_CONST_KEY_MAP keys argument '%.200s' object is not a mapping catching ExceptionGroup with except* is not allowed. Use except instead. no locals found during 'import *' cannot 'yield from' a coroutine object in a non-coroutine generator '%.200s' object does not support the asynchronous context manager protocol '%.200s' object does not support the asynchronous context manager protocol (missed __aexit__ method) '%.200s' object does not support the context manager protocol '%.200s' object does not support the context manager protocol (missed __exit__ method) %U argument after * must be an iterable, not %.200s cannot access local variable '%s' where it is not associated with a value error return without exception set inconsistent use of tabs and spaces in indentation too many levels of indentation unexpected character after line continuation character unindent does not match any outer indentation level Parser column offset overflow - source line is too big invalid non-printable character U+%s invalid digit '%c' in octal literal invalid digit '%c' in binary literal leading zeros in decimal integer literals are not permitted; use an 0o prefix for octal integers unterminated triple-quoted string literal (detected at line %d) closing parenthesis '%c' does not match opening parenthesis '%c' on line %d closing parenthesis '%c' does not match opening parenthesis '%c' unterminated string literal (detected at line %d) Non-UTF-8 code starting with '\x%.2x' in file %U on line %i, but no encoding declared; see https://peps.python.org/pep-0263/ for details source code cannot contain null bytes /builddir/build/BUILD/Python-3.11.9/Objects/codeobject.c code: co_code larger than INT_MAX code: co_varnames is too small __build_class__: not enough arguments __build_class__: func must be a function __build_class__: name is not a string __mro_entries__ must return a tuple %.200s.__prepare__() must return a mapping, not %.200s __class__ not set defining %.200R as %.200R. Was __classcell__ propagated to type.__new__? __class__ set to %.200R defining %.200R as %.200R Variable annotations syntax is only single target (not %s) can be annotated only single target (not tuple) can be annotated assignment to yield expression not possible '%s' is an illegal expression for augmented assignment type_traverse() called on non-heap type '%.100s' /builddir/build/BUILD/Python-3.11.9/Objects/typeobject.c unicodedata.normalize() must return a string, not %.200s field 'id' is required for Name field 'ctx' is required for Name cannot use starred expression here cannot use double starred expression here ':' expected after dictionary key cannot use a starred expression in a dictionary value expression expected after dictionary key and ':' dict unpacking cannot be used in dict comprehension '%.200s' object has no attribute '%s' Format strings are only supported in Python 3.6 and greater /builddir/build/BUILD/Python-3.11.9/Parser/string_parser.c bytes can only contain ASCII literal characters cannot mix bytes and nonbytes literals descriptor '%V' needs a type, not '%s', as arg 2 %U takes exactly one argument (%zd given) %.200s() takes no keyword arguments field 'value' is required for Constant __set_name__() takes 2 positional arguments but %d were given PyArg_UnpackTuple() argument list is not a tuple %.200s expected %s%zd argument%s, got %zd unpacked tuple should have %s%zd element%s, but has %zd field 'value' is required for Attribute field 'attr' is required for Attribute field 'ctx' is required for Attribute attribute '%V' of '%.100s' objects is not readable invalid syntax. Perhaps you forgot a comma? expected 'else' after 'if' expression Missing parentheses in call to '%U'. Did you mean %U(...)? with Barry as BDFL, use '<>' instead of '!=' can't delete numeric/char attribute attribute value type must be bool Truncation of value to unsigned char Truncation of value to unsigned short Writing negative value into unsigned field Truncation of value to unsigned int attribute '%V' of '%.100s' objects is not writable __name__ must be set to a string object __qualname__ must be set to a string object field 'value' is required for Expr Underscores in numeric literals are only supported in Python 3.6 and greater %S - Consider hexadecimal for huge integer literals to avoid decimal conversion limits. non-default argument follows default argument Lambda expression parameters cannot be parenthesized at least one argument must precede / expected comma between / and * Positional-only parameters are expected an indented block after function definition on line %d can only concatenate str (not "%.200s") to str strings are too large to concat object.__new__() takes exactly one argument (the type to instantiate) Can't instantiate abstract class %s with abstract method%s %U positional argument follows keyword argument unpacking positional argument follows keyword argument iterable argument unpacking follows keyword argument unpacking Generator expression must be parenthesized invalid syntax. Maybe you meant '==' or ':=' instead of '='? object.__init__() takes exactly one argument (the instance to initialize) field 'value' is required for Assign Function parameters cannot be parenthesized /builddir/build/BUILD/Python-3.11.9/Objects/weakrefobject.c field 'name' is required for alias field 'arg' is required for arg field 'func' is required for Call trailing comma not allowed without surrounding parentheses import %U # previously loaded (%R) module %s: m_size may not be negative for multi-phase initialization module %s has multiple create slots module %s uses unknown slot ID %i creation of module %s failed without setting an exception creation of module %s raised unreported exception module %s is not a module object, but requests module state module %s specifies execution slots, but did not create a ModuleType instance named arguments must follow bare * bare * has associated type comment var-positional argument cannot have default value * argument may appear only once cannot use assignment expressions with %s cannot assign to %s here. Maybe you meant '==' instead of '='? var-keyword argument cannot have default value arguments cannot follow var-keyword argument execution of module %s failed without setting an exception execution of module %s raised unreported exception module %s initialized with unknown slot %i PyModule_AddObjectRef() first argument must be a module PyModule_AddObjectRef() must be called with an exception raised if value is NULL f-string: single '}' is not allowed f-string: unexpected end of string attribute of type '%.200s' is not callable module '%U' has no attribute '%U' partially initialized module '%U' has no attribute '%U' (most likely due to a circular import) cannot access submodule '%U' of module '%U' (most likely due to a circular import) field 'ctx' is required for List unknown Unicode character name \N escapes not supported (can't load unicodedata module) Cannot have two type comments on def %s() requires a dict argument, not '%s' f-string: expressions nested too deeply f-string expression part cannot include a backslash f-string: too many nested parenthesis f-string expression part cannot include '#' f-string: closing parenthesis '%c' does not match opening parenthesis '%c' f-string: expression required before '%c' f-string: empty expression not allowed f-string: self documenting expressions are only supported in Python 3.8 and greater f-string: invalid conversion character: expected 's', 'r', or 'a' expected an indented block after 'elif' statement on line %d dictionary changed size during iteration dictionary keys changed during iteration expected an indented block after 'else' statement on line %d cannot unpack non-iterable %.200s object not enough values to unpack (expected %d, got %d) not enough values to unpack (expected at least %d, got %d) too many values to unpack (expected %d) not enough values to unpack (expected at least %d, got %zd) field 'test' is required for If expected an indented block after 'finally' statement on line %d /builddir/build/BUILD/Python-3.11.9/Objects/object.c '%s' not supported between instances of '%.100s' and '%.100s' field 'value' is required for Subscript field 'slice' is required for Subscript field 'ctx' is required for Subscript expected an indented block after class definition on line %d field 'value' is required for FormattedValue _PyErr_SetObject: exception %R is not a BaseException subclass field 'name' is required for FunctionDef field 'args' is required for FunctionDef field 'name' is required for ClassDef maximum recursion depth exceeded while normalizing an exception Cannot recover from MemoryErrors while normalizing exceptions. Cannot recover from the recursive normalization of an exception. calling %R should have returned an instance of BaseException, not %s Negative size passed to _PyUnicode_New /builddir/build/BUILD/Python-3.11.9/Python/getargs.c %.200s%s takes at most %d %sargument%s (%zd given) Invalid format string (| specified twice) Invalid format string ($ before |) Invalid format string ($ specified twice) %.200s%s takes no positional arguments %.200s%s takes %s %d positional argument%s (%zd given) More keyword list entries (%d) than format specifiers (%d) %.200s%s missing required argument '%s' (pos %d) more argument specifiers than keyword list entries (remaining format:'%s') argument for %.200s%s given by name ('%s') and position (%d) '%U' is an invalid keyword argument for %.200s%s invalid keyword argument for %.200s%s field 'target' is required for comprehension field 'iter' is required for comprehension invalid \x escape at position %zd decoding error; unknown error handling code: %.400s field 'target' is required for For field 'iter' is required for For field 'test' is required for Assert /builddir/build/BUILD/Python-3.11.9/Python/traceback.c __traceback__ may not be deleted __traceback__ must be a traceback or None field 'left' is required for BinOp field 'op' is required for BinOp field 'right' is required for BinOp catching classes that do not inherit from BaseException is not allowed __init__() should return None, not '%.200s' expected default value expression property %R of %R object has no deleter property %R of %R object has no setter property of %R object has no deleter property of %R object has no setter property %R of %R object has no getter property of %R object has no getter field 'test' is required for While field 'ctx' is required for Tuple tuple indices must be integers or slices, not %.200s cannot fit '%.200s' into an index-sized integer '%.200s' object cannot be interpreted as an integer __index__ returned non-int (type %.200s) __index__ returned non-int (type %.200s). The ability to return an instance of a strict subclass of int is deprecated, and may be removed in a future version of Python. field 'context_expr' is required for withitem uninitialized classmethod object /builddir/build/BUILD/Python-3.11.9/Objects/classobject.c field 'target' is required for AugAssign field 'op' is required for AugAssign field 'value' is required for AugAssign field 'op' is required for UnaryOp field 'operand' is required for UnaryOp vars() argument must have __dict__ attribute no positional arguments expected uninitialized staticmethod object field 'value' is required for Starred field 'ctx' is required for Starred field 'value' is required for keyword Type spec does not define the name field. builtin type %.200s has no __module__ attribute field 'test' is required for IfExp field 'body' is required for IfExp field 'orelse' is required for IfExp warnings_get_state: could not identify current interpreter module kind %d should not be possible field 'target' is required for NamedExpr field 'value' is required for NamedExpr from __future__ imports must occur at the beginning of the file future feature %.100s is not defined %s only supported in Python 3.%i and greater cannot initialize filesystem codec failed to get the Python codec of the filesystem encoding Failed to initialize __main__.__loader__ Failed to retrieve BuiltinImporter Failed to test __main__.__loader__ Failed to initialize __main__.__builtins__ Failed to retrieve builtins module Failed to test __main__.__builtins__ Failed to initialize __main__.__annotations__ failed to get the Python codec name of the stdio encoding external importer setup failed can't initialize sys standard streams failed to update the Python config unknown filesystem error handler <stdin> is a directory, cannot continue 'import warnings' failed; traceback: Failed to import the site module Python runtime initialized with LC_CTYPE=C (a locale with default ASCII encoding), which may cause Unicode compatibility problems. Using C.UTF-8, C.utf8, or UTF-8 (if available) as alternative Unicode-compatible locales is recommended. # can't import zipimport.zipimporter AST optimizer recursion depth mismatch (before=%d, after=%d) slice indices must be integers or None or have an __index__ method tuple for startswith must only contain str, not %.100s startswith first arg must be str or a tuple of str, not %.100s maximum recursion depth exceeded during compilation Format string contains positional fields Replacement index %zd out of range for positional args tuple Unknown conversion specifier %c Unknown conversion specifier \x%x Single '}' encountered in format string Single '{' encountered in format string end of string while looking for conversion specifier expected ':' after conversion specifier expected '}' before end of string Too many decimal digits in format string cannot switch from manual field specification to automatic field numbering cannot switch from automatic field numbering to manual field specification '%.200s' object does not support indexing Only '.' or '[' may follow ']' in format field specifier Empty attribute in format string while getting the repr of an object __repr__ returned non-string (type %.200s) this compiler does not handle FunctionTypes symtable analysis recursion depth mismatch (before=%d, after=%d) Signal %i ignored due to race condition string is too long to generate repr Space not allowed in string format specifier Sign not allowed in string format specifier Negative zero coercion (z) not allowed in string format specifier Alternate form (#) not allowed in string format specifier '=' alignment not allowed in string format specifier annotated name '%U' can't be global annotated name '%U' can't be nonlocal name '%U' is parameter and global name '%U' is used prior to global declaration name '%U' is assigned to before global declaration name '%U' is parameter and nonlocal name '%U' is used prior to nonlocal declaration name '%U' is assigned to before nonlocal declaration assignment expression cannot be used in a comprehension iterable expression assignment expression cannot rebind comprehension iteration variable '%U' assignment expression within a comprehension cannot be used in a class body duplicate argument '%U' in function definition comprehension inner loop cannot rebind assignment expression target '%U' private identifier too large to be mangled sep must be None or a string, not %.200s end must be None or a string, not %.200s %.200s%s missing required argument '%U' (pos %d) Format specifier must be a string, not %.200s Type %.100s doesn't define __format__ __format__ must return a str, not %.200s while getting the str of an object __str__ returned non-string (type %.200s) null file for PyFile_WriteString Exceeds the limit (%d digits) for integer string conversion; use sys.set_int_max_str_digits() to increase the limit separator: expected str instance, %.80s found sequence item %zd: expected str instance, %.80s found join() result is too long for a Python string 'in <string>' requires string as left operand, not %.100s name '%U' is nonlocal and global nonlocal declaration not allowed at module level no binding for nonlocal '%U' found /builddir/build/BUILD/Python-3.11.9/Objects/setobject.c list indices must be integers or slices, not %.200s all arguments to joinpath() must be str or None maximum number of symbolic links reached cannot read file larger than 32KB during initialization must be str or None, not %.100s Set changed size during iteration /builddir/build/BUILD/Python-3.11.9/Objects/bytesobject.c int has too many bits to express in a platform size_t can't convert negative value to size_t Python int too large to convert to C size_t unsupported operand type(s) for %.100s: '%.100s' and '%.100s'. Did you mean "print(<message>, file=<output_stream>)"? Python int too large to convert to C int can't convert negative value to unsigned int Python int too large to convert to C unsigned long can't send non-None value to a just-started coroutine can't send non-None value to a just-started generator can't send non-None value to a just-started async generator async generator already executing coroutine raised StopIteration generator raised StopIteration async generator raised StopIteration cannot reuse already awaited coroutine async generator raised StopAsyncIteration __package__ != __spec__.parent __spec__.parent must be a string can't resolve package from __spec__ or __package__, falling back on __name__ and __path__ attempted relative import beyond top-level package attempted relative import with no known parent package import time: self [us] | cumulative | imported package import time: %9ld | %10ld | %*s%s %R not in sys.modules as expected PyObject_CallFinalizerFromDealloc called on object with a non-zero refcount bad operand type for unary -: '%.200s' coroutine '%S' was never awaited coroutine ignored GeneratorExit generator ignored GeneratorExit async generator ignored GeneratorExit 'return' with value in async generator invalid node type (%d) for augmented assignment %s op %d should not be possible invalid node type (%d) for annotated assignment assertion is always true, perhaps remove parentheses? 'continue' not properly in loop 'async for' outside async function '%s' can not be used within an annotation unary op %d should not be possible 'yield from' inside async function 'await' outside async function '%.200s' object is not callable; perhaps you missed a comma? Unrecognized conversion character %d '%.200s' object is not subscriptable; perhaps you missed a comma? %.200s indices must be integers or slices, not %.200s; perhaps you missed a comma? starred assignment target must be in a list or tuple can't use starred expression here import * only allowed at module level Can't convert '%.100s' object to str implicitly can't specify a timeout for a non-blocking call timeout value must be positive bad operand type for unary ~: '%.200s' "is" with a literal. Did you mean "=="? "is not" with a literal. Did you mean "!="? '%.200s' object does not support item deletion PyCapsule_New called with null pointer globals and locals cannot be NULL exec() globals must be a dict, not %.100s locals must be a mapping or None, not %.100s cannot use a closure with this code object code object requires a closure of exactly length %zd closure can only be used when source is a code object cannot set %R attribute of immutable type '%s' Out of memory interning an attribute name too many statically nested blocks Python import machinery not initialized asynchronous comprehension outside of an asynchronous function PyCapsule_GetPointer called with invalid PyCapsule object PyCapsule_GetPointer called with incorrect name compiler stack_effect(opcode=%d, arg=%i) failed unexpected %s jumping backwards default 'except:' must be last argument should be integer or None, not %.200s 'break', 'continue' and 'return' cannot appear in an except* block __length_hint__ must be an integer, not %.100s __length_hint__() should return >= 0 on removing the last compiler stack item '%.200s' object doesn't support item deletion _PyST_GetScope(name=%R) failed: unknown scope in unit %S (%R); symbols: %R; locals: %R; globals: %R compiler_lookup_arg(name=%R) with reftype=%d failed in %S; freevars of code %S: %R can only concatenate tuple (not "%.200s") to tuple length argument must be non-negative byteorder must be either 'little' or 'big' can't convert negative int to unsigned a bytes-like object is required, not '%.100s' PyBuffer_FillInfo: view==NULL argument is obsolete too many expressions in star-unpacking assignment multiple starred expressions in assignment __bytes__ returned non-bytes (type %.200s) byte array too long to convert to int Comparison between bytes and string Comparison between bytes and int /builddir/build/BUILD/Python-3.11.9/Objects/cellobject.c Internal error: failed to get value of a constant object too deeply nested to marshal cannot import name %R from partially initialized module %R (most likely due to a circular import) (%S) cannot import name %R from %R (%S) cannot import name %R from %R (unknown location) string indices must be integers, not '%.200s' _Py_normalize_encoding() failed no codec search functions registered: can't find encoding codec search functions must return 4-tuples /builddir/build/BUILD/Python-3.11.9/Python/ceval.c string, bytes, os.PathLike, integer or None string, bytes, os.PathLike or integer string, bytes, os.PathLike or None expected %.200s.__fspath__() to return str or bytes, not %.200s %s%s%s should be %s, not %.200s %s%sembedded null character in %s expected str, bytes or os.PathLike object, not %.200s %s: can't specify dir_fd without matching path %s: can't specify both dir_fd and fd %s: cannot use fd and follow_symlinks together Can't compare %.100s and %.100s file is not a valid file descripter file.fileno() is not a valid file descriptor unable to get the current thread state %s expected at least 1 argument, got 0 Cannot specify a default for %s() with multiple positional arguments Unmatched left paren in format string Unmatched right paren in format string No active exception to reraise calling %R should have returned an instance of BaseException, not %R exceptions must derive from BaseException exception causes must derive from BaseException encoder %s returned bytearray instead of bytes; use codecs.encode() to encode to arbitrary types '%.400s' encoder returned '%.400s' instead of 'bytes'; use codecs.encode() to encode to arbitrary types tuple for endswith must only contain str, not %.100s endswith first arg must be str or a tuple of str, not %.100s int() base must be >= 2 and <= 36, or 0 int() can't convert non-string with explicit base __int__ returned non-int (type %.200s) __int__ returned non-int (type %.200s). The ability to return an instance of a strict subclass of int is deprecated, and may be removed in a future version of Python. The delegation of int() to __trunc__ is deprecated. __trunc__ returned non-Integral (type %.200s) int() argument must be a string, a bytes-like object or a real number, not '%.200s' cannot convert float infinity to integer cannot convert float NaN to integer isinstance() arg 2 must be a type, a tuple of types, or a union 'path' must be 'str', not '%.200s' can't have text and binary mode at once must have exactly one of create/read/write/append mode binary mode doesn't take an encoding argument binary mode doesn't take an errors argument binary mode doesn't take a newline argument line buffering (buffering=1) isn't supported in binary mode, the default buffer size will be used can't have unbuffered text I/O Must have exactly one of create/read/write/append mode and at most one plus Cannot use closefd=False with file name File or stream is not readable. buffer size must be strictly positive Raw stream returned invalid position %zd cannot fit '%.200s' into an offset-sized integer I/O operation on uninitialized object read length must be non-negative or -1 unbounded read returned more bytes than a Python bytes object can hold _PyErr_ChainExceptions: exception %R is not a BaseException subclass byte indices must be integers or slices, not %.200s operation forbidden on released memoryview object memoryview: a bytes-like object is required, not '%.200s' compile() mode must be 'exec', 'eval', 'single' or 'func_type' compile() mode must be 'exec', 'eval' or 'single' compile(): invalid optimize value compile() mode 'func_type' requires flag PyCF_ONLY_AST required field "body" missing from Module Module field "body" must be a list, not a %.200s while traversing 'Module' node Module field "body" changed size during iteration required field "type_ignores" missing from Module Module field "type_ignores" must be a list, not a %.200s required field "lineno" missing from TypeIgnore while traversing 'TypeIgnore' node required field "tag" missing from TypeIgnore expected some sort of type_ignore, but got %R Module field "type_ignores" changed size during iteration required field "body" missing from Interactive Interactive field "body" must be a list, not a %.200s while traversing 'Interactive' node Interactive field "body" changed size during iteration required field "body" missing from Expression while traversing 'Expression' node required field "argtypes" missing from FunctionType FunctionType field "argtypes" must be a list, not a %.200s while traversing 'FunctionType' node FunctionType field "argtypes" changed size during iteration required field "returns" missing from FunctionType expected some sort of mod, but got %R AST validator recursion depth mismatch (before=%d, after=%d) argument for %.200s%s given by name ('%U') and position (%d) memoryview: number of dimensions must not exceed 64 path should be string, bytes, or os.PathLike, not %.200s mod = Module(stmt* body, type_ignore* type_ignores) | Interactive(stmt* body) | Expression(expr body) | FunctionType(expr* argtypes, expr returns) Module(stmt* body, type_ignore* type_ignores) FunctionType(expr* argtypes, expr returns) stmt = FunctionDef(identifier name, arguments args, stmt* body, expr* decorator_list, expr? returns, string? type_comment) | AsyncFunctionDef(identifier name, arguments args, stmt* body, expr* decorator_list, expr? returns, string? type_comment) | ClassDef(identifier name, expr* bases, keyword* keywords, stmt* body, expr* decorator_list) | Return(expr? value) | Delete(expr* targets) | Assign(expr* targets, expr value, string? type_comment) | AugAssign(expr target, operator op, expr value) | AnnAssign(expr target, expr annotation, expr? value, int simple) | For(expr target, expr iter, stmt* body, stmt* orelse, string? type_comment) | AsyncFor(expr target, expr iter, stmt* body, stmt* orelse, string? type_comment) | While(expr test, stmt* body, stmt* orelse) | If(expr test, stmt* body, stmt* orelse) | With(withitem* items, stmt* body, string? type_comment) | AsyncWith(withitem* items, stmt* body, string? type_comment) | Match(expr subject, match_case* cases) | Raise(expr? exc, expr? cause) | Try(stmt* body, excepthandler* handlers, stmt* orelse, stmt* finalbody) | TryStar(stmt* body, excepthandler* handlers, stmt* orelse, stmt* finalbody) | Assert(expr test, expr? msg) | Import(alias* names) | ImportFrom(identifier? module, alias* names, int? level) | Global(identifier* names) | Nonlocal(identifier* names) | Expr(expr value) | Pass | Break | Continue FunctionDef(identifier name, arguments args, stmt* body, expr* decorator_list, expr? returns, string? type_comment) AsyncFunctionDef(identifier name, arguments args, stmt* body, expr* decorator_list, expr? returns, string? type_comment) ClassDef(identifier name, expr* bases, keyword* keywords, stmt* body, expr* decorator_list) Assign(expr* targets, expr value, string? type_comment) AugAssign(expr target, operator op, expr value) AnnAssign(expr target, expr annotation, expr? value, int simple) For(expr target, expr iter, stmt* body, stmt* orelse, string? type_comment) AsyncFor(expr target, expr iter, stmt* body, stmt* orelse, string? type_comment) While(expr test, stmt* body, stmt* orelse) If(expr test, stmt* body, stmt* orelse) With(withitem* items, stmt* body, string? type_comment) AsyncWith(withitem* items, stmt* body, string? type_comment) Match(expr subject, match_case* cases) Try(stmt* body, excepthandler* handlers, stmt* orelse, stmt* finalbody) TryStar(stmt* body, excepthandler* handlers, stmt* orelse, stmt* finalbody) ImportFrom(identifier? module, alias* names, int? level) expr = BoolOp(boolop op, expr* values) | NamedExpr(expr target, expr value) | BinOp(expr left, operator op, expr right) | UnaryOp(unaryop op, expr operand) | Lambda(arguments args, expr body) | IfExp(expr test, expr body, expr orelse) | Dict(expr* keys, expr* values) | Set(expr* elts) | ListComp(expr elt, comprehension* generators) | SetComp(expr elt, comprehension* generators) | DictComp(expr key, expr value, comprehension* generators) | GeneratorExp(expr elt, comprehension* generators) | Await(expr value) | Yield(expr? value) | YieldFrom(expr value) | Compare(expr left, cmpop* ops, expr* comparators) | Call(expr func, expr* args, keyword* keywords) | FormattedValue(expr value, int conversion, expr? format_spec) | JoinedStr(expr* values) | Constant(constant value, string? kind) | Attribute(expr value, identifier attr, expr_context ctx) | Subscript(expr value, expr slice, expr_context ctx) | Starred(expr value, expr_context ctx) | Name(identifier id, expr_context ctx) | List(expr* elts, expr_context ctx) | Tuple(expr* elts, expr_context ctx) | Slice(expr? lower, expr? upper, expr? step) BoolOp(boolop op, expr* values) NamedExpr(expr target, expr value) BinOp(expr left, operator op, expr right) UnaryOp(unaryop op, expr operand) Lambda(arguments args, expr body) IfExp(expr test, expr body, expr orelse) Dict(expr* keys, expr* values) ListComp(expr elt, comprehension* generators) SetComp(expr elt, comprehension* generators) DictComp(expr key, expr value, comprehension* generators) GeneratorExp(expr elt, comprehension* generators) Compare(expr left, cmpop* ops, expr* comparators) Call(expr func, expr* args, keyword* keywords) FormattedValue(expr value, int conversion, expr? format_spec) Constant(constant value, string? kind) Attribute(expr value, identifier attr, expr_context ctx) Subscript(expr value, expr slice, expr_context ctx) Starred(expr value, expr_context ctx) Name(identifier id, expr_context ctx) List(expr* elts, expr_context ctx) Tuple(expr* elts, expr_context ctx) Slice(expr? lower, expr? upper, expr? step) expr_context = Load | Store | Del operator = Add | Sub | Mult | MatMult | Div | Mod | Pow | LShift | RShift | BitOr | BitXor | BitAnd | FloorDiv unaryop = Invert | Not | UAdd | USub cmpop = Eq | NotEq | Lt | LtE | Gt | GtE | Is | IsNot | In | NotIn comprehension(expr target, expr iter, expr* ifs, int is_async) excepthandler = ExceptHandler(expr? type, identifier? name, stmt* body) arguments(arg* posonlyargs, arg* args, arg? vararg, arg* kwonlyargs, expr* kw_defaults, arg? kwarg, expr* defaults) arg(identifier arg, expr? annotation, string? type_comment) keyword(identifier? arg, expr value) alias(identifier name, identifier? asname) withitem(expr context_expr, expr? optional_vars) match_case(pattern pattern, expr? guard, stmt* body) pattern = MatchValue(expr value) | MatchSingleton(constant value) | MatchSequence(pattern* patterns) | MatchMapping(expr* keys, pattern* patterns, identifier? rest) | MatchClass(expr cls, pattern* patterns, identifier* kwd_attrs, pattern* kwd_patterns) | MatchStar(identifier? name) | MatchAs(pattern? pattern, identifier? name) | MatchOr(pattern* patterns) MatchSingleton(constant value) MatchSequence(pattern* patterns) MatchMapping(expr* keys, pattern* patterns, identifier? rest) MatchClass(expr cls, pattern* patterns, identifier* kwd_attrs, pattern* kwd_patterns) MatchAs(pattern? pattern, identifier? name) type_ignore = TypeIgnore(int lineno, string tag) TypeIgnore(int lineno, string tag) invalid indexing of 0-dim memory multi-dimensional slicing is not implemented memoryview has %zd exported buffer%s _memory_release(): negative export count memoryview: underlying buffer is not writable memoryview: underlying buffer is not C-contiguous memoryview: underlying buffer is not Fortran contiguous memoryview: underlying buffer is not contiguous memoryview: underlying buffer requires suboffsets memoryview: cannot cast to unsigned bytes if the format flag is present %s() arg 1 must be a %s object source code string cannot contain null bytes from-import-* object has no __dict__ and no __all__ module __name__ must be a string, not %.100s %s in %U.%s must be str, not %.100s unknown error handler name '%.400s' __new__() called with non-type 'self' %s.__new__(): not enough arguments %s.__new__(X): X is not a type object (%s) %s.__new__(%s): %s is not a subtype of %s %s.__new__(%s) is not safe, use %s.__new__() super(): __class__ is not a type (%s) super(): __class__ cell not found items() returned item which size is not 2 __abc_tpflags__ cannot be both Py_TPFLAGS_SEQUENCE and Py_TPFLAGS_MAPPING mappingproxy() argument must be a mapping, not %s %.200s.%U() returned a non-iterable (type %.200s) PyType_GetModule: Type '%s' is not a heap type PyType_GetModule: Type '%s' has no associated module cannot set '%s' attribute of immutable type '%s' cannot delete '%s' attribute of immutable type '%s' Refusing to create an inheritance cycle issubclass() arg 1 must be a class __subclasshook__ must return either False, True, or NotImplemented __subclasses__() must return a list _abc_impl is set to a wrong type issubclass() arg 2 must be a class, a tuple of classes, or a union expected a subclass of ImportError 'encoding' argument not specified TextIOWrapper() argument 'errors' must be str or None, not %.50s embedded null character in errors '%.400s' is not a text encoding; use %s to handle arbitrary codecs File or stream is not writable. iter(v, w): v must be callable encoding without a string argument errors without a string argument string argument without an encoding cannot convert '%.200s' object to bytearray Failed checking if argv[0] is an import path entry Type "help", "copyright", "credits" or "license" for more information. Unable to decode the command from the command line: %S: can't open file %R: [Errno %d] %s %S: %R is a directory, cannot continue /builddir/build/BUILD/Python-3.11.9/Objects/bytearrayobject.c deallocated bytearray object has exported buffers Could not import runpy module Could not access runpy._run_module_as_main Could not convert module name to unicode Could not create arguments for runpy._run_module_as_main '%.200s' object is not reversible range() arg 3 must not be zero range expected at least 1 argument, got 0 range expected at most 3 arguments, got %zd integer division or modulo by zero type object '%s' has no attribute '__annotations__' dir(): expected keys() of locals to be a list, not '%.200s' object does not provide __dir__ <module>.__dict__ is not a dictionary map() must have at least two arguments. must assign iterable to extended slice attempt to assign sequence of size %zd to extended slice of size %zd can't multiply sequence by non-int of type '%.200s' '%.200s' object is not a container decoding to str: need a bytes-like object, %.80s found '%.400s' decoder returned '%.400s' instead of 'str'; use codecs.decode() to decode to arbitrary types not enough arguments for format string %%%c format: an integer is required, not %.200s %%%c format: a real number is required, not %.200s unsupported format character '%c' (0x%x) at index %zd not all arguments converted during string formatting <frozen importlib._bootstrap_external> underlying buffer has been detached enumerate() missing required argument 'iterable' enumerate() takes at most 2 arguments (%d given) __annotations__ must be set to a dict object readline() should have returned a str object, not '%.200s' illegal decoder state: the first item should be a bytes object, not '%.200s' underlying %s() should have returned a bytes-like object, not '%.200s' Existing exports of data: object cannot be re-sized PyBuffer_ToContiguous: len != view->len raw readinto() returned invalid length %zd (should have been between 0 and %zd) can't extend bytearray with %.100s PyMemoryView_FromBuffer(): info->buf must not be NULL can't set bytearray slice from %.100s IncrementalNewlineDecoder.__init__() not called can only concatenate list (not "%.200s") to list decoder should return a string result, not '%.200s' globals must be a real dict; try eval(expr, {}, mapping) eval must be given globals and locals when called without a frame code object passed to eval() may not contain free variables field 'key' is required for DictComp field 'value' is required for DictComp Precision not allowed in integer format specifier Negative zero coercion (z) not allowed in integer format specifier Sign not allowed with integer format specifier 'c' Alternate form (#) not allowed with integer format specifier 'c' gc: %zd uncollectable objects at shutdown gc: %zd uncollectable objects at shutdown; use gc.set_debug(gc.DEBUG_UNCOLLECTABLE) to list them bytearray_getbuffer: view==NULL argument is obsolete Exception ignored in m_clear of module%s%V %s: src and dst must be the same type cpython._PySys_ClearAuditHooks cpython.PyInterpreterState_Clear PyThreadState_Clear: warning: thread still has a frame PyThreadState_Clear: warning: thread still has a generator field 'args' is required for Lambda field 'body' is required for Lambda field 'name' is required for AsyncFunctionDef field 'args' is required for AsyncFunctionDef field 'body' is required for Expression dynamic module does not define module export function (%s_%s) initialization of %s failed without raising an exception initialization of %s raised unreported exception init function of %s returned uninitialized object initialization of %s did not return PyModuleDef initialization of %s did not return an extension module interpreter has no modules dictionary Cannot write %zi characters at %zi in a string of %zi characters Cannot copy %s characters into a string of %s characters Cannot modify a string currently used the number of frames must be in range [1; %lu] the tracemalloc module has been unloaded wrapper %s() takes no keyword arguments tracemalloc_realloc() failed to allocate a trace cannot convert dictionary update sequence element #%zd to a sequence dictionary update sequence element #%zd has length %zd; 2 is required Couldn't create thread-state for new thread expected %d argument%s, got %zd auto-releasing thread-state, but no thread-state for this thread thread state %p must be current when releasing can't apply this %s to %s object object of type '%.200s' has no len() File or stream is not seekable. argument should be integer or None, not '%.200s' argument should be integer or bytes-like object, not '%.200s' Py_Initialize must be called first ord() expected string of length 1, but %.200s found ord() expected a character, but string of length %zd found PyCapsule_Import could not import module "%s" PyCapsule_Import "%s" is not valid encoder should return a bytes object, not '%.200s' unsupported operand type(s) for %.100s: '%.100s' and '%.100s' unsupported operand type(s) for %.100s: '%.100s', '%.100s', '%.100s' pow() 3rd argument cannot be 0 base is not invertible for the given modulus Failed calling sys.__interactivehook__ python: Can't reopen .pyc file python: failed to set __main__.__loader__ chr() arg not in range(0x110000) raw write() returned invalid length %zd (should have been between 0 and %zd) range indices must be integers or slices, not %.200s Py_HasFileSystemDefaultEncoding Py_FileSystemDefaultEncodeErrors _Py_HasFileSystemDefaultEncodeErrors %s+---------------- %zd ---------------- %s+---------------- ... ---------------- +------------------------------------ regular expression code size limit exceeded expected string or bytes-like object, got '%.200s' Exception Group Traceback (most recent call last): TypeError: print_exception(): Exception expected for value, Ignored error getting __notes__: %R cannot use a string pattern on a bytes-like object cannot use a bytes pattern on a string-like object unsupported format string passed to %.200s.__format__ The span of capturing group is wrong, please report a bug for the re module. the first argument must be callable maxsize should be integer or None PyType_GetModuleByDef: No superclass of '%s' has the given module Un;translating error handler must return (str, int) tuple position %zd from error handler out of bounds character mapping must be in range(0x%x) character mapping must return integer, None or str iterable unpacking cannot be used in comprehension did you forget parentheses around the comprehension target? bytes object is too large to make repr end_offset must be provided when end_lineno is provided can't unpack IEEE 754 special value on non-IEEE platform encoded result is too long for a Python string Internal lock count overflowed cannot release un-acquired lock At least one argument is required. bad operand type for abs(): '%.200s' type 'partial' takes at least one argument '%.200s' object can't be concatenated int too large to convert to float type %.100s doesn't define __round__ method Exception ignored on building sys.unraisablehook arguments Exception ignored in audit hook Exception ignored in sys.unraisablehook rounded value too large to represent field 'target' is required for AnnAssign field 'annotation' is required for AnnAssign sys.unraisablehook argument type must be UnraisableHookArgs must be real number, not %.50s %.50s.__float__ returned non-float (type %.50s) %.50s.__float__ returned non-float (type %.50s). The ability to return an instance of a strict subclass of float is deprecated, and may be removed in a future version of Python. /builddir/build/BUILD/Python-3.11.9/Objects/iterobject.c bytearray indices must be integers or slices, not %.200s can assign only bytes, buffers, or iterables of ints in range(0, 256) attempt to assign bytes of size %zd to extended slice of size %zd float() argument must be a string or a real number, not '%.200s' could not convert string to %s: %R could not convert string to float: %R could not convert string to float: '%.200s' value too large to convert to float: '%.200s' invalid literal for int() with base %d: %.200R int() arg 2 must be >= 2 and <= 36 int string too large to convert Exceeds the limit (%d digits) for integer string conversion: value has %zd digits; use sys.set_int_max_str_digits() to increase the limit translation table must be 256 characters long Negative size passed to PyByteArray_FromStringAndSize Cannot specify both ',' and '_'. Format specifier missing precision Invalid format specifier '%U' for object of type '%.200s' Cannot specify '%c' with '%c'. Cannot specify '%c' with '\x%x'. bad operand type for unary +: '%.200s' /builddir/build/BUILD/Python-3.11.9/Objects/methodobject.c bytearray object is too large to make repr descriptor '%V' of '%.100s' object needs an argument descriptor '%V' requires a '%.100s' object but received a '%.100s' maketrans arguments must have same length /builddir/build/BUILD/Python-3.11.9/Objects/fileobject.c object.readline() returned non-string repeat argument cannot be negative float too large to pack with d format sequence item %zd: expected a bytes-like object, %.80s found sequence changed size during iteration <method>.__class__.__qualname__ is not a unicode object %s first arg must be bytes or a tuple of bytes, not %s bytes must be in range(0, 256) cannot convert '%.200s' object to bytes zip() argument %d is shorter than argument%s%d zip() argument %d is longer than argument%s%d __defaults__ must be set to a tuple object descriptor for index '%zd' for tuple subclasses doesn't apply to '%s' object attribute name must be a string constructor requires a sequence %.500s() takes a dict as second arg, if any %.500s() takes an at least %zd-sequence (%zd-sequence given) %.500s() takes an at most %zd-sequence (%zd-sequence given) %.500s() takes a %zd-sequence (%zd-sequence given) sum() can't sum strings [use ''.join(seq) instead] sum() can't sum bytes [use b''.join(seq) instead] sum() can't sum bytearray [use b''.join(seq) instead] positional patterns follow keyword patterns real number required in complex literal field 'value' is required for MatchSingleton memoryview: casts are restricted to C-contiguous views shape must be a list or a tuple memoryview: cast must be 1D -> ND or ND -> 1D memoryview: destination format must be a native single character format prefixed with an optional '@' memoryview: cannot cast between two non-byte formats memoryview: length is not a multiple of itemsize memoryview.cast(): elements of shape must be integers memoryview.cast(): elements of shape must be integers > 0 memoryview.cast(): product(shape) > SSIZE_MAX memoryview: product(shape) * itemsize != buffer size memoryview: cannot cast view with zeros in shape or strides field 'cls' is required for MatchClass field 'subject' is required for Match memoryview: unsupported format %s memoryview: format %s not supported patterns may only match literals and attribute lookups multiple starred names in sequence pattern too many expressions in star-unpacking sequence pattern multiple starred expressions in sequence pattern keys (%d) / patterns (%d) length mismatch in mapping pattern too many sub-patterns in mapping pattern can't use NULL keys in MatchMapping (set 'rest' parameter instead) mapping pattern checks duplicate key (%R) mapping pattern keys may only match literals and attribute lookups kwd_attrs (%d) / kwd_patterns (%d) length mismatch in class pattern too many sub-patterns in class pattern %R attribute name repeated in class pattern: %U name capture %R makes remaining patterns unreachable wildcard makes remaining patterns unreachable multiple assignments to name %R in pattern alternative patterns bind different names invalid match pattern node in AST (kind=%d) pow() 3rd argument not allowed unless all arguments are integers 0.0 cannot be raised to a negative power other argument must be K instance clock_gettime(CLOCK_MONOTONIC) '%.200s' object is not an iterator register() takes at least 1 argument (0 given) /builddir/build/BUILD/Python-3.11.9/Python/pystrtod.c __getformat__() argument 1 must be 'double' or 'float' insane float_format or double_format iiiiiiiii;strftime(): illegal time tuple argument cannot clear an executing frame 'async with' outside async function first argument must be callable or None '%.200s' object is unsliceable tuple.index(x): x not in tuple can only assign string to %s.__name__, not '%s' __hash__ method should return an integer audit() missing 1 required positional argument: 'event' expected str for argument 'event' expected str for argument 'event', not %.200s Small block threshold = %d, in %u size classes. class size num pools blocks in use avail blocks ----- ---- --------- ------------- ------------ # bytes lost to arena alignment # bytes lost to arena map root regular expression scanner already executing Un;decoding error handler must return (str, int) tuple codec must pass exception instance configuration names must be strings or integers unrecognized configuration name category must be a Warning subclass, not '%s' field 'value' is required for MatchValue 'registry' must be a dict or None _warnings.filters must be a list _warnings.filters item %zd isn't a 5-tuple action must be a string, not '%.200s' _warnings.defaultaction must be a string, not '%.200s' _warnings.onceregistry must be a dict, not '%.200s' Unrecognized action (%R) in warnings.filters: %R warnings._showwarnmsg() must be set to a callable unable to get warnings.WarningMessage first maketrans argument must be a string if there is a second argument the first two maketrans arguments must have equal length if you give only one argument to maketrans it must be a dict string keys in translate table must be of length 1 keys in translate table must be strings or integers illegal environment variable name __get__(None, None) is invalid expected at most 1 arguments, got %zd update() takes at most 1 positional argument (%zd given) need more than 0 values to unpack need more than 1 value to unpack too many values to unpack (expected 2) process stopped by delivery of signal %i OrderedDict mutated during iteration OrderedDict changed size during iteration newline must be str or None, not %.200s initial_value must be str or None, not %.200s can only assign string to %s.__qualname__, not '%s' string is longer than the buffer called match pattern must be a type %s.__match_args__ must be a tuple (got %s) %s() accepts %d positional sub-pattern%s (%d given) __match_args__ elements must be strings (got %s) reconfigure() argument 'encoding' must be str or None, not %s reconfigure() argument 'errors' must be str or None, not %s reconfigure() argument 'newline' must be str or None, not %s It is not possible to set the encoding or newline of stream after the first read deque mutated during iteration optional 3rd arg must be a dictionary thread is not supported for isolated subinterpreters signal %i cannot be registered, use enable() instead fork not supported for isolated subinterpreters could not acquire lock for %s at interpreter shutdown, possibly due to daemon threads failed releasing import lock after fork Load averages are unobtainable must be %d-item sequence, not %.50s must be sequence of length %d, not %zd Invalid value NaN (not a number) timestamp out of range for platform time_t string too large in _PyUnicode_FormatLong PyNumber_ToBase: base must be 2, 8, 10 or 16 timeout must be greater than 0 Timeout (%lu:%02lu:%02lu.%06u)! unable to start watchdog thread Initialization arguments are not supported Couldn't get thread-state dictionary float too large to pack with f format encoder must return a tuple (object, integer) co_argcount must be a positive integer co_posonlyargcount must be a positive integer co_kwonlyargcount must be a positive integer co_nlocals must be a positive integer co_stacksize must be a positive integer co_flags must be a positive integer co_firstlineno must be a positive integer code: co_nlocals != len(co_varnames) __code__ must be set to a code object %U() requires a code object with %zd free vars, not %zd code point in surrogate code point range(0xd800, 0xe000) code point not in range(0x110000) bad argument type for built-in operation only classes may be registered could not register None for cross-interpreter sharing could not register int for cross-interpreter sharing could not register bytes for cross-interpreter sharing could not register str for cross-interpreter sharing context variable name must be a str readline() should have returned a bytes object, not '%.200s' could not find io module state (interpreter shutdown?) %s: cannot use dir_fd and follow_symlinks together %s%s%s unavailable on this platform slice indices must be integers or have an __index__ method huge integer: number of bits overflows a Py_ssize_t __getnewargs_ex__ should return a tuple, not '%.200s' __getnewargs_ex__ should return a tuple of length 2, not %zd first item of the tuple returned by __getnewargs_ex__ must be a tuple, not '%.200s' second item of the tuple returned by __getnewargs_ex__ must be a dict, not '%.200s' __getnewargs__ should return a tuple, not '%.200s' Type %.100s doesn't define __sizeof__ __sizeof__() should return >= 0 weakly-referenced object no longer exists Out of memory and PyExc_MemoryError is not initialized yet Comparison between bytearray and string deallocated BytesIO object has exported buffers string argument expected, got '%s' fileno() returned a non-integer argument must be an int, or have a fileno() method. file descriptor cannot be a negative integer (%i) Python int too large for C unsigned short cannot add more objects to bytearray intermediate overflow during division integer division result too large for a float throw() third argument must be a traceback object instance exception may not have a separate value exceptions must be classes or instances deriving from BaseException, not %s range object index out of range %U() missing %i required %s argument%s: %U %.200s.__slotnames__ should be a list or None, not %.200s copyreg._slotnames didn't return a list or None __slotsname__ changed size during iteration non-hexadecimal number found in fromhex() arg at position %zd %.200s() %.200s must be %.50s, not %.50s <descriptor>.__name__ is not a unicode object <descriptor>.__objclass__.__qualname__ is not a unicode object %%b requires a bytes-like object, or an object that implements __bytes__, not '%.100s' %%%c format: %s is required, not %.200s %c requires an integer in range(256) or a single byte not all arguments converted during bytes formatting PyBytes_FromFormatV(): %c format expects an integer in range [0; 255] %.200s() takes no positional arguments Cannot install a trace function while another trace function is being installed cannot modify read-only memory memoryview slice assignments are currently restricted to ndim = 1 memoryview assignment: lvalue and rvalue have different structures invalid whence (%i, should be 0, 1 or 2) decoder must return a tuple (object,integer) complex() can't take second arg if first is a string complex() second arg can't be a string complex() first argument must be a string or a number, not '%.200s' complex() second argument must be a number, not '%.200s' __complex__ returned non-complex (type %.200s) __complex__ returned non-complex (type %.200s). The ability to return an instance of a strict subclass of complex is deprecated, and may be removed in a future version of Python. an instance of ContextVar was expected popitem(): dictionary is empty %.200s attribute must be bytes On;encoding error handler must return (str/bytes, int) tuple %.200s attribute must be unicode character mapping must be in range(256) character mapping must return integer, bytes or None, not %.400s invalid octal escape sequence '\%.3s' ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/ partial character in shift sequence non-zero padding bits in shift sequence Invalid whence (%i, should be 0, 1 or 2) Can't do nonzero cur-relative seeks memoryview: internal error in richcompare __bool__ should return bool, returned %s __await__() returned a coroutine __await__() returned non-iterator of type '%.100s' object %.100s can't be used in 'await' expression 0.0 to a negative or complex power field 'target' is required for AsyncFor field 'iter' is required for AsyncFor complex() arg is a malformed string Zero padding is not allowed in complex format specifier '=' alignment flag is not allowed in complex format specifier Unknown format code '%c' for object of type '%.200s' Unknown format code '\x%x' for object of type '%.200s' Stop argument for islice() must be None or an integer: 0 <= x <= sys.maxsize. Indices for islice() must be None or an integer: 0 <= x <= sys.maxsize. Step for islice() must be a positive integer or None. %s() got multiple sub-patterns for attribute %R zip_longest() got an unexpected keyword argument This object has no __weakref__ Tuple or struct_time argument required cannot re-enter the tee iterator cannot convert Infinity to integer ratio cannot convert NaN to integer ratio iiiiiiiii;mktime(): illegal time tuple argument fill character is bigger than the string maximum character sleep length must be non-negative non-integer arguments in division '%S' is an invalid keyword argument for %.200s%s PyUnicode_FromUnicode(NULL, size) is deprecated; use PyUnicode_New() instead maxdigits must be 0 or larger than %d <code object %U at %p, file "%U", line %d> <code object %U at %p, file ???, line %d> utime: you may specify either 'times' or 'ns' but not both utime: 'times' must be either a tuple of two ints or None utime: 'ns' must be a tuple of two ints %.200s.__divmod__() must return a 2-tuple, not %.200s hexadecimal string too long to convert hexadecimal value too large to represent as a float invalid hexadecimal floating-point string float too large to pack with e format first argument must be callable required field "lineno" missing from stmt required field "col_offset" missing from stmt required field "name" missing from FunctionDef while traversing 'FunctionDef' node required field "args" missing from FunctionDef required field "body" missing from FunctionDef FunctionDef field "body" must be a list, not a %.200s FunctionDef field "body" changed size during iteration required field "decorator_list" missing from FunctionDef FunctionDef field "decorator_list" must be a list, not a %.200s FunctionDef field "decorator_list" changed size during iteration required field "name" missing from AsyncFunctionDef while traversing 'AsyncFunctionDef' node required field "args" missing from AsyncFunctionDef required field "body" missing from AsyncFunctionDef AsyncFunctionDef field "body" must be a list, not a %.200s AsyncFunctionDef field "body" changed size during iteration required field "decorator_list" missing from AsyncFunctionDef AsyncFunctionDef field "decorator_list" must be a list, not a %.200s AsyncFunctionDef field "decorator_list" changed size during iteration required field "name" missing from ClassDef while traversing 'ClassDef' node required field "bases" missing from ClassDef ClassDef field "bases" must be a list, not a %.200s ClassDef field "bases" changed size during iteration required field "keywords" missing from ClassDef ClassDef field "keywords" must be a list, not a %.200s ClassDef field "keywords" changed size during iteration required field "body" missing from ClassDef ClassDef field "body" must be a list, not a %.200s ClassDef field "body" changed size during iteration required field "decorator_list" missing from ClassDef ClassDef field "decorator_list" must be a list, not a %.200s ClassDef field "decorator_list" changed size during iteration while traversing 'Return' node required field "targets" missing from Delete Delete field "targets" must be a list, not a %.200s while traversing 'Delete' node Delete field "targets" changed size during iteration required field "targets" missing from Assign Assign field "targets" must be a list, not a %.200s while traversing 'Assign' node Assign field "targets" changed size during iteration required field "value" missing from Assign required field "target" missing from AugAssign while traversing 'AugAssign' node required field "op" missing from AugAssign required field "value" missing from AugAssign required field "target" missing from AnnAssign while traversing 'AnnAssign' node required field "annotation" missing from AnnAssign required field "simple" missing from AnnAssign required field "target" missing from For required field "iter" missing from For required field "body" missing from For For field "body" must be a list, not a %.200s For field "body" changed size during iteration required field "orelse" missing from For For field "orelse" must be a list, not a %.200s For field "orelse" changed size during iteration required field "target" missing from AsyncFor while traversing 'AsyncFor' node required field "iter" missing from AsyncFor required field "body" missing from AsyncFor AsyncFor field "body" must be a list, not a %.200s AsyncFor field "body" changed size during iteration required field "orelse" missing from AsyncFor AsyncFor field "orelse" must be a list, not a %.200s AsyncFor field "orelse" changed size during iteration required field "test" missing from While while traversing 'While' node required field "body" missing from While While field "body" must be a list, not a %.200s While field "body" changed size during iteration required field "orelse" missing from While While field "orelse" must be a list, not a %.200s While field "orelse" changed size during iteration required field "test" missing from If required field "body" missing from If If field "body" must be a list, not a %.200s If field "body" changed size during iteration required field "orelse" missing from If If field "orelse" must be a list, not a %.200s If field "orelse" changed size during iteration required field "items" missing from With With field "items" must be a list, not a %.200s With field "items" changed size during iteration required field "body" missing from With With field "body" must be a list, not a %.200s With field "body" changed size during iteration required field "items" missing from AsyncWith AsyncWith field "items" must be a list, not a %.200s while traversing 'AsyncWith' node AsyncWith field "items" changed size during iteration required field "body" missing from AsyncWith AsyncWith field "body" must be a list, not a %.200s AsyncWith field "body" changed size during iteration required field "subject" missing from Match while traversing 'Match' node required field "cases" missing from Match Match field "cases" must be a list, not a %.200s Match field "cases" changed size during iteration while traversing 'Raise' node required field "body" missing from Try Try field "body" must be a list, not a %.200s Try field "body" changed size during iteration required field "handlers" missing from Try Try field "handlers" must be a list, not a %.200s Try field "handlers" changed size during iteration required field "orelse" missing from Try Try field "orelse" must be a list, not a %.200s Try field "orelse" changed size during iteration required field "finalbody" missing from Try Try field "finalbody" must be a list, not a %.200s Try field "finalbody" changed size during iteration required field "body" missing from TryStar TryStar field "body" must be a list, not a %.200s while traversing 'TryStar' node TryStar field "body" changed size during iteration required field "handlers" missing from TryStar TryStar field "handlers" must be a list, not a %.200s TryStar field "handlers" changed size during iteration required field "orelse" missing from TryStar TryStar field "orelse" must be a list, not a %.200s TryStar field "orelse" changed size during iteration required field "finalbody" missing from TryStar TryStar field "finalbody" must be a list, not a %.200s TryStar field "finalbody" changed size during iteration required field "test" missing from Assert while traversing 'Assert' node required field "names" missing from Import Import field "names" must be a list, not a %.200s while traversing 'Import' node Import field "names" changed size during iteration while traversing 'ImportFrom' node required field "names" missing from ImportFrom ImportFrom field "names" must be a list, not a %.200s ImportFrom field "names" changed size during iteration required field "names" missing from Global Global field "names" must be a list, not a %.200s while traversing 'Global' node Global field "names" changed size during iteration required field "names" missing from Nonlocal Nonlocal field "names" must be a list, not a %.200s while traversing 'Nonlocal' node Nonlocal field "names" changed size during iteration required field "value" missing from Expr expected some sort of stmt, but got %R required field "lineno" missing from expr required field "col_offset" missing from expr required field "op" missing from BoolOp while traversing 'BoolOp' node expected some sort of boolop, but got %R required field "values" missing from BoolOp BoolOp field "values" must be a list, not a %.200s BoolOp field "values" changed size during iteration required field "target" missing from NamedExpr while traversing 'NamedExpr' node required field "value" missing from NamedExpr required field "left" missing from BinOp while traversing 'BinOp' node required field "op" missing from BinOp required field "right" missing from BinOp required field "op" missing from UnaryOp while traversing 'UnaryOp' node expected some sort of unaryop, but got %R required field "operand" missing from UnaryOp required field "args" missing from Lambda while traversing 'Lambda' node required field "body" missing from Lambda required field "test" missing from IfExp while traversing 'IfExp' node required field "body" missing from IfExp required field "orelse" missing from IfExp required field "keys" missing from Dict Dict field "keys" must be a list, not a %.200s Dict field "keys" changed size during iteration required field "values" missing from Dict Dict field "values" must be a list, not a %.200s Dict field "values" changed size during iteration required field "elts" missing from Set Set field "elts" must be a list, not a %.200s Set field "elts" changed size during iteration required field "elt" missing from ListComp while traversing 'ListComp' node required field "generators" missing from ListComp ListComp field "generators" must be a list, not a %.200s ListComp field "generators" changed size during iteration field 'elt' is required for ListComp required field "elt" missing from SetComp while traversing 'SetComp' node required field "generators" missing from SetComp SetComp field "generators" must be a list, not a %.200s SetComp field "generators" changed size during iteration field 'elt' is required for SetComp required field "key" missing from DictComp while traversing 'DictComp' node required field "value" missing from DictComp required field "generators" missing from DictComp DictComp field "generators" must be a list, not a %.200s DictComp field "generators" changed size during iteration required field "elt" missing from GeneratorExp while traversing 'GeneratorExp' node required field "generators" missing from GeneratorExp GeneratorExp field "generators" must be a list, not a %.200s GeneratorExp field "generators" changed size during iteration field 'elt' is required for GeneratorExp required field "value" missing from Await while traversing 'Await' node field 'value' is required for Await while traversing 'Yield' node required field "value" missing from YieldFrom while traversing 'YieldFrom' node field 'value' is required for YieldFrom required field "left" missing from Compare while traversing 'Compare' node required field "ops" missing from Compare Compare field "ops" must be a list, not a %.200s expected some sort of cmpop, but got %R Compare field "ops" changed size during iteration required field "comparators" missing from Compare Compare field "comparators" must be a list, not a %.200s Compare field "comparators" changed size during iteration field 'left' is required for Compare required field "func" missing from Call required field "args" missing from Call Call field "args" must be a list, not a %.200s Call field "args" changed size during iteration required field "keywords" missing from Call Call field "keywords" must be a list, not a %.200s Call field "keywords" changed size during iteration required field "value" missing from FormattedValue while traversing 'FormattedValue' node required field "conversion" missing from FormattedValue required field "values" missing from JoinedStr JoinedStr field "values" must be a list, not a %.200s while traversing 'JoinedStr' node JoinedStr field "values" changed size during iteration required field "value" missing from Constant while traversing 'Constant' node required field "value" missing from Attribute while traversing 'Attribute' node required field "attr" missing from Attribute required field "ctx" missing from Attribute required field "value" missing from Subscript while traversing 'Subscript' node required field "slice" missing from Subscript required field "ctx" missing from Subscript required field "value" missing from Starred while traversing 'Starred' node required field "ctx" missing from Starred required field "id" missing from Name required field "ctx" missing from Name required field "elts" missing from List List field "elts" must be a list, not a %.200s List field "elts" changed size during iteration required field "ctx" missing from List required field "elts" missing from Tuple Tuple field "elts" must be a list, not a %.200s while traversing 'Tuple' node Tuple field "elts" changed size during iteration required field "ctx" missing from Tuple while traversing 'Slice' node expected some sort of expr, but got %R AST identifier must be of type str expected some sort of expr_context, but got %R expected some sort of operator, but got %R AST node line range (%d, %d) is not valid AST node column range (%d, %d) for line range (%d, %d) is not valid line %d, column %d-%d is not a valid range AnnAssign with simple non-Name target Raise with cause but no exception Try has neither except handlers nor finalbody Try has orelse but no except handlers TryStar has neither except handlers nor finalbody TryStar has orelse but no except handlers None disallowed in statement list None disallowed in expression list expression which can't be assigned to in %s context expression must have %s context but has %s instead BoolOp with less than 2 values Dict doesn't have the same number of keys as values Compare has a different number of comparators and operands NamedExpr target must be a Name identifier field can't represent '%s' constant got an invalid type in Constant: %s '%U' codec can't decode byte 0x%02x in position %zd: %U '%U' codec can't decode bytes in position %zd-%zd: %U switch interval must be strictly positive __dict__ must be set to a dictionary, not a '%.200s' Cannot recover from stack overflow. maximum recursion depth exceeded%s reduce() arg 2 must support iteration reduce() of empty iterable with no initial value unexpected expression in assignment %d (line %d) bytesiobuf_getbuffer: view==NULL argument is obsolete <built-in method %s of %s object at %p> reentrant call inside %s.__repr__ clock_gettime(CLOCK_PROCESS_CPUTIME_ID) the processor time used is not available or its value cannot be represented recursion limit must be greater or equal than 1 cannot set the recursion limit to %i at the recursion depth %i: the limit is too low integer argument expected, got '%s' multi-dimensional sub-views are not implemented index out of bounds on dimension %d cannot hash writable memoryview object memoryview: hashing is restricted to formats 'B', 'b' or 'c' /builddir/build/BUILD/Python-3.11.9/Objects/memoryobject.c memoryview: invalid type for format '%s' memoryview: invalid value for format '%s' cannot index %zd-dimension view with %zd-element tuple methodcaller needs at least one argument, the method name keywords dict changed size during iteration argument of type '%.200s' is not iterable sequence.index(x): x not in sequence imaginary number required in complex literal expected PickleBuffer, %.200s found operation forbidden on released PickleBuffer object cannot extract raw buffer from non-contiguous buffer In structseq_repr(), member %zd name is NULL for type %.500s can only assign tuple to %s.__bases__, not %s can only assign non-empty tuple to %s.__bases__, not () %s.__bases__ must be tuple of classes, not '%s' a __bases__ item causes an inheritance cycle %s assignment: '%s' deallocator differs from '%s' %s assignment: '%s' object layout differs from '%s' %U argument after ** must be a mapping, not %.200s %U got multiple values for keyword argument '%S' can't delete tb_next attribute expected traceback object, got '%s' <%s object; span=(%zd, %zd), match=%.50R> '%U' codec can't encode character '\x%02x' in position %zd: %U '%U' codec can't encode character '\u%04x' in position %zd: %U '%U' codec can't encode character '\U%08x' in position %zd: %U '%U' codec can't encode characters in position %zd-%zd: %U '%S' is an invalid keyword argument for enumerate() strerror() argument out of range iiiiiiiii;asctime(): illegal time tuple argument clock_gettime(CLOCK_THREAD_CPUTIME_ID) The fill character must be a unicode character, not %.100s The fill character must be exactly one character long cannot access free variable '%s' where it is not associated with a value in enclosing scope <method-wrapper '%s' of %s object at %p> Try `python -h' for more information. Enable tracemalloc to get the memory block allocation traceback Memory block allocated at (most recent call first): Debug memory block at address p=%p: %zu bytes originally requested The %d pad bytes at p-%d are not all FORBIDDENBYTE (0x%02x): Because memory is corrupted at the start, the count of bytes requested may be bogus, and checking the trailing pad bytes may segfault. The %d pad bytes at tail=%p are Stack (most recent call first): unable to get the interpreter state unable to get the thread head state _PyThreadState_Init() is for internal use only %s: bug likely caused by a refcount error in a C extension PyType_HasFeature(Py_TYPE(((PyObject*)((op)))), (1UL << 28)) kind == PyUnicode_1BYTE_KIND || kind == PyUnicode_2BYTE_KIND || kind == PyUnicode_4BYTE_KIND compact->utf8_length == ascii->length compact->wstr_length == ascii->length PyUnicode_READ(((int)(kind)), ((const void*)(data)), (ascii->length)) == 0 PyType_HasFeature(Py_TYPE(((PyObject*)((op)))), (1UL << 29)) 0 <= mp->ma_used && mp->ma_used <= usable 0 <= keys->dk_usable && keys->dk_usable <= usable 0 <= keys->dk_nentries && keys->dk_nentries <= usable keys->dk_usable + keys->dk_nentries <= usable keys->dk_kind != DICT_KEYS_SPLIT keys->dk_refcnt == 1 || keys == &empty_keys_struct keys->dk_kind == DICT_KEYS_SPLIT entry->me_value != ((void *)0) Py_IS_TYPE(((PyObject*)((key))), &PyUnicode_Type) entry->me_value == ((void *)0) (duplicate_check & (1<<index)) == 0 mp->ma_values->values[index] != ((void *)0) sys.set_asyncgen_hook_finalizer sys.set_asyncgen_hook_firstiter failed to reinitialize lock at fork failed to create init interpreter ID mutex Tokens can only be created by ContextVars EllipsisType takes no arguments NotImplementedType takes no arguments issubclass() argument 2 cannot be a parameterized generic isinstance() argument 2 cannot be a parameterized generic expected a function, exception type or tuple of exception types exception cause must be None or derive from BaseException __context__ may not be deleted exception context must be None or derive from BaseException PyCapsule_GetName called with invalid PyCapsule object PyCapsule_GetDestructor called with invalid PyCapsule object PyCapsule_GetContext called with invalid PyCapsule object PyCapsule_SetName called with invalid PyCapsule object PyCapsule_SetDestructor called with invalid PyCapsule object PyCapsule_SetContext called with invalid PyCapsule object PyCapsule_SetPointer called with null pointer PyCapsule_SetPointer called with invalid PyCapsule object <%s %s object owner=%ld count=%lu at %p> <symtable entry %U(%R), line %d> <super: <class '%s'>, <%s object>> <frame at %p, file %R, line %d, code %S> <stdprinter(fd=%d) object at %p> <async_generator object %S at %p> <slot wrapper '%V' of '%s' objects> <attribute '%V' of '%s' objects> <cell at %p: %.80s object at %p> unable to raise a stack overflow (allocated %zu bytes on the stack, %zu recursive calls) unrecognized interpreter ID %lld a ContextVar key was expected, got %R an instance of Context was expected cannot exit context: %R has not been entered cannot exit context: thread state references a different context object __await__ returned a non-iterable '|=' is not supported by %s; use '|' instead '%.200s' object is not an async iterable aiter() returned not an async iterator of type '%.100s' %s() expects an error PyStatus don't know how to handle %.200s in error callback this __dict__ descriptor does not support '%.200s' objects %s:%d: bad argument to internal function Weakref proxy referenced a non-iterator '%.200s' object tuple assignment index out of range Python int too large for C unsigned int /builddir/build/BUILD/Python-3.11.9/Objects/funcobject.c non-dict keyword only default args expected tuple for closure, got '%.100s' cannot enter context: %R is already entered !_PyObject_IsFreed((PyObject *)type) Py_REFCNT(((PyObject*)((type)))) >= 1 PyType_Check(((PyObject*)((type)))) !(type->tp_flags & (1UL << 13)) type->tp_traverse != ((void *)0) PyDict_Contains(type->tp_dict, &(_PyRuntime.global_objects.singletons.strings.identifiers.___new__._ascii.ob_base)) == 0 Py_REFCNT(((PyObject*)((op)))) >= 1 bad argument to internal function PyState_RemoveModule called on module with slots Interpreters module-list not accessible. Cannot install a profile function while another profile function is being installed null argument to internal routine %S does not support cross-interpreter data expected a writable bytes-like object a strictly positive integer is required must have a sched_param object uid should be integer, not %.200s gid should be integer, not %.200s interpreter ID must be an int, got %.100s interpreter ID must be a non-negative int, got %R write could not complete without blocking maximum recursion limit exceeded internal error in regular expression engine deque already at its maximum size field 'returns' is required for FunctionType field 'tag' is required for TypeIgnore argument must be str or None, not %.50s argument must be str, not %.50s in collect_exception_group_leaf_ids '%.200s' object can't be repeated required field "name" missing from alias while traversing 'alias' node required field "lineno" missing from alias required field "col_offset" missing from alias AST string must be of type str can't jump from unreachable code can't jump into an exception handler, or code may be unreachable can't jump into the body of a for loop can't jump into a re-raising block as there's no location can't jump into an 'except' block as there's no exception cannot find bytecode for specified line can only jump from a 'line' trace event can't jump from the 'call' trace event of a new frame f_lineno can only be set by a trace function line %d comes before the current code block line %d comes after the current code block float argument required, not %.200s both destination and source must be bytes-like objects destination is too small to receive data from source name tuples must contain only strings, not '%.500s' cannot set '__annotations__' attribute of immutable type '%s' '%.200s' object does not support vectorcall an instance of Token was expected %R was created by a different ContextVar %R was created in a different Context expected an instance of Token, got %R Context() does not accept any arguments '%.200s' object doesn't support slice assignment '%.200s' object doesn't support slice deletion underlying buffer is not writable writable contiguous buffer requested for a non-contiguous object. can't prepend path0 to sys.path Cannot add note: __notes__ is not a list expected traceback object or None, got '%s' '%.200s' object is not an async iterator <weakref at %p; to '%s' at %p> <weakref at %p; to '%s' at %p (%U)> /builddir/build/BUILD/Python-3.11.9/Objects/frameobject.c keyword list must be a dictionary No such frozen object named %R Frozen object named %R is invalid Excluded frozen object named %R Frozen modules are disabled and the frozen object named %R is not essential run() missing 1 required positional argument <_io.FileIO fd=%d mode='%s' closefd=%s> <_io.FileIO name=%R mode='%s' closefd=%s> %.200s() must return a deque, not %.200s object %.50s does not have __anext__ method object %.50s does not have __aiter__ method object %.50s does not have __await__ method PyUnicode_AsDecodedObject() is deprecated; use PyCodec_Decode() to decode from str PyUnicode_AsDecodedUnicode() is deprecated; use PyCodec_Decode() to decode from str to str PyUnicode_AsEncodedObject() is deprecated; use PyUnicode_AsEncodedString() to encode from str to bytes or PyCodec_Encode() for generic encoding PyUnicode_AsEncodedUnicode() is deprecated; use PyCodec_Encode() to encode from str to str '%.400s' encoder returned '%.400s' instead of 'str'; use codecs.encode() to encode to arbitrary types Ignoring unimportable $PYTHONBREAKPOINT: "%s" the BufferedRWPair object is being garbage-collected can only concatenate deque (not "%.200s") to deque while traversing 'keyword' node required field "value" missing from keyword required field "lineno" missing from keyword required field "col_offset" missing from keyword required field "arg" missing from arg required field "lineno" missing from arg required field "col_offset" missing from arg required field "posonlyargs" missing from arguments arguments field "posonlyargs" must be a list, not a %.200s while traversing 'arguments' node arguments field "posonlyargs" changed size during iteration required field "args" missing from arguments arguments field "args" must be a list, not a %.200s arguments field "args" changed size during iteration required field "kwonlyargs" missing from arguments arguments field "kwonlyargs" must be a list, not a %.200s arguments field "kwonlyargs" changed size during iteration required field "kw_defaults" missing from arguments arguments field "kw_defaults" must be a list, not a %.200s arguments field "kw_defaults" changed size during iteration required field "defaults" missing from arguments arguments field "defaults" must be a list, not a %.200s arguments field "defaults" changed size during iteration required field "target" missing from comprehension while traversing 'comprehension' node required field "iter" missing from comprehension required field "ifs" missing from comprehension comprehension field "ifs" must be a list, not a %.200s comprehension field "ifs" changed size during iteration required field "is_async" missing from comprehension required field "context_expr" missing from withitem while traversing 'withitem' node required field "lineno" missing from pattern while traversing 'pattern' node required field "col_offset" missing from pattern required field "end_lineno" missing from pattern required field "end_col_offset" missing from pattern required field "value" missing from MatchValue while traversing 'MatchValue' node required field "value" missing from MatchSingleton while traversing 'MatchSingleton' node required field "patterns" missing from MatchSequence MatchSequence field "patterns" must be a list, not a %.200s while traversing 'MatchSequence' node MatchSequence field "patterns" changed size during iteration required field "keys" missing from MatchMapping MatchMapping field "keys" must be a list, not a %.200s while traversing 'MatchMapping' node MatchMapping field "keys" changed size during iteration required field "patterns" missing from MatchMapping MatchMapping field "patterns" must be a list, not a %.200s MatchMapping field "patterns" changed size during iteration required field "cls" missing from MatchClass while traversing 'MatchClass' node required field "patterns" missing from MatchClass MatchClass field "patterns" must be a list, not a %.200s MatchClass field "patterns" changed size during iteration required field "kwd_attrs" missing from MatchClass MatchClass field "kwd_attrs" must be a list, not a %.200s MatchClass field "kwd_attrs" changed size during iteration required field "kwd_patterns" missing from MatchClass MatchClass field "kwd_patterns" must be a list, not a %.200s MatchClass field "kwd_patterns" changed size during iteration while traversing 'MatchStar' node while traversing 'MatchAs' node required field "patterns" missing from MatchOr MatchOr field "patterns" must be a list, not a %.200s while traversing 'MatchOr' node MatchOr field "patterns" changed size during iteration expected some sort of pattern, but got %R required field "lineno" missing from excepthandler while traversing 'excepthandler' node required field "col_offset" missing from excepthandler while traversing 'ExceptHandler' node required field "body" missing from ExceptHandler ExceptHandler field "body" must be a list, not a %.200s ExceptHandler field "body" changed size during iteration expected some sort of excepthandler, but got %R required field "pattern" missing from match_case while traversing 'match_case' node required field "body" missing from match_case match_case field "body" must be a list, not a %.200s match_case field "body" changed size during iteration field 'pattern' is required for match_case Too %s arguments for %R; actual %zd, expected %zd Fatal Python error from unexpected signum: callable finalizer expected, got %.50s callable firstiter expected, got %.50s unexpected constant inside of a literal pattern more positional defaults than args on arguments length of kwonlyargs is not the same as kw_defaults on arguments comprehension with no generators can't capture name '_' in patterns MatchSingleton can only contain True, False and None MatchMapping doesn't have the same number of keys as patterns MatchClass doesn't have the same number of keyword attributes as patterns MatchClass cls field can only contain Name or Attribute nodes. MatchAs must specify a target name if a pattern is given MatchOr requires at least 2 patterns [Previous line repeated %ld more times] [Previous line repeated %ld more time] Exception ignored when trying to write to the signal wakeup fd: setgroups argument must be a sequence signal number %ld out of range [1; %i] invalid signal number %ld, please use valid_signals() set_wakeup_fd only works in main thread of the main interpreter the fd %i must be in non-blocking mode expected an iterator of ints, but iterator yielded %R could not allocate a large enough CPU set unable to determine login name negative value for 'count' not allowed readv() arg 2 must be a sequence preadv2() arg 2 must be a sequence writev() arg 2 must be a sequence pwritev() arg 2 must be a sequence signal only works in main thread of the main interpreter signal handler must be signal.SIG_IGN, signal.SIG_DFL, or a callable object Cannot create a consistent method resolution order (MRO) for bases can't translate character '\x%02x' in position %zd: %U can't translate character '\u%04x' in position %zd: %U can't translate character '\U%08x' in position %zd: %U can't translate characters in position %zd-%zd: %U comparing strings with non-ASCII characters is not supported unsupported operand types(s) or combination of types: '%.100s' and '%.100s' Buffer must be single dimension unknown expression kind inside f-string unknown f-value conversion kind module_globals must be a dict, not '%.200s' domain must be a non-empty string env.keys() or env.values() is not a list is_symlink() takes no arguments getpwnam(): name not found: %R %.200s.__setstate__ argument should be 3-tuple, got %.200s second item of state must be an integer, not %.200s position value cannot be negative third item of state should be a dict, got a %.200s second argument (exceptions) must be a sequence second argument (exceptions) must be a non-empty sequence Item %d of second argument (exceptions) is not an exception Cannot nest BaseExceptions in an ExceptionGroup Cannot nest BaseExceptions in '%.200s' size must be 0 or a positive value setting stack size not supported str() or repr() returned '%.100s' derive must return an instance of BaseExceptionGroup in exceptiongroup_split_recursive state argument must be a tuple OK;setstate(): illegal state argument peek() should have returned a bytes object, not '%.200s' read() should have returned a bytes object, not '%.200s' underlying stream is not seekable telling position disabled by next() call can't reconstruct logical file position %.400s constructor takes at most %zd positional argument%s %.400s got multiple values for argument '%U' %.200s.__setstate__ argument should be 4-tuple, got %.200s third item of state must be an integer, got %.200s fourth item of state should be a dict, got a %.200s PyUnicode_InternImmortal() is deprecated; use PyUnicode_InternInPlace() instead NotImplemented should not be used in a boolean context can't do nonzero cur-relative seeks can't do nonzero end-relative seeks invalid whence (%d, should be %d, %d or %d) underlying read() should have returned a bytes object, not '%.200s' can't restore logical file position %s: argv must be a tuple or list %s: environment must be a mapping object %s: argv first element cannot be empty file_actions must be a sequence or None Each file_actions element must be a non-empty tuple OiO&ik;A open file_action tuple must have 5 elements Oi;A close file_action tuple must have 2 elements Oii;A dup2 file_action tuple must have 3 elements Unknown file_actions identifier OO;A scheduler tuple must have two elements 'yield' inside list comprehension 'yield' inside set comprehension 'yield' inside dict comprehension 'yield' inside generator expression BUG: internal directive bookkeeping broken symtable() arg 3 must be 'exec' or 'eval' or 'single' file.read() returned not bytes but %.100s can't delete __class__ attribute __class__ must be set to a class, not '%s' object __class__ assignment only supported for mutable types or ModuleType subclasses __kwdefaults__ must be set to a dict object link: src and dst must be the same type symlink: src and dst must be the same type execv() arg 2 must be a tuple or list execv() arg 2 must not be empty execv() arg 2 first element cannot be empty execve: argv must be a tuple or list execve: argv must not be empty execve: environment must be a mapping object execve: argv first element cannot be empty generation parameter must be less than the number of available generations (%i) generation parameter cannot be negative arg 3 (name) must be None or string arg 4 (defaults) must be None or tuple arg 5 (closure) must be None or tuple %U requires closure of length %zd, not %zd arg 5 (closure) expected cell, found %s code: argcount must not be negative code: posonlyargcount must not be negative code: kwonlyargcount must not be negative code: nlocals must not be negative cannot reuse already awaited __anext__()/asend() anext(): asynchronous generator is already running cannot reuse already awaited aclose()/athrow() aclose(): asynchronous generator is already running athrow(): asynchronous generator is already running Py_ExitStatusException() must not be called on success Can't reinitialize pending calls lock Failed to reinitialize runtime locks fork not supported for subinterpreters _thread.excepthook argument type must be ExceptHookArgs expression cannot contain assignment, perhaps you meant "=="? expected an indented block after 'with' statement on line %d multiple exception types must be parenthesized expected one or more exception types expected an indented block after 'for' statement on line %d expected an indented block after 'while' statement on line %d expected an indented block after 'except*' statement on line %d expected an indented block after 'except' statement on line %d an int variable for demonstration purposes function object to use in future partial calls tuple of arguments to future partial calls dictionary of keyword arguments to future partial calls Value wrapped by a key function. Weak-reference support module. day of week, range [0, 6], Monday is 0 1 if summer time is in effect, 0 if not, and -1 if unknown The time value as returned by gmtime(), localtime(), and strptime(), and accepted by asctime(), mktime() and strftime(). May be considered as a sequence of 9 integers. Note that several fields' values are not the same as those defined by the C language standard for struct tm. For example, the value of the field tm_year is the actual year, not year - 1900. See individual fields' descriptions for details. A dictionary mapping group names to group numbers. The pattern string from which the RE object was compiled. The number of capturing groups in the pattern. The integer index of the last matched capturing group. The name of the last matched capturing group. The string passed to match() or search(). The regular expression object. The index into the string at which the RE engine started looking for a match. The index into the string beyond which the RE engine will not go. itertools.combinations_with_replacement True if the file descriptor will be closed by close(). maximum size of a deque or None if unbounded Factory for default value called by __missing__(). _collections._deque_reverse_iterator errno associated with this signal real user ID of sending process integer time of last modification time of last access in nanoseconds time of last modification in nanoseconds time of last change in nanoseconds name of machine on network (implementation-defined) elapsed time since an arbitrary point in the past width of the terminal window in characters height of the terminal window in characters the entry's base filename, relative to scandir() "path" argument the entry's full path name; equivalent to os.path.join(scandir_path, entry.name) SC_THREAD_DESTRUCTOR_ITERATIONS CS_XBS5_ILP32_OFFBIG_LINTFLAGS CS_XBS5_LPBIG_OFFBIG_LINTFLAGS enable(file=sys.stderr, all_threads=True): enable the fault handler disable(): disable the fault handler is_enabled()->bool: check if the handler is enabled dump_traceback(file=sys.stderr, all_threads=True): dump the traceback of the current thread, or of all threads if all_threads is True, into file dump_traceback_later(timeout, repeat=False, file=sys.stderrn, exit=False): dump the traceback of all threads in timeout seconds, or each timeout seconds if repeat is True. If exit is True, call _exit(1) which is not safe. cancel_dump_traceback_later(): cancel the previous call to dump_traceback_later(). register(signum, file=sys.stderr, all_threads=True, chain=False): register a handler for the signal 'signum': dump the traceback of the current thread, or of all threads if all_threads is True, into file unregister(signum): unregister the handler of the signal 'signum' registered by register() _read_null(): read from NULL, raise a SIGSEGV or SIGBUS signal depending on the platform _sigsegv(release_gil=False): raise a SIGSEGV signal fatal_error_c_thread(): call Py_FatalError() in a new C thread. _sigabrt(): raise a SIGABRT signal _sigfpe(): raise a SIGFPE signal _stack_overflow(): recursive call to raise a stack overflow .cpython-311-x86_64-linux-gnu.so name of the thread implementation name of the lock implementation name and version of the thread library Hook to intercept first iteration Hook to intercept finalization width of the type used for hashing, in bits prime number giving the modulus on which the hash function is based value to be used for hash of a positive infinity value to be used for hash of a nan multiplier used for the imaginary part of a complex number name of the algorithm for hashing of str, bytes and memoryviews internal output size of hash algorithm small string optimization cutoff 'alpha', 'beta', 'candidate', or 'final' set_coroutine_origin_tracking_depth get_coroutine_origin_tracking_depth _override_frozen_modules_for_tests Implements the 'strict' error handling, which raises a UnicodeError on coding errors. Implements the 'ignore' error handling, which ignores malformed data and continues. Implements the 'replace' error handling, which replaces malformed data with a replacement marker. Implements the 'xmlcharrefreplace' error handling, which replaces an unencodable character with the appropriate XML character reference. Implements the 'backslashreplace' error handling, which replaces malformed data with a backslashed escape sequence. Implements the 'namereplace' error handling, which replaces an unencodable character with a \N{...} escape sequence. Type variables in the types.UnionType. Represent a PEP 604 union type E.g. for int | str split the argument as a field name parse the argument as a format string __prepare__() -> dict used to create the namespace for the class statement the instance invoking super(); may be None the type of the instance invoking super(); may be None __new__($type, *args, **kwargs) -- Create and return a new object. See help(type) for accurate signature. __repr__($self, /) -- Return repr(self). __hash__($self, /) -- Return hash(self). __call__($self, /, *args, **kwargs) -- Call self as a function. __str__($self, /) -- Return str(self). __getattribute__($self, name, /) -- Return getattr(self, name). __setattr__($self, name, value, /) -- Implement setattr(self, name, value). __delattr__($self, name, /) -- Implement delattr(self, name). __lt__($self, value, /) -- Return self<value. __le__($self, value, /) -- Return self<=value. __eq__($self, value, /) -- Return self==value. __ne__($self, value, /) -- Return self!=value. __gt__($self, value, /) -- Return self>value. __ge__($self, value, /) -- Return self>=value. __iter__($self, /) -- Implement iter(self). __next__($self, /) -- Implement next(self). __get__($self, instance, owner=None, /) -- Return an attribute of instance, which is of type owner. __set__($self, instance, value, /) -- Set an attribute of instance to value. __delete__($self, instance, /) -- Delete an attribute of instance. __init__($self, /, *args, **kwargs) -- Initialize self. See help(type(self)) for accurate signature. __new__(type, /, *args, **kwargs) -- Create and return new object. See help(type) for accurate signature. __await__($self, /) -- Return an iterator to be used in await expression. __aiter__($self, /) -- Return an awaitable, that resolves in asynchronous iterator. __anext__($self, /) -- Return a value or raise StopAsyncIteration. __add__($self, value, /) -- Return self+value. __radd__($self, value, /) -- Return value+self. __sub__($self, value, /) -- Return self-value. __rsub__($self, value, /) -- Return value-self. __mul__($self, value, /) -- Return self*value. __rmul__($self, value, /) -- Return value*self. __mod__($self, value, /) -- Return self%value. __rmod__($self, value, /) -- Return value%self. __divmod__($self, value, /) -- Return divmod(self, value). __rdivmod__($self, value, /) -- Return divmod(value, self). __pow__($self, value, mod=None, /) -- Return pow(self, value, mod). __rpow__($self, value, mod=None, /) -- Return pow(value, self, mod). __abs__($self, /) -- abs(self) __bool__($self, /) -- True if self else False __invert__($self, /) -- ~self __lshift__($self, value, /) -- Return self<<value. __rlshift__($self, value, /) -- Return value<<self. __rshift__($self, value, /) -- Return self>>value. __rrshift__($self, value, /) -- Return value>>self. __and__($self, value, /) -- Return self&value. __rand__($self, value, /) -- Return value&self. __xor__($self, value, /) -- Return self^value. __rxor__($self, value, /) -- Return value^self. __or__($self, value, /) -- Return self|value. __ror__($self, value, /) -- Return value|self. __int__($self, /) -- int(self) __float__($self, /) -- float(self) __iadd__($self, value, /) -- Return self+=value. __isub__($self, value, /) -- Return self-=value. __imul__($self, value, /) -- Return self*=value. __imod__($self, value, /) -- Return self%=value. __ipow__($self, value, /) -- Return self**=value. __ilshift__($self, value, /) -- Return self<<=value. __irshift__($self, value, /) -- Return self>>=value. __iand__($self, value, /) -- Return self&=value. __ixor__($self, value, /) -- Return self^=value. __ior__($self, value, /) -- Return self|=value. __floordiv__($self, value, /) -- Return self//value. __rfloordiv__($self, value, /) -- Return value//self. __truediv__($self, value, /) -- Return self/value. __rtruediv__($self, value, /) -- Return value/self. __ifloordiv__($self, value, /) -- Return self//=value. __itruediv__($self, value, /) -- Return self/=value. __index__($self, /) -- Return self converted to an integer, if self is suitable for use as an index into a list. __matmul__($self, value, /) -- Return self@value. __rmatmul__($self, value, /) -- Return value@self. __imatmul__($self, value, /) -- Return self@=value. __len__($self, /) -- Return len(self). __getitem__($self, key, /) -- Return self[key]. __setitem__($self, key, value, /) -- Set self[key] to value. __delitem__($self, key, /) -- Delete self[key]. __contains__($self, key, /) -- Return key in self. __iadd__($self, value, /) -- Implement self+=value. __imul__($self, value, /) -- Implement self*=value. dictionary for instance variables list of weak references to the object Wrapper for potentially out-of-band buffers __dir__() -> list specialized dir() implementation dictionary that this view refers to the real part of a complex number the imaginary part of a complex number the numerator of a rational number in lowest terms the denominator of a rational number in lowest terms Returns self, the complex conjugate of any int. Truncating an Integral returns itself. Flooring an Integral returns itself. Ceiling of an Integral returns itself. size in bytes of the C type used to represent a digit maximum string conversion digits limitation minimum positive value for int_max_str_digits DBL_MAX -- maximum representable finite float DBL_MAX_EXP -- maximum int e such that radix**(e-1) is representable DBL_MAX_10_EXP -- maximum int e such that 10**e is representable DBL_MIN -- Minimum positive normalized float DBL_MIN_EXP -- minimum int e such that radix**(e-1) is a normalized float DBL_MIN_10_EXP -- minimum int e such that 10**e is a normalized float DBL_DIG -- maximum number of decimal digits that can be faithfully represented in a float DBL_MANT_DIG -- mantissa digits DBL_EPSILON -- Difference between 1 and the next representable float FLT_RADIX -- radix of exponent FLT_ROUNDS -- rounding mode used for arithmetic operations qualified name of the generator object being iterated by yield from, or None qualified name of the coroutine object being awaited on, or None qualified name of the async generator A wrapper object implementing __await__ for coroutines. Type variables in the GenericAlias. __typing_unpacked_tuple_args__ Improper mixture of spaces and tabs. Local name referenced but not bound to a value. Method or function hasn't been implemented yet. Operation only works on directories. Operation doesn't work on directories. Base class for warnings generated by user code. Base class for warnings about Unicode related problems, mostly related to conversion problems. Base class for warnings about dubious syntax. Base class for warnings about dubious runtime behavior. Base class for warnings about resource usage. Base class for warnings about features which will be deprecated in the future. Base class for warnings about probable mistakes in module imports Base class for warnings about constructs that will change semantically in the future. Base class for warnings about encodings. Base class for warnings about deprecated features. Base class for warnings about bytes and buffer related problems, mostly related to conversion from str or comparing to str. Second argument to a division or modulo operation was zero. Result too large to be represented. Floating point operation failed. Base class for warning categories. Inappropriate argument value (of correct type). Internal error in the Python interpreter. Please report this to the Python maintainer, along with the traceback, the Python version, and the hardware/OS platform and version. Signal the end from iterator.__next__(). Signal the end from iterator.__anext__(). Weak ref proxy used after referent went away. Base class for I/O related errors. Import can't find module, or can't find name in module. Base class for arithmetic errors. Request to exit from the interpreter. Request that a generator exit. Common base class for all non-exit exceptions. A combination of multiple unrelated exceptions. Common base class for all exceptions D.get(k[,d]) -> D[k] if k in D, else d. d defaults to None. D.keys() -> a set-like object providing a view on D's keys D.values() -> an object providing a view on D's values D.items() -> a set-like object providing a view on D's items D.copy() -> a shallow copy of D D.__reversed__() -> reverse iterator the function (or other callable) implementing a method the instance to which a method is bound u t f 8 1 0 d e v - - - - h e l p - c - m s t r i c t a l w a y s n e v e r , u t f - 8 a s c i i o n o f f . i g n o r e r b w a r n _ d e f a u l t _ e n c o d i n g - - v e r s i o n b B c : d E h i I J m : O P q R s S t u v V W : x X : ? e r r o r : : B y t e s W a r n i n g d e f a u l t : : B y t e s W a r n i n g s u r r o g a t e e s c a p e d e f a u l t s h o w r e f c o u n t f a u l t h a n d l e r i m p o r t t i m e n o _ d e b u g _ r a n g e s t r a c e m a l l o c i n t _ m a x _ s t r _ d i g i t s p y c a c h e _ p r e f i x f r o z e n _ m o d u l e s b a c k s l a s h r e p l a c e s u r r o g a t e p a s s x m l c h a r r e f r e p l a c e _ _ m a i n _ _ c h e c k - h a s h - b a s e d - p y c s h e l p - a l l h e l p - e n v h e l p - x o p t i o n s +QPPEPEP4 kw _ b Y J;/ 0 ) tYPkʭʭʭʭ@5ʭʭʭʭʭ ʭʭʭʭʭʭʭʭʭʭʭ ʭʭʭlhʭhʭʭʭʭ ʭʭʭʭ kЪXM%ȀȀʃ31KHP1=n7}=W; R b V5-F6//x44X3B5,4054r58,0-34 8@/4443X33343{4[4333G4333,4xTwTwTwwJxTwTwTwwwwTwwTw4xTwTwTwTwTwTwTwTwTwTwZwTwwfwwTwwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTw[xTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTwTw#x{rАr"rDrrrrrMr\r1rƐhr- hs - hs`~3~}}~(_3q\+ҭ3٫ŬHf00000000000000000!000000v`jjjjjjjjjjjjjjjpjNOOOOOOOOOOOOOOOOOOOOOOO[QOOOOQOOOOOOOOPPPPPPPPOOOOOOOOOOOOOOOOOOOOOOQOOOOOO7QOOOOOOQOOOOSROOOROOOOOOONOOOPOPIQRONR]]]F:]] ]]]] p %&&&&&&&&&&&&&&&&&&&&&&&%'&&&&2'&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&'&&&&&&&L'&&&&&&&&&&&&&&&?'&!& ˦ hX٥٥XX٥@@@(((SH)MԶY( *q]?S[TM]]i]$YuNOW?NM'LLNGNA5dX'@ o)y t \tldK3>oLP@t:~2~+U 9di%Jb=v}!tNefX~iiԱf; krdyx<W}^2,T@ S0)>E"L7t4J!\| 2 <(2,<i+iiiiiiii<<|6 1 111111` PP QOOOlOlOOOPPPPlOOOOlOPPPOOPOOOOPOQOOlOPOOPlOPPlOlOOOOlOlOP QPlOOOOOlOPlOOPPPPPPPOPOOOOPPPPPOlOOOOONNN=OEO=OW-^--R..---W-W-W-. 1&F1F&> 1 1 1 1 166 1 1 1 1 11 1\*h\\\"^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ S,a;Ikck1k] 4%(4CM +v;rt vt?}zO O O O O O O O O O O O O O O |O O O O |#}{ j G WLLWLLLLLLLWLWLLR>RRRRR>RRRRRRRRRRRR>RRRRWLLWLLLLLLLWLWLLKWWKKWKKKKKKKWKWKKKVKKVKKKKKKKnVKVKKQ ȄȄD&_ǁ_݅#:#5p5 H4J B@> XGΫN;Rs , k jj7jjjjjjjjjJjj5jjj?jjjjjjjjjjj?jj?jjl4 < \ v >/ 5s V m] >a.tGG:GTGdӓG G[*#N(M`*TLVV zpTڃSTup[V\)qH[MZZZy ji7lme]eD {ededh1^5q55N)iME VoQo do o O [ Ҹ 0}ooSSSSSSSSSjoSS@oSSSŹSSSSSSSSSSSgSSHSS( ȾȾ{ȾȾȾȾȾ=ȾȾ7ȾȾ>ȾȾȾȾȾȾȾȾȾȾȾȾȾȾȾȾtȾȾȾȾmȾRȾȾ>>EL++++>>Ή|Ssd]Jeyyv2CǑ~ĒYC=͙%Οow=)dddddddddddddddddddddddddddddo]Tdddddddddd«Z v7O M4!rFP reI|Yo |||go||.oo||2#Iqqqqqqqqqqqqqqqq{qqqqqqqqʥ{1SSSSSSSSSS1SSS)yyyyTyyyyyyyypyyy&I`+```"b0b"22l22222l2222222222222222222i2P2l22222 Xe #= 7 ! " A II"G5*2 4 36"211T1y0c01+30/-,,,M,+ *+5{))5.///..z.q.1..;*;!8;:777y77f76=;;N/N#NN NMMMMMMMݞeXLdM{+V͢,¤G5УHLQQQ%eN'IYmN<#kS٧iS N¦NMYM=ͺͺͺOC7+g[syybb ٺ!!!!?z __zzz/AHZ!#;#;#;#;#9#9##9#""MLDL;L2L)L LLLLKKKKKKKKKKKKKK~KuKlKcKZKQKHK?K6K-K$KKK K KJJJJJJJJJJJJJJJJJJJJJML)LKK6KJ)LKKKKZK6K)LKKKKZK KJKMLMLMLDLDLDLDL)LKKKKKKKKKKKKKKKKKZK6K)LKJJJJJJJJJJJJJJJJJJJJJrJK K KJJJJJJJJJJJJJJyJpJgJK K KJJJJJJJJJJJJJJyJpJgJK K KJJJJJJJJJJJJJJyJpJgJ^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^J^JΌJJJJJJJyJpJgJK K KJJJJJJJΌ IIHHHHHHHHׄ IIIIIIIIHHHHHHHII}ItIkIbIYIPIGI>I5I,I#IIIIHHIIIIIIIIIIhIhIhIhIIIIzIqILIIIIIIIIIIII) JJ JJIIIIvJmJdJ[JRJIJ@J7JJJJJJJJJ,K#KKKKJJwJK|KsKjKaKXKOKAFK$LLL L LKKKKKKKKKKKKPLGL>L5L,L#LLÈLLLLLLL{LrLM MMLLLLLLWLLLLLLLLM`MWMNMEM<M3M*M!MMMMMMMMMMM҇MVNMNDN;N2N)N NNNNNNNNxNxoNONNNNNNBN'P+O PP PP/ڂOOOA|OOOOOOOOOOOO|OsOjOaOXOOOOOOOOOOOO|OsOjOaOXOXOOOFO0P0POsO=O4OBP9P0P'P PP PPOOOOOOOOOOoPfP]PTPKPBP9P0PPPPPPPPPfQ]QTQKQBQ9Q0Q'Q QZQQQQQQfQ]QTQKQBQ9Q0Q'Q QZQxQoQfQ]QTQKQBQ9Q 0Q0Q0Q0Q0Q0QQxQoQfQ]QTQKQBQ9Q 0Q0Q0Q0Q0Q0Q0Q0Q0Q0Q0Q0Q0Q0Q0Q0Q0Q0Q0Q0Q0Q0QQxQoQfQ]QTQKQBQ9Q Q QQPPPP PwQnQeQ\QSQJQAQ8QwQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQMQER<R3R*R!RRR RRMRMRMRRRRzRqRhRMRMRMRMRMRMRR_RVRRRRzRqRhR SSRRRRRRRRSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSRRRRRRR|RS_sR}}}}}}}RP~Y~b~k~t~SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS SSRRRRRRRRSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS}~~~~R~~~~ (RQPPPPPPPQQPPPPPPPQQPPPPPPPCQ:Q1Q(Q QQ QQPPPPPPPPPPPPPPPPPtSSSSSSSSSSS~UUU~U+W"WWWWVV~VWWWWwWnWeW~aW XWWWWWWWWA~WWWWWWWWWWWWWWWWWWWWWW XWWWWWWWWA~WWWWWWWWW}~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~W~WWWWWWWWWW}`WWWNWEW<W3W*W|!WWWWWWWW|yWXXXWWWWN|WbvvvvX6x$xtvYvYvPvX xwvX{{XXZZZZZZZZZyZpZgZ^ZUZLZCZ:Z1Z(ZZZ ZZ ZZYYYYYYYYYYYYYY}YtYkYbYYYPYGY>Y5Y,Y#YxxIyyyz<zYYYX yZyXX{ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ^ZUZ ZYZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ:ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ^ZUZVXMXDX;X2X)X XXXXWWWWWWWWWWWWWW~WuWAxlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWVX2XXWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWwWWWWvW4X+X"XXXXWsvW}XtXkXkXbXYX=vPXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXv YYYYXXXXXXXXXXXXXX6uX)Y YYYYXXXXYYYYYYYYYYYYYYzYqYhY_YVYMYDY;Y2Y)Y YYYYtXYYYYYYYtYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYtYYsYYYYsYKZBZ9Z0Zs'ZZZZZZZzZsqZ [[ZZZZZ\sZ_[V[M[D[/s;[}\t\k\b\Y\P\G\>\5\,\#\\\\[[r[$]]] ] ]\\\\\p\p\p\p\p\p\p\]] ] ]\\\\\\\\\\\\\\y\r]\\\\\\)r\e]\]S]J]A]8]/]q&]]]]]]]]q]^^^]]]]q]p^g^^^U^L^C^:^~q1^^^^^^^^Hq^ __ __^^^q^___w_n_e_\_S_J_pA_B`9`0`'` `` ``_B`9`0`'` `` ``_________p_N`E`<`3`*`!``7p``````w`n`pe`a``````o`lacaZaQaHa?a6a-a$a]kllgm n?nnnnok#llpmnHnnnoxk,llymnQnnnok5llm$nZnnnok>lk2oalacaZaQaHa?a6a-a$aua kklualacakkuauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauauaualacaZaQaHa?a6a-a$a]kllgm n?nnnnok#llpmnHnnnoxk,llymnQnnnok5llm$nZnnnouacaZaQaHa?a6a-a$a]kpmHn,lkk9k^^^^^^^^^^^^^^Ol_h^hh\_S_J_A_8_/_&_\_S_J_A_8_/_&_S_J_A_8_/_&_ _e_\_S_J_A_8_/_&_ _e_\_S_J_e_\_\_S_J_A_8_/_&_ _e_\_\_S_J__^ _e_\_\_S_J_\_\_S_S_S_S_A_8_8_8_/_/_&_&_&_&_e_\_S_J_A_ _e_\_S_S_J_J_e_\_ _e_ghgghg __ _ _^gh"ln_S_J_A_8_/_&_8^/^&^ ^^ ^^aj]^^^~^u^l^c^4jZ^_ _ _^^^^^^^)f2fiDfMf_fhfzf^____|_s_j_a_X_O_F_=_4_+_"___i___________?i_________?i_________?i_________?i_________?i_________|_s_j_a_X_O_F_h=_______________ h_C`:`1`(` `` `g````z`q`h`g_````````g`c/ddefffff/aa~aualacaZaQa5gHa\,An6&+'+'+'%+'+'+'+'+'&+'+'+'+'+'+'+'+'+'+'k%$$+'$$Y&+'+'}'&$&&&&G$G$&&&&%&&&&&%DDDDDE.Euuuuv v^^pgyDZS Rky c ( e d peZedk sedk r<dZdZde Ze de de Z e de d gZ e de de d Z d gZ d Ze de e d ZdZdZn9edk r3dZe dZdZdZ e de dgZ e Z dgZ d Zde e epd d Zde dZdZdZedd Ze d Ze d Ze d Ze d Ze d! Z e d" Z e d# Z e d$ Z e d% Z e d&d' Z!e d( Z"e d) Z#d*Z$d*Z%d*Z& e'e Z(es) e d+g d, Zn # e)$ r Y nw xY weseZe*r e+ee* s e,ee*z ree*z Ze-rese.Zeseev r e/e Zese.Znedk reZ.es7er5e0r3e01 e D ] Z2 e3e2e Z2 e,e2 re2Z n esdZ e/d Z4e4Z$e5se6r1edk re7r e8e9 d-e de ZneZe.seZ.e5pe6Z e8e Z4d.Z:erd/Z:ne!re;re-se;Zd*Z<esZe-sW e4p e8e Z= e8e= Z< e> e3e<e Z?n$# e@eAf$ r e> e3e=e Z?e=Z<Y nw xY wn# e@eAf$ r d*Z<g Z?Y nw xY we?D ]ZBeBC d0 \ ZDZEZFeEreDG H d k reFG xZ4Z$es eIe Zeek rdZn # eJ$ r Y nw xY wesi e3e4 eKe Zedk rN ee sC eKe ZLede de fD ]-ZMeMe*re*ndz ZMeLeMk r e3e4eM ZM eeM reMZ n. nd*Z<esepe.pdZe.seZ. eIe. Z.n+# eJ$ r#ZN ee. r eOd1e Y d*ZN[Nnd*ZN[Nww xY we4s5edk r/e9r- e8e9 ZP eQd2 e D r eIeP Z4e4Z$e4s e8e. xZ4Z$e$s e8e. Z$d*ZRd*ZSe-sve:ste9ee.fD ]fZ2e2rbedk r3 e+e2d3 s e+e2d4 re2T d d, Z2e2d5z Z2 e>e2 ZR e8e2 ZS n # eJ$ r Y bw xY wgeSrd,Z!eSZg Z"d*ZUe:se$re-re d6d, d,k r e3e$ e> e3e$e d, Z& e3e$e ZUnJ# e)$ r e$Z& e3e$e ZUY n5e@eAf$ r, e e3e$e r e3e$e ZUedk re$Z&Y nw xY weUr:edk reUZVn eeUge R ZVeVr e3eVd Z%n e3eUd Z%e seVZ e seUZ d'e d6< e-rdxZ Z ner eC e \ Z ZWZ eWse Z d*Z%e9rbe s` e8e9 ZPer*edk r e e3ePe rePZ n eePe Z e r'e r%e s# eQd7 e D rePZ e3e e Z%erIe4rGe sEedk r e e3e4e re4Z n ee4e Z e r e3e e Z% eXe% sd*Z%e r e r e4re s ee4ge R Z e re%s e3e e Z%eYr$e s"eYZ eQd8 e D s eOd9 e s e/d Z eOd9 e rOe sMedk re Z e se4r ee4e eX Z e seZreZZ e r eX e3e e sedk re&se Z&n eOd: e se Z e re s eOd; e-r e-1 e e d(< d'e d)< ne#sg Z"e!r8e r6e 1 e D ] Z2e"[ e/e2 !edk r0e9r e8e9 ZPne4ZPe"[ e3ePe nAeUr e"[ e3eYe n e"[ e3e e edk r/e!r,e\r)e\j] e\j^ fD ]Z_ e\` e_e ZD d,Za e\b eDe\c eDea Zdn # eJ$ r Y n>w xY w eeedef r(e"g ed1 e ead'z ZaqesLe%sJe\b eDd* Zd eeedef r(e"g ed1 e e\h eD n# e\h eD w xY w# eJ$ r Y w xY weir7ei1 e D ]!Z2e"[ e3e e2 "e%se r e3e e Z%e&se r e3e e Z&edk rJe&re"[ e& e%re"[ e% e4re4e"vre"[ e4 n.e%re"[ e% e&re"[ e& e"e d(< d'e d)< edk r2eUr0e d! peYZ e d" peZpe Z eRrd'e d<< d,e d&< d,e d=< d'e d>< g Z"eRD ]~ZBeBC d? d, G ZBeBs2eBd@k rd'e d=< >eBj dA r eOdB _e"[ e3eSeB e"e d(< d'e d)< ee d < ee d < ee d < ee d < e e d!< e e d"< e pe e d#< e pe e d$< ee d < e%pde dC< e&pde dD< d*S )E platlibdirposixdarwinzpybuilddir.txtzModules/Setup.localpythonz/python.z/os.pyz/os.pycz /lib-dynloadz Lib/os.pyz pyvenv.cfgz.zip:/ntz\Modules\Setup.localLibz\os.pyz\os.pycz Lib\os.py zSOFTWARE\Python\PythonCore\z \PythonPath;\)testc p r1t fd|D r S t /d S d S )Nc 3 J K | ] } t | V d S N)joinpath).0fprefixr s <frozen getpath> <genexpr>z search_up.<locals>.<genexpr> s7 <<QttHVQ''((<<<<<< )anydirname)r r landmarkss `` r search_upr sb ! <<<<<)<<< < < M ! ! ! ! !r program_namehome executablebase_executabler exec_prefix base_prefixbase_exec_prefixpythonpath_envuse_environment module_search_pathsmodule_search_paths_setN orig_argv z /bin/pythonFT=z Failed to find real location of c # Z K | ]&}t t t | V 'd S r isfiler library_dir)r ps r r r s4 F F6(;** + + F F F F F Fr exedllz._pth_is_python_buildc # Z K | ]&}t t t | V 'd S r r, r r s r r r 3 s4 NN6(;2233NNNNNNr c # Z K | ]&}t t t | V 'd S r )r- r r r4 s r r r N s4 II16(61--..IIIIIIr z6Could not find platform independent libraries <prefix>z9Could not find platform dependent libraries <exec_prefix>z8Consider setting $PYTHONHOME to <prefix>[:<exec_prefix>]isolated site_import safe_path#z import sitezimport z'unsupported 'import' line in ._pth file stdlib_dirplatstdlib_dir)kconfigget PLATLIBDIRr os_name BUILDDIR_TXTBUILD_LANDMARK VERSION_MAJORDEFAULT_PROGRAM_NAME VERSION_MINOR STDLIB_SUBDIRSTDLIB_LANDMARKSPLATSTDLIB_LANDMARKBUILDSTDLIB_LANDMARKS VENV_LANDMARK ZIP_LANDMARKDELIMSEPVPATH PYDEBUGEXTPYWINVER WINREG_KEYr- r r r r r r r r! r" ENV_PYTHONPATHr$ pythonpathpythonpath_was_setreal_executable_dirr: r; boolprogram_name_was_set IndexError EXE_SUFFIX hassuffixisxfile py_setpathreal_executableabspathENV_PATHsplitr/ r executable_dirENV_PYTHONEXECUTABLEENV___PYVENV_LAUNCHER__WITH_NEXT_FRAMEWORKr library home_was_setENV_PYTHONHOME venv_prefix venv_prefix2 readlines pyvenvcfgFileNotFoundErrorPermissionErrorline partitionkeyhad_equvaluestriplowerrealpathOSErrorbasenamebase_exe candidateexwarnr. r pthpth_dir rpartition build_prefixbuild_stdlib_prefix had_delimisdirPREFIX EXEC_PREFIXappendwinregHKEY_CURRENT_USERHKEY_LOCAL_MACHINEhk OpenKeyExi QueryValueEnumKeyv isinstancestrextendCloseKey PYTHONPATH startswith r r <module>r s \ ZZ % % 3 gH,,#L*N3M33!II-II-IIM(000]2K2K2KL '[[ [[ [[[ (M M KK K KKKL E CC __#L 555N$M(111m3M3M3MN '/ )N MPMP=P*:JPPPLH(HHHJ E C (. ! ! ! ! ! zz.)) zz& ZZ % % ** .// H jj '' jj '' :: 011 ()** .22 ZZ- . . ZZ 9:: tL)) zz+r2215 ('L -ii j99 -gglU_F_>`>` - *,L % %$ 'c\)) &&J ! !JJ !O l x ^^E " " HQ % % 71:: J E )J WS\\N ) )2 ) ( 2 %WW - -YY-YY-YY$ *)%@)@J WZ((N LL D 6J 6 &<)<)< gl++ '! ((; "F"FGGII!?3 ' ' '! ((< "G"GHHI&KKK ' / % % "nnS 1 1We ! syy{{((**f4438;;== @N 0" &&.hz&:&:O&*44*, D& &&.h~xx ?S?S&T&TO $vvo/F/F#+8J#7#7*>@h @h@hYf@h@h)i & &I %z)Ir II '9 4 4 ((0 (K(KI &vi 0 0 &2; % & E : 9O9rO &%OC h//OO C C C vo C A A ABBB C -'X--'-''""K s F F5E F F FFF - "+.. , D+27?+C+CCN( 3!'/22 , z? 3 $IIa$7$799Q;N;NLL%%a( LA ill!'!** -'- -'j -' ::(! , ,q 0 05! Ihh 2LAA B B1 E x 3U;; < < <, x 3U;; / 5 5 5 6((.?? @ @ 5#8$7??L$ "55 ' d??". "+)L"Q;P"Q"Q"Q 7!"5u==JJ!,66J )(F '&K &'!" `I F[[ *. )>)>& ; ! K =v = gg&& >$6((; ==>> ) (F"; == = - =f =sNN=MNNNNN =$ %Xfm < < " "v " d??vhh~|<<== (' Y~|<<F "!&-88J5$$ " ! 9) 9n 9V 9>=,<=== 9* 9!&-88J Kf KsII8HIIIII K DI J J J G EFFF R; R d?? !K U~ U#)N4GeTTTK &{ &%K R%%>Q(R(R"S"S R$ & 1 &1NPQQQ I I GHHH Z*$.$4$4U$;$;F !()F $%% U* J *> * %%e,, * *A ggajj ) ) ) ) $ )!''**KK(K((; ==>>>> :((6<889999((6<88999$?v +V-FG B &&r:66)A " & 1 1#v~~c17M7M N NAA & " " " !E"%:a-- > & - -aggenn = = =Q > > " - -c4 8 8%:a-- > & - -aggenn = = =OOC((((FOOC((((( 3!!%(( 3 3A hhvq 1 1 2 2 2 2 5& 5 Xfm44 Dk D!+/BCC$ . n - - - * j ) ) ) .nJ > > n - - - * j ) ) ) . n - - -$.F !()F $% d??|? ZZ ! ! +VF**]++D{DfK *F: !F F=F;J 7 7~~c""1%++-- 7 ] " "$%F= ! ! __Y ' ' 7 D: ; ; ; ; hhw 5 5 6 6 6 6$.F !()F $% &~ v!| + x #} #-v} - < !| !'R| )/R s # G GG+K? K K? K;8K? :K;;K? ? L L 2NN N P Q P==Q(T TT71U) )V0>/V0/V0 f e/*ce/c e/ cB e/f /ff ff xxsubtype is an example module showing how to subtype builtin types from C. test_descr.py in the standard test suite requires it in order to complete. If you don't care about the examples, and don't intend to run the Python test suite, you can recompile Python without Modules/xxsubtype.c. pwd.struct_passwd: Results from getpw*() routines. This object may be accessed either as a tuple of (pw_name,pw_passwd,pw_uid,pw_gid,pw_gecos,pw_dir,pw_shell) or via the object attributes as named in the above tuple. This module provides access to the Unix password database. It is available on all Unix versions. Password database entries are reported as 7-tuples containing the following items from the password database (see `<pwd.h>'), in order: pw_name, pw_passwd, pw_uid, pw_gid, pw_gecos, pw_dir, pw_shell. The uid and gid items are integers, all others are strings. An exception is raised if the entry asked for cannot be found. getpwall($module, /) -- Return a list of all available password database entries, in arbitrary order. See help(pwd) for more on password database entries. getpwnam($module, name, /) -- Return the password database entry for the given user name. See `help(pwd)` for more on password database entries. getpwuid($module, uidobj, /) -- Return the password database entry for the given numeric user ID. See `help(pwd)` for more on password database entries. symtable($module, source, filename, startstr, /) -- Return symbol and scope dictionaries used internally by compiler. Convert a file's mode to a string of the form '-rwxrwxrwx' Return the portion of the file's mode that describes the file type. Return the portion of the file's mode that can be set by os.chmod(). S_ISWHT(mode) -> bool Return True if mode is from a whiteout. S_ISPORT(mode) -> bool Return True if mode is from an event port. S_ISDOOR(mode) -> bool Return True if mode is from a door. S_ISSOCK(mode) -> bool Return True if mode is from a socket. S_ISLNK(mode) -> bool Return True if mode is from a symbolic link. S_ISFIFO(mode) -> bool Return True if mode is from a FIFO (named pipe). S_ISREG(mode) -> bool Return True if mode is from a regular file. S_ISBLK(mode) -> bool Return True if mode is from a block special device file. S_ISCHR(mode) -> bool Return True if mode is from a character special device file. S_ISDIR(mode) -> bool Return True if mode is from a directory. S_IFMT_: file type bits S_IFDIR: directory S_IFCHR: character device S_IFBLK: block device S_IFREG: regular file S_IFIFO: fifo (named pipe) S_IFLNK: symbolic link S_IFSOCK: socket file S_IFDOOR: door S_IFPORT: event port S_IFWHT: whiteout S_ISUID: set UID bit S_ISGID: set GID bit S_ENFMT: file locking enforcement S_ISVTX: sticky bit S_IREAD: Unix V7 synonym for S_IRUSR S_IWRITE: Unix V7 synonym for S_IWUSR S_IEXEC: Unix V7 synonym for S_IXUSR S_IRWXU: mask for owner permissions S_IRUSR: read by owner S_IWUSR: write by owner S_IXUSR: execute by owner S_IRWXG: mask for group permissions S_IRGRP: read by group S_IWGRP: write by group S_IXGRP: execute by group S_IRWXO: mask for others (not in group) permissions S_IROTH: read by others S_IWOTH: write by others S_IXOTH: execute by others UF_NODUMP: do not dump file UF_IMMUTABLE: file may not be changed UF_APPEND: file may only be appended to UF_OPAQUE: directory is opaque when viewed through a union stack UF_NOUNLINK: file may not be renamed or deleted UF_COMPRESSED: OS X: file is hfs-compressed UF_HIDDEN: OS X: file should not be displayed SF_ARCHIVED: file may be archived SF_IMMUTABLE: file may not be changed SF_APPEND: file may only be appended to SF_NOUNLINK: file may not be renamed or deleted SF_SNAPSHOT: file is a snapshot file ST_MODE ST_INO ST_DEV ST_NLINK ST_UID ST_GID ST_SIZE ST_ATIME ST_MTIME ST_CTIME FILE_ATTRIBUTE_*: Windows file attribute constants (only present on Windows) call($module, obj, /, *args, **kwargs) -- Same as obj(*args, **kwargs). length_hint($module, obj, default=0, /) -- Return an estimate of the number of items in obj. This is useful for presizing containers when building from an iterable. If the object supports len(), the result will be exact. Otherwise, it may over- or under-estimate by an arbitrary amount. The result will be an integer >= 0. _compare_digest($module, a, b, /) -- Return 'a == b'. This function uses an approach designed to prevent timing analysis, making it appropriate for cryptography. a and b must both be of the same type: either str (ASCII only), or any bytes-like object. Note: If a and b are of different lengths, or if an error occurs, a timing attack could theoretically reveal information about the types and lengths of a and b--but not their values. ge($module, a, b, /) -- Same as a >= b. gt($module, a, b, /) -- Same as a > b. le($module, a, b, /) -- Same as a <= b. lt($module, a, b, /) -- Same as a < b. ne($module, a, b, /) -- Same as a != b. eq($module, a, b, /) -- Same as a == b. ipow($module, a, b, /) -- Same as a **= b. pow($module, a, b, /) -- Same as a ** b. delitem($module, a, b, /) -- Same as del a[b]. setitem($module, a, b, c, /) -- Same as a[b] = c. getitem($module, a, b, /) -- Same as a[b]. iconcat($module, a, b, /) -- Same as a += b, for a and b sequences. concat($module, a, b, /) -- Same as a + b, for a and b sequences. ior($module, a, b, /) -- Same as a |= b. ixor($module, a, b, /) -- Same as a ^= b. iand($module, a, b, /) -- Same as a &= b. irshift($module, a, b, /) -- Same as a >>= b. ilshift($module, a, b, /) -- Same as a <<= b. imod($module, a, b, /) -- Same as a %= b. itruediv($module, a, b, /) -- Same as a /= b. ifloordiv($module, a, b, /) -- Same as a //= b. imatmul($module, a, b, /) -- Same as a @= b. imul($module, a, b, /) -- Same as a *= b. isub($module, a, b, /) -- Same as a -= b. iadd($module, a, b, /) -- Same as a += b. or_($module, a, b, /) -- Same as a | b. xor($module, a, b, /) -- Same as a ^ b. and_($module, a, b, /) -- Same as a & b. not_($module, a, /) -- Same as not a. rshift($module, a, b, /) -- Same as a >> b. lshift($module, a, b, /) -- Same as a << b. invert($module, a, /) -- Same as ~a. inv($module, a, /) -- Same as ~a. abs($module, a, /) -- Same as abs(a). pos($module, a, /) -- Same as +a. neg($module, a, /) -- Same as -a. mod($module, a, b, /) -- Same as a % b. truediv($module, a, b, /) -- Same as a / b. floordiv($module, a, b, /) -- Same as a // b. matmul($module, a, b, /) -- Same as a @ b. mul($module, a, b, /) -- Same as a * b. sub($module, a, b, /) -- Same as a - b. add($module, a, b, /) -- Same as a + b. index($module, a, /) -- Same as a.__index__() is_not($module, a, b, /) -- Same as a is not b. is_($module, a, b, /) -- Same as a is b. countOf($module, a, b, /) -- Return the number of items in a which are, or which equal, b. indexOf($module, a, b, /) -- Return the first index of b in a. contains($module, a, b, /) -- Same as b in a (note reversed operands). truth($module, a, /) -- Return True if a is true, False otherwise. itemgetter(item, ...) --> itemgetter object Return a callable object that fetches the given item(s) from its operand. After f = itemgetter(2), the call f(r) returns r[2]. After g = itemgetter(2, 5, 3), the call g(r) returns (r[2], r[5], r[3]) attrgetter(attr, ...) --> attrgetter object Return a callable object that fetches the given attribute(s) from its operand. After f = attrgetter('name'), the call f(r) returns r.name. After g = attrgetter('name', 'date'), the call g(r) returns (r.name, r.date). After h = attrgetter('name.first', 'name.last'), the call h(r) returns (r.name.first, r.name.last). Return state information for pickling methodcaller(name, ...) --> methodcaller object Return a callable object that calls the given method on its operand. After f = methodcaller('name'), the call f(r) returns r.name(). After g = methodcaller('name', 'date', foo=1), the call g(r) returns r.name('date', foo=1). Operator interface. This module exports a set of functions implemented in C corresponding to the intrinsic operators of Python. For example, operator.add(x, y) is equivalent to the expression x+y. The function names are those used for special methods; variants without leading and trailing '__' are also provided for convenience. getencoding($module, /) -- Get the current locale encoding. bind_textdomain_codeset($module, domain, codeset, /) -- Bind the C library's domain to codeset. bindtextdomain($module, domain, dir, /) -- Bind the C library's domain to dir. textdomain($module, domain, /) -- Set the C library's textdmain to domain, returning the new domain. dcgettext($module, domain, msg, category, /) -- Return translation of msg in domain and category. dgettext($module, domain, msg, /) -- dgettext(domain, msg) -> string Return translation of msg in domain. gettext($module, msg, /) -- gettext(msg) -> string Return translation of msg. nl_langinfo($module, key, /) -- Return the value for the locale information associated with key. strxfrm($module, string, /) -- Return a string that can be used as a key for locale-aware comparisons. strcoll($module, os1, os2, /) -- Compares two strings according to the locale. localeconv($module, /) -- Returns numeric and monetary locale-specific parameters. setlocale($module, category, locale=<unrepresentable>, /) -- Activates/queries locale processing. Support for POSIX locales. partial(func, *args, **keywords) - new function with partial application of the given arguments and keywords. Create a cached callable that wraps another function. user_function: the function being cached maxsize: 0 for no caching None for unlimited cache size n for a bounded cache typed: False cache f(3) and f(3.0) as identical calls True cache f(3) and f(3.0) as distinct calls cache_info_type: namedtuple class with the fields: hits misses currsize maxsize Tools that operate on functions. Convert a cmp= function into a key= function. reduce(function, iterable[, initial]) -> value Apply a function of two arguments cumulatively to the items of a sequence or iterable, from left to right, so as to reduce the iterable to a single value. For example, reduce(lambda x, y: x+y, [1, 2, 3, 4, 5]) calculates ((((1+2)+3)+4)+5). If initial is present, it is placed before the items of the iterable in the calculation, and serves as a default when the iterable is empty. Internal state held by ABC machinery. _abc_subclasscheck($module, self, subclass, /) -- Internal ABC helper for subclasss checks. Should be never used outside abc module. _abc_instancecheck($module, self, instance, /) -- Internal ABC helper for instance checks. Should be never used outside abc module. _abc_register($module, self, subclass, /) -- Internal ABC helper for subclasss registration. Should be never used outside abc module. _get_dump($module, self, /) -- Internal ABC helper for cache and registry debugging. Return shallow copies of registry, of both caches, and negative cache version. Don't call this function directly, instead use ABC._dump_registry() for a nice repr. _reset_caches($module, self, /) -- Internal ABC helper to reset both caches of a given class. Should be only used by refleak.py _reset_registry($module, self, /) -- Internal ABC helper to reset registry of a given class. Should be only used by refleak.py _abc_init($module, self, /) -- Internal ABC helper for class set-up. Should be never used outside abc module. get_cache_token($module, /) -- Returns the current ABC cache token. The token is an opaque object (supporting equality testing) identifying the current version of the ABC cache for virtual subclasses. The token changes with every call to register() on any ABC. Module contains faster C implementation of abc.ABCMeta proxy($module, object, callback=None, /) -- Create a proxy object that weakly references 'object'. 'callback', if given, is called with a reference to the proxy when 'object' is about to be finalized. getweakrefs($module, object, /) -- Return a list of all weak reference objects pointing to 'object'. _remove_dead_weakref($module, dct, key, /) -- Atomically remove key from dict if it points to a dead weakref. getweakrefcount($module, object, /) -- Return the number of weak references to 'object'. get_clock_info(name: str) -> dict Get information of the specified clock. perf_counter_ns() -> int Performance counter for benchmarking as nanoseconds. perf_counter() -> float Performance counter for benchmarking. thread_time() -> int Thread time for profiling as nanoseconds: sum of the kernel and user-space CPU time. thread_time() -> float Thread time for profiling: sum of the kernel and user-space CPU time. process_time() -> int Process time for profiling as nanoseconds: sum of the kernel and user-space CPU time. process_time() -> float Process time for profiling: sum of the kernel and user-space CPU time. monotonic_ns() -> int Monotonic clock, cannot go backward, as nanoseconds. monotonic() -> float Monotonic clock, cannot go backward. tzset() Initialize, or reinitialize, the local timezone to the value stored in os.environ['TZ']. The TZ environment variable should be specified in standard Unix timezone format as documented in the tzset man page (eg. 'US/Eastern', 'Europe/Amsterdam'). Unknown timezones will silently fall back to UTC. If the TZ environment variable is not set, the local timezone is set to the systems best guess of wallclock time. Changing the TZ environment variable without calling tzset *may* change the local timezone used by methods such as localtime, but this behaviour should not be relied on. strptime(string, format) -> struct_time Parse a string to a time tuple according to a format specification. See the library reference manual for formatting codes (same as strftime()). Commonly used format codes: %Y Year with century as a decimal number. %m Month as a decimal number [01,12]. %d Day of the month as a decimal number [01,31]. %H Hour (24-hour clock) as a decimal number [00,23]. %M Minute as a decimal number [00,59]. %S Second as a decimal number [00,61]. %z Time zone offset from UTC. %a Locale's abbreviated weekday name. %A Locale's full weekday name. %b Locale's abbreviated month name. %B Locale's full month name. %c Locale's appropriate date and time representation. %I Hour (12-hour clock) as a decimal number [01,12]. %p Locale's equivalent of either AM or PM. Other codes may be available on your platform. See documentation for the C library strftime function. strftime(format[, tuple]) -> string Convert a time tuple to a string according to a format specification. See the library reference manual for formatting codes. When the time tuple is not present, current time as returned by localtime() is used. Commonly used format codes: %Y Year with century as a decimal number. %m Month as a decimal number [01,12]. %d Day of the month as a decimal number [01,31]. %H Hour (24-hour clock) as a decimal number [00,23]. %M Minute as a decimal number [00,59]. %S Second as a decimal number [00,61]. %z Time zone offset from UTC. %a Locale's abbreviated weekday name. %A Locale's full weekday name. %b Locale's abbreviated month name. %B Locale's full month name. %c Locale's appropriate date and time representation. %I Hour (12-hour clock) as a decimal number [01,12]. %p Locale's equivalent of either AM or PM. Other codes may be available on your platform. See documentation for the C library strftime function. mktime(tuple) -> floating point number Convert a time tuple in local time to seconds since the Epoch. Note that mktime(gmtime(0)) will not generally return zero for most time zones; instead the returned value will either be equal to that of the timezone or altzone attributes on the time module. ctime(seconds) -> string Convert a time in seconds since the Epoch to a string in local time. This is equivalent to asctime(localtime(seconds)). When the time tuple is not present, current time as returned by localtime() is used. asctime([tuple]) -> string Convert a time tuple to a string, e.g. 'Sat Jun 06 16:26:11 1998'. When the time tuple is not present, current time as returned by localtime() is used. localtime([seconds]) -> (tm_year,tm_mon,tm_mday,tm_hour,tm_min, tm_sec,tm_wday,tm_yday,tm_isdst) Convert seconds since the Epoch to a time tuple expressing local time. When 'seconds' is not passed in, convert the current time instead. gmtime([seconds]) -> (tm_year, tm_mon, tm_mday, tm_hour, tm_min, tm_sec, tm_wday, tm_yday, tm_isdst) Convert seconds since the Epoch to a time tuple expressing UTC (a.k.a. GMT). When 'seconds' is not passed in, convert the current time instead. If the platform supports the tm_gmtoff and tm_zone, they are available as attributes only. sleep(seconds) Delay execution for a given number of seconds. The argument may be a floating point number for subsecond precision. pthread_getcpuclockid(thread_id) -> int Return the clk_id of a thread's CPU time clock. clock_getres(clk_id) -> floating point number Return the resolution (precision) of the specified clock clk_id. clock_settime_ns(clk_id, time) Set the time of the specified clock clk_id with nanoseconds. clock_settime(clk_id, time) Set the time of the specified clock clk_id. clock_gettime_ns(clk_id) -> int Return the time of the specified clock clk_id as nanoseconds. clock_gettime(clk_id) -> float Return the time of the specified clock clk_id. time_ns() -> int Return the current time in nanoseconds since the Epoch. time() -> floating point number Return the current time in seconds since the Epoch. Fractions of a second may be present if the system clock provides them. This module provides various functions to manipulate time values. There are two standard representations of time. One is the number of seconds since the Epoch, in UTC (a.k.a. GMT). It may be an integer or a floating point number (to represent fractions of seconds). The Epoch is system-defined; on Unix, it is generally January 1st, 1970. The actual value can be retrieved by calling gmtime(0). The other representation is a tuple of 9 integers giving local time. The tuple items are: year (including century, e.g. 1998) month (1-12) day (1-31) hours (0-23) minutes (0-59) seconds (0-59) weekday (0-6, Monday is 0) Julian day (day in the year, 1-366) DST (Daylight Savings Time) flag (-1, 0 or 1) If the DST flag is 0, the time is given in the regular time zone; if it is 1, the time is given in the DST time zone; if it is -1, mktime() should guess based on the date and time. Sun Mon Tue Wed Thu Fri Sat Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec locked() -> bool (locked_lock() is an obsolete synonym) Return whether the lock is in the locked state. release() (release_lock() is an obsolete synonym) Release the lock, allowing another thread that is blocked waiting for the lock to acquire the lock. The lock must be in the locked state, but it needn't be locked by the same thread that unlocks it. acquire(blocking=True, timeout=-1) -> bool (acquire_lock() is an obsolete synonym) Lock the lock. Without argument, this blocks if the lock is already locked (even by the same thread), waiting for another thread to release the lock, and return True once the lock is acquired. With an argument, this will only block if the argument is true, and the return value reflects whether the lock is acquired. The blocking operation is interruptible. A lock object is a synchronization primitive. To create a lock, call threading.Lock(). Methods are: acquire() -- lock the lock, possibly blocking until it can be obtained release() -- unlock of the lock locked() -- test whether the lock is currently locked A lock is not owned by the thread that locked it; another thread may unlock it. A thread attempting to lock a lock that it has already locked will block until another thread unlocks it. Deadlocks may ensue. _recursion_count() -> int For internal use by reentrancy checks. _release_save() -> tuple For internal use by `threading.Condition`. _acquire_restore(state) -> None For internal use by `threading.Condition`. _is_owned() -> bool For internal use by `threading.Condition`. release() Release the lock, allowing another thread that is blocked waiting for the lock to acquire the lock. The lock must be in the locked state, and must be locked by the same thread that unlocks it; otherwise a `RuntimeError` is raised. Do note that if the lock was acquire()d several times in a row by the current thread, release() needs to be called as many times for the lock to be available for other threads. acquire(blocking=True) -> bool Lock the lock. `blocking` indicates whether we should wait for the lock to be available or not. If `blocking` is False and another thread holds the lock, the method will return False immediately. If `blocking` is True and another thread holds the lock, the method will wait for the lock to be released, take it and then return True. (note: the blocking operation is interruptible.) In all other cases, the method will return True immediately. Precisely, if the current thread already holds the lock, its internal counter is simply incremented. If nobody holds the lock, the lock is taken and its internal counter initialized to 1. ExceptHookArgs Type used to pass arguments to threading.excepthook. excepthook(exc_type, exc_value, exc_traceback, thread) Handle uncaught Thread.run() exception. _set_sentinel() -> lock Set a sentinel lock that will be released when the current thread state is finalized (after it is untied from the interpreter). This is a private API for the threading module. stack_size([size]) -> size Return the thread stack size used when creating new threads. The optional size argument specifies the stack size (in bytes) to be used for subsequently created threads, and must be 0 (use platform or configured default) or a positive integer value of at least 32,768 (32k). If changing the thread stack size is unsupported, a ThreadError exception is raised. If the specified size is invalid, a ValueError exception is raised, and the stack size is unmodified. 32k bytes currently the minimum supported stack size value to guarantee sufficient stack space for the interpreter itself. Note that some platforms may have particular restrictions on values for the stack size, such as requiring a minimum stack size larger than 32 KiB or requiring allocation in multiples of the system memory page size - platform documentation should be referred to for more information (4 KiB pages are common; using multiples of 4096 for the stack size is the suggested approach in the absence of more specific information). _count() -> integer Return the number of currently running Python threads, excluding the main thread. The returned number comprises all threads created through `start_new_thread()` as well as `threading.Thread`, and not yet finished. This function is meant for internal and specialized purposes only. In most applications `threading.enumerate()` should be used instead. get_native_id() -> integer Return a non-negative integer identifying the thread as reported by the OS (kernel). This may be used to uniquely identify a particular thread within a system. get_ident() -> integer Return a non-zero integer that uniquely identifies the current thread amongst other threads that exist simultaneously. This may be used to identify per-thread resources. Even though on some platforms threads identities may appear to be allocated consecutive numbers starting at 1, this behavior should not be relied upon, and the number should be seen purely as a magic cookie. A thread's identity may be reused for another thread after it exits. interrupt_main(signum=signal.SIGINT, /) Simulate the arrival of the given signal in the main thread, where the corresponding signal handler will be executed. If *signum* is omitted, SIGINT is assumed. A subthread can use this function to interrupt the main thread. Note: the default signal handler for SIGINT raises ``KeyboardInterrupt``. exit() (exit_thread() is an obsolete synonym) This is synonymous to ``raise SystemExit''. It will cause the current thread to exit silently unless the exception is caught. allocate_lock() -> lock object (allocate() is an obsolete synonym) Create a new lock object. See help(type(threading.Lock())) for information about locks. start_new_thread(function, args[, kwargs]) (start_new() is an obsolete synonym) Start a new thread and return its identifier. The thread will call the function with positional arguments from the tuple args and keyword arguments taken from the optional dictionary kwargs. The thread exits when the function returns; the return value is ignored. The thread will also exit when the function raises an unhandled exception; a stack trace will be printed unless the exception is SystemExit. This module provides primitive operations to write multi-threaded programs. The 'threading' module provides a more convenient interface. __deepcopy__($self, memo, /) -- __copy__($self, /) -- scanner($self, /, string, pos=0, endpos=sys.maxsize) -- finditer($self, /, string, pos=0, endpos=sys.maxsize) -- Return an iterator over all non-overlapping matches for the RE pattern in string. For each match, the iterator returns a match object. split($self, /, string, maxsplit=0) -- Split string by the occurrences of pattern. findall($self, /, string, pos=0, endpos=sys.maxsize) -- Return a list of all non-overlapping matches of pattern in string. subn($self, /, repl, string, count=0) -- Return the tuple (new_string, number_of_subs_made) found by replacing the leftmost non-overlapping occurrences of pattern with the replacement repl. sub($self, /, repl, string, count=0) -- Return the string obtained by replacing the leftmost non-overlapping occurrences of pattern in string by the replacement repl. search($self, /, string, pos=0, endpos=sys.maxsize) -- Scan through string looking for a match, and return a corresponding match object instance. Return None if no position in the string matches. fullmatch($self, /, string, pos=0, endpos=sys.maxsize) -- Matches against all of the string. match($self, /, string, pos=0, endpos=sys.maxsize) -- Matches zero or more characters at the beginning of the string. Compiled regular expression object. __deepcopy__($self, memo, /) -- __copy__($self, /) -- expand($self, /, template) -- Return the string obtained by doing backslash substitution on the string template, as done by the sub() method. groupdict($self, /, default=None) -- Return a dictionary containing all the named subgroups of the match, keyed by the subgroup name. default Is used for groups that did not participate in the match. groups($self, /, default=None) -- Return a tuple containing all the subgroups of the match, from 1. default Is used for groups that did not participate in the match. span($self, group=0, /) -- For match object m, return the 2-tuple (m.start(group), m.end(group)). end($self, group=0, /) -- Return index of the end of the substring matched by group. start($self, group=0, /) -- Return index of the start of the substring matched by group. group([group1, ...]) -> str or tuple. Return subgroup(s) of the match by indices or names. For 0 returns the entire match. The result of re.match() and re.search(). Match objects always have a boolean value of True. search($self, /) -- match($self, /) -- unicode_tolower($module, character, /) -- ascii_tolower($module, character, /) -- unicode_iscased($module, character, /) -- ascii_iscased($module, character, /) -- getcodesize($module, /) -- compile($module, /, pattern, flags, code, groups, groupindex, indexgroup) -- SRE 2.2.2 Copyright (c) 1997-2002 by Secret Labs AB pairwise(iterable, /) -- Return an iterator of overlapping pairs taken from the input iterator. s -> (s0,s1), (s1,s2), (s2, s3), ... groupby(iterable, key=None) -- make an iterator that returns consecutive keys and groups from the iterable iterable Elements to divide into groups according to the key function. key A function for computing the group category for each element. If the key function is not specified or is None, the element itself is used for grouping. teedataobject(iterable, values, next, /) -- Data container common to multiple tee objects. _tee(iterable, /) -- Iterator wrapped to make it copyable. cycle(iterable, /) -- Return elements from the iterable until it is exhausted. Then repeat the sequence indefinitely. dropwhile(predicate, iterable, /) -- Drop items from the iterable while predicate(item) is true. Afterwards, return every element until the iterable is exhausted. takewhile(predicate, iterable, /) -- Return successive entries from an iterable as long as the predicate evaluates to true for each entry. starmap(function, iterable, /) -- Return an iterator whose values are returned from the function evaluated with an argument tuple taken from the given sequence. combinations(iterable, r) -- Return successive r-length combinations of elements in the iterable. combinations(range(4), 3) --> (0,1,2), (0,1,3), (0,2,3), (1,2,3) combinations_with_replacement(iterable, r) -- Return successive r-length combinations of elements in the iterable allowing individual elements to have successive repeats. combinations_with_replacement('ABC', 2) --> ('A','A'), ('A','B'), ('A','C'), ('B','B'), ('B','C'), ('C','C') permutations(iterable, r=None) -- Return successive r-length permutations of elements in the iterable. permutations(range(3), 2) --> (0,1), (0,2), (1,0), (1,2), (2,0), (2,1) accumulate(iterable, func=None, *, initial=None) -- Return series of accumulated sums (or other binary function results). compress(data, selectors) -- Return data elements corresponding to true selector elements. Forms a shorter iterator from selected data elements using the selectors to choose the data elements. filterfalse(function, iterable, /) -- Return those items of iterable for which function(item) is false. If function is None, return the items that are false. count(start=0, step=1) -- Return a count object whose .__next__() method returns consecutive values. Equivalent to: def count(firstval=0, step=1): x = firstval while 1: yield x x += step Returns an independent iterator. islice(iterable, stop) --> islice object islice(iterable, start, stop[, step]) --> islice object Return an iterator whose next() method returns selected values from an iterable. If start is specified, will skip all preceding elements; otherwise, start defaults to zero. Step defaults to one. If specified as another value, step determines how many values are skipped between successive calls. Works like a slice() on a list but returns an iterator. chain(*iterables) --> chain object Return a chain object whose .__next__() method returns elements from the first iterable until it is exhausted, then elements from the next iterable, until all of the iterables are exhausted. from_iterable($type, iterable, /) -- Alternative chain() constructor taking a single iterable argument that evaluates lazily. product(*iterables, repeat=1) --> product object Cartesian product of input iterables. Equivalent to nested for-loops. For example, product(A, B) returns the same as: ((x,y) for x in A for y in B). The leftmost iterators are in the outermost for-loop, so the output tuples cycle in a manner similar to an odometer (with the rightmost element changing on every iteration). To compute the product of an iterable with itself, specify the number of repetitions with the optional repeat keyword argument. For example, product(A, repeat=4) means the same as product(A, A, A, A). product('ab', range(3)) --> ('a',0) ('a',1) ('a',2) ('b',0) ('b',1) ('b',2) product((0,1), (0,1), (0,1)) --> (0,0,0) (0,0,1) (0,1,0) (0,1,1) (1,0,0) ... Returns size in memory, in bytes. Private method returning an estimate of len(list(it)). repeat(object [,times]) -> create an iterator which returns the object for the specified number of times. If not specified, returns the object endlessly. Set state information for unpickling. Return state information for pickling. zip_longest(iter1 [,iter2 [...]], [fillvalue=None]) --> zip_longest object Return a zip_longest object whose .__next__() method returns a tuple where the i-th element comes from the i-th iterable argument. The .__next__() method continues until the longest iterable in the argument sequence is exhausted and then it raises StopIteration. When the shorter iterables are exhausted, the fillvalue is substituted in their place. The fillvalue defaults to None or can be specified by a keyword argument. tee($module, iterable, n=2, /) -- Returns a tuple of n independent iterators. Functional tools for creating and using iterators. Infinite iterators: count(start=0, step=1) --> start, start+step, start+2*step, ... cycle(p) --> p0, p1, ... plast, p0, p1, ... repeat(elem [,n]) --> elem, elem, elem, ... endlessly or up to n times Iterators terminating on the shortest input sequence: accumulate(p[, func]) --> p0, p0+p1, p0+p1+p2 chain(p, q, ...) --> p0, p1, ... plast, q0, q1, ... chain.from_iterable([p, q, ...]) --> p0, p1, ... plast, q0, q1, ... compress(data, selectors) --> (d[0] if s[0]), (d[1] if s[1]), ... dropwhile(pred, seq) --> seq[n], seq[n+1], starting when pred fails groupby(iterable[, keyfunc]) --> sub-iterators grouped by value of keyfunc(v) filterfalse(pred, seq) --> elements of seq where pred(elem) is False islice(seq, [start,] stop [, step]) --> elements from seq[start:stop:step] pairwise(s) --> (s[0],s[1]), (s[1],s[2]), (s[2], s[3]), ... starmap(fun, seq) --> fun(*seq[0]), fun(*seq[1]), ... tee(it, n=2) --> (it1, it2 , ... itn) splits one iterator into n takewhile(pred, seq) --> seq[0], seq[1], until pred fails zip_longest(p, q, ...) --> (p[0], q[0]), (p[1], q[1]), ... Combinatoric generators: product(p, q, ... [repeat=1]) --> cartesian product permutations(p[, r]) combinations(p, r) combinations_with_replacement(p, r) writable($self, /) -- Returns True if the IO object can be written. readable($self, /) -- Returns True if the IO object can be read. seekable($self, /) -- Returns True if the IO object can be seeked. write($self, s, /) -- Write string to file. Returns the number of characters written, which is always equal to the length of the string. seek($self, pos, whence=0, /) -- Change stream position. Seek to character offset pos relative to position indicated by whence: 0 Start of stream (the default). pos should be >= 0; 1 Current position - pos must be 0; 2 End of stream - pos must be 0. Returns the new absolute position. truncate($self, pos=None, /) -- Truncate size to pos. The pos argument defaults to the current file position, as returned by tell(). The current file position is unchanged. Returns the new absolute position. tell($self, /) -- Tell the current file position. readline($self, size=-1, /) -- Read until newline or EOF. Returns an empty string if EOF is hit immediately. read($self, size=-1, /) -- Read at most size characters, returned as a string. If the argument is negative or omitted, read until EOF is reached. Return an empty string at EOF. getvalue($self, /) -- Retrieve the entire contents of the object. close($self, /) -- Close the IO object. Attempting any further operation after the object is closed will raise a ValueError. This method has no effect if the file is already closed. StringIO(initial_value='', newline='\n') -- Text I/O implementation using an in-memory buffer. The initial_value argument sets the value of object. The newline argument is like the one of TextIOWrapper's constructor. Write string to stream. Returns the number of characters written (which is always equal to the length of the string). Read until newline or EOF. Returns an empty string if EOF is hit immediately. Read at most n characters from stream. Read from underlying buffer until we have n characters or we hit EOF. If n is negative or omitted, read until EOF. Separate the underlying buffer from the TextIOBase and return it. After the underlying buffer has been detached, the TextIO is in an unusable state. The error setting of the decoder or encoder. Subclasses should override. Line endings translated so far. Only line endings translated during reading are considered. Subclasses should override. Encoding of the text stream. Subclasses should override. Base class for text I/O. This class provides a character and line based interface to stream I/O. There is no readinto method because Python's character strings are immutable. reset($self, /) -- setstate($self, state, /) -- getstate($self, /) -- decode($self, /, input, final=False) -- IncrementalNewlineDecoder(decoder, translate, errors='strict') -- Codec used when reading a file in universal newlines mode. It wraps another incremental decoder, translating \r\n and \r into \n. It also records the types of newlines encountered. When used with translate=False, it ensures that the newline sequence is returned in one piece. When used with decoder=None, it expects unicode strings as decode input and translates newlines without first invoking an external decoder. truncate($self, pos=None, /) -- tell($self, /) -- Return the stream position as an opaque number. The return value of tell() can be given as input to seek(), to restore a previous stream position. seek($self, cookie, whence=os.SEEK_SET, /) -- Set the stream position, and return the new stream position. cookie Zero or an opaque number returned by tell(). whence The relative position to seek from. Four operations are supported, given by the following argument combinations: - seek(0, SEEK_SET): Rewind to the start of the stream. - seek(cookie, SEEK_SET): Restore a previous position; 'cookie' must be a number returned by tell(). - seek(0, SEEK_END): Fast-forward to the end of the stream. - seek(0, SEEK_CUR): Leave the current stream position unchanged. Any other argument combinations are invalid, and may raise exceptions. isatty($self, /) -- writable($self, /) -- readable($self, /) -- seekable($self, /) -- fileno($self, /) -- close($self, /) -- flush($self, /) -- readline($self, size=-1, /) -- read($self, size=-1, /) -- write($self, text, /) -- reconfigure($self, /, *, encoding=None, errors=None, newline=None, line_buffering=None, write_through=None) -- Reconfigure the text stream with new parameters. This also does an implicit stream flush. detach($self, /) -- TextIOWrapper(buffer, encoding=None, errors=None, newline=None, line_buffering=False, write_through=False) -- Character and line based layer over a BufferedIOBase object, buffer. encoding gives the name of the encoding that the stream will be decoded or encoded with. It defaults to locale.getencoding(). errors determines the strictness of encoding and decoding (see help(codecs.Codec) or the documentation for codecs.register) and defaults to "strict". newline controls how line endings are handled. It can be None, '', '\n', '\r', and '\r\n'. It works as follows: * On input, if newline is None, universal newlines mode is enabled. Lines in the input can end in '\n', '\r', or '\r\n', and these are translated into '\n' before being returned to the caller. If it is '', universal newline mode is enabled, but line endings are returned to the caller untranslated. If it has any of the other legal values, input lines are only terminated by the given string, and the line ending is returned to the caller untranslated. * On output, if newline is None, any '\n' characters written are translated to the system default line separator, os.linesep. If newline is '' or '\n', no translation takes place. If newline is any of the other legal values, any '\n' characters written are translated to the given string. If line_buffering is True, a call to flush is implied when a call to write contains a newline character. Write the given buffer to the IO stream. Returns the number of bytes written, which is always the length of b in bytes. Raises BlockingIOError if the buffer is full and the underlying raw stream cannot accept more data at the moment. readinto1($self, buffer, /) -- readinto($self, buffer, /) -- Read and return up to n bytes, with at most one read() call to the underlying raw stream. A short result does not imply that EOF is imminent. Returns an empty bytes object on EOF. Read and return up to n bytes. If the argument is omitted, None, or negative, reads and returns all data until EOF. If the argument is positive, and the underlying raw stream is not 'interactive', multiple raw reads may be issued to satisfy the byte count (unless EOF is reached first). But for interactive raw streams (as well as sockets and pipes), at most one raw read will be issued, and a short result does not imply that EOF is imminent. Returns an empty bytes object on EOF. Returns None if the underlying raw stream was open in non-blocking mode and no data is available at the moment. detach($self, /) -- Disconnect this buffer from its underlying raw stream and return it. After the raw stream has been detached, the buffer is in an unusable state. Base class for buffered IO objects. The main difference with RawIOBase is that the read() method supports omitting the size argument, and does not have a default implementation that defers to readinto(). In addition, read(), readinto() and write() may raise BlockingIOError if the underlying raw stream is in non-blocking mode and not ready; unlike their raw counterparts, they will never return None. A typical implementation should not inherit from a RawIOBase implementation, but wrap one. BufferedReader(raw, buffer_size=DEFAULT_BUFFER_SIZE) -- Create a new buffered reader using the given readable raw IO object. BufferedWriter(raw, buffer_size=DEFAULT_BUFFER_SIZE) -- A buffer for a writeable sequential RawIO object. The constructor creates a BufferedWriter for the given writeable raw stream. If the buffer_size is not given, it defaults to DEFAULT_BUFFER_SIZE. BufferedRWPair(reader, writer, buffer_size=DEFAULT_BUFFER_SIZE, /) -- A buffered reader and writer object together. A buffered reader object and buffered writer object put together to form a sequential IO object that can read and write. This is typically used with a socket or two-way pipe. reader and writer are RawIOBase objects that are readable and writeable respectively. If the buffer_size is omitted it defaults to DEFAULT_BUFFER_SIZE. write($self, buffer, /) -- peek($self, size=0, /) -- readline($self, size=-1, /) -- readinto1($self, buffer, /) -- readinto($self, buffer, /) -- read1($self, size=-1, /) -- read($self, size=-1, /) -- truncate($self, pos=None, /) -- seek($self, target, whence=0, /) -- BufferedRandom(raw, buffer_size=DEFAULT_BUFFER_SIZE) -- A buffered interface to random access streams. The constructor creates a reader and writer for a seekable stream, raw, given in the first argument. If the buffer_size is omitted it defaults to DEFAULT_BUFFER_SIZE. _enter_buffered_busy truncate($self, size=None, /) -- Truncate the file to at most size bytes. Size defaults to the current file position, as returned by tell(). The current file position is unchanged. Returns the new size. seek($self, pos, whence=0, /) -- Change stream position. Seek to byte offset pos relative to position indicated by whence: 0 Start of stream (the default). pos should be >= 0; 1 Current position - pos may be negative; 2 End of stream - pos usually negative. Returns the new absolute position. getvalue($self, /) -- Retrieve the entire contents of the BytesIO object. getbuffer($self, /) -- Get a read-write view over the contents of the BytesIO object. read($self, size=-1, /) -- Read at most size bytes, returned as a bytes object. If the size argument is negative, read until EOF is reached. Return an empty bytes object at EOF. readlines($self, size=None, /) -- List of bytes objects, each a line from the file. Call readline() repeatedly and return a list of the lines so read. The optional size argument, if given, is an approximate bound on the total number of bytes in the lines returned. readline($self, size=-1, /) -- Next line from the file, as a bytes object. Retain newline. A non-negative size argument limits the maximum number of bytes to return (an incomplete line may be returned then). Return an empty bytes object at EOF. readinto($self, buffer, /) -- Read bytes into buffer. Returns number of bytes read (0 for EOF), or None if the object is set not to block and has no data to read. read1($self, size=-1, /) -- Read at most size bytes, returned as a bytes object. If the size argument is negative or omitted, read until EOF is reached. Return an empty bytes object at EOF. writelines($self, lines, /) -- Write lines to the file. Note that newlines are not added. lines can be any iterable object producing bytes-like objects. This is equivalent to calling write() for each element. write($self, b, /) -- Write bytes to file. Return the number of bytes written. tell($self, /) -- Current file position, an integer. isatty($self, /) -- Always returns False. BytesIO objects are not connected to a TTY-like device. flush($self, /) -- Does nothing. close($self, /) -- Disable all I/O operations. writable($self, /) -- Returns True if the IO object can be written. seekable($self, /) -- Returns True if the IO object can be seeked. readable($self, /) -- Returns True if the IO object can be read. BytesIO(initial_bytes=b'') -- Buffered I/O implementation using an in-memory bytes buffer. FileIO(file, mode='r', closefd=True, opener=None) -- Open a file. The mode can be 'r' (default), 'w', 'x' or 'a' for reading, writing, exclusive creation or appending. The file will be created if it doesn't exist when opened for writing or appending; it will be truncated when opened for writing. A FileExistsError will be raised if it already exists when opened for creating. Opening a file for creating implies writing so this mode behaves in a similar way to 'w'.Add a '+' to the mode to allow simultaneous reading and writing. A custom opener can be used by passing a callable as *opener*. The underlying file descriptor for the file object is then obtained by calling opener with (*name*, *flags*). *opener* must return an open file descriptor (passing os.open as *opener* results in functionality similar to passing None). isatty($self, /) -- True if the file is connected to a TTY device. fileno($self, /) -- Return the underlying file descriptor (an integer). writable($self, /) -- True if file was opened in a write mode. readable($self, /) -- True if file was opened in a read mode. seekable($self, /) -- True if file supports random-access. close($self, /) -- Close the file. A closed file cannot be used for further I/O operations. close() may be called more than once without error. truncate($self, size=None, /) -- Truncate the file to at most size bytes and return the truncated size. Size defaults to the current file position, as returned by tell(). The current file position is changed to the value of size. tell($self, /) -- Current file position. Can raise OSError for non seekable files. seek($self, pos, whence=0, /) -- Move to new file position and return the file position. Argument offset is a byte count. Optional argument whence defaults to SEEK_SET or 0 (offset from start of file, offset should be >= 0); other values are SEEK_CUR or 1 (move relative to current position, positive or negative), and SEEK_END or 2 (move relative to end of file, usually negative, although many platforms allow seeking beyond the end of a file). Note that not all file objects are seekable. write($self, b, /) -- Write buffer b to file, return number of bytes written. Only makes one system call, so not all of the data may be written. The number of bytes actually written is returned. In non-blocking mode, returns None if the write would block. readinto($self, buffer, /) -- Same as RawIOBase.readinto(). readall($self, /) -- Read all data from the file, returned as bytes. In non-blocking mode, returns as much as is immediately available, or None if no data is available. Return an empty bytes object at EOF. read($self, size=-1, /) -- Read at most size bytes, returned as bytes. Only makes one system call, so less data may be returned than requested. In non-blocking mode, returns None if no data is available. Return an empty bytes object at EOF. writelines($self, lines, /) -- Write a list of lines to stream. Line separators are not added, so it is usual for each of the lines provided to have a line separator at the end. readlines($self, hint=-1, /) -- Return a list of lines from the stream. hint can be specified to control the number of lines read: no more lines will be read if the total size (in bytes/characters) of all lines so far exceeds hint. readline($self, size=-1, /) -- Read and return a line from the stream. If size is specified, at most size bytes will be read. The line terminator is always b'\n' for binary files; for text files, the newlines argument to open can be used to select the line terminator(s) recognized. isatty($self, /) -- Return whether this is an 'interactive' stream. Return False if it can't be determined. fileno($self, /) -- Returns underlying file descriptor if one exists. OSError is raised if the IO object does not use a file descriptor. writable($self, /) -- Return whether object was opened for writing. If False, write() will raise OSError. readable($self, /) -- Return whether object was opened for reading. If False, read() will raise OSError. seekable($self, /) -- Return whether object supports random access. If False, seek(), tell() and truncate() will raise OSError. This method may need to do a test seek(). close($self, /) -- Flush and close the IO object. This method has no effect if the file is already closed. flush($self, /) -- Flush write buffers, if applicable. This is not implemented for read-only and non-blocking streams. Truncate file to size bytes. File pointer is left unchanged. Size defaults to the current IO position as reported by tell(). Returns the new size. tell($self, /) -- Return current stream position. seek($self, offset, whence=os.SEEK_SET, /) -- Change the stream position to the given byte offset. offset The stream position, relative to 'whence'. whence The relative position to seek from. The offset is interpreted relative to the position indicated by whence. Values for whence are: * os.SEEK_SET or 0 -- start of stream (the default); offset should be zero or positive * os.SEEK_CUR or 1 -- current stream position; offset may be negative * os.SEEK_END or 2 -- end of stream; offset is usually negative Return the new absolute position. The abstract base class for all I/O classes. This class provides dummy implementations for many methods that derived classes can override selectively; the default implementations represent a file that cannot be read, written or seeked. Even though IOBase does not declare read, readinto, or write because their signatures will vary, implementations and clients should consider those methods part of the interface. Also, implementations may raise UnsupportedOperation when operations they do not support are called. The basic type used for binary data read from or written to a file is bytes. Other bytes-like objects are accepted as method arguments too. In some cases (such as readinto), a writable object is required. Text I/O classes work with str data. Note that calling any method (except additional calls to close(), which are ignored) on a closed stream should raise a ValueError. IOBase (and its subclasses) support the iterator protocol, meaning that an IOBase object can be iterated over yielding the lines in a stream. IOBase also supports the :keyword:`with` statement. In this example, fp is closed after the suite of the with statement is complete: with open('spam.txt', 'r') as fp: fp.write('Spam and eggs!') readall($self, /) -- Read until EOF, using multiple read() call. read($self, size=-1, /) -- Base class for raw binary I/O. open_code($module, /, path) -- Opens the provided file with the intent to import the contents. This may perform extra validation beyond open(), but is otherwise interchangeable with calling open(path, 'rb'). text_encoding($module, encoding, stacklevel=2, /) -- A helper function to choose the text encoding. When encoding is not None, this function returns it. Otherwise, this function returns the default text encoding (i.e. "locale" or "utf-8" depends on UTF-8 mode). This function emits an EncodingWarning if encoding is None and sys.flags.warn_default_encoding is true. This can be used in APIs with an encoding=None parameter. However, please consider using encoding="utf-8" for new APIs. open($module, /, file, mode='r', buffering=-1, encoding=None, errors=None, newline=None, closefd=True, opener=None) -- Open file and return a stream. Raise OSError upon failure. file is either a text or byte string giving the name (and the path if the file isn't in the current working directory) of the file to be opened or an integer file descriptor of the file to be wrapped. (If a file descriptor is given, it is closed when the returned I/O object is closed, unless closefd is set to False.) mode is an optional string that specifies the mode in which the file is opened. It defaults to 'r' which means open for reading in text mode. Other common values are 'w' for writing (truncating the file if it already exists), 'x' for creating and writing to a new file, and 'a' for appending (which on some Unix systems, means that all writes append to the end of the file regardless of the current seek position). In text mode, if encoding is not specified the encoding used is platform dependent: locale.getencoding() is called to get the current locale encoding. (For reading and writing raw bytes use binary mode and leave encoding unspecified.) The available modes are: ========= =============================================================== Character Meaning --------- --------------------------------------------------------------- 'r' open for reading (default) 'w' open for writing, truncating the file first 'x' create a new file and open it for writing 'a' open for writing, appending to the end of the file if it exists 'b' binary mode 't' text mode (default) '+' open a disk file for updating (reading and writing) ========= =============================================================== The default mode is 'rt' (open for reading text). For binary random access, the mode 'w+b' opens and truncates the file to 0 bytes, while 'r+b' opens the file without truncation. The 'x' mode implies 'w' and raises an `FileExistsError` if the file already exists. Python distinguishes between files opened in binary and text modes, even when the underlying operating system doesn't. Files opened in binary mode (appending 'b' to the mode argument) return contents as bytes objects without any decoding. In text mode (the default, or when 't' is appended to the mode argument), the contents of the file are returned as strings, the bytes having been first decoded using a platform-dependent encoding or using the specified encoding if given. buffering is an optional integer used to set the buffering policy. Pass 0 to switch buffering off (only allowed in binary mode), 1 to select line buffering (only usable in text mode), and an integer > 1 to indicate the size of a fixed-size chunk buffer. When no buffering argument is given, the default buffering policy works as follows: * Binary files are buffered in fixed-size chunks; the size of the buffer is chosen using a heuristic trying to determine the underlying device's "block size" and falling back on `io.DEFAULT_BUFFER_SIZE`. On many systems, the buffer will typically be 4096 or 8192 bytes long. * "Interactive" text files (files for which isatty() returns True) use line buffering. Other text files use the policy described above for binary files. encoding is the name of the encoding used to decode or encode the file. This should only be used in text mode. The default encoding is platform dependent, but any encoding supported by Python can be passed. See the codecs module for the list of supported encodings. errors is an optional string that specifies how encoding errors are to be handled---this argument should not be used in binary mode. Pass 'strict' to raise a ValueError exception if there is an encoding error (the default of None has the same effect), or pass 'ignore' to ignore errors. (Note that ignoring encoding errors can lead to data loss.) See the documentation for codecs.register or run 'help(codecs.Codec)' for a list of the permitted encoding error strings. newline controls how universal newlines works (it only applies to text mode). It can be None, '', '\n', '\r', and '\r\n'. It works as follows: * On input, if newline is None, universal newlines mode is enabled. Lines in the input can end in '\n', '\r', or '\r\n', and these are translated into '\n' before being returned to the caller. If it is '', universal newline mode is enabled, but line endings are returned to the caller untranslated. If it has any of the other legal values, input lines are only terminated by the given string, and the line ending is returned to the caller untranslated. * On output, if newline is None, any '\n' characters written are translated to the system default line separator, os.linesep. If newline is '' or '\n', no translation takes place. If newline is any of the other legal values, any '\n' characters written are translated to the given string. If closefd is False, the underlying file descriptor will be kept open when the file is closed. This does not work when a file name is given and must be True in that case. A custom opener can be used by passing a callable as *opener*. The underlying file descriptor for the file object is then obtained by calling *opener* with (*file*, *flags*). *opener* must return an open file descriptor (passing os.open as *opener* results in functionality similar to passing None). open() returns a file object whose type depends on the mode, and through which the standard file operations such as reading and writing are performed. When open() is used to open a file in a text mode ('w', 'r', 'wt', 'rt', etc.), it returns a TextIOWrapper. When used to open a file in a binary mode, the returned class varies: in read binary mode, it returns a BufferedReader; in write binary and append binary modes, it returns a BufferedWriter, and in read/write mode, it returns a BufferedRandom. It is also possible to use a string or bytearray as a file for both reading and writing. For strings StringIO can be used like a file opened in a text mode, and for bytes a BytesIO can be used like a file opened in a binary mode. The io module provides the Python interfaces to stream handling. The builtin open function is defined in this module. At the top of the I/O hierarchy is the abstract base class IOBase. It defines the basic interface to a stream. Note, however, that there is no separation between reading and writing to streams; implementations are allowed to raise an OSError if they do not support a given operation. Extending IOBase is RawIOBase which deals simply with the reading and writing of raw bytes to a stream. FileIO subclasses RawIOBase to provide an interface to OS files. BufferedIOBase deals with buffering on a raw byte stream (RawIOBase). Its subclasses, BufferedWriter, BufferedReader, and BufferedRWPair buffer streams that are readable, writable, and both respectively. BufferedRandom provides a buffered interface to random access streams. BytesIO is a simple stream of in-memory bytes. Another IOBase subclass, TextIOBase, deals with the encoding and decoding of streams into text. TextIOWrapper, which extends it, is a buffered text interface to a buffered raw stream (`BufferedIOBase`). Finally, StringIO is an in-memory stream for text. Argument names are not part of the specification, and only the arguments of open() are intended to be used as keyword arguments. data: DEFAULT_BUFFER_SIZE An int containing the default buffer size used by the module's buffered I/O classes. open() uses the file's blksize (as obtained by os.stat) if possible. This module makes available standard errno system symbols. The value of each symbol is the corresponding integer value, e.g., on most systems, errno.ENOENT equals the integer 2. The dictionary errno.errorcode maps numeric codes to symbol names, e.g., errno.errorcode[2] could be the string 'ENOENT'. Symbols that are not relevant to the underlying system are not defined. To map error codes to error messages, use the function os.strerror(), e.g. os.strerror(2) could return 'No such file or directory'. D.__sizeof__() -- size of D in memory, in bytes Rotate the deque n steps to the right (default n=1). If n is negative, rotates left. D.reverse() -- reverse *IN PLACE* D.__reversed__() -- return a reverse iterator over the deque D.remove(value) -- remove first occurrence of value. Remove and return the leftmost element. Remove and return the rightmost element. D.insert(index, object) -- insert object before index D.index(value, [start, [stop]]) -- return first index of value. Raises ValueError if the value is not present. Extend the left side of the deque with elements from the iterable Extend the right side of the deque with elements from the iterable D.count(value) -- return number of occurrences of value Return a shallow copy of a deque. Remove all elements from the deque. Add an element to the left side of the deque. Add an element to the right side of the deque. deque([iterable[, maxlen]]) --> deque object A list-like sequence optimized for data accesses near its endpoints. Private method returning an estimate of len(list(it)). Return state information for pickling. D.copy() -> a shallow copy of D. __missing__(key) # Called by __getitem__ for missing key; pseudo-code: if self.default_factory is None: raise KeyError((key,)) self[key] = value = self.default_factory() return value defaultdict(default_factory=None, /, [...]) --> dict with default factory The default factory is called without arguments to produce a new value when a key is not present, in __getitem__ only. A defaultdict compares equal to a dict with the same items. All remaining arguments are treated the same as if they were passed to the dict constructor, including keyword arguments. _count_elements($module, mapping, iterable, /) -- Count elements in the iterable, updating the mapping High performance data structures. - deque: ordered collection accessible from endpoints only - defaultdict: dict subclass with a default value factory lookup_error($module, name, /) -- lookup_error(errors) -> handler Return the error handler for the specified error handling name or raise a LookupError, if no handler exists under this name. register_error($module, errors, handler, /) -- Register the specified error handler under the name errors. handler must be a callable object, that will be called with an exception instance containing information about the location of the encoding/decoding error and must return a (replacement, new position) tuple. readbuffer_encode($module, data, errors=None, /) -- charmap_build($module, map, /) -- charmap_decode($module, data, errors=None, mapping=None, /) -- charmap_encode($module, str, errors=None, mapping=None, /) -- ascii_decode($module, data, errors=None, /) -- ascii_encode($module, str, errors=None, /) -- latin_1_decode($module, data, errors=None, /) -- latin_1_encode($module, str, errors=None, /) -- raw_unicode_escape_decode($module, data, errors=None, final=True, /) -- raw_unicode_escape_encode($module, str, errors=None, /) -- unicode_escape_decode($module, data, errors=None, final=True, /) -- unicode_escape_encode($module, str, errors=None, /) -- utf_32_ex_decode($module, data, errors=None, byteorder=0, final=False, /) -- utf_32_be_decode($module, data, errors=None, final=False, /) -- utf_32_le_decode($module, data, errors=None, final=False, /) -- utf_32_decode($module, data, errors=None, final=False, /) -- utf_32_be_encode($module, str, errors=None, /) -- utf_32_le_encode($module, str, errors=None, /) -- utf_32_encode($module, str, errors=None, byteorder=0, /) -- utf_16_ex_decode($module, data, errors=None, byteorder=0, final=False, /) -- utf_16_be_decode($module, data, errors=None, final=False, /) -- utf_16_le_decode($module, data, errors=None, final=False, /) -- utf_16_decode($module, data, errors=None, final=False, /) -- utf_16_be_encode($module, str, errors=None, /) -- utf_16_le_encode($module, str, errors=None, /) -- utf_16_encode($module, str, errors=None, byteorder=0, /) -- utf_7_decode($module, data, errors=None, final=False, /) -- utf_7_encode($module, str, errors=None, /) -- utf_8_decode($module, data, errors=None, final=False, /) -- utf_8_encode($module, str, errors=None, /) -- escape_decode($module, data, errors=None, /) -- escape_encode($module, data, errors=None, /) -- decode($module, /, obj, encoding='utf-8', errors='strict') -- Decodes obj using the codec registered for encoding. Default encoding is 'utf-8'. errors may be given to set a different error handling scheme. Default is 'strict' meaning that encoding errors raise a ValueError. Other possible values are 'ignore', 'replace' and 'backslashreplace' as well as any other name registered with codecs.register_error that can handle ValueErrors. encode($module, /, obj, encoding='utf-8', errors='strict') -- Encodes obj using the codec registered for encoding. The default encoding is 'utf-8'. errors may be given to set a different error handling scheme. Default is 'strict' meaning that encoding errors raise a ValueError. Other possible values are 'ignore', 'replace' and 'backslashreplace' as well as any other name registered with codecs.register_error that can handle ValueErrors. lookup($module, encoding, /) -- Looks up a codec tuple in the Python codec registry and returns a CodecInfo object. unregister($module, search_function, /) -- Unregister a codec search function and clear the registry's cache. If the search function is not registered, do nothing. register($module, search_function, /) -- Register a codec search function. Search functions are expected to take one argument, the encoding name in all lower case letters, and either return None, or a tuple of functions (encoder, decoder, stream_reader, stream_writer) (or a CodecInfo object). reset_peak($module, /) -- Set the peak size of memory blocks traced by tracemalloc to the current size. Do nothing if the tracemalloc module is not tracing memory allocations. get_traced_memory($module, /) -- Get the current size and peak size of memory blocks traced by tracemalloc. Returns a tuple: (current: int, peak: int). get_tracemalloc_memory($module, /) -- Get the memory usage in bytes of the tracemalloc module. This memory is used internally to trace memory allocations. get_traceback_limit($module, /) -- Get the maximum number of frames stored in the traceback of a trace. By default, a trace of an allocated memory block only stores the most recent frame: the limit is 1. stop($module, /) -- Stop tracing Python memory allocations. Also clear traces of memory blocks allocated by Python. start($module, nframe=1, /) -- Start tracing Python memory allocations. Also set the maximum number of frames stored in the traceback of a trace to nframe. _get_object_traceback($module, obj, /) -- Get the traceback where the Python object obj was allocated. Return a tuple of (filename: str, lineno: int) tuples. Return None if the tracemalloc module is disabled or did not trace the allocation of the object. _get_traces($module, /) -- Get traces of all memory blocks allocated by Python. Return a list of (size: int, traceback: tuple) tuples. traceback is a tuple of (filename: str, lineno: int) tuples. Return an empty list if the tracemalloc module is disabled. clear_traces($module, /) -- Clear traces of memory blocks allocated by Python. is_tracing($module, /) -- Return True if the tracemalloc module is tracing Python memory allocations. Debug module to trace memory blocks allocated by Python. tracemalloc_realloc struct_siginfo: Result from sigwaitinfo or sigtimedwait. This object may be accessed either as a tuple of (si_signo, si_code, si_errno, si_pid, si_uid, si_status, si_band), or via the attributes si_signo, si_code, and so on. valid_signals($module, /) -- Return a set of valid signal numbers on this platform. The signal numbers returned by this function can be safely passed to functions like `pthread_sigmask`. sigtimedwait($module, sigset, timeout, /) -- Like sigwaitinfo(), but with a timeout. The timeout is specified in seconds, with floating point numbers allowed. sigwaitinfo($module, sigset, /) -- Wait synchronously until one of the signals in *sigset* is delivered. Returns a struct_siginfo containing information about the signal. sigwait($module, sigset, /) -- Wait for a signal. Suspend execution of the calling thread until the delivery of one of the signals specified in the signal set sigset. The function accepts the signal and returns the signal number. sigpending($module, /) -- Examine pending signals. Returns a set of signal numbers that are pending for delivery to the calling thread. pthread_sigmask($module, how, mask, /) -- Fetch and/or change the signal mask of the calling thread. pthread_kill($module, thread_id, signalnum, /) -- Send a signal to a thread. pidfd_send_signal($module, pidfd, signalnum, siginfo=None, flags=0, /) -- Send a signal to a process referred to by a pid file descriptor. pause($module, /) -- Wait until a signal arrives. siginterrupt($module, signalnum, flag, /) -- Change system call restart behaviour. If flag is False, system calls will be restarted when interrupted by signal sig, else system calls will be interrupted. set_wakeup_fd(fd, *, warn_on_full_buffer=True) -> fd Sets the fd to be written to (with the signal number) when a signal comes in. A library can use this to wakeup select or poll. The previous fd or -1 is returned. The fd must be non-blocking. getsignal($module, signalnum, /) -- Return the current action for the given signal. The return value can be: SIG_IGN -- if the signal is being ignored SIG_DFL -- if the default action for the signal is in effect None -- if an unknown handler is in effect anything else -- the callable Python object used as a handler strsignal($module, signalnum, /) -- Return the system description of the given signal. Returns the description of signal *signalnum*, such as "Interrupt" for :const:`SIGINT`. Returns :const:`None` if *signalnum* has no description. Raises :exc:`ValueError` if *signalnum* is invalid. raise_signal($module, signalnum, /) -- Send a signal to the executing process. signal($module, signalnum, handler, /) -- Set the action for the given signal. The action can be SIG_DFL, SIG_IGN, or a callable Python object. The previous action is returned. See getsignal() for possible return values. *** IMPORTANT NOTICE *** A signal handler function is called with two arguments: the first is the signal number, the second is the interrupted stack frame. getitimer($module, which, /) -- Returns current value of given itimer. setitimer($module, which, seconds, interval=0.0, /) -- Sets given itimer (one of ITIMER_REAL, ITIMER_VIRTUAL or ITIMER_PROF). The timer will fire after value seconds and after that every interval seconds. The itimer can be cleared by setting seconds to zero. Returns old values as a tuple: (delay, interval). alarm($module, seconds, /) -- Arrange for SIGALRM to arrive after the given number of seconds. default_int_handler($module, signalnum, frame, /) -- The default handler for SIGINT installed by Python. It raises KeyboardInterrupt. This module provides mechanisms to use signal handlers in Python. Functions: alarm() -- cause SIGALRM after a specified time [Unix only] setitimer() -- cause a signal (described below) after a specified float time and the timer may restart then [Unix only] getitimer() -- get current value of timer [Unix only] signal() -- set the action for a given signal getsignal() -- get the signal action for a given signal pause() -- wait until a signal arrives [Unix only] default_int_handler() -- default SIGINT handler signal constants: SIG_DFL -- used to refer to the system default handler SIG_IGN -- used to ignore the signal NSIG -- number of defined signals SIGINT, SIGTERM, etc. -- signal numbers itimer constants: ITIMER_REAL -- decrements in real time, and delivers SIGALRM upon expiration ITIMER_VIRTUAL -- decrements only when the process is executing, and delivers SIGVTALRM upon expiration ITIMER_PROF -- decrements both when the process is executing and when the system is executing on behalf of the process. Coupled with ITIMER_VIRTUAL, this timer is usually used to profile the time spent by the application in user and kernel space. SIGPROF is delivered upon expiration. *** IMPORTANT NOTICE *** A signal handler function is called with two arguments: the first is the signal number, the second is the interrupted stack frame. _PyOS_InterruptOccurred stat_result: Result from stat, fstat, or lstat. This object may be accessed either as a tuple of (mode, ino, dev, nlink, uid, gid, size, atime, mtime, ctime) or via the attributes st_mode, st_ino, st_dev, st_nlink, st_uid, and so on. Posix/windows: If your platform supports st_blksize, st_blocks, st_rdev, or st_flags, they are available as attributes only. See os.stat for more information. statvfs_result: Result from statvfs or fstatvfs. This object may be accessed either as a tuple of (bsize, frsize, blocks, bfree, bavail, files, ffree, favail, flag, namemax), or via the attributes f_bsize, f_frsize, f_blocks, f_bfree, and so on. See os.statvfs for more information. waitid_result: Result from waitid. This object may be accessed either as a tuple of (si_pid, si_uid, si_signo, si_status, si_code), or via the attributes si_pid, si_uid, and so on. See os.waitid for more information. uname_result: Result from os.uname(). This object may be accessed either as a tuple of (sysname, nodename, release, version, machine), or via the attributes sysname, nodename, release, version, and machine. See os.uname for more information. sched_param(sched_priority) -- Currently has only one field: sched_priority sched_priority A scheduling parameter. times_result: Result from os.times(). This object may be accessed either as a tuple of (user, system, children_user, children_system, elapsed), or via the attributes user, system, children_user, children_system, and elapsed. See os.times for more information. A tuple of (columns, lines) for holding terminal window size __fspath__($self, /) -- Returns the path for the entry. inode($self, /) -- Return inode of the entry; cached per entry. stat($self, /, *, follow_symlinks=True) -- Return stat_result object for the entry; cached per entry. is_symlink($self, /) -- Return True if the entry is a symbolic link; cached per entry. is_file($self, /, *, follow_symlinks=True) -- Return True if the entry is a file; cached per entry. is_dir($self, /, *, follow_symlinks=True) -- Return True if the entry is a directory; cached per entry. waitstatus_to_exitcode($module, /, status) -- Convert a wait status to an exit code. On Unix: * If WIFEXITED(status) is true, return WEXITSTATUS(status). * If WIFSIGNALED(status) is true, return -WTERMSIG(status). * Otherwise, raise a ValueError. On Windows, return status shifted right by 8 bits. On Unix, if the process is being traced or if waitpid() was called with WUNTRACED option, the caller must first check if WIFSTOPPED(status) is true. This function must not be called if WIFSTOPPED(status) is true. eventfd_write($module, /, fd, value) -- Write eventfd value. eventfd_read($module, /, fd) -- Read eventfd value eventfd($module, /, initval, flags=EFD_CLOEXEC) -- Creates and returns an event notification file descriptor. memfd_create($module, /, name, flags=MFD_CLOEXEC) -- getrandom($module, /, size, flags=0) -- Obtain a series of random bytes. fspath($module, /, path) -- Return the file system path representation of the object. If the object is str or bytes, then allow it to pass through as-is. If the object defines __fspath__(), then return the result of that method. All other types raise a TypeError. scandir($module, /, path=None) -- Return an iterator of DirEntry objects for given path. path can be specified as either str, bytes, or a path-like object. If path is bytes, the names of yielded DirEntry objects will also be bytes; in all other circumstances they will be str. If path is None, uses the path='.'. set_blocking($module, fd, blocking, /) -- Set the blocking mode of the specified file descriptor. Set the O_NONBLOCK flag if blocking is False, clear the O_NONBLOCK flag otherwise. get_blocking($module, fd, /) -- Get the blocking mode of the file descriptor. Return False if the O_NONBLOCK flag is set, True if the flag is cleared. set_inheritable($module, fd, inheritable, /) -- Set the inheritable flag of the specified file descriptor. get_inheritable($module, fd, /) -- Get the close-on-exe flag of the specified file descriptor. cpu_count($module, /) -- Return the number of CPUs in the system; return None if indeterminable. This number is not equivalent to the number of CPUs the current process can use. The number of usable CPUs can be obtained with ``len(os.sched_getaffinity(0))`` get_terminal_size($module, fd=<unrepresentable>, /) -- Return the size of the terminal window as (columns, lines). The optional argument fd (default standard output) specifies which file descriptor should be queried. If the file descriptor is not connected to a terminal, an OSError is thrown. This function will only be defined if an implementation is available for this system. shutil.get_terminal_size is the high-level function which should normally be used, os.get_terminal_size is the low-level implementation. listxattr($module, /, path=None, *, follow_symlinks=True) -- Return a list of extended attributes on path. path may be either None, a string, a path-like object, or an open file descriptor. if path is None, listxattr will examine the current directory. If follow_symlinks is False, and the last element of the path is a symbolic link, listxattr will examine the symbolic link itself instead of the file the link points to. removexattr($module, /, path, attribute, *, follow_symlinks=True) -- Remove extended attribute attribute on path. path may be either a string, a path-like object, or an open file descriptor. If follow_symlinks is False, and the last element of the path is a symbolic link, removexattr will modify the symbolic link itself instead of the file the link points to. setxattr($module, /, path, attribute, value, flags=0, *, follow_symlinks=True) -- Set extended attribute attribute on path to value. path may be either a string, a path-like object, or an open file descriptor. If follow_symlinks is False, and the last element of the path is a symbolic link, setxattr will modify the symbolic link itself instead of the file the link points to. getxattr($module, /, path, attribute, *, follow_symlinks=True) -- Return the value of extended attribute attribute on path. path may be either a string, a path-like object, or an open file descriptor. If follow_symlinks is False, and the last element of the path is a symbolic link, getxattr will examine the symbolic link itself instead of the file the link points to. getresgid($module, /) -- Return a tuple of the current process's real, effective, and saved group ids. getresuid($module, /) -- Return a tuple of the current process's real, effective, and saved user ids. setresgid($module, rgid, egid, sgid, /) -- Set the current process's real, effective, and saved group ids. setresuid($module, ruid, euid, suid, /) -- Set the current process's real, effective, and saved user ids. urandom($module, size, /) -- Return a bytes object containing random bytes suitable for cryptographic use. getloadavg($module, /) -- Return average recent system load information. Return the number of processes in the system run queue averaged over the last 1, 5, and 15 minutes as a tuple of three floats. Raises OSError if the load average was unobtainable. _path_normpath($module, /, path) -- Basic path normalization. abort($module, /) -- Abort the interpreter immediately. This function 'dumps core' or otherwise fails in the hardest way possible on the hosting operating system. This function never returns. pathconf($module, /, path, name) -- Return the configuration limit name for the file or directory path. If there is no limit, return -1. On some platforms, path may also be specified as an open file descriptor. If this functionality is unavailable, using it raises an exception. fpathconf($module, fd, name, /) -- Return the configuration limit name for the file descriptor fd. If there is no limit, return -1. sysconf($module, name, /) -- Return an integer-valued system configuration variable. confstr($module, name, /) -- Return a string-valued system configuration variable. statvfs($module, /, path) -- Perform a statvfs system call on the given path. path may always be specified as a string. On some platforms, path may also be specified as an open file descriptor. If this functionality is unavailable, using it raises an exception. fstatvfs($module, fd, /) -- Perform an fstatvfs system call on the given fd. Equivalent to statvfs(fd). WSTOPSIG($module, /, status) -- Return the signal that stopped the process that provided the status value. WTERMSIG($module, /, status) -- Return the signal that terminated the process that provided the status value. WEXITSTATUS($module, /, status) -- Return the process return code from status. WIFEXITED($module, /, status) -- Return True if the process returning status exited via the exit() system call. WIFSIGNALED($module, /, status) -- Return True if the process returning status was terminated by a signal. WIFSTOPPED($module, /, status) -- Return True if the process returning status was stopped. WIFCONTINUED($module, /, status) -- Return True if a particular process was continued from a job control stop. Return True if the process returning status was continued from a job control stop. WCOREDUMP($module, status, /) -- Return True if the process returning status was dumped to a core file. fdatasync($module, /, fd) -- Force write of fd to disk without forcing update of metadata. sync($module, /) -- Force write of everything to disk. fsync($module, /, fd) -- Force write of fd to disk. fchdir($module, /, fd) -- Change to the directory of the given file descriptor. fd must be opened on a directory, not a file. Equivalent to os.chdir(fd). strerror($module, code, /) -- Translate an error code to a message string. unsetenv($module, name, /) -- Delete an environment variable. putenv($module, name, value, /) -- Change or add an environment variable. posix_fadvise($module, fd, offset, length, advice, /) -- Announce an intention to access data in a specific pattern. Announce an intention to access data in a specific pattern, thus allowing the kernel to make optimizations. The advice applies to the region of the file specified by fd starting at offset and continuing for length bytes. advice is one of POSIX_FADV_NORMAL, POSIX_FADV_SEQUENTIAL, POSIX_FADV_RANDOM, POSIX_FADV_NOREUSE, POSIX_FADV_WILLNEED, or POSIX_FADV_DONTNEED. posix_fallocate($module, fd, offset, length, /) -- Ensure a file has allocated at least a particular number of bytes on disk. Ensure that the file specified by fd encompasses a range of bytes starting at offset bytes from the beginning and continuing for length bytes. truncate($module, /, path, length) -- Truncate a file, specified by path, to a specific length. On some platforms, path may also be specified as an open file descriptor. If this functionality is unavailable, using it raises an exception. ftruncate($module, fd, length, /) -- Truncate a file, specified by file descriptor, to a specific length. makedev($module, major, minor, /) -- Composes a raw device number from the major and minor device numbers. minor($module, device, /) -- Extracts a device minor number from a raw device number. major($module, device, /) -- Extracts a device major number from a raw device number. mknod($module, /, path, mode=384, device=0, *, dir_fd=None) -- Create a node in the file system. Create a node in the file system (file, device special file or named pipe) at path. mode specifies both the permissions to use and the type of node to be created, being combined (bitwise OR) with one of S_IFREG, S_IFCHR, S_IFBLK, and S_IFIFO. If S_IFCHR or S_IFBLK is set on mode, device defines the newly created device special file (probably using os.makedev()). Otherwise device is ignored. If dir_fd is not None, it should be a file descriptor open to a directory, and path should be relative; path will then be relative to that directory. dir_fd may not be implemented on your platform. If it is unavailable, using it will raise a NotImplementedError. mkfifo($module, /, path, mode=438, *, dir_fd=None) -- Create a "fifo" (a POSIX named pipe). If dir_fd is not None, it should be a file descriptor open to a directory, and path should be relative; path will then be relative to that directory. dir_fd may not be implemented on your platform. If it is unavailable, using it will raise a NotImplementedError. pipe2($module, flags, /) -- Create a pipe with flags set atomically. Returns a tuple of two file descriptors: (read_fd, write_fd) flags can be constructed by ORing together one or more of these values: O_NONBLOCK, O_CLOEXEC. pipe($module, /) -- Create a pipe. Returns a tuple of two file descriptors: (read_fd, write_fd) isatty($module, fd, /) -- Return True if the fd is connected to a terminal. Return True if the file descriptor is an open file descriptor connected to the slave end of a terminal. fstat($module, /, fd) -- Perform a stat system call on the given file descriptor. Like stat(), but for an open file descriptor. Equivalent to os.stat(fd). sendfile($module, /, out_fd, in_fd, offset, count) -- Copy count bytes from file descriptor in_fd to file descriptor out_fd. pwritev($module, fd, buffers, offset, flags=0, /) -- Writes the contents of bytes-like objects to a file descriptor at a given offset. Combines the functionality of writev() and pwrite(). All buffers must be a sequence of bytes-like objects. Buffers are processed in array order. Entire contents of first buffer is written before proceeding to second, and so on. The operating system may set a limit (sysconf() value SC_IOV_MAX) on the number of buffers that can be used. This function writes the contents of each object to the file descriptor and returns the total number of bytes written. The flags argument contains a bitwise OR of zero or more of the following flags: - RWF_DSYNC - RWF_SYNC - RWF_APPEND Using non-zero flags requires Linux 4.7 or newer. pwrite($module, fd, buffer, offset, /) -- Write bytes to a file descriptor starting at a particular offset. Write buffer to fd, starting at offset bytes from the beginning of the file. Returns the number of bytes writte. Does not change the current file offset. writev($module, fd, buffers, /) -- Iterate over buffers, and write the contents of each to a file descriptor. Returns the total number of bytes written. buffers must be a sequence of bytes-like objects. write($module, fd, data, /) -- Write a bytes object to a file descriptor. preadv($module, fd, buffers, offset, flags=0, /) -- Reads from a file descriptor into a number of mutable bytes-like objects. Combines the functionality of readv() and pread(). As readv(), it will transfer data into each buffer until it is full and then move on to the next buffer in the sequence to hold the rest of the data. Its fourth argument, specifies the file offset at which the input operation is to be performed. It will return the total number of bytes read (which can be less than the total capacity of all the objects). The flags argument contains a bitwise OR of zero or more of the following flags: - RWF_HIPRI - RWF_NOWAIT Using non-zero flags requires Linux 4.6 or newer. pread($module, fd, length, offset, /) -- Read a number of bytes from a file descriptor starting at a particular offset. Read length bytes from file descriptor fd, starting at offset bytes from the beginning of the file. The file offset remains unchanged. readv($module, fd, buffers, /) -- Read from a file descriptor fd into an iterable of buffers. The buffers should be mutable buffers accepting bytes. readv will transfer data into each buffer until it is full and then move on to the next buffer in the sequence to hold the rest of the data. readv returns the total number of bytes read, which may be less than the total capacity of all the buffers. read($module, fd, length, /) -- Read from a file descriptor. Returns a bytes object. lseek($module, fd, position, whence, /) -- Set the position of a file descriptor. Return the new position. fd An open file descriptor, as returned by os.open(). position Position, interpreted relative to 'whence'. whence The relative position to seek from. Valid values are: - SEEK_SET: seek from the start of the file. - SEEK_CUR: seek from the current file position. - SEEK_END: seek from the end of the file. The return value is the number of bytes relative to the beginning of the file. lockf($module, fd, command, length, /) -- Apply, test or remove a POSIX lock on an open file descriptor. fd An open file descriptor. command One of F_LOCK, F_TLOCK, F_ULOCK or F_TEST. length The number of bytes to lock, starting at the current position. dup2($module, /, fd, fd2, inheritable=True) -- Duplicate file descriptor. dup($module, fd, /) -- Return a duplicate of a file descriptor. device_encoding($module, /, fd) -- Return a string describing the encoding of a terminal's file descriptor. The file descriptor must be attached to a terminal. If the device is not a terminal, return None. closerange($module, fd_low, fd_high, /) -- Closes all file descriptors in [fd_low, fd_high), ignoring errors. close($module, /, fd) -- Close a file descriptor. open($module, /, path, flags, mode=511, *, dir_fd=None) -- Open a file for low level IO. Returns a file descriptor (integer). If dir_fd is not None, it should be a file descriptor open to a directory, and path should be relative; path will then be relative to that directory. dir_fd may not be implemented on your platform. If it is unavailable, using it will raise a NotImplementedError. tcsetpgrp($module, fd, pgid, /) -- Set the process group associated with the terminal specified by fd. tcgetpgrp($module, fd, /) -- Return the process group associated with the terminal specified by fd. setpgid($module, pid, pgrp, /) -- Call the system call setpgid(pid, pgrp). setsid($module, /) -- Call the system call setsid(). getsid($module, pid, /) -- Call the system call getsid(pid) and return the result. pidfd_open($module, /, pid, flags=0) -- Return a file descriptor referring to the process *pid*. The descriptor can be used to perform process management without races and signals. waitpid($module, pid, options, /) -- Wait for completion of a given child process. Returns a tuple of information regarding the child process: (pid, status) The options argument is ignored on Windows. waitid($module, idtype, id, options, /) -- Returns the result of waiting for a process or processes. idtype Must be one of be P_PID, P_PGID or P_ALL. id The id to wait on. options Constructed from the ORing of one or more of WEXITED, WSTOPPED or WCONTINUED and additionally may be ORed with WNOHANG or WNOWAIT. Returns either waitid_result or None if WNOHANG is specified and there are no children in a waitable state. wait4($module, /, pid, options) -- Wait for completion of a specific child process. Returns a tuple of information about the child process: (pid, status, rusage) wait3($module, /, options) -- Wait for completion of a child process. Returns a tuple of information about the child process: (pid, status, rusage) wait($module, /) -- Wait for completion of a child process. Returns a tuple of information about the child process: (pid, status) setpgrp($module, /) -- Make the current process the leader of its process group. getpgid($module, /, pid) -- Call the system call getpgid(), and return the result. initgroups($module, username, gid, /) -- Initialize the group access list. Call the system initgroups() to initialize the group access list with all of the groups of which the specified username is a member, plus the specified group id. setgroups($module, groups, /) -- Set the groups of the current process to list. setregid($module, rgid, egid, /) -- Set the current process's real and effective group ids. setegid($module, egid, /) -- Set the current process's effective group id. setgid($module, gid, /) -- Set the current process's group id. setreuid($module, ruid, euid, /) -- Set the current process's real and effective user ids. seteuid($module, euid, /) -- Set the current process's effective user id. setuid($module, uid, /) -- Set the current process's user id. killpg($module, pgid, signal, /) -- Kill a process group with a signal. kill($module, pid, signal, /) -- Kill a process with a signal. getlogin($module, /) -- Return the actual login name. getuid($module, /) -- Return the current process's user id. getppid($module, /) -- Return the parent's process id. If the parent process has already exited, Windows machines will still return its id; others systems will return the id of the 'init' process (1). getpgrp($module, /) -- Return the current process group id. getpid($module, /) -- Return the current process id. getgroups($module, /) -- Return list of supplemental group IDs for the process. getgrouplist($module, user, group, /) -- Returns a list of groups to which a user belongs. user username to lookup group base group id of the user getgid($module, /) -- Return the current process's group id. geteuid($module, /) -- Return the current process's effective user id. getegid($module, /) -- Return the current process's effective group id. forkpty($module, /) -- Fork a new process with a new pseudo-terminal as controlling tty. Returns a tuple of (pid, master_fd). Like fork(), return pid of 0 to the child process, and pid of child to the parent process. To both, return fd of newly opened pseudo-terminal. login_tty($module, fd, /) -- Prepare the tty of which fd is a file descriptor for a new login session. Make the calling process a session leader; make the tty the controlling tty, the stdin, the stdout, and the stderr of the calling process; close fd. openpty($module, /) -- Open a pseudo-terminal. Return a tuple of (master_fd, slave_fd) containing open file descriptors for both the master and slave ends. sched_getaffinity($module, pid, /) -- Return the affinity of the process identified by pid (or the current process if zero). The affinity is returned as a set of CPU identifiers. sched_setaffinity($module, pid, mask, /) -- Set the CPU affinity of the process identified by pid to mask. mask should be an iterable of integers identifying CPUs. sched_yield($module, /) -- Voluntarily relinquish the CPU. sched_setscheduler($module, pid, policy, param, /) -- Set the scheduling policy for the process identified by pid. If pid is 0, the calling process is changed. param is an instance of sched_param. sched_setparam($module, pid, param, /) -- Set scheduling parameters for the process identified by pid. If pid is 0, sets parameters for the calling process. param should be an instance of sched_param. sched_rr_get_interval($module, pid, /) -- Return the round-robin quantum for the process identified by pid, in seconds. Value returned is a float. sched_getscheduler($module, pid, /) -- Get the scheduling policy for the process identified by pid. Passing 0 for pid returns the scheduling policy for the calling process. sched_getparam($module, pid, /) -- Returns scheduling parameters for the process identified by pid. If pid is 0, returns parameters for the calling process. Return value is an instance of sched_param. sched_get_priority_min($module, /, policy) -- Get the minimum scheduling priority for policy. sched_get_priority_max($module, /, policy) -- Get the maximum scheduling priority for policy. register_at_fork($module, /, *, before=<unrepresentable>, after_in_child=<unrepresentable>, after_in_parent=<unrepresentable>) -- Register callables to be called when forking a new process. before A callable to be called in the parent before the fork() syscall. after_in_child A callable to be called in the child after fork(). after_in_parent A callable to be called in the parent after fork(). 'before' callbacks are called in reverse order. 'after_in_child' and 'after_in_parent' callbacks are called in order. fork($module, /) -- Fork a child process. Return 0 to child process and PID of child to parent process. execve($module, /, path, argv, env) -- Execute an executable path with arguments, replacing current process. path Path of executable file. argv Tuple or list of strings. env Dictionary of strings mapping to strings. execv($module, path, argv, /) -- Execute an executable path with arguments, replacing current process. path Path of executable file. argv Tuple or list of strings. _exit($module, /, status) -- Exit to the system with specified status, without normal exit processing. times($module, /) -- Return a collection containing process timing information. The object returned behaves like a named tuple with these fields: (utime, stime, cutime, cstime, elapsed_time) All fields are floating point numbers. utime($module, /, path, times=None, *, ns=<unrepresentable>, dir_fd=None, follow_symlinks=True) -- Set the access and modified time of path. path may always be specified as a string. On some platforms, path may also be specified as an open file descriptor. If this functionality is unavailable, using it raises an exception. If times is not None, it must be a tuple (atime, mtime); atime and mtime should be expressed as float seconds since the epoch. If ns is specified, it must be a tuple (atime_ns, mtime_ns); atime_ns and mtime_ns should be expressed as integer nanoseconds since the epoch. If times is None and ns is unspecified, utime uses the current time. Specifying tuples for both times and ns is an error. If dir_fd is not None, it should be a file descriptor open to a directory, and path should be relative; path will then be relative to that directory. If follow_symlinks is False, and the last element of the path is a symbolic link, utime will modify the symbolic link itself instead of the file the link points to. It is an error to use dir_fd or follow_symlinks when specifying path as an open file descriptor. dir_fd and follow_symlinks may not be available on your platform. If they are unavailable, using them will raise a NotImplementedError. remove($module, /, path, *, dir_fd=None) -- Remove a file (same as unlink()). If dir_fd is not None, it should be a file descriptor open to a directory, and path should be relative; path will then be relative to that directory. dir_fd may not be implemented on your platform. If it is unavailable, using it will raise a NotImplementedError. unlink($module, /, path, *, dir_fd=None) -- Remove a file (same as remove()). If dir_fd is not None, it should be a file descriptor open to a directory, and path should be relative; path will then be relative to that directory. dir_fd may not be implemented on your platform. If it is unavailable, using it will raise a NotImplementedError. uname($module, /) -- Return an object identifying the current operating system. The object behaves like a named tuple with the following fields: (sysname, nodename, release, version, machine) umask($module, mask, /) -- Set the current numeric umask and return the previous umask. system($module, /, command) -- Execute the command in a subshell. symlink($module, /, src, dst, target_is_directory=False, *, dir_fd=None) -- Create a symbolic link pointing to src named dst. target_is_directory is required on Windows if the target is to be interpreted as a directory. (On Windows, symlink requires Windows 6.0 or greater, and raises a NotImplementedError otherwise.) target_is_directory is ignored on non-Windows platforms. If dir_fd is not None, it should be a file descriptor open to a directory, and path should be relative; path will then be relative to that directory. dir_fd may not be implemented on your platform. If it is unavailable, using it will raise a NotImplementedError. rmdir($module, /, path, *, dir_fd=None) -- Remove a directory. If dir_fd is not None, it should be a file descriptor open to a directory, and path should be relative; path will then be relative to that directory. dir_fd may not be implemented on your platform. If it is unavailable, using it will raise a NotImplementedError. replace($module, /, src, dst, *, src_dir_fd=None, dst_dir_fd=None) -- Rename a file or directory, overwriting the destination. If either src_dir_fd or dst_dir_fd is not None, it should be a file descriptor open to a directory, and the respective path string (src or dst) should be relative; the path will then be relative to that directory. src_dir_fd and dst_dir_fd, may not be implemented on your platform. If they are unavailable, using them will raise a NotImplementedError. rename($module, /, src, dst, *, src_dir_fd=None, dst_dir_fd=None) -- Rename a file or directory. If either src_dir_fd or dst_dir_fd is not None, it should be a file descriptor open to a directory, and the respective path string (src or dst) should be relative; the path will then be relative to that directory. src_dir_fd and dst_dir_fd, may not be implemented on your platform. If they are unavailable, using them will raise a NotImplementedError. splice($module, /, src, dst, count, offset_src=None, offset_dst=None, flags=0) -- Transfer count bytes from one pipe to a descriptor or vice versa. src Source file descriptor. dst Destination file descriptor. count Number of bytes to copy. offset_src Starting offset in src. offset_dst Starting offset in dst. flags Flags to modify the semantics of the call. If offset_src is None, then src is read from the current position; respectively for offset_dst. The offset associated to the file descriptor that refers to a pipe must be None. copy_file_range($module, /, src, dst, count, offset_src=None, offset_dst=None) -- Copy count bytes from one file descriptor to another. src Source file descriptor. dst Destination file descriptor. count Number of bytes to copy. offset_src Starting offset in src. offset_dst Starting offset in dst. If offset_src is None, then src is read from the current position; respectively for offset_dst. readlink($module, /, path, *, dir_fd=None) -- Return a string representing the path to which the symbolic link points. If dir_fd is not None, it should be a file descriptor open to a directory, and path should be relative; path will then be relative to that directory. dir_fd may not be implemented on your platform. If it is unavailable, using it will raise a NotImplementedError. posix_spawnp($module, path, argv, env, /, *, file_actions=(), setpgroup=<unrepresentable>, resetids=False, setsid=False, setsigmask=(), setsigdef=(), scheduler=<unrepresentable>) -- Execute the program specified by path in a new process. path Path of executable file. argv Tuple or list of strings. env Dictionary of strings mapping to strings. file_actions A sequence of file action tuples. setpgroup The pgroup to use with the POSIX_SPAWN_SETPGROUP flag. resetids If the value is `True` the POSIX_SPAWN_RESETIDS will be activated. setsid If the value is `True` the POSIX_SPAWN_SETSID or POSIX_SPAWN_SETSID_NP will be activated. setsigmask The sigmask to use with the POSIX_SPAWN_SETSIGMASK flag. setsigdef The sigmask to use with the POSIX_SPAWN_SETSIGDEF flag. scheduler A tuple with the scheduler policy (optional) and parameters. posix_spawn($module, path, argv, env, /, *, file_actions=(), setpgroup=<unrepresentable>, resetids=False, setsid=False, setsigmask=(), setsigdef=(), scheduler=<unrepresentable>) -- Execute the program specified by path in a new process. path Path of executable file. argv Tuple or list of strings. env Dictionary of strings mapping to strings. file_actions A sequence of file action tuples. setpgroup The pgroup to use with the POSIX_SPAWN_SETPGROUP flag. resetids If the value is `true` the POSIX_SPAWN_RESETIDS will be activated. setsid If the value is `true` the POSIX_SPAWN_SETSID or POSIX_SPAWN_SETSID_NP will be activated. setsigmask The sigmask to use with the POSIX_SPAWN_SETSIGMASK flag. setsigdef The sigmask to use with the POSIX_SPAWN_SETSIGDEF flag. scheduler A tuple with the scheduler policy (optional) and parameters. setpriority($module, /, which, who, priority) -- Set program scheduling priority. getpriority($module, /, which, who) -- Return program scheduling priority. nice($module, increment, /) -- Add increment to the priority of process and return the new priority. mkdir($module, /, path, mode=511, *, dir_fd=None) -- Create a directory. If dir_fd is not None, it should be a file descriptor open to a directory, and path should be relative; path will then be relative to that directory. dir_fd may not be implemented on your platform. If it is unavailable, using it will raise a NotImplementedError. The mode argument is ignored on Windows. Where it is used, the current umask value is first masked out. lstat($module, /, path, *, dir_fd=None) -- Perform a stat system call on the given path, without following symbolic links. Like stat(), but do not follow symbolic links. Equivalent to stat(path, follow_symlinks=False). listdir($module, /, path=None) -- Return a list containing the names of the files in the directory. path can be specified as either str, bytes, or a path-like object. If path is bytes, the filenames returned will also be bytes; in all other circumstances the filenames returned will be str. If path is None, uses the path='.'. On some platforms, path may also be specified as an open file descriptor;\ the file descriptor must refer to a directory. If this functionality is unavailable, using it raises NotImplementedError. The list is in arbitrary order. It does not include the special entries '.' and '..' even if they are present in the directory. link($module, /, src, dst, *, src_dir_fd=None, dst_dir_fd=None, follow_symlinks=True) -- Create a hard link to a file. If either src_dir_fd or dst_dir_fd is not None, it should be a file descriptor open to a directory, and the respective path string (src or dst) should be relative; the path will then be relative to that directory. If follow_symlinks is False, and the last element of src is a symbolic link, link will create a link to the symbolic link itself instead of the file the link points to. src_dir_fd, dst_dir_fd, and follow_symlinks may not be implemented on your platform. If they are unavailable, using them will raise a NotImplementedError. getcwdb($module, /) -- Return a bytes string representing the current working directory. getcwd($module, /) -- Return a unicode string representing the current working directory. ctermid($module, /) -- Return the name of the controlling terminal for this process. chroot($module, /, path) -- Change root directory to path. lchown($module, /, path, uid, gid) -- Change the owner and group id of path to the numeric uid and gid. This function will not follow symbolic links. Equivalent to os.chown(path, uid, gid, follow_symlinks=False). fchown($module, /, fd, uid, gid) -- Change the owner and group id of the file specified by file descriptor. Equivalent to os.chown(fd, uid, gid). chown($module, /, path, uid, gid, *, dir_fd=None, follow_symlinks=True) -- Change the owner and group id of path to the numeric uid and gid.\ path Path to be examined; can be string, bytes, a path-like object, or open-file-descriptor int. dir_fd If not None, it should be a file descriptor open to a directory, and path should be relative; path will then be relative to that directory. follow_symlinks If False, and the last element of the path is a symbolic link, stat will examine the symbolic link itself instead of the file the link points to. path may always be specified as a string. On some platforms, path may also be specified as an open file descriptor. If this functionality is unavailable, using it raises an exception. If dir_fd is not None, it should be a file descriptor open to a directory, and path should be relative; path will then be relative to that directory. If follow_symlinks is False, and the last element of the path is a symbolic link, chown will modify the symbolic link itself instead of the file the link points to. It is an error to use dir_fd or follow_symlinks when specifying path as an open file descriptor. dir_fd and follow_symlinks may not be implemented on your platform. If they are unavailable, using them will raise a NotImplementedError. fchmod($module, /, fd, mode) -- Change the access permissions of the file given by file descriptor fd. Equivalent to os.chmod(fd, mode). chmod($module, /, path, mode, *, dir_fd=None, follow_symlinks=True) -- Change the access permissions of a file. path Path to be modified. May always be specified as a str, bytes, or a path-like object. On some platforms, path may also be specified as an open file descriptor. If this functionality is unavailable, using it raises an exception. mode Operating-system mode bitfield. dir_fd If not None, it should be a file descriptor open to a directory, and path should be relative; path will then be relative to that directory. follow_symlinks If False, and the last element of the path is a symbolic link, chmod will modify the symbolic link itself instead of the file the link points to. It is an error to use dir_fd or follow_symlinks when specifying path as an open file descriptor. dir_fd and follow_symlinks may not be implemented on your platform. If they are unavailable, using them will raise a NotImplementedError. chdir($module, /, path) -- Change the current working directory to the specified path. path may always be specified as a string. On some platforms, path may also be specified as an open file descriptor. If this functionality is unavailable, using it raises an exception. ttyname($module, fd, /) -- Return the name of the terminal device connected to 'fd'. fd Integer file descriptor handle. access($module, /, path, mode, *, dir_fd=None, effective_ids=False, follow_symlinks=True) -- Use the real uid/gid to test for access to a path. path Path to be tested; can be string, bytes, or a path-like object. mode Operating-system mode bitfield. Can be F_OK to test existence, or the inclusive-OR of R_OK, W_OK, and X_OK. dir_fd If not None, it should be a file descriptor open to a directory, and path should be relative; path will then be relative to that directory. effective_ids If True, access will use the effective uid/gid instead of the real uid/gid. follow_symlinks If False, and the last element of the path is a symbolic link, access will examine the symbolic link itself instead of the file the link points to. dir_fd, effective_ids, and follow_symlinks may not be implemented on your platform. If they are unavailable, using them will raise a NotImplementedError. Note that most operations will use the effective uid/gid, therefore this routine can be used in a suid/sgid environment to test if the invoking user has the specified access to the path. stat($module, /, path, *, dir_fd=None, follow_symlinks=True) -- Perform a stat system call on the given path. path Path to be examined; can be string, bytes, a path-like object or open-file-descriptor int. dir_fd If not None, it should be a file descriptor open to a directory, and path should be a relative string; path will then be relative to that directory. follow_symlinks If False, and the last element of the path is a symbolic link, stat will examine the symbolic link itself instead of the file the link points to. dir_fd and follow_symlinks may not be implemented on your platform. If they are unavailable, using them will raise a NotImplementedError. It's an error to use dir_fd or follow_symlinks when specifying path as an open file descriptor. This module provides access to operating system functionality that is standardized by the C Standard and the POSIX standard (a thinly disguised Unix interface). Refer to the library manual and corresponding Unix manual entries for more information on calls. PyOS_AfterFork_Child PyOS_AfterFork_Parent faulthandler module. _PyFaulthandler_Init faulthandler_fatal_error_thread _ncallbacks() -> int Return the number of registered exit functions. _run_exitfuncs() -> None Run all registered exit functions. If a callback raises an exception, it is logged with sys.unraisablehook. unregister(func) -> None Unregister an exit function which was previously registered using atexit.register func - function to be unregistered _clear() -> None Clear the list of previously registered exit functions. register(func, *args, **kwargs) -> func Register a function to be executed upon normal program termination func - function to be called at exit args - optional arguments to pass to func kwargs - optional keyword arguments to pass to func func is returned to facilitate usage as a decorator. allow programmer to define multiple exit functions to be executed upon normal program termination. Two public functions, register and unregister, are defined. _PyAtExit_Init get_freeze_count($module, /) -- Return the number of objects in the permanent generation. unfreeze($module, /) -- Unfreeze all objects in the permanent generation. Put all objects in the permanent generation back into oldest generation. freeze($module, /) -- Freeze all current tracked objects and ignore them for future collections. This can be used before a POSIX fork() call to make the gc copy-on-write friendly. Note: collection before a POSIX fork() call may free pages for future allocation which can cause copy-on-write. get_referents(*objs) -> list Return the list of objects that are directly referred to by objs. get_referrers(*objs) -> list Return the list of objects that directly refer to any of objs. is_finalized($module, obj, /) -- Returns true if the object has been already finalized by the GC. is_tracked($module, obj, /) -- Returns true if the object is tracked by the garbage collector. Simple atomic objects will return false. get_stats($module, /) -- Return a list of dictionaries containing per-generation statistics. get_objects($module, /, generation=None) -- Return a list of objects tracked by the collector (excluding the list returned). generation Generation to extract the objects from. If generation is not None, return only the objects tracked by the collector that are in that generation. collect($module, /, generation=2) -- Run the garbage collector. With no arguments, run a full collection. The optional argument may be an integer specifying which generation to collect. A ValueError is raised if the generation number is invalid. The number of unreachable objects is returned. get_threshold($module, /) -- Return the current collection thresholds. set_threshold(threshold0, [threshold1, threshold2]) -> None Sets the collection thresholds. Setting threshold0 to zero disables collection. get_count($module, /) -- Return a three-tuple of the current collection counts. get_debug($module, /) -- Get the garbage collection debugging flags. set_debug($module, flags, /) -- Set the garbage collection debugging flags. flags An integer that can have the following bits turned on: DEBUG_STATS - Print statistics during collection. DEBUG_COLLECTABLE - Print collectable objects found. DEBUG_UNCOLLECTABLE - Print unreachable but uncollectable objects found. DEBUG_SAVEALL - Save objects to gc.garbage rather than freeing them. DEBUG_LEAK - Debug leaking programs (everything but STATS). Debugging information is written to sys.stderr. isenabled($module, /) -- Returns true if automatic garbage collection is enabled. disable($module, /) -- Disable automatic garbage collection. enable($module, /) -- Enable automatic garbage collection. This module provides access to the garbage collector for reference cycles. enable() -- Enable automatic garbage collection. disable() -- Disable automatic garbage collection. isenabled() -- Returns true if automatic collection is enabled. collect() -- Do a full collection right now. get_count() -- Return the current collection counts. get_stats() -- Return list of dictionaries containing per-generation stats. set_debug() -- Set debugging flags. get_debug() -- Get debugging flags. set_threshold() -- Set the collection thresholds. get_threshold() -- Return the current the collection thresholds. get_objects() -- Return a list of all objects tracked by the collector. is_tracked() -- Returns true if a given object is tracked. is_finalized() -- Returns true if a given object has been already finalized. get_referrers() -- Return the list of objects that refer to an object. get_referents() -- Return the list of objects that an object refers to. freeze() -- Freeze all tracked objects and ignore them for future collections. unfreeze() -- Unfreeze all objects in the permanent generation. get_freeze_count() -- Return the number of objects in the permanent generation. PyObject_GC_Track _PyGC_Init ؗҜ<3#I9=D2[%Cod(h 7yACnF?O8M2 0HwZ<sOu ? $@ Y@ @@ @ j@ .A cA חA eA _B vH7B mB @0B ļB 4&k C 7yAC W4vC NgmC =`XC@x DPKDMD } TracebackType(tb_next, tb_frame, tb_lasti, tb_lineno) -- Create a new traceback object. sys.thread_info A named tuple holding information about the thread implementation. asyncgen_hooks A named tuple providing information about asynchronous generators hooks. The attributes are read only. hash_info A named tuple providing parameters used for computing hashes. The attributes are read only. set_int_max_str_digits($module, /, maxdigits) -- Set the maximum string digits limit for non-binary int<->str conversions. get_int_max_str_digits($module, /) -- Return the maximum string digits limit for non-binary int<->str conversions. unraisablehook($module, unraisable, /) -- Handle an unraisable exception. The unraisable argument has the following attributes: * exc_type: Exception type. * exc_value: Exception value, can be None. * exc_traceback: Exception traceback, can be None. * err_msg: Error message, can be None. * object: Object causing the exception, can be None. get_asyncgen_hooks($module, /) -- Return the installed asynchronous generators hooks. This returns a namedtuple of the form (firstiter, finalizer). set_asyncgen_hooks([firstiter] [, finalizer]) Set a finalizer for async generators objects. get_coroutine_origin_tracking_depth($module, /) -- Check status of origin tracking for coroutine objects in this thread. set_coroutine_origin_tracking_depth($module, /, depth) -- Enable or disable origin tracking for coroutine objects in this thread. Coroutine objects will track 'depth' frames of traceback information about where they came from, available in their cr_origin attribute. Set a depth of 0 to disable. _debugmallocstats($module, /) -- Print summary info to stderr about the state of pymalloc's structures. In Py_DEBUG mode, also perform some expensive internal consistency checks. call_tracing($module, func, args, /) -- Call func(*args), while tracing is enabled. The tracing state is saved, and restored afterwards. This is intended to be called from a debugger from a checkpoint, to recursively debug some other code. gettrace($module, /) -- Return the global debug tracing function set with sys.settrace. See the debugger chapter in the library manual. settrace(function) Set the global debug tracing function. It will be called on each function call. See the debugger chapter in the library manual. setrecursionlimit($module, limit, /) -- Set the maximum depth of the Python interpreter stack to n. This limit prevents infinite recursion from causing an overflow of the C stack and crashing Python. The highest possible limit is platform- dependent. getprofile($module, /) -- Return the profiling function set with sys.setprofile. See the profiler chapter in the library manual. setprofile(function) Set the profiling function. It will be called on each function call and return. See the profiler chapter in the library manual. setdlopenflags($module, flags, /) -- Set the flags used by the interpreter for dlopen calls. This is used, for example, when the interpreter loads extension modules. Among other things, this will enable a lazy resolving of symbols when importing a module, if called as sys.setdlopenflags(0). To share symbols across extension modules, call as sys.setdlopenflags(os.RTLD_GLOBAL). Symbolic names for the flag modules can be found in the os module (RTLD_xxx constants, e.g. os.RTLD_LAZY). getswitchinterval($module, /) -- Return the current thread switch interval; see sys.setswitchinterval(). setswitchinterval($module, interval, /) -- Set the ideal thread switching delay inside the Python interpreter. The actual frequency of switching threads can be lower if the interpreter executes long sequences of uninterruptible code (this is implementation-specific and workload-dependent). The parameter must represent the desired switching delay in seconds A typical value is 0.005 (5 milliseconds). is_finalizing($module, /) -- Return True if Python is exiting. intern($module, string, /) -- ``Intern'' the given string. This enters the string in the (global) table of interned strings whose purpose is to speed up dictionary lookups. Return the string itself or the previously interned string object with the same value. _getframe($module, depth=0, /) -- Return a frame object from the call stack. If optional integer depth is given, return the frame object that many calls below the top of the stack. If that is deeper than the call stack, ValueError is raised. The default for depth is zero, returning the frame at the top of the call stack. This function should be used for internal and specialized purposes only. getsizeof(object [, default]) -> int Return the size of object in bytes. getrecursionlimit($module, /) -- Return the current value of the recursion limit. The recursion limit is the maximum depth of the Python interpreter stack. This limit prevents infinite recursion from causing an overflow of the C stack and crashing Python. getrefcount($module, object, /) -- Return the reference count of object. The count returned is generally one higher than you might expect, because it includes the (temporary) reference as an argument to getrefcount(). _getquickenedcount($module, /) -- getfilesystemencodeerrors($module, /) -- Return the error mode used Unicode to OS filename conversion. getfilesystemencoding($module, /) -- Return the encoding used to convert Unicode filenames to OS filenames. getallocatedblocks($module, /) -- Return the number of memory blocks currently allocated. getdlopenflags($module, /) -- Return the current value of the flags that are used for dlopen calls. The flag constants are defined in the os module. getdefaultencoding($module, /) -- Return the current default encoding used by the Unicode implementation. exit($module, status=None, /) -- Exit the interpreter by raising SystemExit(status). If the status is omitted or None, it defaults to zero (i.e., success). If the status is an integer, it will be used as the system exit status. If it is another kind of object, it will be printed and the system exit status will be one (i.e., failure). excepthook($module, exctype, value, traceback, /) -- Handle an exception by displaying it with a traceback on sys.stderr. exc_info($module, /) -- Return current exception information: (type, value, traceback). Return information about the most recent exception caught by an except clause in the current stack frame or in an older stack frame. exception($module, /) -- Return the current exception. Return the most recent exception caught by an except clause in the current stack frame or in an older stack frame, or None if no such exception exists. displayhook($module, object, /) -- Print an object to sys.stdout and also save it in builtins._ _current_exceptions($module, /) -- Return a dict mapping each thread's identifier to its current raised exception. This function should be used for specialized purposes only. _current_frames($module, /) -- Return a dict mapping each thread's thread id to its current stack frame. This function should be used for specialized purposes only. _clear_type_cache($module, /) -- Clear the internal type lookup cache. breakpointhook(*args, **kws) This hook function is called by built-in breakpoint(). audit(event, *args) Passes the event to any audit hooks that are attached. addaudithook($module, /, hook) -- Adds a new audit hook callback. sys.flags Flags provided through command line arguments or environment vars. sys.version_info Version information as a named tuple. This module provides access to some objects used or maintained by the interpreter and to functions that interact strongly with the interpreter. Dynamic objects: argv -- command line arguments; argv[0] is the script pathname if known path -- module search path; path[0] is the script directory, else '' modules -- dictionary of loaded modules displayhook -- called to show results in an interactive session excepthook -- called to handle any uncaught exception other than SystemExit To customize printing in an interactive session or to install a custom top-level exception handler, assign other functions to replace these. stdin -- standard input file object; used by input() stdout -- standard output file object; used by print() stderr -- standard error object; used for error messages By assigning other file objects (or objects that behave like files) to these, it is possible to redirect all of the interpreter's I/O. last_type -- type of last uncaught exception last_value -- value of last uncaught exception last_traceback -- traceback of last uncaught exception These three are only available in an interactive session after a traceback has been printed. Static objects: builtin_module_names -- tuple of module names built into this interpreter copyright -- copyright notice pertaining to this interpreter exec_prefix -- prefix used to find the machine-specific Python library executable -- absolute path of the executable binary of the Python interpreter float_info -- a named tuple with information about the float implementation. float_repr_style -- string indicating the style of repr() output for floats hash_info -- a named tuple with information about the hash algorithm. hexversion -- version information encoded as a single integer implementation -- Python implementation information. int_info -- a named tuple with information about the int implementation. maxsize -- the largest supported length of containers. maxunicode -- the value of the largest Unicode code point platform -- platform identifier prefix -- prefix used to find the Python library thread_info -- a named tuple with information about the thread implementation. version -- the version of this interpreter as a string version_info -- version information as a named tuple __stdin__ -- the original stdin; don't touch! __stdout__ -- the original stdout; don't touch! __stderr__ -- the original stderr; don't touch! __displayhook__ -- the original displayhook; don't touch! __excepthook__ -- the original excepthook; don't touch! Functions: displayhook() -- print an object to the screen, and save it in builtins._ excepthook() -- print an exception and its traceback to sys.stderr exception() -- return the current thread's active exception exc_info() -- return information about the current thread's active exception exit() -- exit the interpreter by raising SystemExit getdlopenflags() -- returns flags to be used for dlopen() calls getprofile() -- get the global profiling function getrefcount() -- return the reference count for an object (plus one :-) getrecursionlimit() -- return the max recursion depth for the interpreter getsizeof() -- return the size of an object in bytes gettrace() -- get the global debug tracing function setdlopenflags() -- set the flags to be used for dlopen() calls setprofile() -- set the global profiling function setrecursionlimit() -- set the max recursion depth for the interpreter settrace() -- set the global debug tracing function PySys_SetArgvEx PySys_SetPath _PySys_Create sys_audit _PySys_InitCore _PySys_SetPreliminaryStderr ' / 8 @ _Py_HashRandomization_Init During handling of the above exception, another exception occurred: The above exception was the direct cause of the following exception: PyGILState_Release PyGILState_Ensure _PyGILState_Reinit _PyThread_CurrentExceptions PyInterpreterState_Delete _PyInterpreterState_DeleteExceptMain PyThreadState_Get PyState_RemoveModule PyState_AddModule _PyThreadState_Init _PyRuntimeState_ReInitThreads _PyRuntimeState_Init _PyGILState_Init _PyThreadState_DeleteCurrent PyInterpreterState_Get _PyInterpreterState_Enable _PyThreadState_Delete _PyGILState_NoteThreadState _register_builtins_for_crossinterpreter_data init_threadstate tstate_delete_common init_interpreter Py_EndInterpreter Py_InitializeFromConfig _Py_PreInitializeFromPyArgv Python detected LC_CTYPE=C: LC_CTYPE coerced to %.20s (set another locale or PYTHONCOERCECLOCALE=0 to disable this locale coercion behavior). pyinit_main new_interpreter init_interp_main add_main_module init_set_builtins_open init_sys_streams init_importlib_external init_import_site pycore_interp_init pycore_init_builtins pycore_init_types pycore_create_interpreter pycore_init_runtime pyinit_core_reconfigure pyinit_main_reconfigure !"#$%&'()*+,-./0123456789:;<=>?@abcdefghijklmnopqrstuvwxyz[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`ABCDEFGHIJKLMNOPQRSTUVWXYZ{|}~_PyPreConfig_Write _PyPreConfig_Read preconfig_init_utf8_mode preconfig_init_allocator _PyArgv_AsWstrList _Py_SetProgramFullPath Py_SetProgramName Py_SetPythonHome Py_SetPath _PyPathConfig_UpdateGlobal UUUUUUUU?33333333*$I$I$ q q q E]tEUUUUUUU;;I$I$I8885P^Cy 0 0 0 袋. ,d! p= ףp= ؉؉ %^B{ $I$I$ =B!B |PuPuP q q @ ( loads($module, bytes, /) -- Convert the bytes-like object to a value. If no valid value is found, raise EOFError, ValueError or TypeError. Extra bytes in the input are ignored. dumps($module, value, version=version, /) -- Return the bytes object that would be written to a file by dump(value, file). value Must be a supported type. version Indicates the data format that dumps should use. Raise a ValueError exception if value has (or contains an object that has) an unsupported type. load($module, file, /) -- Read one value from the open file and return it. file Must be readable binary file. If no valid value is read (e.g. because the data has a different Python version's incompatible marshal format), raise EOFError, ValueError or TypeError. Note: If an object containing an unsupported type was marshalled with dump(), load() will substitute None for the unmarshallable type. dump($module, value, file, version=version, /) -- Write the value on the open file. value Must be a supported type. file Must be a writeable binary file. version Indicates the data format that dump should use. If the value has (or contains an object that has) an unsupported type, a ValueError exception is raised - but garbage data will also be written to the file. The object will not be properly read back by load(). This module contains functions that can read and write Python values in a binary format. The format is specific to Python, but independent of machine architecture issues. Not all Python object types are supported; in general, only objects whose value is independent from a particular invocation of Python can be written and read by this module. The following types are supported: None, integers, floating point numbers, strings, bytes, bytearrays, tuples, lists, sets, dictionaries, and code objects, where it should be understood that tuples, lists and dictionaries are only supported as long as the values contained therein are themselves supported; and recursive lists and dictionaries should not be written (they will cause infinite loops). Variables: version -- indicates the format that the module uses. Version 0 is the historical format, version 1 shares interned strings and version 2 uses a binary format for floating point numbers. Version 3 shares common object references (New in version 3.4). Functions: dump() -- write value to a file load() -- read value from a file dumps() -- marshal value as a bytes object loads() -- read value from a bytes-like object _PyConfig_Read PyConfig_SetWideStringList _PyConfig_Write _PyConfig_Copy config_init_stdio_encoding config_get_locale_encoding config_parse_cmdline PyConfig_SetString config_update_argv PyWideStringList_Insert core_read_precmdline _PyErr_SetFromPyStatus config_run_filename_abspath config_init_tracemalloc config_init_int_max_str_digits config_init_hash_seed The following implementation-specific options are available: -X dev : enable Python Development Mode; also PYTHONDEVMODE -X faulthandler: dump the Python traceback on fatal errors; also PYTHONFAULTHANDLER -X frozen_modules=[on|off]: whether to use frozen modules; the default is "on" for installed Python and "off" for a local build -X importtime: show how long each import takes; also PYTHONPROFILEIMPORTTIME -X int_max_str_digits=N: limit the size of int<->str conversions; 0 disables the limit; also PYTHONINTMAXSTRDIGITS -X no_debug_ranges: don't include extra location information in code objects; also PYTHONNODEBUGRANGES -X pycache_prefix=PATH: write .pyc files to a parallel tree instead of to the code tree; also PYTHONPYCACHEPREFIX -X showrefcount: output the total reference count and number of used memory blocks when the program finishes or after each statement in the interactive interpreter; only works on debug builds -X tracemalloc[=N]: trace Python memory allocations; N sets a traceback limit of N frames (default: 1); also PYTHONTRACEMALLOC=N -X utf8[=0|1]: enable (1) or disable (0) UTF-8 mode; also PYTHONUTF8 -X warn_default_encoding: enable opt-in EncodingWarning for 'encoding=None'; also PYTHONWARNDEFAULTENCODING Options (and corresponding environment variables): -b : issue warnings about converting bytes/bytearray to str and comparing bytes/bytearray with str or bytes with int. (-bb: issue errors) -B : don't write .pyc files on import; also PYTHONDONTWRITEBYTECODE=x -c cmd : program passed in as string (terminates option list) -d : turn on parser debugging output (for experts only, only works on debug builds); also PYTHONDEBUG=x -E : ignore PYTHON* environment variables (such as PYTHONPATH) -h : print this help message and exit (also -? or --help) -i : inspect interactively after running script; forces a prompt even if stdin does not appear to be a terminal; also PYTHONINSPECT=x -I : isolate Python from the user's environment (implies -E and -s) -m mod : run library module as a script (terminates option list) -O : remove assert and __debug__-dependent statements; add .opt-1 before .pyc extension; also PYTHONOPTIMIZE=x -OO : do -O changes and also discard docstrings; add .opt-2 before .pyc extension -P : don't prepend a potentially unsafe path to sys.path; also PYTHONSAFEPATH -q : don't print version and copyright messages on interactive startup -s : don't add user site directory to sys.path; also PYTHONNOUSERSITE=x -S : don't imply 'import site' on initialization -u : force the stdout and stderr streams to be unbuffered; this option has no effect on stdin; also PYTHONUNBUFFERED=x -v : verbose (trace import statements); also PYTHONVERBOSE=x can be supplied multiple times to increase verbosity -V : print the Python version number and exit (also --version) when given twice, print more information about the build -W arg : warning control; arg is action:message:category:module:lineno also PYTHONWARNINGS=arg -x : skip first line of source, allowing use of non-Unix forms of #!cmd -X opt : set implementation-specific option --check-hash-based-pycs always|default|never: control how Python invalidates hash-based .pyc files --help-env: print help about Python environment variables and exit --help-xoptions: print help about implementation-specific -X options and exit --help-all: print complete help information and exit Arguments: file : program read from script file - : program read from stdin (default; interactive mode if a tty) arg ...: arguments passed to program in sys.argv[1:] usage: %ls [option] ... [-c cmd | -m mod | file | -] [arg] ... Environment variables that change behavior: PYTHONSTARTUP : file executed on interactive startup (no default) PYTHONPATH : '%lc'-separated list of directories prefixed to the default module search path. The result is sys.path. PYTHONHOME : alternate <prefix> directory (or <prefix>%lc<exec_prefix>). The default module search path uses %s. PYTHONPLATLIBDIR: override sys.platlibdir PYTHONCASEOK : ignore case in 'import' statements (Windows) PYTHONIOENCODING: encoding[:errors] used for stdin/stdout/stderr PYTHONHASHSEED : if this variable is set to 'random', a random value is used to seed the hashes of str and bytes objects. It can also be set to an integer in the range [0,4294967295] to get hash values with a predictable seed. PYTHONMALLOC : set the Python memory allocators and/or install debug hooks on Python memory allocators. Use PYTHONMALLOC=debug to install debug hooks. PYTHONCOERCECLOCALE: if this variable is set to 0, it disables the locale coercion behavior. Use PYTHONCOERCECLOCALE=warn to request display of locale coercion and locale compatibility warnings on stderr. PYTHONBREAKPOINT: if this variable is set to 0, it disables the default debugger. It can be set to the callable of your debugger of choice. These variables have equivalent command-line options (see --help for details): PYTHONDEBUG : enable parser debug mode (-d) PYTHONDEVMODE : enable Python Development Mode (-X dev) PYTHONDONTWRITEBYTECODE: don't write .pyc files (-B) PYTHONFAULTHANDLER: dump the Python traceback on fatal errors (-X faulthandler) PYTHONINSPECT : inspect interactively after running script (-i) PYTHONINTMAXSTRDIGITS: limit the size of int<->str conversions; 0 disables the limit (-X int_max_str_digits=N) PYTHONNODEBUGRANGES: don't include extra location information in code objects (-X no_debug_ranges) PYTHONNOUSERSITE: disable user site directory (-s) PYTHONOPTIMIZE : enable level 1 optimizations (-O) PYTHONPROFILEIMPORTTIME: show how long each import takes (-X importtime) PYTHONPYCACHEPREFIX: root directory for bytecode cache (pyc) files (-X pycache_prefix) PYTHONSAFEPATH : don't prepend a potentially unsafe path to sys.path. PYTHONTRACEMALLOC: trace Python memory allocations (-X tracemalloc) PYTHONUNBUFFERED: disable stdout/stderr buffering (-u) PYTHONUTF8 : control the UTF-8 mode (-X utf8) PYTHONVERBOSE : trace import statements (-v) PYTHONWARNDEFAULTENCODING: enable opt-in EncodingWarning for 'encoding=None' (-X warn_default_encoding) PYTHONWARNINGS : warning control (-W) config_init_pycache_prefix config_set_bytes_string source_hash($module, /, key, source) -- _fix_co_filename($module, code, path, /) -- Changes code.co_filename to specify the passed-in file path. code Code object to change. path File path to use. exec_builtin($module, mod, /) -- Initialize a built-in module. exec_dynamic($module, mod, /) -- Initialize an extension module. create_dynamic($module, spec, file=<unrepresentable>, /) -- Create an extension module. _override_frozen_modules_for_tests($module, override, /) -- (internal-only) Override PyConfig.use_frozen_modules. (-1: "off", 1: "on", 0: no override) See frozen_modules() in Lib/test/support/import_helper.py. _frozen_module_names($module, /) -- Returns the list of available frozen modules. is_frozen($module, name, /) -- Returns True if the module name corresponds to a frozen module. is_builtin($module, name, /) -- Returns True if the module name corresponds to a built-in module. init_frozen($module, name, /) -- Initializes a frozen module. create_builtin($module, spec, /) -- Create an extension module. is_frozen_package($module, name, /) -- Returns True if the module name is of a frozen package. get_frozen_object($module, name, data=None, /) -- Create a code object for a frozen module. find_frozen($module, name, /, *, withdata=False) -- Return info about the corresponding frozen module (if there is one) or None. The returned info (a 2-tuple): * data the raw marshalled bytes * is_package whether or not it is a package * origname the originally frozen module's name, or None if not a stdlib module (this will usually be the same as the module's current name) release_lock($module, /) -- Release the interpreter's import lock. On platforms without threads, this function does nothing. acquire_lock($module, /) -- Acquires the interpreter's import lock for the current thread. This lock should be used by import hooks to ensure thread-safety when importing modules. On platforms without threads, this function does nothing. lock_held($module, /) -- Return True if the import lock is currently held, else False. On platforms without threads, return False. extension_suffixes($module, /) -- Returns the list of file suffixes used to identify extension modules. (Extremely) low-level import machinery bits as used by importlib and imp. _PyImportZip_Init PyImport_ExecCodeModuleWithPathnames _PyImport_ReInitLock PyImport_GetModuleDict Copyright (c) 2001-2023 Python Software Foundation. All Rights Reserved. Copyright (c) 2000 BeOpen.com. All Rights Reserved. Copyright (c) 1995-2001 Corporation for National Research Initiatives. All Rights Reserved. Copyright (c) 1991-1995 Stichting Mathematisch Centrum, Amsterdam. All Rights Reserved. vgetargs1_impl Py_FrozenMain UnraisableHookArgs Type used to pass arguments to sys.unraisablehook. _PyErr_WriteUnraisableMsg _PyErr_NormalizeException _PyErr_InitTypes _PyErr_NoMemory copy($self, /) -- Return a shallow copy of the context object. values($self, /) -- Return a list of all variables' values in the context object. keys($self, /) -- Return a list of all variables in the context object. items($self, /) -- Return all variables and their values in the context object. The result is returned as a list of 2-tuples (variable, value). get($self, key, default=None, /) -- Return the value for `key` if `key` has the value in the context object. If `key` does not exist, return `default`. If `default` is not given, return None. reset($self, token, /) -- Reset the context variable. The variable is reset to the value it had before the `ContextVar.set()` that created the token was used. set($self, value, /) -- Call to set a new value for the context variable in the current context. The required value argument is the new value for the context variable. Returns a Token object that can be used to restore the variable to its previous value via the `ContextVar.reset()` method. get($self, default=<unrepresentable>, /) -- Return a value for the context variable for the current context. If there is no value for the variable in the current context, the method will: * return the value of the default argument of the method, if provided; or * return the default value for the context variable, if it was created with one; or * raise a LookupError. _PyContext_Init zzzzzz zzzkkkk !#$%jjjjjd||tt123456t<=DEFGJKRSTUVWXYZ[\]^_`abcdefghijklmnoprstuvwxz{|}~____}}<<<\\\\ < = C C _PyEval_EvalFrameDefault _Py_CheckRecursiveCall _PyEval_ReInitThreads PyEval_AcquireLock PyEval_RestoreThread PyEval_SaveThread PyEval_ReleaseThread PyEval_AcquireThread eval_frame_handle_pending destroy_gil take_gil drop_gil create_gil filter(function or None, iterable) --> filter object Return an iterator yielding those items of iterable for which function(item) is true. If function is None, return the items that are true. map(func, *iterables) --> map object Make an iterator that computes the function using arguments from each of the iterables. Stops when the shortest iterable is exhausted. Set state information for unpickling. Return state information for pickling. zip(*iterables, strict=False) --> Yield tuples until an input is exhausted. >>> list(zip('abcdefg', range(3), range(4))) [('a', 0, 0), ('b', 1, 1), ('c', 2, 2)] The zip object yields n-length tuples, where n is the number of iterables passed as positional arguments to zip(). The i-th element in every tuple comes from the i-th iterable argument to zip(). This continues until the shortest argument is exhausted. If strict is true and one of the arguments is exhausted before the others, raise a ValueError. vars([object]) -> dictionary Without arguments, equivalent to locals(). With an argument, equivalent to object.__dict__. sum($module, iterable, /, start=0) -- Return the sum of a 'start' value (default: 0) plus an iterable of numbers When the iterable is empty, return the start value. This function is intended specifically for use with numeric values and may reject non-numeric types. sorted($module, iterable, /, *, key=None, reverse=False) -- Return a new list containing all items from the iterable in ascending order. A custom key function can be supplied to customize the sort order, and the reverse flag can be set to request the result in descending order. setattr($module, obj, name, value, /) -- Sets the named attribute on the given object to the specified value. setattr(x, 'y', v) is equivalent to ``x.y = v`` round($module, /, number, ndigits=None) -- Round a number to a given precision in decimal digits. The return value is an integer if ndigits is omitted or None. Otherwise the return value has the same type as the number. ndigits may be negative. repr($module, obj, /) -- Return the canonical string representation of the object. For many object types, including most builtins, eval(repr(obj)) == obj. print($module, /, *args, sep=' ', end='\n', file=None, flush=False) -- Prints the values to a stream, or to sys.stdout by default. sep string inserted between values, default a space. end string appended after the last value, default a newline. file a file-like object (stream); defaults to the current sys.stdout. flush whether to forcibly flush the stream. pow($module, /, base, exp, mod=None) -- Equivalent to base**exp with 2 arguments or base**exp % mod with 3 arguments Some types, such as ints, are able to use a more efficient algorithm when invoked using the three argument form. ord($module, c, /) -- Return the Unicode code point for a one-character string. oct($module, number, /) -- Return the octal representation of an integer. >>> oct(342391) '0o1234567' anext($module, aiterator, default=<unrepresentable>, /) -- async anext(aiterator[, default]) Return the next item from the async iterator. If default is given and the async iterator is exhausted, it is returned instead of raising StopAsyncIteration. next(iterator[, default]) Return the next item from the iterator. If default is given and the iterator is exhausted, it is returned instead of raising StopIteration. min(iterable, *[, default=obj, key=func]) -> value min(arg1, arg2, *args, *[, key=func]) -> value With a single iterable argument, return its smallest item. The default keyword-only argument specifies an object to return if the provided iterable is empty. With two or more arguments, return the smallest argument. max(iterable, *[, default=obj, key=func]) -> value max(arg1, arg2, *args, *[, key=func]) -> value With a single iterable argument, return its biggest item. The default keyword-only argument specifies an object to return if the provided iterable is empty. With two or more arguments, return the largest argument. locals($module, /) -- Return a dictionary containing the current scope's local variables. NOTE: Whether or not updates to this dictionary will affect name lookups in the local scope and vice-versa is *implementation dependent* and not covered by any backwards compatibility guarantees. len($module, obj, /) -- Return the number of items in a container. aiter($module, async_iterable, /) -- Return an AsyncIterator for an AsyncIterable object. iter(iterable) -> iterator iter(callable, sentinel) -> iterator Get an iterator from an object. In the first form, the argument must supply its own iterator, or be a sequence. In the second form, the callable is called until it returns the sentinel. issubclass($module, cls, class_or_tuple, /) -- Return whether 'cls' is derived from another class or is the same class. A tuple, as in ``issubclass(x, (A, B, ...))``, may be given as the target to check against. This is equivalent to ``issubclass(x, A) or issubclass(x, B) or ...``. isinstance($module, obj, class_or_tuple, /) -- Return whether an object is an instance of a class or of a subclass thereof. A tuple, as in ``isinstance(x, (A, B, ...))``, may be given as the target to check against. This is equivalent to ``isinstance(x, A) or isinstance(x, B) or ...`` etc. input($module, prompt='', /) -- Read a string from standard input. The trailing newline is stripped. The prompt string, if given, is printed to standard output without a trailing newline before reading input. If the user hits EOF (*nix: Ctrl-D, Windows: Ctrl-Z+Return), raise EOFError. On *nix systems, readline is used if available. id($module, obj, /) -- Return the identity of an object. This is guaranteed to be unique among simultaneously existing objects. (CPython uses the object's memory address.) hex($module, number, /) -- Return the hexadecimal representation of an integer. >>> hex(12648430) '0xc0ffee' hash($module, obj, /) -- Return the hash value for the given object. Two objects that compare equal must also have the same hash value, but the reverse is not necessarily true. hasattr($module, obj, name, /) -- Return whether the object has an attribute with the given name. This is done by calling getattr(obj, name) and catching AttributeError. globals($module, /) -- Return the dictionary containing the current scope's global variables. NOTE: Updates to this dictionary *will* affect name lookups in the current global scope and vice-versa. getattr(object, name[, default]) -> value Get a named attribute from an object; getattr(x, 'y') is equivalent to x.y. When a default argument is given, it is returned when the attribute doesn't exist; without it, an exception is raised in that case. format($module, value, format_spec='', /) -- Return value.__format__(format_spec) format_spec defaults to the empty string. See the Format Specification Mini-Language section of help('FORMATTING') for details. exec($module, source, globals=None, locals=None, /, *, closure=None) -- Execute the given source in the context of globals and locals. The source may be a string representing one or more Python statements or a code object as returned by compile(). The globals must be a dictionary and locals can be any mapping, defaulting to the current globals and locals. If only globals is given, locals defaults to it. The closure must be a tuple of cellvars, and can only be used when source is a code object requiring exactly that many cellvars. eval($module, source, globals=None, locals=None, /) -- Evaluate the given source in the context of globals and locals. The source may be a string representing a Python expression or a code object as returned by compile(). The globals must be a dictionary and locals can be any mapping, defaulting to the current globals and locals. If only globals is given, locals defaults to it. divmod($module, x, y, /) -- Return the tuple (x//y, x%y). Invariant: div*y + mod == x. dir([object]) -> list of strings If called without an argument, return the names in the current scope. Else, return an alphabetized list of names comprising (some of) the attributes of the given object, and of attributes reachable from it. If the object supplies a method named __dir__, it will be used; otherwise the default dir() logic is used and returns: for a module object: the module's attributes. for a class object: its attributes, and recursively the attributes of its bases. for any other object: its attributes, its class's attributes, and recursively the attributes of its class's base classes. delattr($module, obj, name, /) -- Deletes the named attribute from the given object. delattr(x, 'y') is equivalent to ``del x.y`` compile($module, /, source, filename, mode, flags=0, dont_inherit=False, optimize=-1, *, _feature_version=-1) -- Compile source into a code object that can be executed by exec() or eval(). The source code may represent a Python module, statement or expression. The filename will be used for run-time error messages. The mode must be 'exec' to compile a module, 'single' to compile a single (interactive) statement, or 'eval' to compile an expression. The flags argument, if present, controls which future statements influence the compilation of the code. The dont_inherit argument, if true, stops the compilation inheriting the effects of any future statements in effect in the code calling compile; if absent or false these statements do influence the compilation, in addition to any features explicitly specified. chr($module, i, /) -- Return a Unicode string of one character with ordinal i; 0 <= i <= 0x10ffff. callable($module, obj, /) -- Return whether the object is callable (i.e., some kind of function). Note that classes are callable, as are instances of classes with a __call__() method. breakpoint(*args, **kws) Call sys.breakpointhook(*args, **kws). sys.breakpointhook() must accept whatever arguments are passed. By default, this drops you into the pdb debugger. bin($module, number, /) -- Return the binary representation of an integer. >>> bin(2796202) '0b1010101010101010101010' ascii($module, obj, /) -- Return an ASCII-only representation of an object. As repr(), return a string containing a printable representation of an object, but escape the non-ASCII characters in the string returned by repr() using \\x, \\u or \\U escapes. This generates a string similar to that returned by repr() in Python 2. any($module, iterable, /) -- Return True if bool(x) is True for any x in the iterable. If the iterable is empty, return False. all($module, iterable, /) -- Return True if bool(x) is True for all values x in the iterable. If the iterable is empty, return True. abs($module, x, /) -- Return the absolute value of the argument. __import__($module, /, name, globals=None, locals=None, fromlist=(), level=0) -- Import a module. Because this function is meant for use by the Python interpreter and not for general use, it is better to use importlib.import_module() to programmatically import a module. The globals argument is only used to determine the context; they are not modified. The locals argument is unused. The fromlist should be a list of names to emulate ``from name import ...``, or an empty list to emulate ``import name``. When importing a module from a package, note that __import__('A.B', ...) returns package A when fromlist is empty, but its submodule B when fromlist is not empty. The level argument is used to determine whether to perform absolute or relative imports: 0 is absolute, while a positive number is the number of parent directories to search relative to the current module. __build_class__(func, name, /, *bases, [metaclass], **kwds) -> class Internal helper function used by the class statement. Built-in functions, types, exceptions, and other objects. This module provides direct access to all 'built-in' identifiers of Python; for example, builtins.len is the full name for the built-in function len(). This module is not normally accessed explicitly by most applications, but can be useful in modules that provide objects with the same name as a built-in value, but in which the built-in of that name is also needed. Low-level interface to warnings functionality. warn($module, /, message, category=None, stacklevel=1, source=None) -- Issue a warning, or maybe ignore it or raise an exception. _warnings provides basic warning filtering support. It is a helper module to speed up interpreter start-up. s s S S S s i 0 I n N s S j J E e 5 R 5 p q r s t u v w x y z { | } ~ 2 4 > A ! B " B " J * c b K J h 1 H 1 t T w W y Y a A a ` s s P R T V B B ( ! ) " * # + $ , % - & . ' / ( ! ) " * # + $ , % - & . ' / ` h a i b j c k d l e m f n g o ` h a i b j c k d l e m f n g o p E E B B B B B E t E E B B B B B E B B B B B B B B | E E B B B B B E p q r s t u v w x y z { | } ~ f f F F F f f i F I F i f l F L F l f f i F F I F f i f f l F F L F f l s t S T S t s t S T S t t v D F D v t e D 5 D e t k D ; D k ~ v N F N v t m D = D m 0 ' ' ' g gy y ' ' ' g ' g ' g ' ' ' ' O ' ' ' 'a a ' ' ' ' ' ' ' ' ' ' 8 8 ' ' A' ' ' g ' ' ~ ' +* ' ] ' (* '?* ?* ' = ' E ' G ' * * ' * * ' * * '. . '2 2 '3 3 '6 6 '5 5 'O O 'K K '1 1 '( ( 'D D '/ / '- - ') ) 'A A ') ) '+ + '* * ') ) '& & 'C C '* * ' '' ' ' '% % ' ' ' 7 v 4 t ' & ' % ' @ ' ? '! 0! g ' '( $ 0( g- + - g ' ' '0 . 0 g3 1 3 g '6 4 6 g9 7 9 g '< : < g? = ? g ' ' 'B @ B g ' P ' ' ' ' 0 ' 'F C H g ` ' ' L J L gO M O gR P R gU S U gX V X g[ Y [ g^ \ ^ ga _ a gd b d gg e g gj h j gm k m gp n p gs q s gv t v gy w y g| z | g } g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g! ! g$ "$ g' %' g* (* g- +- g0 .0 g3 13 g6 46 g9 79 g< :< g? =? gB @B gE CE gH FH gK IK gN LN gQ OQ gT RT gW UW gZ XZ g] [] g ` ^` gc ac gf df gi gi gl jl go mo gr pr gu su gx vx g @ ' ' '8 8 '| y | g ~ g g g g g g ' ' g 0 g 0 g 0 gJ J 'V V 'd d ' 'p p '~ ~ ' g g g g g g g g Ag Ag Ag Ag Ag Ag Ag Ag g g" $ g( % * g. + 0 g4 1 6 g: 7 < g@ = B gF C H AgL I N AgR O T AgX U Z Ag^ [ ` Agd a f Agj g l Agp m r Agv s x g| y ~ g g g g g g g Ag Ag Ag Ag Ag Ag Ag Ag g g g g 0 g ' Ag g g g g g 0 g '% " ' Ag, (0, g3 /03 g9 6 9 g? ;0? g 'F B0F gM I0M gS P S gX U X g^ Z0^ g 'd a f gk h m gq n s gx u x g~ z0 g ' ' Ag ' A ' ' ' ' / / $ $ ' ' ' ' ' ' ' ' ' ' ' u ' Z '0 0 ' Z ' Z ' Z ' Z ' Z ' Z ' Z ' ' ' Z ' u '` ` ' g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g" " g% #% g( &( g+ )+ g. ,. g1 /1 g4 24 g7 57 g: 8: g= ;= g@ >@ gC AC gF DF gI GI gL JL gO MO gR PR gU SU gX VX g[ Y[ g^ \^ ga _a gd bd gg eg gj hj gm km gp np gs qs gv tv gy wy g} z g g g 0 g 0 g g g g g g g g ( ' ' ' ' ' " ' ' $ ! " # $ % & ' ( ( ) * + ( , - . / 0 . 1 2 3 4 4 4 5 5 6 7 8 7 7 7 7 9 : ; 9 : ; 9 : ; < = 9 : ; > ? @ A B C D D E F G H I J K L M M N O P M Q R S T U V T W X V Y Z [ \ ] ^ ] _ ] ` a a b c 7 d e f f f f f f f f f g g g g g g g f f g g g g g g g g g g g g f f f f f g g h g i 2 2 2 j k l l l m n n o p q q q r s t u u v w x y y y z { | } ~ @ @ @ g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g g g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g g g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g g g g g g 7 7 7 7 7 7 7 7 7 7 7 7 7 f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f !"#$%&'()*+,-./0123456789:;<=>?@ABCD EFG HI JJK L MNO PQRRRRS TU VW XX YZ[ \] ^^ _`a bcddeef gf hijklm f g hijklm f f f f f f f f f f f f f y y y y y y y y y ny y y y y y o y pqy y n y y ry 7 7 7 7 y y y s ttttttttttttttttuuuuuuuuuuuuuuuu hijklm hijklm hijklm vvvvvvvvvvvvvvvvvvvvvvvvvvwwwwwwwwwwwwwwwwwwwwwwwwwwg hijklm g hijklm hijklm hijklm xyz{| }~ f f 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 g g g g g g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g g g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g g g g g g 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g f f 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g g g g g g g g g f g 7 g g g 7 f f 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 g g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 f f f f g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 f g g f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f f 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 h 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 hijklm 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 hijklm 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g g g g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g g g g g g g g g g g g g g g g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g g g g g g g g g g g g g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g g g g g g g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 g 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 gg hijklm 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 ! " " # $ % & ' " " " ( ) * + , - . / 0 1 2 3 4 5 6 7 8 9 : ; < = > ? @ @ @ @ A B @ @ @ @ C D @ @ @ @ @ @ E F G H I J K L @ M N O P Q R S @ @ T U " " " " " " V " " " " " W " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " X Y Z [ " " " \ " " " ] ^ " " " " " _ " " " ` " " " " " " " " " " a b c " " " " " " d e " " " " " " " " f " " " " " " " " " " " " " " g " " " " " " " " h " " " " d " " " " " " " " " " " " " " " " " " " " g " " " " " " i " " " " " " " " " " " " " " " " j k " " " " " " " " " " " " " " " " " l m " " " " " " " " " " " " " " " " " " n " " " " " " " " o " " p q r s t u v w x y z { " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " | } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } ~ " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " @ @ @ @ @ " @ @ @ @ @ @ @ @ @ " " " " " " " " " " " " " " " V " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } } size($self, /) -- Return the size (in bytes) of this object. __sizeof__($self, /) -- Return the size of the string in memory, in bytes. maketrans(x, y=<unrepresentable>, z=<unrepresentable>, /) -- Return a translation table usable for str.translate(). If there is only one argument, it must be a dictionary mapping Unicode ordinals (integers) or characters to Unicode ordinals, strings or None. Character keys will be then converted to ordinals. If there are two arguments, they must be strings of equal length, and in the resulting dictionary, each character in x will be mapped to the character at the same position in y. If there is a third argument, it must be a string, whose characters will be mapped to None in the result. __format__($self, format_spec, /) -- Return a formatted version of the string as described by format_spec. S.format_map(mapping) -> str Return a formatted version of S, using substitutions from mapping. The substitutions are identified by braces ('{' and '}'). S.format(*args, **kwargs) -> str Return a formatted version of S, using substitutions from args and kwargs. The substitutions are identified by braces ('{' and '}'). zfill($self, width, /) -- Pad a numeric string with zeros on the left, to fill a field of the given width. The string is never truncated. isprintable($self, /) -- Return True if the string is printable, False otherwise. A string is printable if all of its characters are considered printable in repr() or if it is empty. isidentifier($self, /) -- Return True if the string is a valid Python identifier, False otherwise. Call keyword.iskeyword(s) to test whether string s is a reserved identifier, such as "def" or "class". isalnum($self, /) -- Return True if the string is an alpha-numeric string, False otherwise. A string is alpha-numeric if all characters in the string are alpha-numeric and there is at least one character in the string. isalpha($self, /) -- Return True if the string is an alphabetic string, False otherwise. A string is alphabetic if all characters in the string are alphabetic and there is at least one character in the string. isnumeric($self, /) -- Return True if the string is a numeric string, False otherwise. A string is numeric if all characters in the string are numeric and there is at least one character in the string. isdigit($self, /) -- Return True if the string is a digit string, False otherwise. A string is a digit string if all characters in the string are digits and there is at least one character in the string. isdecimal($self, /) -- Return True if the string is a decimal string, False otherwise. A string is a decimal string if all characters in the string are decimal and there is at least one character in the string. isspace($self, /) -- Return True if the string is a whitespace string, False otherwise. A string is whitespace if all characters in the string are whitespace and there is at least one character in the string. istitle($self, /) -- Return True if the string is a title-cased string, False otherwise. In a title-cased string, upper- and title-case characters may only follow uncased characters and lowercase characters only cased ones. isupper($self, /) -- Return True if the string is an uppercase string, False otherwise. A string is uppercase if all cased characters in the string are uppercase and there is at least one cased character in the string. islower($self, /) -- Return True if the string is a lowercase string, False otherwise. A string is lowercase if all cased characters in the string are lowercase and there is at least one cased character in the string. isascii($self, /) -- Return True if all characters in the string are ASCII, False otherwise. ASCII characters have code points in the range U+0000-U+007F. Empty string is ASCII too. removesuffix($self, suffix, /) -- Return a str with the given suffix string removed if present. If the string ends with the suffix string and that suffix is not empty, return string[:-len(suffix)]. Otherwise, return a copy of the original string. removeprefix($self, prefix, /) -- Return a str with the given prefix string removed if present. If the string starts with the prefix string, return string[len(prefix):]. Otherwise, return a copy of the original string. S.endswith(suffix[, start[, end]]) -> bool Return True if S ends with the specified suffix, False otherwise. With optional start, test S beginning at that position. With optional end, stop comparing S at that position. suffix can also be a tuple of strings to try. S.startswith(prefix[, start[, end]]) -> bool Return True if S starts with the specified prefix, False otherwise. With optional start, test S beginning at that position. With optional end, stop comparing S at that position. prefix can also be a tuple of strings to try. upper($self, /) -- Return a copy of the string converted to uppercase. translate($self, table, /) -- Replace each character in the string using the given translation table. table Translation table, which must be a mapping of Unicode ordinals to Unicode ordinals, strings, or None. The table must implement lookup/indexing via __getitem__, for instance a dictionary or list. If this operation raises LookupError, the character is left untouched. Characters mapped to None are deleted. swapcase($self, /) -- Convert uppercase characters to lowercase and lowercase characters to uppercase. strip($self, chars=None, /) -- Return a copy of the string with leading and trailing whitespace removed. If chars is given and not None, remove characters in chars instead. splitlines($self, /, keepends=False) -- Return a list of the lines in the string, breaking at line boundaries. Line breaks are not included in the resulting list unless keepends is given and true. rpartition($self, sep, /) -- Partition the string into three parts using the given separator. This will search for the separator in the string, starting at the end. If the separator is found, returns a 3-tuple containing the part before the separator, the separator itself, and the part after it. If the separator is not found, returns a 3-tuple containing two empty strings and the original string. rstrip($self, chars=None, /) -- Return a copy of the string with trailing whitespace removed. If chars is given and not None, remove characters in chars instead. rjust($self, width, fillchar=' ', /) -- Return a right-justified string of length width. Padding is done using the specified fill character (default is a space). S.rindex(sub[, start[, end]]) -> int Return the highest index in S where substring sub is found, such that sub is contained within S[start:end]. Optional arguments start and end are interpreted as in slice notation. Raises ValueError when the substring is not found. S.rfind(sub[, start[, end]]) -> int Return the highest index in S where substring sub is found, such that sub is contained within S[start:end]. Optional arguments start and end are interpreted as in slice notation. Return -1 on failure. lstrip($self, chars=None, /) -- Return a copy of the string with leading whitespace removed. If chars is given and not None, remove characters in chars instead. lower($self, /) -- Return a copy of the string converted to lowercase. ljust($self, width, fillchar=' ', /) -- Return a left-justified string of length width. Padding is done using the specified fill character (default is a space). S.index(sub[, start[, end]]) -> int Return the lowest index in S where substring sub is found, such that sub is contained within S[start:end]. Optional arguments start and end are interpreted as in slice notation. Raises ValueError when the substring is not found. partition($self, sep, /) -- Partition the string into three parts using the given separator. This will search for the separator in the string. If the separator is found, returns a 3-tuple containing the part before the separator, the separator itself, and the part after it. If the separator is not found, returns a 3-tuple containing the original string and two empty strings. S.find(sub[, start[, end]]) -> int Return the lowest index in S where substring sub is found, such that sub is contained within S[start:end]. Optional arguments start and end are interpreted as in slice notation. Return -1 on failure. expandtabs($self, /, tabsize=8) -- Return a copy where all tab characters are expanded using spaces. If tabsize is not given, a tab size of 8 characters is assumed. S.count(sub[, start[, end]]) -> int Return the number of non-overlapping occurrences of substring sub in string S[start:end]. Optional arguments start and end are interpreted as in slice notation. center($self, width, fillchar=' ', /) -- Return a centered string of length width. Padding is done using the specified fill character (default is a space). title($self, /) -- Return a version of the string where each word is titlecased. More specifically, words start with uppercased characters and all remaining cased characters have lower case. casefold($self, /) -- Return a version of the string suitable for caseless comparisons. capitalize($self, /) -- Return a capitalized version of the string. More specifically, make the first character have upper case and the rest lower case. join($self, iterable, /) -- Concatenate any number of strings. The string whose method is called is inserted in between each given string. The result is returned as a new string. Example: '.'.join(['ab', 'pq', 'rs']) -> 'ab.pq.rs' rsplit($self, /, sep=None, maxsplit=-1) -- Return a list of the substrings in the string, using sep as the separator string. sep The separator used to split the string. When set to None (the default value), will split on any whitespace character (including \n \r \t \f and spaces) and will discard empty strings from the result. maxsplit Maximum number of splits. -1 (the default value) means no limit. Splitting starts at the end of the string and works to the front. split($self, /, sep=None, maxsplit=-1) -- Return a list of the substrings in the string, using sep as the separator string. sep The separator used to split the string. When set to None (the default value), will split on any whitespace character (including \n \r \t \f and spaces) and will discard empty strings from the result. maxsplit Maximum number of splits. -1 (the default value) means no limit. Splitting starts at the front of the string and works to the end. Note, str.split() is mainly useful for data that has been intentionally delimited. With natural text that includes punctuation, consider using the regular expression module. replace($self, old, new, count=-1, /) -- Return a copy with all occurrences of substring old replaced by new. count Maximum number of occurrences to replace. -1 (the default value) means replace all occurrences. If the optional argument count is given, only the first count occurrences are replaced. encode($self, /, encoding='utf-8', errors='strict') -- Encode the string using the codec registered for encoding. encoding The encoding in which to encode the string. errors The error handling scheme to use for encoding errors. The default is 'strict' meaning that encoding errors raise a UnicodeEncodeError. Other possible values are 'ignore', 'replace' and 'xmlcharrefreplace' as well as any other name registered with codecs.register_error that can handle UnicodeEncodeErrors. str(object='') -> str str(bytes_or_buffer[, encoding[, errors]]) -> str Create a new string object from the given object. If encoding or errors is specified, then the object must expose a data buffer that will be decoded using the given encoding and error handler. Otherwise, returns the result of object.__str__() (if defined) or repr(object). encoding defaults to sys.getdefaultencoding(). errors defaults to 'strict'. Set state information for unpickling. Return state information for pickling. Private method returning an estimate of len(list(it)). _PyUnicode_InitTypes init_stdio_encoding init_fs_encoding _PyUnicode_CheckConsistency unicode_dealloc __sizeof__($self, /) -- Return memory consumption of the type object. __dir__($self, /) -- Specialized __dir__ implementation for types. __subclasscheck__($self, subclass, /) -- Check if a class is a subclass. __instancecheck__($self, instance, /) -- Check if an object is an instance. __subclasses__($self, /) -- Return a list of immediate subclasses. mro($self, /) -- Return a type's method resolution order. type(object) -> the object's type type(name, bases, dict, **kwds) -> a new type __dir__($self, /) -- Default dir() implementation. __sizeof__($self, /) -- Size of object in memory, in bytes. __format__($self, format_spec, /) -- Default object formatter. This method is called when a class is subclassed. The default implementation does nothing. It may be overridden to extend subclasses. Abstract classes can override this to customize issubclass(). This is invoked early on by abc.ABCMeta.__subclasscheck__(). It should return True, False or NotImplemented. If it returns NotImplemented, the normal algorithm is used. Otherwise, it overrides the normal algorithm (and the outcome is cached). __getstate__($self, /) -- Helper for pickle. __reduce__($self, /) -- Helper for pickle. __reduce_ex__($self, protocol, /) -- Helper for pickle. object() -- The base class of the class hierarchy. When called, it accepts no arguments and returns a new featureless instance that has no instance attributes and cannot be given any. super() -> same as super(__class__, <first argument>) super(type) -> unbound super object super(type, obj) -> bound super object; requires isinstance(obj, type) super(type, type2) -> bound super object; requires issubclass(type2, type) Typical use to call a cooperative superclass method: class C(B): def meth(self, arg): super().meth(arg) This works for class methods too: class C(B): @classmethod def cmeth(cls, arg): super().cmeth(arg) _PyTypes_InitSlotDefs p p p @ ` ` h ` H ` ` ` ` ` ` ` ` ` ` ` ` ` ` ` ` ` ` P ` X ` ` 0 ` x ` 8 ` ( ` ` ` ` ` ` p ` ( h h 8 h @ h H h h h h 0 P 0 x @ x (H 8X H @` ` P P P P _PyType_CheckConsistency type_traverse count($self, value, /) -- Return number of occurrences of value. index($self, value, start=0, stop=sys.maxsize, /) -- Return first index of value. Raises ValueError if the value is not present. __getnewargs__($self, /) -- tuple(iterable=(), /) -- Built-in immutable sequence. If no argument is given, the constructor returns an empty tuple. If iterable is specified the tuple is initialized from iterable's items. If the argument is a tuple, the return value is the same object. Set state information for unpickling. Return state information for pickling. Private method returning an estimate of len(list(it)). _PyTuple_InitTypes __match_args__ n_unnamed_fields n_fields n_sequence_fields Return state information for pickling. S.indices(len) -> (start, stop, stride) Assuming a sequence of length len, calculate the start and stop indices, and the stride length of the extended slice described by S. Out of bounds indices are clipped in a manner consistent with the handling of normal slices. slice(stop) slice(start, stop[, step]) Create a slice object. This is used for extended slicing (e.g. a[0:10:2]). Private method returning an estimate of len(list(it)). Update a set with the union of itself and others. Update a set with the symmetric difference of itself and another. Remove an element from a set; it must be a member. If the element is not a member, raise a KeyError. Remove and return an arbitrary set element. Raises KeyError if the set is empty. Update a set with the intersection of itself and another. Remove all elements of another set from this set. Remove an element from a set if it is a member. Unlike set.remove(), the discard() method does not raise an exception when an element is missing from the set. Remove all elements from this set. Add an element to a set. This has no effect if the element is already present. set() -> new empty set object set(iterable) -> new set object Build an unordered collection of unique elements. Return the union of sets as a new set. (i.e. all elements that are in either set.) Return the symmetric difference of two sets as a new set. (i.e. all elements that are in exactly one of the sets.) S.__sizeof__() -> size of S in memory, in bytes Return state information for pickling. issuperset($self, other, /) -- Test whether every element in other is in the set. issubset($self, other, /) -- Test whether every element in the set is in other. Return True if two sets have a null intersection. Return the intersection of two sets as a new set. (i.e. all elements that are in both sets.) Return the difference of two or more sets as a new set. (i.e. all elements that are in this set but not the others.) Return a shallow copy of a set. x.__contains__(y) <==> y in x. frozenset() -> empty frozenset object frozenset(iterable) -> frozenset object Build an immutable unordered collection of unique elements. dummy_dealloc rangeobject.index(value) -> integer -- return index of value. Raise ValueError if the value is not present. rangeobject.count(value) -> integer -- return number of occurrences of value Return a reverse iterator. range(stop) -> range object range(start, stop[, step]) -> range object Return an object that produces a sequence of integers from start (inclusive) to stop (exclusive) by step. range(i, j) produces i, i+1, i+2, ..., j-1. start defaults to 0, and stop is omitted! range(4) produces 0, 1, 2, 3. These are exactly the valid indices for a list of 4 elements. When step is given, it specifies the increment (or decrement). Set state information for unpickling. Return state information for pickling. Private method returning an estimate of len(list(it)). release($self, /) -- Release the underlying buffer exposed by the PickleBuffer object. raw($self, /) -- Return a memoryview of the raw memory underlying this buffer. Will raise BufferError is the buffer isn't contiguous. _PyMem_DebugMalloc _PyMem_DebugCalloc _PyMem_DebugFree _PyMem_DebugRealloc _PyMem_DebugRawFree _PyMem_DebugRawRealloc PyObject_CallFinalizerFromDealloc _PyObject_CheckConsistency _PyObject_AssertFailed _PyTypes_InitTypes notimplemented_dealloc none_dealloc Return state information for pickling A simple attribute-based namespace. SimpleNamespace(**kwargs) module(name, doc=None) -- Create a module object. The name must be a string; the optional doc argument can have any type. A bool indicating whether the memory is contiguous. A bool indicating whether the memory is Fortran contiguous. A bool indicating whether the memory is C contiguous. A tuple of integers used internally for PIL-style arrays. A tuple of ndim integers giving the size in bytes to access each element for each dimension of the array. A tuple of ndim integers giving the shape of the memory as an N-dimensional array. An integer indicating how many dimensions of a multi-dimensional array the memory represents. A string containing the format (in struct module style) for each element in the view. The size in bytes of each element of the memoryview. A bool indicating whether the memory is read only. The amount of space in bytes that the array would use in a contiguous representation. The underlying object of the memoryview. toreadonly($self, /) -- Return a readonly version of the memoryview. cast($self, /, format, shape=<unrepresentable>) -- Cast a memoryview to a new format or shape. tolist($self, /) -- Return the data in the buffer as a list of elements. hex($self, /, sep=<unrepresentable>, bytes_per_sep=1) -- Return the data in the buffer as a str of hexadecimal numbers. sep An optional single character or byte to separate hex bytes. bytes_per_sep How many bytes between separators. Positive values count from the right, negative values count from the left. Example: >>> value = memoryview(b'\xb9\x01\xef') >>> value.hex() 'b901ef' >>> value.hex(':') 'b9:01:ef' >>> value.hex(':', 2) 'b9:01ef' >>> value.hex(':', -2) 'b901:ef' tobytes($self, /, order='C') -- Return the data in the buffer as a byte string. Order can be {'C', 'F', 'A'}. When order is 'C' or 'F', the data of the original array is converted to C or Fortran order. For contiguous views, 'A' returns an exact copy of the physical memory. In particular, in-memory Fortran order is preserved. For non-contiguous views, the data is converted to C first. order=None is the same as order='C'. release($self, /) -- Release the underlying buffer exposed by the memoryview object. memoryview(object) -- Create a new memoryview object which references the given object. move_to_end($self, /, key, last=True) -- Move an existing element to the end (or beginning if last is false). Raise KeyError if the element does not exist. od.__reversed__() <==> reversed(od) od.copy() -> a shallow copy of od od.clear() -> None. Remove all items from od. popitem($self, /, last=True) -- Remove and return a (key, value) pair from the dictionary. Pairs are returned in LIFO order if last is true or FIFO order if false. pop($self, /, key, default=<unrepresentable>) -- od.pop(key[,default]) -> v, remove specified key and return the corresponding value. If the key is not found, return the default if given; otherwise, raise a KeyError. setdefault($self, /, key, default=None) -- Insert key with a value of default if key is not in the dictionary. Return the value for key if key is in the dictionary, else default. Return state information for pickling fromkeys($type, /, iterable, value=None) -- Create a new ordered dictionary with keys from iterable and values set to value. Dictionary that remembers insertion order Return state information for pickling __reversed__($self, /) -- Return a reverse iterator over the dict keys. D.copy() -> a shallow copy of D D.clear() -> None. Remove all items from D. fromkeys($type, iterable, value=None, /) -- Create a new dictionary with keys from iterable and values set to value. D.update([E, ]**F) -> None. Update D from dict/iterable E and F. If E is present and has a .keys() method, then does: for k in E: D[k] = E[k] If E is present and lacks a .keys() method, then does: for k, v in E: D[k] = v In either case, this is followed by: for k in F: D[k] = F[k] D.values() -> an object providing a view on D's values D.items() -> a set-like object providing a view on D's items D.keys() -> a set-like object providing a view on D's keys popitem($self, /) -- Remove and return a (key, value) pair as a 2-tuple. Pairs are returned in LIFO (last-in, first-out) order. Raises KeyError if the dict is empty. pop($self, key, default=<unrepresentable>, /) -- D.pop(k[,d]) -> v, remove specified key and return the corresponding value. If the key is not found, return the default if given; otherwise, raise a KeyError. setdefault($self, key, default=None, /) -- Insert key with a value of default if key is not in the dictionary. Return the value for key if key is in the dictionary, else default. get($self, key, default=None, /) -- Return the value for key if key is in the dictionary, else default. D.__sizeof__() -> size of D in memory, in bytes x.__getitem__(y) <==> x[y] __contains__($self, key, /) -- True if the dictionary has the specified key, else False. dict() -> new empty dictionary dict(mapping) -> new dictionary initialized from a mapping object's (key, value) pairs dict(iterable) -> new dictionary initialized as if via: d = {} for k, v in iterable: d[k] = v dict(**kwargs) -> new dictionary initialized with the name=value pairs in the keyword argument list. For example: dict(one=1, two=2) Return state information for pickling. Private method returning an estimate of len(list(it)). Return a reverse iterator over the dict keys. Return a reverse iterator over the dict items. Return True if the view and the given iterable have a null intersection. Return a reverse iterator over the dict values. _PyDict_CheckConsistency __sizeof__($self, /) -- Returns size in memory, in bytes. __format__($self, format_spec, /) -- __getnewargs__($self, /) -- __round__($self, ndigits=<unrepresentable>, /) -- Rounding an Integral returns itself. Rounding with an ndigits argument also returns an integer. as_integer_ratio($self, /) -- Return integer ratio. Return a pair of integers, whose ratio is exactly equal to the original int and with a positive denominator. >>> (10).as_integer_ratio() (10, 1) >>> (-10).as_integer_ratio() (-10, 1) >>> (0).as_integer_ratio() (0, 1) from_bytes($type, /, bytes, byteorder='big', *, signed=False) -- Return the integer represented by the given array of bytes. bytes Holds the array of bytes to convert. The argument must either support the buffer protocol or be an iterable object producing bytes. Bytes and bytearray are examples of built-in objects that support the buffer protocol. byteorder The byte order used to represent the integer. If byteorder is 'big', the most significant byte is at the beginning of the byte array. If byteorder is 'little', the most significant byte is at the end of the byte array. To request the native byte order of the host system, use `sys.byteorder' as the byte order value. Default is to use 'big'. signed Indicates whether two's complement is used to represent the integer. to_bytes($self, /, length=1, byteorder='big', *, signed=False) -- Return an array of bytes representing an integer. length Length of bytes object to use. An OverflowError is raised if the integer is not representable with the given number of bytes. Default is length 1. byteorder The byte order used to represent the integer. If byteorder is 'big', the most significant byte is at the beginning of the byte array. If byteorder is 'little', the most significant byte is at the end of the byte array. To request the native byte order of the host system, use `sys.byteorder' as the byte order value. Default is to use 'big'. signed Determines whether two's complement is used to represent the integer. If signed is False and a negative integer is given, an OverflowError is raised. bit_count($self, /) -- Number of ones in the binary representation of the absolute value of self. Also known as the population count. >>> bin(13) '0b1101' >>> (13).bit_count() 3 bit_length($self, /) -- Number of bits necessary to represent self in binary. >>> bin(37) '0b100101' >>> (37).bit_length() 6 int([x]) -> integer int(x, base=10) -> integer Convert a number or string to an integer, or return 0 if no arguments are given. If x is a number, return x.__int__(). For floating point numbers, this truncates towards zero. If x is not a number or if base is given, then x must be a string, bytes, or bytearray instance representing an integer literal in the given base. The literal can be preceded by '+' or '-' and be surrounded by whitespace. The base defaults to 10. Valid bases are 0 and 2-36. Base 0 means to interpret the base from the string as an integer literal. >>> int('0b100', base=0) 4 sys.int_info A named tuple that holds information about Python's internal representation of integers. The attributes are read only. _PyLong_InitTypes sort($self, /, *, key=None, reverse=False) -- Sort the list in ascending order and return None. The sort is in-place (i.e. the list itself is modified) and stable (i.e. the order of two equal elements is maintained). If a key function is given, apply it once to each list item and sort them, ascending or descending, according to their function values. The reverse flag can be set to sort in descending order. reverse($self, /) -- Reverse *IN PLACE*. count($self, value, /) -- Return number of occurrences of value. index($self, value, start=0, stop=sys.maxsize, /) -- Return first index of value. Raises ValueError if the value is not present. remove($self, value, /) -- Remove first occurrence of value. Raises ValueError if the value is not present. pop($self, index=-1, /) -- Remove and return item at index (default last). Raises IndexError if list is empty or index is out of range. extend($self, iterable, /) -- Extend list by appending elements from the iterable. insert($self, index, object, /) -- Insert object before index. append($self, object, /) -- Append object to the end of the list. copy($self, /) -- Return a shallow copy of the list. clear($self, /) -- Remove all items from list. __sizeof__($self, /) -- Return the size of the list in memory, in bytes. __reversed__($self, /) -- Return a reverse iterator over the list. list(iterable=(), /) -- Built-in mutable sequence. If no argument is given, the constructor creates a new empty list. The argument must be an iterable if specified. Set state information for unpickling. Return state information for pickling. Private method returning an estimate of len(list(it)). Set state information for unpickling. Private method returning an estimate of len(list(it)). Return state information for pickling. close() -> raise GeneratorExit inside generator. throw(typ[,val[,tb]]) -> raise exception in the wrapped iterator, return next yielded value or raise StopIteration. send(arg) -> send 'arg' into the wrapped iterator, return next yielded value or raise StopIteration. A interpreter ID identifies a interpreter and may be used as an int. function(code, globals, name=None, argdefs=None, closure=None) -- Create a function object. code a code object globals the globals dictionary name a string that overrides the name from the code object argdefs a tuple that specifies the default argument values closure a tuple that supplies the bindings for free variables classmethod(function) -> method Convert a function to be a class method. A class method receives the class as implicit first argument, just like an instance method receives the instance. To declare a class method, use this idiom: class C: @classmethod def f(cls, arg1, arg2, argN): ... It can be called either on the class (e.g. C.f()) or on an instance (e.g. C().f()). The instance is ignored except for its class. If a class method is called for a derived class, the derived class object is passed as the implied first argument. Class methods are different than C++ or Java static methods. If you want those, see the staticmethod builtin. staticmethod(function) -> method Convert a function to be a static method. A static method does not receive an implicit first argument. To declare a static method, use this idiom: class C: @staticmethod def f(arg1, arg2, argN): ... It can be called either on the class (e.g. C.f()) or on an instance (e.g. C().f()). Both the class and the instance are ignored, and neither is passed implicitly as the first argument to the method. Static methods in Python are similar to those found in Java or C++. For a more advanced concept, see the classmethod builtin. F.__sizeof__() -> size of F in memory, in bytes F.clear(): clear most references held by the frame sys.float_info A named tuple holding information about the float type. It contains low level information about the precision and internal representation. Please study your system's :file:`float.h` for more information. __format__($self, format_spec, /) -- Formats the float according to format_spec. __getformat__($type, typestr, /) -- You probably don't want to use this function. typestr Must be 'double' or 'float'. It exists mainly to be used in Python's test suite. This function returns whichever of 'unknown', 'IEEE, big-endian' or 'IEEE, little-endian' best describes the format of floating point numbers used by the C type named by typestr. __getnewargs__($self, /) -- is_integer($self, /) -- Return True if the float is an integer. hex($self, /) -- Return a hexadecimal representation of a floating-point number. >>> (-0.1).hex() '-0x1.999999999999ap-4' >>> 3.14159.hex() '0x1.921f9f01b866ep+1' fromhex($type, string, /) -- Create a floating-point number from a hexadecimal string. >>> float.fromhex('0x1.ffffp10') 2047.984375 >>> float.fromhex('-0x1p-1074') -5e-324 as_integer_ratio($self, /) -- Return integer ratio. Return a pair of integers, whose ratio is exactly equal to the original float and with a positive denominator. Raise OverflowError on infinities and a ValueError on NaNs. >>> (10.0).as_integer_ratio() (10, 1) >>> (0.0).as_integer_ratio() (0, 1) >>> (-.25).as_integer_ratio() (-1, 4) __round__($self, ndigits=None, /) -- Return the Integral closest to x, rounding half toward even. When an argument is passed, work like built-in round(x, ndigits). __ceil__($self, /) -- Return the ceiling as an Integral. __floor__($self, /) -- Return the floor as an Integral. __trunc__($self, /) -- Return the Integral closest to x between 0 and x. conjugate($self, /) -- Return self, the complex conjugate of any float. float(x=0, /) -- Convert a string or number to a floating point number, if possible. _PyFloat_InitTypes close() -> raise GeneratorExit inside coroutine. throw(value) throw(type[,value[,traceback]]) Raise exception in coroutine, return next iterated value or raise StopIteration. send(arg) -> send 'arg' into coroutine, return next iterated value or raise StopIteration. gen.__sizeof__() -> size of gen in memory, in bytes aclose() -> raise GeneratorExit inside generator. athrow(typ[,val[,tb]]) -> raise exception in generator. asend(v) -> send 'v' in generator. close() -> raise GeneratorExit inside generator. throw(value) throw(type[,value[,tb]]) Raise exception in generator, return next yielded value or raise StopIteration. send(arg) -> send 'arg' into generator, return next yielded value or raise StopIteration. Represent a PEP 585 generic type E.g. for t = list[int], t.__origin__ is list and t.__args__ is (int,). Exception.add_note(note) -- add a note to the exception Exception.with_traceback(tb) -- set self.__traceback__ to tb and return self. _PyExc_InitState _PyExc_InitGlobalObjects enumerate(iterable, start=0) -- Return an enumerate object. iterable an object supporting iteration The enumerate object yields pairs containing a count (from start, which defaults to zero) and a value yielded by the iterable argument. enumerate is useful for obtaining an indexed list: (0, seq[0]), (1, seq[1]), (2, seq[2]), ... Set state information for unpickling. Return state information for pickling. Private method returning an estimate of len(list(it)). reversed(sequence, /) -- Return a reverse iterator over the values of the given sequence. Method to set name of a property. Descriptor to obtain a copy of the property with a different deleter. Descriptor to obtain a copy of the property with a different setter. Descriptor to obtain a copy of the property with a different getter. property(fget=None, fset=None, fdel=None, doc=None) -- Property attribute. fget function to be used for getting an attribute value fset function to be used for setting an attribute value fdel function to be used for del'ing an attribute doc docstring Typical use is to define a managed attribute x: class C(object): def getx(self): return self._x def setx(self, value): self._x = value def delx(self): del self._x x = property(getx, setx, delx, "I'm the 'x' property.") Decorators make defining new properties or modifying existing ones easy: class C(object): @property def x(self): "I am the 'x' property." return self._x @x.setter def x(self, value): self._x = value @x.deleter def x(self): del self._x __format__($self, format_spec, /) -- Convert to a string according to format_spec. __getnewargs__($self, /) -- __complex__($self, /) -- Convert this value to exact type complex. conjugate($self, /) -- Return the complex conjugate of its argument. (3-4j).conjugate() == 3+4j. complex(real=0, imag=0) -- Create a complex number from a real part and an optional imaginary part. This is equivalent to (real + imag*1j) where imag defaults to 0. ? _varname_from_oparg($self, /, oparg) -- (internal-only) Return the local variable name for the given oparg. WARNING: this method is for internal use only and may change or go away. replace($self, /, **changes) -- Return a copy of the code object with new values for the specified fields. code(argcount, posonlyargcount, kwonlyargcount, nlocals, stacksize, flags, codestring, constants, names, varnames, filename, name, qualname, firstlineno, linetable, exceptiontable, freevars=(), cellvars=(), /) -- Create a code object. Not for the faint of heart. J __reduce__($self, /) -- method(function, instance, /) -- Create a bound instance method object. instancemethod(function, /) -- Bind a function to a class. cell([contents]) -- Create a new cell object. contents the contents of the cell. If not specified, the cell will be empty, and further attempts to access its cell_contents attribute will raise a ValueError. Capsule objects let you wrap a C "void *" pointer in a Python object. They're a way of passing data through the Python interpreter without creating your own custom type. Capsules are used for communication between extension modules. They provide a way for an extension module to export a C interface to other extension modules, so that extension modules can use the Python import mechanism to link to one another. zfill($self, width, /) -- Pad a numeric string with zeros on the left, to fill a field of the given width. The original string is never truncated. translate($self, table, /, delete=b'') -- Return a copy with each character mapped by the given translation table. table Translation table, which must be a bytes object of length 256. All characters occurring in the optional argument delete are removed. The remaining characters are mapped through the given translation table. strip($self, bytes=None, /) -- Strip leading and trailing bytes contained in the argument. If the argument is omitted or None, strip leading and trailing ASCII whitespace. splitlines($self, /, keepends=False) -- Return a list of the lines in the bytes, breaking at line boundaries. Line breaks are not included in the resulting list unless keepends is given and true. split($self, /, sep=None, maxsplit=-1) -- Return a list of the sections in the bytes, using sep as the delimiter. sep The delimiter according which to split the bytes. None (the default value) means split on ASCII whitespace characters (space, tab, return, newline, formfeed, vertical tab). maxsplit Maximum number of splits to do. -1 (the default value) means no limit. rstrip($self, bytes=None, /) -- Strip trailing bytes contained in the argument. If the argument is omitted or None, strip trailing ASCII whitespace. rsplit($self, /, sep=None, maxsplit=-1) -- Return a list of the sections in the bytes, using sep as the delimiter. sep The delimiter according which to split the bytes. None (the default value) means split on ASCII whitespace characters (space, tab, return, newline, formfeed, vertical tab). maxsplit Maximum number of splits to do. -1 (the default value) means no limit. Splitting is done starting at the end of the bytes and working to the front. rpartition($self, sep, /) -- Partition the bytes into three parts using the given separator. This will search for the separator sep in the bytes, starting at the end. If the separator is found, returns a 3-tuple containing the part before the separator, the separator itself, and the part after it. If the separator is not found, returns a 3-tuple containing two empty bytes objects and the original bytes object. rjust($self, width, fillchar=b' ', /) -- Return a right-justified string of length width. Padding is done using the specified fill character. removesuffix($self, suffix, /) -- Return a bytes object with the given suffix string removed if present. If the bytes ends with the suffix string and that suffix is not empty, return bytes[:-len(prefix)]. Otherwise, return a copy of the original bytes. removeprefix($self, prefix, /) -- Return a bytes object with the given prefix string removed if present. If the bytes starts with the prefix string, return bytes[len(prefix):]. Otherwise, return a copy of the original bytes. replace($self, old, new, count=-1, /) -- Return a copy with all occurrences of substring old replaced by new. count Maximum number of occurrences to replace. -1 (the default value) means replace all occurrences. If the optional argument count is given, only the first count occurrences are replaced. partition($self, sep, /) -- Partition the bytes into three parts using the given separator. This will search for the separator sep in the bytes. If the separator is found, returns a 3-tuple containing the part before the separator, the separator itself, and the part after it. If the separator is not found, returns a 3-tuple containing the original bytes object and two empty bytes objects. maketrans(frm, to, /) -- Return a translation table useable for the bytes or bytearray translate method. The returned table will be one where each byte in frm is mapped to the byte at the same position in to. The bytes objects frm and to must be of the same length. lstrip($self, bytes=None, /) -- Strip leading bytes contained in the argument. If the argument is omitted or None, strip leading ASCII whitespace. ljust($self, width, fillchar=b' ', /) -- Return a left-justified string of length width. Padding is done using the specified fill character. join($self, iterable_of_bytes, /) -- Concatenate any number of bytes objects. The bytes whose method is called is inserted in between each pair. The result is returned as a new bytes object. Example: b'.'.join([b'ab', b'pq', b'rs']) -> b'ab.pq.rs'. hex($self, /, sep=<unrepresentable>, bytes_per_sep=1) -- Create a string of hexadecimal numbers from a bytes object. sep An optional single character or byte to separate hex bytes. bytes_per_sep How many bytes between separators. Positive values count from the right, negative values count from the left. Example: >>> value = b'\xb9\x01\xef' >>> value.hex() 'b901ef' >>> value.hex(':') 'b9:01:ef' >>> value.hex(':', 2) 'b9:01ef' >>> value.hex(':', -2) 'b901:ef' fromhex($type, string, /) -- Create a bytes object from a string of hexadecimal numbers. Spaces between two numbers are accepted. Example: bytes.fromhex('B9 01EF') -> b'\\xb9\\x01\\xef'. expandtabs($self, /, tabsize=8) -- Return a copy where all tab characters are expanded using spaces. If tabsize is not given, a tab size of 8 characters is assumed. decode($self, /, encoding='utf-8', errors='strict') -- Decode the bytes using the codec registered for encoding. encoding The encoding with which to decode the bytes. errors The error handling scheme to use for the handling of decoding errors. The default is 'strict' meaning that decoding errors raise a UnicodeDecodeError. Other possible values are 'ignore' and 'replace' as well as any other name registered with codecs.register_error that can handle UnicodeDecodeErrors. center($self, width, fillchar=b' ', /) -- Return a centered string of length width. Padding is done using the specified fill character. __bytes__($self, /) -- Convert this value to exact type bytes. bytes(iterable_of_ints) -> bytes bytes(string, encoding[, errors]) -> bytes bytes(bytes_or_buffer) -> immutable copy of bytes_or_buffer bytes(int) -> bytes object of size given by the parameter initialized with null bytes bytes() -> empty bytes object Construct an immutable array of bytes from: - an iterable yielding integers in range(256) - a text string encoded using the specified encoding - any object implementing the buffer API. - an integer Set state information for unpickling. Return state information for pickling. Private method returning an estimate of len(list(it)). _PyBytes_InitTypes zfill($self, width, /) -- Pad a numeric string with zeros on the left, to fill a field of the given width. The original string is never truncated. translate($self, table, /, delete=b'') -- Return a copy with each character mapped by the given translation table. table Translation table, which must be a bytes object of length 256. All characters occurring in the optional argument delete are removed. The remaining characters are mapped through the given translation table. strip($self, bytes=None, /) -- Strip leading and trailing bytes contained in the argument. If the argument is omitted or None, strip leading and trailing ASCII whitespace. splitlines($self, /, keepends=False) -- Return a list of the lines in the bytearray, breaking at line boundaries. Line breaks are not included in the resulting list unless keepends is given and true. split($self, /, sep=None, maxsplit=-1) -- Return a list of the sections in the bytearray, using sep as the delimiter. sep The delimiter according which to split the bytearray. None (the default value) means split on ASCII whitespace characters (space, tab, return, newline, formfeed, vertical tab). maxsplit Maximum number of splits to do. -1 (the default value) means no limit. rstrip($self, bytes=None, /) -- Strip trailing bytes contained in the argument. If the argument is omitted or None, strip trailing ASCII whitespace. rsplit($self, /, sep=None, maxsplit=-1) -- Return a list of the sections in the bytearray, using sep as the delimiter. sep The delimiter according which to split the bytearray. None (the default value) means split on ASCII whitespace characters (space, tab, return, newline, formfeed, vertical tab). maxsplit Maximum number of splits to do. -1 (the default value) means no limit. Splitting is done starting at the end of the bytearray and working to the front. rpartition($self, sep, /) -- Partition the bytearray into three parts using the given separator. This will search for the separator sep in the bytearray, starting at the end. If the separator is found, returns a 3-tuple containing the part before the separator, the separator itself, and the part after it as new bytearray objects. If the separator is not found, returns a 3-tuple containing two empty bytearray objects and the copy of the original bytearray object. rjust($self, width, fillchar=b' ', /) -- Return a right-justified string of length width. Padding is done using the specified fill character. reverse($self, /) -- Reverse the order of the values in B in place. removesuffix($self, suffix, /) -- Return a bytearray with the given suffix string removed if present. If the bytearray ends with the suffix string and that suffix is not empty, return bytearray[:-len(suffix)]. Otherwise, return a copy of the original bytearray. removeprefix($self, prefix, /) -- Return a bytearray with the given prefix string removed if present. If the bytearray starts with the prefix string, return bytearray[len(prefix):]. Otherwise, return a copy of the original bytearray. replace($self, old, new, count=-1, /) -- Return a copy with all occurrences of substring old replaced by new. count Maximum number of occurrences to replace. -1 (the default value) means replace all occurrences. If the optional argument count is given, only the first count occurrences are replaced. remove($self, value, /) -- Remove the first occurrence of a value in the bytearray. value The value to remove. pop($self, index=-1, /) -- Remove and return a single item from B. index The index from where to remove the item. -1 (the default value) means remove the last item. If no index argument is given, will pop the last item. partition($self, sep, /) -- Partition the bytearray into three parts using the given separator. This will search for the separator sep in the bytearray. If the separator is found, returns a 3-tuple containing the part before the separator, the separator itself, and the part after it as new bytearray objects. If the separator is not found, returns a 3-tuple containing the copy of the original bytearray object and two empty bytearray objects. maketrans(frm, to, /) -- Return a translation table useable for the bytes or bytearray translate method. The returned table will be one where each byte in frm is mapped to the byte at the same position in to. The bytes objects frm and to must be of the same length. lstrip($self, bytes=None, /) -- Strip leading bytes contained in the argument. If the argument is omitted or None, strip leading ASCII whitespace. ljust($self, width, fillchar=b' ', /) -- Return a left-justified string of length width. Padding is done using the specified fill character. join($self, iterable_of_bytes, /) -- Concatenate any number of bytes/bytearray objects. The bytearray whose method is called is inserted in between each pair. The result is returned as a new bytearray object. insert($self, index, item, /) -- Insert a single item into the bytearray before the given index. index The index where the value is to be inserted. item The item to be inserted. hex($self, /, sep=<unrepresentable>, bytes_per_sep=1) -- Create a string of hexadecimal numbers from a bytearray object. sep An optional single character or byte to separate hex bytes. bytes_per_sep How many bytes between separators. Positive values count from the right, negative values count from the left. Example: >>> value = bytearray([0xb9, 0x01, 0xef]) >>> value.hex() 'b901ef' >>> value.hex(':') 'b9:01:ef' >>> value.hex(':', 2) 'b9:01ef' >>> value.hex(':', -2) 'b901:ef' fromhex($type, string, /) -- Create a bytearray object from a string of hexadecimal numbers. Spaces between two numbers are accepted. Example: bytearray.fromhex('B9 01EF') -> bytearray(b'\\xb9\\x01\\xef') extend($self, iterable_of_ints, /) -- Append all the items from the iterator or sequence to the end of the bytearray. iterable_of_ints The iterable of items to append. expandtabs($self, /, tabsize=8) -- Return a copy where all tab characters are expanded using spaces. If tabsize is not given, a tab size of 8 characters is assumed. decode($self, /, encoding='utf-8', errors='strict') -- Decode the bytearray using the codec registered for encoding. encoding The encoding with which to decode the bytearray. errors The error handling scheme to use for the handling of decoding errors. The default is 'strict' meaning that decoding errors raise a UnicodeDecodeError. Other possible values are 'ignore' and 'replace' as well as any other name registered with codecs.register_error that can handle UnicodeDecodeErrors. copy($self, /) -- Return a copy of B. clear($self, /) -- Remove all items from the bytearray. center($self, width, fillchar=b' ', /) -- Return a centered string of length width. Padding is done using the specified fill character. append($self, item, /) -- Append a single item to the end of the bytearray. item The item to be appended. __sizeof__($self, /) -- Returns the size of the bytearray object in memory, in bytes. __reduce_ex__($self, proto=0, /) -- Return state information for pickling. B.__alloc__() -> int Return the number of bytes actually allocated. bytearray(iterable_of_ints) -> bytearray bytearray(string, encoding[, errors]) -> bytearray bytearray(bytes_or_buffer) -> mutable copy of bytes_or_buffer bytearray(int) -> bytes array of size given by the parameter initialized with null bytes bytearray() -> empty bytes array Construct a mutable bytearray object from: - an iterable yielding integers in range(256) - a text string encoded using the specified encoding - a bytes or a buffer object - any object implementing the buffer API. - an integer Set state information for unpickling. __reduce__($self, /) -- Return state information for pickling. Private method returning an estimate of len(list(it)). B.isspace() -> bool Return True if all characters in B are whitespace and there is at least one character in B, False otherwise. B.isalpha() -> bool Return True if all characters in B are alphabetic and there is at least one character in B, False otherwise. B.isalnum() -> bool Return True if all characters in B are alphanumeric and there is at least one character in B, False otherwise. B.isascii() -> bool Return True if B is empty or all characters in B are ASCII, False otherwise. B.isdigit() -> bool Return True if all characters in B are digits and there is at least one character in B, False otherwise. B.islower() -> bool Return True if all cased characters in B are lowercase and there is at least one cased character in B, False otherwise. B.isupper() -> bool Return True if all cased characters in B are uppercase and there is at least one cased character in B, False otherwise. B.istitle() -> bool Return True if B is a titlecased string and there is at least one character in B, i.e. uppercase characters may only follow uncased characters and lowercase characters only cased ones. Return False otherwise. B.lower() -> copy of B Return a copy of B with all ASCII characters converted to lowercase. B.upper() -> copy of B Return a copy of B with all ASCII characters converted to uppercase. B.title() -> copy of B Return a titlecased version of B, i.e. ASCII words start with uppercase characters, all remaining cased characters have lowercase. B.capitalize() -> copy of B Return a copy of B with only its first character capitalized (ASCII) and the rest lower-cased. B.swapcase() -> copy of B Return a copy of B with uppercase ASCII characters converted to lowercase ASCII and vice versa. B.find(sub[, start[, end]]) -> int Return the lowest index in B where subsection sub is found, such that sub is contained within B[start,end]. Optional arguments start and end are interpreted as in slice notation. Return -1 on failure. B.index(sub[, start[, end]]) -> int Return the lowest index in B where subsection sub is found, such that sub is contained within B[start,end]. Optional arguments start and end are interpreted as in slice notation. Raises ValueError when the subsection is not found. B.rfind(sub[, start[, end]]) -> int Return the highest index in B where subsection sub is found, such that sub is contained within B[start,end]. Optional arguments start and end are interpreted as in slice notation. Return -1 on failure. B.rindex(sub[, start[, end]]) -> int Return the highest index in B where subsection sub is found, such that sub is contained within B[start,end]. Optional arguments start and end are interpreted as in slice notation. Raise ValueError when the subsection is not found. B.count(sub[, start[, end]]) -> int Return the number of non-overlapping occurrences of subsection sub in bytes B[start:end]. Optional arguments start and end are interpreted as in slice notation. B.startswith(prefix[, start[, end]]) -> bool Return True if B starts with the specified prefix, False otherwise. With optional start, test B beginning at that position. With optional end, stop comparing B at that position. prefix can also be a tuple of bytes to try. B.endswith(suffix[, start[, end]]) -> bool Return True if B ends with the specified suffix, False otherwise. With optional start, test B beginning at that position. With optional end, stop comparing B at that position. suffix can also be a tuple of bytes to try. bool(x) -> bool Returns True when the argument x is true, False otherwise. The builtins True and False are the only two instances of the class bool. The class bool is a subclass of the class int, and cannot be subclassed. bool_dealloc tok_backup 6 6666666666 6166666666666666666666666666 6 6666666666666666666666666666 ( ) @ startswith ? Y ???? ? > < & .B eA 00000000. . : 333333? C& .> @ ?? p> 0> ? A5?55 ?5? P9P ^4@ C%X? A pA ?aCoc?`(?yPD?<sOu $@ @ @ Y@ `A > A < < 0@ @ P?ư> .A p UUUUUU? ?y??UUUUUU? ?i? ???UUUUUU? ?$I$I? ?? q q?? @@ @ j@ cA חA _B mB &@UUUUUU? @ (@ *@ @ ,@ .@ @ 1@ !@ 2@ 3@UUUUUU?? 4@ i@ @@ @ jA sA 5@ ^ A 6@ 7@ 8@ 9@ :@ ;@ <@ =@ @ ?333333? ? ? ?333333? >@ r@ p@ L@ OA ?@ @@ @@ A@ A@ B@ B@ C@ C@ @? D@ y@ @@ @ jA D@ E@ E@ ^A F@ F@ G@ G@ H@ H@? @ ? I@ @@ @ j@ A @ N@ @ p@ L@ O"A? @ ? Q@ @ X@ @ \%A @ T@ @ @@ @ j(A "@ @ V@ @ @ @ @w+A0x\t\n\r\u\\+-N{&#, ? \x00\U00 ; ^ |u u w@ wX _x xP x Ny sy rzp z z z` z {x +| V|$ || | <\ p * N xD , t @ G( KX D 6 8 E U I Y # Ɏ0 Ў # ďX ?t T L ˞ H 4 &\ 0 T E T lx 0 | < t H! ! I(" P" |" " "" /\# B# L# _L$ $ G$% % % a`& & ' ' ' 4( ( <) |) ) <* =* J+ ]t+ + źH, , " - \- - . / t/ / @0 Ht0 M0 q0 ӽp1 F1 ~h2 2 ߾H3 4 7h4 4 $5 L5 5 $6 6 ( 7 Vl7 7 p8 8 9 x9 F9 Y : o: T; ; 0< @,= Z= }4> |> > ? 9<? \? ? @ @ PA tC pD ?D o4E vE ~E F `F F F LG G H CDH ~H H <I I I I ,J |J 9J J(K -K K xL 7L OM VM fM ~M 4N N O O `P -P b R R R XS IS PS T `T T T <U U DV |V V z8W W LX rX Y D Z \Z D[ [ \ \ \ \ t] ] P^ ^ l_ _ 0` >` ` A a xPa a a Db b b fDc c $d d [(e e f f xf xg g h k h `i i i Fj Vj k pk k 8 l hl l tm m 8n ?n gn o to $p tDp p lq q \r r r Ls Qs js s0t ht t u L v v w ohw w x Px x x $y y y \ 8z z p"z " { "P{ "{ " | #t| #| # } $`} $} + ~ ,~ 4~ 60 /6` 6 6 6X L M N< N N uT u u x\ x x z< 3z ܁X نL P _ x y }8 f Ҋ 8 ( +| 7، TP j ;p Џ p 1 d ( ơđ 4 4Ē d ޤܓ $ < G T L ?8 F _ė g8 Z T & \ 7 sH x 8 U $P .ĝ \t y о \ @P X F op -| T d #( R| ^p h IH y D S D - #4 g̭ , Fd lȮ ` 2 M T @ ^ | T Y `̱ h r P d ȴ qT 9е p H n 8 e \ L \( p Լ 8 r , x!X ! !ȿ ! ! " r" <#H Y# # # # % % & D'D ' .( ( :) )t E* + + 9- - - 3| }4 6D 6l 6 ?9 9 9 9X 9 : :| ; ; ;t ; < < A= Q= =D D> > > >d ? ? ?` A A AL A SB B, B B D E8 `H H H8 It J KP _L L L4 nM N@ N Q Q\ Q 6R RX R R Rp U aV$ ~V V V V8 eW W@ X !XD VX wX, X Y Yp Z ZH [ l[ [$ [ _ `| c cT )d d, dt e ?e \e e Cfh [f f f gH 0g g gX h h< +i i sjl vk k l l` n nP p 5p pp Qq r` r s tl t tl 1u uD .w Hw ew( wP w x ,xX yx x x vyl yX y z z { {L {| *| s|X A~ H~8 q~ ( ]< z D Ѐ ހP $ Ah H ^h ` ^@ fl P _ n e $ - 0 {` e\ ɔ ֔ 7\ d( b wL =P ( :| T f mh Ԡ 4 ԡ ܡ| u( ¢ Y c Lt p ! d F0 H@ O z @! ! " " # # # }T$ $ µ$ ˵X% ҵ% |,& & ' ' D' K<( s( ( T) ) ) @* * + d+ Q+ bX, t- t- - <. ep. . / 'H/ G/ o\0 v0 1 1 1 2 2 @3 3 4 L4 4 |4 d5 '5 `6 }6 6 L,7 _7 ,8 8 v8 t9 9 D: : t; < @< t< < HT= = > `> > ? =T? l? ? ? @ \@ @ <A A @B B &B rTC C <D D yD |E E 8F F G tG H 4H H I J tJ J $K K rL PL L L M M M TN N >8O sO DP P $P LLQ `Q R dR ZS T T #8V 8W lW aW uW |\X X TY Y . Z SHZ Z Z t[ [ [ (\ \ \ ,\ 3 ] F] ] 8^ X^ a^ y<_ _ H` V ` e 8a a X a x a \b b c h c \d k d e L e S Lf Pg g dg Xh h !i y\i xi i Pj j j Dk xk k 8l 'm \m m )n =(o xo p dp p @q $q $8r $r $r %(s "%Ps :%s P%s X%u %u %,v %\v %v & w *&w ^&w h&x & y &xy "'y )'pz 1'${ '\{ ({ ({ (P| B(| j(| }(P} (} 0) ~ g)~ n) )l .* 6* + =,< , , ,@ - .$ $.x +. u. . / V/L b/ /d b0 0 0@ 0p 0 R1 1 1 '2P 42 K2 X2d j8 s8L 9 9L 9 j: :T :Ď : ;T 3; ; ; < <ؑ < <T J< g< u<L < $= +=` 3=̔ /> 4>h a> g> ?h A *B( B *C C CȘ D 5D8 zD (E RET mE #F LFd Fܛ G< H KH Il Jȝ Lx LȞ $L0 tL |L L$ L 2M AM4 N N (NУ N< -O P8 Q 3Q QЦ R< /S U 9UT IU rU Up RVЩ V V@ V W W W$ X YT Y Z Z ]Į ]$ ^ 8a Ta` pa |a̰ a ax b ,b GbD b b b8 c cܳ c4 c dд d .d\ lg gD g h$ i iܷ i i8 iĸ Dj jH j jĹ j k\ k (l ^lx yl l4 y |4 U| r| |l } }Ծ } ~< !~ 0~ &P . =< P 8 nt u U X 1 3T 6 s ӆ` p( wh < # > @ T ] oP r h 3 8T Ջ H e s Ԍ $ $P e l Ӎl 5 ' S\ z 0 t ɏ ˏ D| } ( Γx & ih @ ʔ ' I t ԕ , &$ . = D G$ [P ^ a $ h \ = xP l L d \ L .< ߤ )x z( , | +L 0 ܦ \ + \ c 8 x ; C J r u v , " ) ? h Ht ̪4 ] H l l< z 4 t Z u\ ߴ| 4 $ е\ Ѷ$ ٶp & 8 @8 G E L H ' xx l D - 8 D 8 I 0 P < h : W X e\ > L L 9 M< X s x O k l L I t ( l 0` xH ` $ < ,! ! ! " Sd" " p# # <# [l$ x$ % % D& k& G& [\' >' \' \( ) X) ) ;) j(* v* * X+ + \, , , - L- |d. . ,/ `H0 0 d1 41 A1 ,2 2 h2 s\3 4 T4 4 B4 j85 vx5 ~5 6 (6 d6 6 7 h7 7 8 H8 8 " 9 =\9 u9 : 4: ;: M ; Tt; [; |< h< < < G= = => ED> g> \? &? P@ @ A m `A v xA A A B C lC C C HD D @E E TF : F i 0G G 8H pH H a I 8I I J J ;K LK K )L 8L L L 4M M ZM j4N N PO O $O .P IlP P @Q Q 7Q 4R R S |S S 9 4T T !T ! U ^"lU .V 41LV >1V f1V 1$W 1W 2W 2<X 3X S3X =HY >Y ?>Y D>lZ ?Z #?D[ ?x[ ? \ cDx\ D\ D\ D@] wE] E] E,^ EX^ E^ "F,_ fF_ mF_ FH` F` GPa IHa Ha YJHb Jb J@c rKc L d !L\d Ld L e LHe "Mf TMhf `Mf jMf NLg Ng -O\h Oh Q<i Rti *Ri 9Ri URXj Rj S k TS8k `Sk Sl S m ]Uhm Um Un Un Vn V o Vo vWo }W8p Wp Xp X q Yq [Yq hY$r Yhr Yr aZHs {Zs Z,t Ztt h[u r[Hu [u \v "\pv -\v 4\w ;\w ^w ^tx r_x u_ y _8y `y J`y 'az @az Yaz ~a{ aH| b } 0b} Bb,} ;j~ cj\~ j~ j k mk qT q q yr wH w x y y܃ y< 1z >z {P { { 0 n Հd x ܂4 ԉ B0 x Ȋ p " 8Ȍ Q T, 8 ! ) O | ƍ ؑ ̒ ː, i Б ܑd ғܕ ' ,x NT w T ܘ 8 % X ؚ p p [8 4 )Н 8 N < @` ̟ 4 Zx pL ) _d f $ 2t _ q pܥ x u| t Ƭ ެ< cD ܫ z Ұt Ь N, ͱH ұ l C ` l d p ܲ 2H 2X p ` c H ж d t ĸ , <| jĹ D 3 H ` Z [ D a k ̽ ` о !0 (!x ! L" "( }# #, $t $ a$8 ]' '\ ' ' ' ' (h X( g( r(\ y( ( (, ')l 3) \) *` * F*$ * "+ 7+$ :+8 f, , ,h - -T 1 1 2\ '2 <2D A2l 2 B3 s3p 4 *4( 4h 4 4@ 5h 5 J6 v6h 6 64 _7 7 7 @8 8 8( 9D : : : I; a< <, .=x f= =X ;> E> B Dd E E8 E E F F I$ I J $J qJ$ }JT J J J J8 J K8 L L$ L BM Z< ZT [ t\ \ ] i i@ i i j Gk dk k$ k k k lT (t gt$ td t w` >w Jw w w w@ kx x y@ ey yL y y y yl y !zX z z {X K| | |d | } }p } } }x } '~D +~| B~ ~ ~T 8` G R a` D J ` R V b 2H Ԋd 9$ \ 6 > ȍT H ` " $ 8< ] d ۓ p 6H R Δ ؕ 0 h \ (L / h x x 4 ` ! S | ɡT d 5 D ۢ $ ,$ Ix x ]h ̰ d4 | 5 = L (d \ ε e 8 U| z 8 P d F | H Ź| º< ߺ| {@! t! ! " l" " ԾL# l# {0$ $ +% n% & [t& k& & D' 4' Q' P( ( ( \) ) ) * '* * + X+ l+ + t, , :- UD- aX- - - - - . hT/ / 0 X0 0 D1 _1 2 h2 2 83 %3 3 <4 4 84 F 5 \5 5 5 X5 86 6 6 56 Z,7 bx7 7 8 L8 i8 9 9 p : : : \ ; P; ; ; H< < &< dP= k= $> 3> \? ? (@ M@ W A `0A i\A nA A A tB B \C C R4D lD D 8TE E $F F dF G XG G 5G \H tH I [I PJ J ,K {0K K f L L L M XM N tN N ntO O O !P :TP Z|P fP ~P P Q DQ lQ Q +Q @4R dR >R nS lS S T dT U \U U gU U U a(V |V V .,W NW UX [<X dlX {X Y TY ,Z !Z $Z [ H[ \[ p[ [ [ \ Z@\ fh\ k\ \ O8] ] 8^ U ^ p ^ w ^ _ , t_ ; _ ^ ` l` ` a 0a 1|a b Xb b c ,c Rc Yc d 6d F@e |e f 9f f0g g h ^th h h i Ti ]i ,j j j uk F l 8l `l l l l |m m n $ Pn G |n N n n P!(o 0#o o#o v#$p #\p #p #tq % r -%0r 0%Xr [%r &r &s &\s Z's N(s Z( t a(`t h(tt |(t (u (u {)v )xv )v *xw h+w +w +(x +Xx +x +4y ,y ,y -z j-z w-L{ -{ -{ -4| 0| z3} 3 ~ 3~ 4~ e4D z4 5 64 J6p R60 Z6 6 M7 P9 d9Ă 9 9@ 9t (: :@ :; < < > ? >@( @ A BD B C .D̈ @E E F FT F G JH H H ,I< IЍ J, K 5L L\ "M )M 3MT MĐ WN ^Nl N N ?O =PX VPē uP Q̔ Q R| WS S ;U ~V V4 VL W X$ ZD Z H[ \l ] ] ^ .^L U^ |^ ^8 3_Л X_ }_t _ _ _, "`L Z`l a̝ a b4 &b 5b b b8 b c̟ Qc< ac c cD c c d d d e8 `e e eԣ fX 1f fT h 9i i id ;j \j Bķ Fk k k kd }l l m< Nm$ np n nh =o Do4 1 gL t 0 Gp ܱ D X [ j H ` ՞ ȴ t , Mh s < Ġx Ӡܷ H \p :< gt l A yԻ @ M| r X p н ٥ < Ⱦ aX צ A̿ \ X b D d & F P [ X d $ }D $ 4h ; ȱ ( uH | , @ T !h )| ^ ֳ ҵ ۺ< x 8 t K T (< f\ | H jH 8 < 0 g < ( v 9, Xt l { & [8 # ld 7p $ :@ CT p ) 2 : B , D p I V j D B ` ' t ; P $ T !H -!` 9! v! }! ! x# # $< $P % % K'P ' ' !( ;( (0 (d (x ( A) ^) w)0 1*` + C+ R+l _+ +< + + + ,T *, 1, V,\ , ,8 -d *- 8- G- j-0 -p - - .x K., N.\ f. . .t . .H / 3/ :/X `/ / 0$ %0\ :0 @0 0< 0 0L M1| [1 1H 1 1 1( D2 H2 2 43@ S3 }3 3 4D &4 (4 ,4 6X _6 6L 6x 6 7( )7D x8 9 98 9 9 90 9 /: G: J: P:d : ?; q; {;p ? @ (@P p@ t@ @h @ A, A A <AL {A A Ax $B B B AC C C0 D D E KE E( FT =Ft uF F F G ?G wG$ G< GT Ht H IH H H H H 'I, TID Id I I )J 1J 9J J J J@ KT kL sL L L L L M, -M SM M4 M| M MX QN qN( N N N N O 3O GOh O O O O\ O O P P HQ\ Q Q( R R R| S PVX WV V Wd X Y< qYX Y 7Z$ SZ Z Z! Zl! 7[! d[! [\" \" ]# ']P# 6]# q]# {]T$ ]$ ]$ ]$ ]@% ]% ]% ]% ],& &^X& B^& d^' y^' ^ ( ^h( _( s_T) _) D`0* `d* `* b+ b+ 5c+ c@, d, d, d@- 7g- ?g- gL. g. h/ 4i/ ki/ iX0 i0 !k0 Wk1 kH1 8l1 l2 4nL3 nl3 n3 n3 nL4 }oh4 o4 p4 ~p<5 p5 Gq|6 Vq6 yq6 q(7 q\7 qt7 r7 r7 r8 xr|8 r8 _s 9 tp9 qu9 u9 v: ov0: vh: w: ;w: Yw; wd; w; w; x< x < x`< x< Ky< ty< y = y = y@= yX= zx= z= t{ > {(> {D> 1|> o|> |> |4? |? |L@ D}@ }@ }PA k~A ~A ~ B ~B .B tPC C "C D ցD BD @E .E cE jE ^DF ۅF +tG G ŇG 8H ?HH O`H ctH H 7H DH qH I $I YI \I I zI I I ؋ J 4J \J pJ ;J OJ J J 4K HK ،\K .pK BK tK K ȍK L ʎ0L ˎDL ӎXL Z|L L L ,M œ M HM M M N N lN N O 1<O tO O O O 60P ;TP OhP XP _P dP ϚP 9Q _$Q j8Q LQ `Q =Q _Q Q Q 7R i4R tHR |\R pR R R R RR fR zR ܟS ,S "HS J\S YpS hS wS S S S ՠT $T w<T TT ˡ|T T wT T U 0U LU 8`U ]U {U U ԣV ,V 0DV O\V ztV V V ޤV V AW | W 8W PW ٥W W jW զW X HX Y\X pX ѧX X X X Y = Y M0Y ]DY iXY |lY Y Y Y #Y ǩ8Z LZ K`Z PZ cZ lZ uZ ~Z [ [ ت,[ @[ T[ h[ #|[ /[ 8[ <[ A[ B[ d[ \ $\ 8\ `\ t\ ū\ ҫ\ \ \ &] <] ,] @] T] ɯl] ۯ] ] ] ] 3^ D$^ W8^ XL^ g`^ t^ ^ ^ ^ ^ ^ !^ k_ @_ T_ h_ /|_ B_ a_ _ _ ` *@` ||` ` ` ` ` a + a I4a nHa \a pa a a b b 4b !Hb Cdb b {b b c $c 8c XTc \hc g|c oc {c c c c c d d Hd "dd =xd Ud od d d $e \e Pe e e e e e f $f >Lf U`f Ztf pf f f f f 50g {Hg `g g 0h h h i Xi W i i i i /j R$j d<j }Pj pj j j j j 3j qk M`k k fk k l ,l Ll %`l Gl il vl l m x<m Tm hm |m Am m n $n -8n ALn K`n o n n #n R(n n( o ( o (Ho D)po h)o *o c*o x*o *o +p + p +8p +Lp +`p +tp +p +p ,p 8,p ,p , q -(q i-@q -Xq -lq -q -q -q O.q .q .q /r 5/,r s/Tr /lr /r 0r T0r 0r 0r 0r @1s 1,s "2Ds L2`s j2|s 2s 2s 2s 2t 3,t c3Tt 3lt 4t O4t a4t z4t 4t 4t 5t 5 u @5(u R5<u d5Pu 5xu 5u 5u 5u 6u U6u ^6u g6v p6$v y68v 6Lv 6`v u7|v 8v 8v 9v 9(w :Pw 8:hw :w :w ;w Z; x ;x ;4x z<px <x <x 6=x ;=x @=y P= y U=0y Z=Dy z=Xy =y W>y _>y ~?y @(z @<z APz )Adz Az qBz Cz C{ C({ jDT{ E{ E{ VF{ F| G0| GH| ~Ht| "I| I| jJ| K$} KP} VL|} L} M} BN ~ N,~ OX~ .P~ hP~ P~ Q$ Q< IR| S :S S S S =T8 Ut U U VЀ V V( !WP XWl sW W /X wX܁ X X MY( ;Zp Z Z U[Ă \ ] ] ] U]@ ]` ] ^ 1^ Y^Ѓ ^ ^ ^ Q_0 y_H _` !`x ` "a ia Pb c0 :cH bc` cx c )d d d d [e\ e e +fȆ f Bh h8 i` \ix i i j܇ j j, }kL 8lx l m m m nd n o o Jp؉ wp p p( pP pd px p p p pЊ &q Bq Dq0 qP r r s <sԋ s s( td t| Tu u u u vD tvl w w w 9x xH yd y y z z z .{ ?|D P}t } ~ "~ԏ ~ ~4 ~H ~\ %x t ̐ $ 8 BX 9ȑ ā ] o, T l ' ( FP Ȉ P d ؔ 9 G n@ ً` l ĕ ݎ D X Zx W̖ x T u8 L ْl <ؗ e Ɠ4 T ϔ P ܘ [, e@ nT xh | Ж̙ U L l Ě 4 H 0\ b ԛ @ I 4 H l L Ԝ H x ԝ . 6( s@ T h ͤ| E @ X ڦ ! 0 | 4 Ԭ $ 8 ܡ M` mx o O J` yx ȣ ? g0 lD Ԥ 7 P x J ܥ @ >l f s Ħ ئ 9$ \ $ 8 h Ĩ ` 0| R ĩ C S q ( < Rp ̪ y , D@ - Lث /$ B8 T l / 0 GX Э Z< X T Į خ + 04 UP [d | ? 4 l t { 9 Y$ y8 L f̱ z , Vd uԲ D p s @ 5H :\ ( (L h E o ,ص )4 ` < h $ UT T ظ M$ P K| B d ܺ _ $ L ` t ܻ Y $ 8 8 d H x u ȼ d E Ƚ _ T t S < z H t A K R u ( < Wd ; { h4 ` * Q m B 0 Q D t < h ! " [#, #d s$ $ |% &| & ( * *0 *l h+ + P, , - 6.$ .D /\ 0 51 1 2 .3H 3p 4 H4 w4 4 P6$ 7t E8 8 8 C9 98 9P 8:p : : {; ; ; ;4 ;H ;\ <p .< H< b< = $= ;= =h B> A EH 6N Q R, e _k zn8 nP nh n Ro 4p qT qh q| q Ur r 3s, }sL sl t t %u w@ =xh y y y I L _ r { 4 | ! y P ۈp F Y$ \ $| I | n\ Z 4 d U f ҙ vD ͚l s$ P P K W8 r| | ץ d\ cH m\ x 8 w @ r P U @ !l r a ϴ, =T ڵ n GX * h 4 ݹL dd 0 0H xh Կ d 5 }@ l Y M 0 | / ( @ 5 ( it O P \@ ; l 6 Cl 0 C$ X k [ V0 P & 8 L ` t X 5 ` l D K 4 t d 4 | ' 8 X y V 0 D 'l 0 xP $ a m 8 X p o c 4 sL x B W4 ` + n L ; " 4 !x $ c& &0 '` ( Z) * * *, -x . 5/ l/ /, \0 1 1 294 :h ,; ; ; ; ; \<4 q<T = = = +> @< G@d @ B HC AD( Et gE E =L L LMd gN O P8 %PL IQ NQ rR wR R@ S\ S S S "T 5T LT [| ] _t }` Ja .b4 lb\ f f f f f0 gX g i j k( k< kP k ok k l m( mh .n n o (pH cq r t t( :uT >uh qv v v w0 wD wX zw w w w w4 xP xl 'x y n{ }p ~ 0 : ~8 t ( h # 5h - K gd px 1 :4 x < A < D0 P I H @h ʬ ΰ| Q ز| r @ [x G I ! 9! " 0" D" " f" " 4 @ LL \` 0 ll L \P \ l! ! ! ! " " " " $ ,h$ <|$ L$ L& ,& & <(' <d' \T( ( l( ( \) ) |) * \\* l* 4+ + ,, `, , , X- l- - |- . l H. . / 4/ / / 0 0 l01 1 1 2 <#|2 \#2 l#2 $2 ^h3 \_3 |_3 `4 \b85 b`5 |d5 d5 g6 Lg<6 <hh6 ,i6 j 7 m7 m7 n7 ,n7 Ln7 n8 n$8 ,p8 p8 Lq8 q89 |s9 ,t8: tx: t: u: <v; x; ||; L~l< |~= D= d= = = ̄P> ̅> ? (? \P? ? \? ܋? \ A |pA A lA ̙DB L\B ̚tB ܚB B C 4C ̢HC C C E PE E 4F |F F `G I <J J J DK XK K L ,L \L |L 0M lDM |M HN ܺN @O <\O lO <P ܽ,P \xP \P LlR R \pS T L4T lT U XU U U dV <V , W PW \lW W W ,lX X , Y <Y Y lY $Z ,@Z l`Z xZ `[ [ l[ 8\ (] ] |] lp^ _ ,_ _ X` ` ` b \\b lb tc c Dd Xd e @e e e f f g ,!g !<h \.h .i 0i 04j 6j 6j 8j ,94k ;k <k = l ?l l@l @l A m |Cm lDXn En Fq R|r |Vs |XHt Xt Y,u |Z,v ]v _x _<y _z \aTz lz lD} m} m<~ \{~ < lH t l LX < F G G O, P S TX fD <fp |hȆ j, kt lm ,n, ,yȈ y ,zĉ Lz؉ z z4 | } <~P \~x ~ l̋ l ܆ l ܦ ̧ |0 ̩ܐ < \ < P \ l< \ | @ \h l$ L ` ؗ < LX , < p t \ p < Ĝ <h , 4 L, t t l 8 $ | \ ( < ܦ l' * , l3 6 ,8p L9ܪ <d \= A A` lH HL lM M| O |V VЯ |W ,Yl lY YIJ [h <] ] `t ,cH c ,dȶ fȷ <h8 k kи tĹ w ,y | ~ LT \ L ̄h ` ,4 \ <4 << < \| \| , d ̟x , LT < X ܦT < | ̪T | \p \$ ܱt , @ ̺ l ̼t ̾ X d x L \` |t l d 8 L l p | < < L ,, < 4 L` | < L l\ \ h 0 \, L P \ ` |< h , | l $ P d | | |0 $ ,p L H \ 4 L ` |'p 2 l2$ 3 4< 8 L9 ;H ,;\ l< < >$ J ,N ]8 ,^| ,g \g i\ j l\! l " n# n$ o% qL& r& sx( s( ,t) ~) ~) `* * 8+ p, |, , - <- - . ,. ̢/ L/ ܥp0 0 0 1 ܫ2 |2 3 ̭04 5 ,6 L7 <L8 8 9 l9 <: ,< < < = $> L|> \> l? @ @ A A \B C L C pC C C \D <D D E G G \H H |XI <I LI I (J lJ @K <K L |tM M N L O PO <O |P <Q dQ |R R , XT l T 2XW ,2X 24Z 3 [ 7[ 7L\ 8 ] ,94] L:] ;^ <^ l>_ Ba <Ba Cb \CXc I|d lK i K<j Kj Kk Mtm N n <NHn cp c q |q r |r 0t \t |@u LTu |pu v v y ܥz z \t{ { { L | \| l} <~ <`~ ~ |< ܭȀ ` ̴ , Lԃ 4 l ` l ,$ d p h ؋ | l ,ԍ <x @ l0 D đ d | P @ ,x < \ l̜ P 8 \ l | T l l l < lX lT 8 ! !( <"l " <% L&, ,)T ,ت ,8 l. ,1 <1 l1 2 2 3 3 ,4| 5 l6L 64 6 L7 l7 9 ,9l > ?н <@ @ @ Ht HT I I L( |L N LN N N( OP lQ ,Sd S \U |U U ,V <V V V8 V0 <WL W X4 Yl |Y Y lZd L[ [ a, Lbh |b ch <d f i |i$ nd n |o |q4 ls lw <x@ <{ |{ { <} L} |}x <~ \~ ~ 8 , L ,4 ܈ \ ܍ \P h , $ ̖ < < | H ̞ ( ܵ 4 |< ̺P d , |4 0 d ` L \ lP T | ` \ <`! ! % 0) L) l<* * D+ l+ + <+ + $, - T- . . <. `/ / \ 0 0 1 1 1 \2 ,@2 <3 L84 \5 ,|6 7 L (8 \8 H: < $; L 8; ; |? ,|? ? p@ L0A ,@B <B <C C , D |!D /E 1G l1G 2\H <2 I 2$J 2<J 2 K |3dK <4$L \4LM 6O <7lQ l7Q |7R :S L;T <V =<W BX itY ,mZ mZ <nd[ n`] \p_ r` u`b vb ,vxc \ze zpj z$k {4l ,{Hl {l L| n \|n |n |n }o }q |}<r }Pr }0s ~\s |s \t <t (u <|u <x ̆x y ܈z ,z 0{ \{ { { | (~ 8 8 | ld L ̶X l ̾ Ll P <Ć | , LD lȍ x L \ $ X LȠ |ġ h L ب |T L l8 <0 l l l l@ T | < | \ |%t L& & ' ( + + +X +H ,| <, , . /@ 1d <5 |5( l7 8 : |:$ ; C ,E< ,N O P8 Q [ L\T \\h \ \0 \ <] ]0 ` <a a< c ft h o4 lo` Ls t " y" y" l~$ ~d$ |) |) (* . / ,0 ܍4 4 ̎(5 5 ̏T6 l7 ̒7 @> d? ,E DL ,XL ܦ4N N <0S <HY d `e ܯ0k <lr |x } } , Ԋ |p < L |t ,, \ < | @ | ` , \ L d " |: hW 4X L\ 4d | \ < 0 | l$ 8 h L |T < L L \ ,T ( Lx | L 4 \ , l ` \ , <X \ <8 \P | < T L $ D < ,P Ll | ( , l.l . l1 1 1d 1 |2 2 L3 3 3x \: :$ ; < << << ,= |= =H ? L@ @X @ B |C<" Ch" LD # |D # E|# F# LF# lF$ G$ GD% GX% G% lfL' f' f' h( lH/ `/ `0 1 <D2 3 4 ̨4 L9 P< < < L< = ܬ= ld? @ 4@ ld@ <D D 0D D \D ̲ F <xF 4G ̳G LG \0H |`H H H <H ,\I lI ܷDJ LXM M M N <N |O O ܹO O S (S <S LS |T T [ <[ \ \ ] ,] l^ @_ _ _ |$a la ,a \pb b d 4f ,i i \ k m 0n Dn n , o 8o Lo o o p Lp |q q lq |r r <ds |s s <t t t u |pu ,u <v lv L@w w Lw 4x lhx x x ,y Py y L{ 0{ h{ { T| <| | x} @ t ,` | T d D <p L Ȕ Ě ؚ 4 , Л 0 L l ܟ ,d ԡ , < L H D ( | \ <t l l 8 ز 0 | | \( <X <0 lH |H p \ , p , | ܿ P < 0 P |!d ! l"< \$ L%4 <' ,( ,) L* \* + +4 - <.@ l. /@ /t 0 L2, |2X 2 \3 38 l4h <7 l7 70 7p 80 : L; ;$ ;8 l< l= =( C C <Dt Dd F G8 |G0 ,H H@ H |K< X <Z Z [ <]p l] ]h |^ _t _ |a a \bT b ,c |c |d ,e e$ <g g h LiH i jP |n np q r r( s ,t( ut ,u |v x x lz z z< | L} |}( } } t D < \( t \ ̇@ l \ x <( | $ <d l l X lT L l0 X l | p L ܝ@ l | 8 ,L L H p l | X ̢ l <4 L l ̲ <4 < L l x , \ < l< , \ P L4 |T l ! \x! ! 0" L" L# t$ $ l% \p% `& lD' ' L ( X( ,( |t) ) + |, ,, <, 4- |- \. . 4/ \/ / @0 \41 `1 1 L2 <`2 l2 `3 <3 d4 4 (5 l5 ,6 7 D7 ,`7 8 9 (9 9 d: : <: (; \; ; T< < ,< <= t= > > ,> (? |? ? \,@ lx@ \A \B <B E XF ,lF F L(G |G l HH pH l!H ! I ,"J "4L "hL #L #8M <$N $N $N %P %`P & Q 'Q L)(R *,T ,*DT *xT +T ,+W |+W +W <,X ,|X ,Y -tY -Y . Z .hZ 0Z 0Z 0[ 0[ <1\ 1\ 1\ 2] 2l^ 3^ L3\_ 3` 3` <4` 4` <5$a l5La 8a 8b l9b 9b :b L:0c :d =0e =Le Ae Af ,Cf |Cf Cf Cg Epg Eg \Fh Gth Gh H0i Hi Ii LKdj \Lj Lj Lk \Ndk Nk QXl Qll Ql Rl T4m Tm Tm ,U4n LU\o |Uo Uo \YHp Y|p Yp Yp Zp ,ZTr Zs Z<s ,[ds |[s ^t _t _t lru s@v \stv yv y4w |w } x }x ,}(x <}<x L}Px \}dx l}xx L~x ~(y ~<y y y z z ,0z LDz \Xz |z z z z @{ l| L| l| | \ } ̄} } ~ ̅~ < | T ̇p ܇ \ L ԁ 8 l l؆ <\ l ( ܈ L , \ ԉ | 4 ̔ ċ , | ̌ h L( @ p \ ܛ p ̞Ē 0 Г < L$ < L \< ܧ$ , P x ؗ <H < \ l | ș ܙ l ؚ ,, \L X ̯t 8 l ܳ < ̶d 8 L |$ l |T ا <4 , 4 x ̭ خ D \ < L |8 < < $ \ Բ |l ` < | lh || ض ,D l\ < | h L\ ع 0 x l @ \ л T H |0 , \X \ , l $ P L $ l ! ," <" " "4 "H #\ l$D $l % % ,% %@ %h & & &| & ' ,'< ' ' (d \( ( ( / L/< l/ |/ / / / 0 3t 3 4 <44 l4\ 4 <5 l58 |5L 5l l6 |6 6d 7 \7 7 70 8 = L=t \= l= = > > >h ,? @ |@ @ A D KH K L L( M M M \N O` Ot O <P P@ PT LQ |Q Q RL ,S LS \S S S SD TX Tl ,T <T Y@ YT Y \Z |Z Z< Z [ L[< [ [ \ |]< ]x ^ ^p ^ b Lc, \d |d d ed f ,f <f f( f< fP fx g g g$ hL Lh h \i\ i iP id ,j Lj k8 ,k` m lm m0 |n n n o0 oD ,oX Lop \o o pP p p Lq q` r r s <s s <t |t@ u v w( Lw< \wP Lx xx x y yl y y y y zD <zt lz { |L | ~( ,~p <~ ~ l@ , < l , | h ̃ \ ܉ \ \T l | $ <t | <X Lp 0 P L ̔ 0 \ L < ,p l ( x < l, ` L \ L d | | ̟ < \ L( H L0 ̫< ܫP h | l$ |8 \( D l | < 0 ̳D \ L8 < lh ( x ` ! <D! ! <! l<" |" " " # <# ܂# # ܃$ ($ lP$ $ ̄$ % % 0% L% l% d& ̉x& |& ' ' |' ' ( H( t( ܐ( ( ( x) * + |+ , , , lh- ̔- l0. <. \ / ܖ/ ,/ d0 0 ̙(1 l2 |2 ܚ3 \3 3 h4 L4 4 ̜ 5 5 <5 5 6 ̞<6 L6 ,7 LT7 ̠7 p8 <8 $9 \x9 ̥9 <p: : : < L,< < << L< l = |0= D= = = ,> X> L> ̫4? , @ ̬@ A ̭A B B ,B ̮TB ̯PC C <C `E ̲ F lpF F LF LG G ,H H H <LI \dI PJ ,J K K \PL L LL M \M M \ N HN \N \O LP |0P P \P lQ XQ Q R ,`R ,0S TT L4U U $V dV ,V lW W <\X X Y ,`Y <Y lY Z 0Z Z \[ |[ [ H\ \ \ \ ] ^ @^ p^ ,^ ^ H_ _ ` pa ,a La l b tb b Lb \b c ,$d d d (e Lpe \e |e e $f f ,f |f xg g <g h l |h , i Xi <i i i <j 4j j j |j Lk xk < k l l l , l | <m m | m 4n o <4o o p ,\p <p Dq q |r s s s Ht t \\u u u 0v \v v <w | w x , x Py y l ,z <"xz "{ "h| #| <#| #} <$} |$} $} $ ~ %~ \&~ |' ( ,)̀ l* ,+ \+Ԃ +0 . ,/ \/؈ / / / /H 0d <0 \2 <3P 3 4 4 4 \6 |6 6P 6d 8 8 <8 L8 8P 8d :Ў ; =H <>d > >؏ > \?4 l?H |?\ ? ?Đ @ؐ @P \N N N O OP Q \QT <S TX LUt U U V0 V V W <W, Y Z Z <ZԖ \Zt |Z Z Z \ ,\ L\ \l ] ^ ^T _h <_t |_ _ \p p8 <q r؛ Lr$ rP |s sМ s tT \t t< v؞ <v x y lz z |{ { {< L| |ȣ } }` ,~ ~Ȥ \8 l @ \( P \ | $ <Щ d x ,\ ̑ , \ , L \ а | | h <س | |x <д ( | ̵ < l , d l l8 L l \ܹ ,d , 8 l L8 |L t ,d Lx ,( | , L P < , \D l LL l` , L | L 0 \x 8 ` , | | 4 | < t l D , < \H t < L \ | < x \0 | , < X \ | , x | , l < \ P , , 0 !h " #H l% |% 'L ,( ) l)t ) * <* L* \* *d <+ \+8 . <. .8 .l . ,/ / /P ,0d <0| 2 2 3` 3t 3 3 L4D 5 A A, BT B C, F |F F G8 |Gh G H L M M< lN| <Q |Q Q4 Q| R <R lS |T` ,U <U ,V W\ |W W X ,X X, Xd Y lY Y0 \Z [ \x \ ,] ]x <^ |_$ _< _P _x ` b4 c ld d$ e@ e e h( ,h\ \h h h( ix j k4 \k| k ,l ll8 lx \m <n ,o` |p p qH t t up v v v| v ,w <xT x x \y ly ,z| |z {( |{l | | L} l}, } }\ \~ ~ ( L| | ,, Lh , ̃P \ LL L| t d l L 4 0 LD | |` < ̗ l P 0 | ܙ | ̚ , ( L ̜ D \ L L , T , < ̼, \| ` < <\ T \ ,$ \P ! LX! ! ! " # ,# P$ $ D% <\% l% 4& H& L& & |' h' ' \( 0( h( ( ( ,( l) ) * ,@+ \+ 8, , - L,- - . (. <. . . ,t/ / 00 D0 \l0 1 ,`1 l1 <2 \2 \2 X3 |3 3 4 ,T4 5 6 6 l 7 D7 X7 | 8 p8 L8 8 @9 X9 9 \9 |9 8: <T: : \: 4; h; ; \; <h< l< = p= ,= = = L> > \P? l? H@ @ ,@ |A HA pA A A < B B B B ,C \|C | C TD D D ,tE \E |E hF |F F ,G G G <G $H \H |H @I l I !pJ l'DK (K (L )L )<M )pM ,*M \,HN ,N -N -O l.4O /O /O <0O \0P 0,P 0@P 1hP ,1P 1P 1P 1Q 20Q l2XQ 2Q 2Q 3Q l3Q 4R 4R 5S 5S 5S 6PT ,8T l80U 8U 9PV |9V 9V <:\W L:pW :W =(X <>PX l>X >X L@,Y l@Y |@Y @Y AHZ BZ C4[ C[ D[ <D[ lE,\ ET\ E|\ lF\ G] ,G] lG] <N|^ lN^ NX_ O_ \O_ P@` P` Q` Qa Ra LRa R0b Spb LSb S@c LTXc Tc <UDd Ud We We Xe Xe ,X f <Xf LX(f \X<f lXPf Yf YPg Zg Zg \[Hh [h [(i <\|i \i \i \ j ]j <]Hj _j `k \a$l aLl atl bl Lbm b,m \hm hm hm h n i4n \ihn |io io io j@p jxp kp |kp kp nq Lo r oDr or p s qs <rs \r t r4t rHt rt rt st |tt tHu uu wu w0v wDv \yv Lzv lzv zw |~w w L x <x lx ,x <x Lx |x Py y ̂y z z Lz ,hz z z ܄{ \h{ { { ,{ lh| ܇| | L } \X} ll} ~ 0~ h~ ~ L p ̊ \ ܍H , < L \Ā l | ̎H l \ , \T \ \ ̗D , l LP ̜ t Ї l, ̥ L0 ̦l < |D l ܨ l \l |H , @ t ܲ L t LD ԑ \< |P |4 p < <P \ 0 ĕ l T LĖ ԗ ,X @ < L \ș 0 d ,x < LT \h , L \ |0 D X , \ | P t P | \\ Р \ l0 X l , | d x 0 ,p < L \ t ĥ <8 | |̦ l8 p D Ȩ <ܨ \ \ Щ L X \ , L |ԫ l Ȭ 4 l ԭ T , < d L x ԯ D X < İ ,$ 0 p \ ,| L0 <ܵ | , Զ l$ P |d LD ,ع T < ĺ < < l ` ! |"< " l$ $ $T % ,% L& &( 't |( (4 )t ) ) \* *h + L+( , L, - /p 2 5 :x : l; < = =` >t > > > >( >< \? |? L@ A` B LB \B lB C C C4 LD lD D \Et F0 GH ,G` \G lG G <Il J \K K` L |P < l ̰ lP < $ X d | | LP ܺ , T h ̻| $ ` L \ L ,4 \ | ,P | L\ @ L@ lh , <t < < P l \ | , |x l4 \ H < L 0 | \ p < L, H L \ |p < l P | < | H , < @ < \@ t \ l , @ T , | < | ,l , L( D p l |@ t X l h < t , \ l D X l \ $ \ Lt | h | l@ l $ <L |d L l D | 0 \ 0 , l ,l , t \ ,4 < L , \ \h l ,L l L l h @ < 8 D L X P L L $ 0 L | H Lh L 0 l \ 0 p !( |" <$ <%l |& '@ ( ) \)0! )! *! <*" +" \+0# +h# ,# L,# ,# ,$ -$ l-$ -$ -% .\% .p% .% ,/% \/& /D& /p& 0& 0& |1,' 1@' 1T' 1h' 2' L4@( 4( 5) 7t) 7) 8* ,8 * <8x* 9* l;@+ ;T+ <l, =, <=, ?|- ?- \@ . @. |BH/ Bp/ <C/ \C/ C80 <Dl0 lE01 E\1 |G1 G 2 G(2 GD2 H2 <I 3 J3 J3 J3 J3 J3 J4 <K4 K5 L5 lL5 LM 6 \M06 N6 LO6 ,P 7 |P@7 P7 \Q7 Q7 Q88 R8 S9 SD: lT: T: U$; U8; U; U; lV4< Xx< |Y= Zd> ,[? l[X? [l? [? <\? \@ l]l@ ]@ \^@ ^A `pA <`A a B <a@B bB bB LcB cC dC |e4D fdD gD gE lhXE hlE hE <iE \iF iF iF i G j<G ,jXG LjG |j(H jH jpI jHJ kJ k K <k K LkK \kK lkPN <l|P LlR \lhT llT |lT lT lxU lU lU lV lW ltZ mZ m] |mtl mp mx m m< mh m8 ln ol od |p4 Lq lrD! u! zR x $ X FJ w ?;*3$" ( D no BDD aAB D p n BEA C(GX X A X (C ABB 8p% D0` 4 Ep BBA A(D`(C ABB pc Aa 4 _ A]0 L q BAA DP_ AABA Op@ P @3 l* Ah Gp+ Ai 8 le BBI A(D0K(A BBB p 0 < & P np% A] E AX p sp BBA A(D0T (K ABBE (D ABBE X(D ABB C Hs A p <6 AU [D p 8 D, D0g P \ d < x p H 0 BDB B(A0D8D8C0A(B BBB 9p , c BFD G@H DAB ( pO @ D 3 HR A ` t AN > Kr @ BAA G@k GABE r DABE ( o# @ CABA 2 AGPdA < _p+ PI CA Dp 8 ` BBD D(Da (A ABBA *p& T ( ACFP[ AAA o P L ,, BBB B(A0A8G6 8A0A(B BBBA ` o t* AJ0ZD 0 G BDD Go DABA sz H + BEB B(A0A8I 8D0A(B BBBA < sP 0 \ BEA G@ AABA s 8 BBA D(J(A ABB s > s$ , @ ,/ AI0`D ` ^s* D0e x $5 , P> BDD G@e DAB ,s @ D1 AI0bD 4[ A/ A r 0 \' D H X $ BBB B(D0D8G8A0A(B BBB erV ? ss , < BAA GP{ DAB 0 2sN P L $ ` lF AAD }AA (s , s LHA IP AAB, s BAA DP AAB 0 j BAA IX AAB H t D h ķ& D a s } s ! L BBB B(D0A8J< 8A0A(B BBBA H Hs $ h + ADA bAA vS ak E A AW 0 O BCA DPf AABA @ BGE A(D0DP 0D(A BBBA @ u P ` 8 t BBA D(G` (D ABBA u; ` 8 BBD A(D@p (A ABBA u @ H $ BBE B(D0A8D@K 8D0A(B BBBA ( p L2 ACD X AAA ` EPDF D ` BBE E(D0A8A@8C0A(B BBB t @ $ F A A @ yv $ T uv ADA AA | E v DA A hy AR D BIN F(U0A8DP8D0A(B BBB @ Sw P ` 0 t O LAA Dp DABA w p , a GED CIB 8 h+ BHA D(GP (D ABB 0 wS P L @ A 4 h +w BED F(G`(D ABB, BCE ABA dw{ w AS L 4 BBB B(A0A8J 8A0A(B BBBA X lw H x BBH G(D0D8Gp 8A0A(B BBBA p 4 r BEF D(G`P(D ABB R ` $ 8 $~ AJ ED ` -y x d 0 p_ BDD GPV DABA F P AN ( tw AAG0\ DAA $ G 0 8 < _ BBD A(E0l (D ABBA 0 x k BDD G`U DABA ` d BBE E(A0A8GX 8D0A(B BBBA k 8F0A(B BBBE 0 M ( P lQ BND yAB | 8 ? BBD D(C0K (A ABBA 0 L lb BBB E(D0A8F 8D0A(B BBBA @ ` ` l > AJ N AA ҅ , p BBB D(A0G 0 R U 0A(A BBBA 0 u BID G W DAB 4 P , $ JR , h D o BDD D0\ AAB , 0 8 h ~ BED A(GPP (D ABBA 6 P $ AAJ0AA 4 ބN 0 L P I D D d K E $ l 3 AHD cAA τ 0 l BDD G` DAB ` 0 BBB B(D0A8G 4 D R 8A0A(B BBBA 4 | @ 8 BDA A(G`_(D ABB ge ` , ) F_A H ( 0 BMB B(A0A8B@ 8D0A(B BBBA P 8 @ p ! G 0 Pa BBB B(A0A8G 8 T= G 8A0A(B BBBA P 8 L BBA D(FP (C ABBF L h P h | D p D b A F 8!} 7m ZZ !F x $ AQ , 4 N H $ DQ ` 2 H x D!% Ac < X!c BGB A(D0 (D BBBA ˈ 0 h" AZ ( \"@ HDE kAAA L p d X" x 4 P" BBA D(A0(A ABB 0 AI $ p"q ACH bAA 4 7L L L p BBB B(A0A8G? 8A0A(B BBBA > @" ( L"4 BAD iAB . L D" BBI B(A0A8G 8A0A(B BBBA h L 4 BBA A(D0 (D ABBB (A ABBJ ( 2 0g(A ABB 8 r BBD A(D0 (D ABBA @ Ï 0 , \ D` F X H _ A ] B ` AGPV AA ? AS 8 й BBA C(D0 (D ABBA ! f 0 4! >% Ac L! = H `! > BBE M(D0A8GP 8A0A(B BBBA ! P ( ! AAG i AAA ( ! d AAG Y AAA $" C 8" ?< A< T" Ǝ H h" ļ BBB E(A0A8D@8A0A(B BBB " n6 @ " XB AG xA " d ( # pp IAD ZAB $ 8# '$ I ABE `# AV 4 |# AAD j AAF T AAB # ύ* cAA, # IIH t ABG $ h $ U BBB B(A0A8J 8D0A(B BBBA NLFFFFX $ . < $ IBE D(D0f (A BBBA $ # 0 ` % 0 BBB B(A0A8D@ 8D0A(B BBBI 8A0A(B BBB 0 p% E @v8A0A(B BBB % xT HK % u ` % BBB B(A0A8DP 8A0A(B BBBK 8A0A(B BBBE <& B P \& $ p& " AAG UAA 4 & : K DAE V DAB AEA & 4 & (v AAD N DAG y DAA ' 2 4' XX IvD P' d' D x' BUE Q( HBL LL\ H ' BEB B(D0D8LP 8A0A(B BBBJ ( # P H ,( @ BUB K(F0F8GP 8D0A(B BBBI x( $ P ( ( ( vO CC ( Tv) ( e H ) \ BEB E(D0A8D} 8D0A(B BBBG L) , H l) BNE E(D0A8D` 8D0A(B BBBI ) ʌ6 ` ) u- ) ̌ * A * $ H (* 4w BBB B(A0A8D` 8A0A(B BBBH t* mb ` * t < * 4 BBB A(A0K (A BBBF * [s 0 < + ~ WGE ] ABE A H+ n8 d+ @ x+ Sx E v J n A IAw A C A + sw Ae A C A + # + , , P AY F B @, ы> d X, 9 REE B(A0A8Gp 8A0A(B BBBH LCp , 7 p 0 , L+ AAD s DAB ZDA - s\ AZ ,- + 4 @- +N IAD LBI rAB x- ! H - r BBB E(A0A8G` 8A0A(B BBBA - ǥ ` H . <t BBB B(A0A8D@ 8D0A(B BBBA L. @ , l. + D` F X H _ A d B . k ` . -F . J 4 . D- AGKpu DAC k DAH / . @ $/ . BBB A(A0DPF 0A(A BBBA h/ ? P / 1$ / ƥ AT ( / 1 JGG AAH 4 / 1 AAD _ DAA a AAB 0 ` YAA< 80 d2 BBB A(A0 (A BBBA x0 . 0 H 0 3 BBA D(D0 (A ABBK (A ABB( 0 \ 0T(A ABB 1 60 $1 86+ 81 T6 L1 P6 `1 ¤ A t1 H6D 1 6# H 1 6\ BBB B(D0A8GP 8A0A(B BBBA 1 G P 2 7 2 2 8 02 7 LBA A(G@c (A ABBA ( l2 P8w ADG0H CAH 2 ã 0 < 2 8 BEE D(A0 (A BBBG 2 sS 0 ( 3 q2 BDD `AB <3 z < X3 9 AAD0M AAK o DAD DAA 3 1 0 < 3 9 ADG0n AAL o DAD DAA $ 3 <:, ADD `AA 8 4 D: BED F(D@ (D ABBA T4 A @ p4 :[ AY < 4 ; BBE D(A0 (D BBBJ ( 4 T 0A(A BBB@ 4 <i BEE A(D0G@ 0A(A BBBF <5 % @ H \5 @ BBB E(D0H8DPC 8D0A(B BBBE 5 ^ P 5 4o! A_ 5 A! A_ 6 ,o$ AQ A , 6 @oS BAA A ABA , L6 po] HHD y AAA J $ |6 pA7 AJ AF 6 6 pD? G F 6 E G F 6 $o! A_ , 7 8o BGD V ABA D7 # `7 F 4 t7 F BAA g ABB | ABA 7 A ( 7 tF KAD b DAI 7 $ L 8 0G BBA A(DP (D ABBA A (D ABBA \8 s P x8 HD 8 8 HN 8 # A 8 I 8 n! A_ $ 8 dJk Y H nAA 9 8 89 Kq A\ B X9 I p9 K 9 D 9 tmT , 9 mc BHD M0@ DABX 9 n VRE B(A0K8NHBPQHB@Z 8D0A(B BBBE < 8: @A 8C0A(B BBBE L x: TK BBB B(A0A8G 8D0A(B BBBA : 8 : U BBB D(D0(A BBB H $; U BEB I(D0D8D@t 8A0A(B BBBD H p; lV\ BEB I(D0D8D@R 8A0A(B BBBF ; Wx Q f ; Wx Q f ; PX P < LX( BDD G0A AABJ V GABH n AABF < T< (Y BBB A(D0t (A BBBJ < ^ { f < `_- ( < |_@ BDD kGB < s PAB = l_ T Z B ` H L 0= <` BBI A(A0 (A BBBF (A BBBB = ,kI = hk < = dkH BBB A(A0/ (A BBBA = < 0 > Tlc @ > ll BEE D(D0D@K0A(A BBB `> O0 @ ( > a_ FAA f ABG > 3 0 > by BDG G@L AABA > @ < ? b BBB A(A0 (A BBBA X? 0 x? lp XX E z ? d ( ? `d AKI DAA ? ) ? l` A^ @ K $@ d A\ A D@ ٝ L \@ 0e FBB A(A0f (A BBBG P (A BBBI @ `l/ Am @ v ( @ e ADD ~ DAA A ? AAA( $A l| ADD0B DAA 8 PA ll BBA A(E0 (D ABBA A h 0 A $m A ; DT _ $ A m- AAA gAA $ B mF ADA }AA (B Ɯ @B ,m7 Au \B < tB 8m BEE A(D0G@0A(A BBB B X @ ( B m: BDD lAB C & C mn Ag A <C . TC c hC $ |C 0d AD0~ AD uA C ś 0 4 C mj BED A(D0S(A ABB C ( 0 ( D dN BDG }AB $ <D m A DBB 8 dD d BBA D(D@h (A ABBE D @ D `d H D \d BBB B(A0A8D` 8D0A(B BBBF E ` ` 0 <E i BBE H@J EBBD pE @ ` E jg BBB B(A0D8G` 8A0A(B BBBI r 8A0A(B BBBD E ` F k) D d (F <F k 8 PF k BBA A(D0W (A ABBA F 3 0 F kU F l $ F jK AGA AA F Λ G j $G k" A` <G PG jH Hz A lG $ G j? JGA jAA G I @ G \k/ AAD0r AAB z DAA I DAE , H x 0D GAE D AAE ( 4H l ADG@E AAE `H Lj9 Aw |H pj $ H ljF HMR YDA H dl G $ H l* ADE ]AA H v , I l BAH P ABB DI 8 `I i tI i I $m G 0 I mt ACIPF AAK QAA I P I m J 5 Y[ X J n BEB B(A0D8G`w 8D0A(B BBBE r 8J0D(G BBBK y 8A0A(B BBBE b 8A0A(B BBBL V 8D0A(B BBBE 8A0A(B BBBE \ 8A0A(B BBBE ~ 8D0A(B BBBE 8A0A(B BBBE ] 8A0A(B BBBE X 8D0A(B BBBE 8A0A(B BBBB h xK Z `[ 8A0A(B BBBE o 8A0A(B BBBE p 8A0A(B BBBE H K r BBB B(A0A8DPl 8D0A(B BBBI 0L ]z P PL <t1 AY E M pL ? Y A L f L f L f( A& L vs ( L s~ BHD lAB M ( 0M g. BDD \AB \M d3 xM sf Dn F W A M [ ( M u AAD0h AAH M 1 0DAA M ft Ar N ,N @g ( @N up BAD0B ABA lN # 0 , N u BDA n ABH N 4 N <vd ADPs JN \ AC A JB O K P O \w 4O Xw BBB D(D0Dp' 0D(A BBBD 0A(A BBBH d 0D(D BBBF N 0G(A BBBB O p O y9 Aw O m L P y BBB B(D0A8G"t 8D0A(B BBBA XP "p "4 xP $t AAD G DAA Y AAA P : P T G L P BBD A(Dp` (D ABBA (J CDBE ( 4Q ՙ pK(A ABB `Q L tQ - BEB E(F0D8Dy 8D0A(B BBBA Q [ 0 Q c ADM f GFE DOA L R BBD A(G@K (A ABBB X (D ABBA hR zf @ , R BMD ABA d R ؓ BBB B(D0A8G` 8A0A(B BBBE D 8A0A(B BBBA S ,l ` ( <S AD w DA w AE hS t~ A| S 0 S 1 D S I S 7 HO A Z S ] LPd S L BBE E(A0D8Dp 8A0A(B BBBF 9 8H0A(B BBBF 4 XT tW pD 8G0A(B BBBE ( T `, BDD ZAB T g H T dN BEB B(E0A8G 8A0A(B BBBG $U DU h`U XU 4O Az E tU h0 AG Y AA U H U \: BBA A(G0 (A ABBF o(A ABB U 0 $ V _B AHA uAA @V XV `, Aj tV V ` H V BBB B(A0A8Dd 8A0A(B BBBD V / ( W P AFJ AAA 8W PW L_< ` dW BBB B(A0A8GP 8A0A(B BBBB 8A0A(B BBB W k P L W Y BBD A(I0 (A ABBD K (D ABBL 8 8X ^c BBA D(D0< (A ABBA tX ˖ 0 X X $ ( X a AAN DAA X c. < X x ADE ~ AAE R AAE IAA <Y aA A XY 4 pY a} BBA A(DPi(D ABB$ Y q PwXY`UXAP 8 Y ,J BAA M DBE k ABA Z ` (Z $ <Z Җ AD t DA `Z AD Z AH Z -7 ( Z Pa@ BDG oAB Z H Z Hai BBB B(A0A8B@ 8A0A(B BBBA 0[ @ @ P[ Lb" A` h[ Ȗ < |[ ADD } JAB t DAA bGA [ 1 [ , [ ax BAA W ABB \ U WDB <\ b: Aq A X\ 3K L l\ p BBA A(B0 (D ABBA k (A ABBE , \ A 0Y (A ABBE H \ BBB B(A0A8DP 8A0A(B BBBJ 8] ߕS P @ X] BBB A(A0DPz 0A(A BBBA ] Ε P ] P$ @ ] l BAA G0t AABE _ DABE H ^ x`e BBB E(A0D8I@ 8D0A(B BBBA `^ U @ ^ N M` A [ ^ +* ` ^ } BBB B(A0A8GPy 8I0A(B BBBL 8C0A(B BBB _ ٔ- P <_ б QF 8 T_ رN BED A(G0 (D ABBE _ [ 0 \ _ P` BBB B(A0K8MZFQB 8D0A(B BBBA ` qk ,` P G H` \` вL BHE E(G0K8MQMOA^ 8D0A(B BBBD EVA NSBEOB ` P @ a l BMG IESA\ CABC Ta @ pa , AGG0[8B@K8A0S AAA P8J@F8B0 d a x BBB E(A0D8Du 8A0A(B BBBE 8A0A(B BBBO 8 b 0 I 8A0A(B BBBE Xb tU Qk A tb g H b k BBE E(D0C8A@S 8D0A(B BBBA b !f @ b 4Y A] A i A c C 4c X D A A Pc N ( dc ju BAD _ ABA c & H c BEB E(A0A8Dp 8D0A(B BBBD c ΣC p d ( ,d R A e E 0 $ Xd h AE J G B N d d 4j" 8 d BED D(DP> (D ABBA d - P ( e ~ ADG0% DAJ 0e 0 , He f BAA G ABB xe 0x H e BBB B(D0A8G`g 8D0A(B BBBA 0 e @F `q8G0A(B BBB f D E 0f 6 A G E Pf Ab I pf d f Q BBB B(A0D8X`o 8G0A(B BBBL U 8P0A(B BBBE 4 f l. `D 8C0A(B BBBA ( $g AGD0Q AAA Pg 6" 0 $ hg gN AAA HAA g g g g g 4 g k AAG AAG r AAE h ( h Lg) A\ A <h C ( Ph AGG0j DAA |h 0 h g G h g $ h g, AAA fAA h F H i g BFB B(D0D8DPg 8M0A(B BBBE H Pi g BBB B(A0D8D 8A0A(B BBBA i 8 i (R BEE D(G0s(A BBB 8 i dh] BBB A(A0J(D BBB $ 4j h/ AGE RGD \j ڢ ACA |j ph AL H j th BDB H(A0A8A@R 8A0A(B BBBA j X: @ L k BFB B(D0H8J 8D0A(B BBBA Tk " tk hi H k diU BEE E(D0D8D`b 8D0A(B BBBA k ` , k 8 BDA x ABF $l I $ @l kS AFA HAA hl & Z AAE 4 l ` ADD DAG K DAH l Ƥ7 l j4 Ar < l j BGH G(K0 (A BBBA 8m 0 Xm k lm n $ m ,lB LAD nAA m ;> m ,g At E l m A m d G n k 8 (n kz BBE D(A0d(A BBB dn ̣ 0 n lQ S t A E @ n h BEB G(D0D@ 0D(A BBBA 8 n l BBD A(A0o (D ABBA $o &r 0 @ @o \l BBB D(D0D@ 0D(A BBBA o 8c @ ` o HJ BBB E(D0D8DP 8A0A(B BBBG 8F0A(B BBBH p @ P (p n, <p n A@ Tp BBB D(A0L@ 0A(A BBBK p Ǣ @ $ p o> AGH kAA p 9 4 p o BBD D(Gp(D ABB 0q p < Lq po BEE A(A0 (D BBBA q C 0 q oJ A} A q D q o& Ad q s r p> BDG $ ,r V h ABA Tr oN AL lr r p A r s r H r p BBB B(D0A8D` 8C0A(B BBBA s 2 ` , 4s q BAA G0q AAB ds p 0 , s c BAA ABA s . ` s BEE E(D0A8G 8A0A(B BBBD RNNI\ 0t ʣ Pt , G lt t t <qI t i t dqj AJPZD t P P H t q LBB E(D0A8DPZ 8A0A(B BBBA ,u 0 P H Lu q1 BEE E(D0C8DP 8A0A(B BBB 0 u 0 Pa8A0A(B BBB u r` AY A u u 4 v r BBD A(E0(A ABB <v # 0 8 Xv 4sk BAA ] ABA (H0Z(A $ v n ABJ v ? Hv v K H v t BPG I(A0A8GP 8A0A(B BBBA <w P 8 \w BBA A(D0o (A ABBA w [ 0 H w j BEB B(A0A8G 8D0A(B BBBA x H x BEB B(A0A8DP2 8D0A(B BBBA lx ͵S P x * Ah x x + Df x ǶP x / Dj y y u+ Ai 4y Ķ Ly BEB B(A0A8Dt 8D0A(B BBBA BPAoEEESMLDMAGS)GGBSBBBAALiKNADdA~BFGIhLDFSMBBBAAL3BhDLLBMDGZHEEEZ @ z GS LeAAVA { V 4 ({ ? BBA D(Gh(A ABB `{ ! 4 |{ IDA p DBL I DKG { W 4 { AAD | AAD T AAB | L | I BBB B(A0A8G# 8D0A(B BBBA p| & 8 | l BBA A(D0 (D ABBH ( | (] 0R(A ABB | j k v A } = H (} D BEB B(A0A8Dp 8A0A(B BBBF , t} pxGOxAp } } p& Ad } Y } p AV ~ 4 H ~ \ BBB B(A0D8Gp 8A0A(B BBBF l~ $ p $ ~ C BX E O E F E ~ 2 Y A L ~ BEB B(D0D8G> 8C0A(B BBBD X 8F0A(B BBBE 8M0A(B BBBE G 8M0A(B BBBE [ 8F0A(B BBBE Q 8L0C(D DDEE | AV < 1 JDG s AAF W AAG k ( < @ @ F BBB A(A0GPo 0A(A BBBJ P > Ab A Y Ā mN ` D: A Wa 8 BBB A(A0Z (A BBBA X h 0 x tm* Fb ?& H BBB B(A0D8DP 8D0A(B BBBA P mU FJ ( C 0 @ \o AAG n GFL IPA 8 t BJD D(D@F (A ABBA = @ L ̂ l BBB B(A0A8D 8A0A(B BBBA < ` 4 P lK BDD t ABA AAB 5 AG W AA L . BBB D(A0F (A BBBH O (A BFBF l 0 H ` BBB B(A0A8DP~ 8D0A(B BBBG h J P $ n BDD0]DB 0 Ȅ ܄ Po % ( AG q AF D GE H D BIE E(H0D8FP 8A0A(B BBBH ( o ADG k AAA 4 ne ADE W CAA b DAE @ ADD d AAA \ AAB DAE P W h H | BEB B(A0A8DP, 8D0A(B BBBA Ȇ P m P BEB B(A0A8D 8D0A(B BBBA EAFXAWAuGSBYGSBBYAVGIAxFOB}MAFSETArASB^HSB T HSBARBHUA l p ! A_ L dI BBA A(J (A ABBB (G ABBB @ H BAD G0T GABE o DABA H 0 d 2 x D0_ A 0 < Dl BAA D0A GABE L DAB 0 0 X BAA G0 AABG 8 i3 0 T A G t `Y 0jM H A[ E d Ԋ BBB B(A0A8G@ 8D0A(B BBBA eHGPFHB@HRPIHA@ < @ L \ P g BBG A(GP (D ABBH l (D ABBA H P p ȋ T BBB B(A0A8G` 8D0A(B BBBF hApMhA`hLpPhB`hGpOhA` ( < h `hJpKhB`, h " BAA CBF @ 4$& BBB D(D0F@l 0A(A BBBH ܌ M% @ % @ $ BEB A(D0D@V 0A(A BBBA T ) @ $ t go AJU0LAA 5 0 (%s An A A( ԍ % AHH0h AAA 0DAA %s An A AT @ <g BBB A(A0K` 0A(A BBBA hSpDxBI` ` %V ̎ & BBB B(A0A8G6 8D0A(B BBBD FRBdFSBdFRAJFRADUB C DSBHUAARBARBHXBASAHRA3ARBH 0 ,5w BBB B(A0A8Dpq 8A0A(B BBBG | @ p @8G Đ h8 4 ؐ d8 ADD k DAG AAA ( $9> < P <9 H d H9 BBB B(A0A8GP 8D0A(B BBBA ' P D Б < D@ D @ E C E D E E E E E E E D E L J E D E F E D E D E D E E E J E D E I h 4= L | 0=E LBA A(D@ (D ABBC h (D ABBG ̒ @ > BEB B(A0C8G 8A0A(B BBBA HKAGLDNuAXB p & @ B ADD0m FAK FAE H DAA ԓ D M 0 0 PC BGD D0X AABA E B 0 < @d 8 P <d BBE D(D0(A BBB < 0 d # Ԕ 8C ( 4C` AD CC S AA n , pd G @ H e BAD G0Y GABE CAGE $ R 0l CABA L C{ BEB B(A0A8DU 8D0A(B BBBA 4 D 8A0A(B BBBE H < H BBB B(A0A8D` 8A0A(B BBBA = ` Tea AP I Ȗ X I BBE B(A0A8D` 8D0A(B BBBA hIpKhA` < b ` 4 \ @L AAG x GFJ L GFE , < L AAE _ CAA $ ė di AJU0FAA 0 T (LG BBB B(A0A8GP 8D0A(B BBBJ XL`IXAP \ W P | `d@ At A M7 BBE B(A0A8DpZ 8D0A(B BBBA ~xAGxBpxOKxApxFTxBpxFQxAp 4 + p 0 T cq BAD G0Y AABA #0 0 , W AAMU AAJ ԙ u# H `Y BEB B(A0A8FPm 8A0A(B BBBA X 8 .#J PEXJ`GXAPoXG`FXAPSXG`QXBPSXG`PXAPoXG`FXAP0 Y DX A qD \AaR aD Ț # ( ܚ b BHD AB ($ $ Yk 8 $ ( L b\ BJD h ABA x # 8 Y BKH A(DPs (A ABBA Л w#o P H ZT BBB B(A0A8GP 8A0A(B BBBA 8 ~# P 8 X [) BBA A(G0 (D ABBA # 0 4 \\ ADD r DAH AAA #X d \$ BEB B(A0A8D` 8D0A(B BBBA hKpIhA`nhIpLhB` h #f ` a T b BBB B(A0A8G@ 8D0A(B BBBA ~HHPOHA@ %' @ T c BBB B(A0A8GP 8D0A(B BBBE XJ`]XAP l X& P ` h ,e BBB E(A0A8Dp0 8D0A(B BBBB $xLKxApxHUxAp L h& pxASxDpxAAHUpxDYxAp \ `_5 An A x * H j BBB B(A0A8Gp 8D0A(B BBBF ܟ */ p 8 _| BBA A(A0^ (A ABBA 8 T, 0 H T 8o BBB B(A0A8Gp 8D0A(B BBBG +/ p 0 ^q BAD G0Y AABA -0 0 X \te BEB B(A0A8DpO 8D0A(B BBBC xGPxBp l - p X P BBB B(A0A8GPD 8D0A(B BBBF iXF`MXBP 6B P X BBB B(A0A8GPD 8D0A(B BBBF iXF`MXBP d 7B P X BBE A(D0G@S 0A(A BBBH 0G(A BBBH r8% @ X ܉ BBB B(A0A8GPD 8D0A(B BBBF iXF`MXBP \ 9B P @ | BDD G0 AABE v GABB $ 90 0a JAB @ BDD G0B AABI V GABB $ , 90 0a JAB d T h BBB B(A0A8GP\ 8D0A(B BBBF iXF`MXBPXF`NXBP ]9 P ܤ f Ad d ԑ BBB B(A0A8GPd 8D0A(B BBBF iXF`NXBPXF`MXBP ` c: P 8 BED A(G@R (A ABBA ;4 @ إ D BBB B(A0A8GP 8D0A(B BBBF iXF`NXBPXF`NXBPXF`MXAPXF`MXBPXF`dXBP h 5; P TY AG } AA =D | Ħ x BBB B(A0A8G@ 8D0A(B BBBA VHHPRHB@HFPTHA@VHFPRHB@HRPFHA@ D = @ < d xc AHG0q AAE I AAE DAA ?: 0 @X3 Am A C ܧ ?& H X BBB B(A0A8GP 8D0A(B BBBD @ ?/ P t ` ܠ BBB B(A0A8Gp 8D0A(B BBBF xJJxApxARxBpxFJxBp ب 3@ p ( 5 BDD cDB $ ~B TDB 8 H BBA A(D@I (C ABBA 9B @ ( VG BDD i KBB $ ̩ G\ T DBA V8 Av G V8 Av 8 G L V Ak A h G. H l BGB E(A0A8D 8A0A(B BBBA ̪ NG V# Aa G ( V| AHR0r AAA D G 0 0 \ Ww ADG0~ LAE ILA HG 0DDA0 ,We UMM ABJ t ; AD pA F8 b HA DD ( < m 8 P W2 BED A(G@ (A ABBA F @ X] A` zA Ȭ jF , ; BDD o CBA H BBE B(A0A8G@q 8D0A(B BBBF \ E @ | pX A] @ tX BBB D(D0G@ 0A(A BBBA ܭ F @ @ `* BBB A(A0G` 0A(A BBBA < @ =Fd ` 0C(A BBBE whIp\hA`H lY BBB B(A0A8GP 8A0A(B BBBA ̮ G P X BBB B(A0A8Gpk 8A0A(B BBBA ixJIxAp t H aG p|xARxBpIxARxBpSxHUxApxASxBpxHUxApxASxBp $ ܬt AAD kAA P/ < q AFG R AAF ` GAB XAA < @ \Q BBB A(D0P (A BBBF 8P& 0 | ,Y BBB E(A0A8D`qhGpHxEBEN`a 8D0A(B BBBA JhGpHxEBEU` O ` L @ BBB A(A0 (D BBBA D (A BBBE dQl 0 H _ BBB B(A0A8GP5 8D0A(B BBBA dQ P < [` 4 0S d H KEB B(A0D8G` 8A0A(B BBBI C` R ` H в [ BBB A(A08G@I8A0_ (A BBBA !T 0 L < BBA D(D0 (D ABBJ (D ABBF ITD 0 ( \O BAA DDB $ Գ EU@ j(A0R(A X \ BBB E(A0A8DpI 8D0A(B BBBA =xDHxAp X U p H x ԼL BBB B(A0A8GP 8D0A(B BBBE ` Ĵ dU PuXH`UXAPXA`SXBPXA`RXBPXH`RXAP XA`SXDP t ( tZ BBB B(A0D8Dp;xGWxBpT 8A0A(B BBBA xHXxAplxHVxAp ,[, p $ ]k AAD bAA \7 H ^ BBB B(A0A8GP 8D0A(B BBBA L [ P l Z Hq \< \ A \/ b A ( ̶ ADD@v AAA |\n @ D lC BBA A(G0f (D ABBA 8F@Q8A0 X \ 0 , t [v BJH D0Y AAB \ 0 $ ,\- AAA gAA H 4\ BBB B(A0A8E@ 8A0A(B BBBA l 4 X\\ @DHAPSHB@HHPRHA@HAPSHA@HAPSHA@HAPRHB@HAPRHB@ ( (^f AAD N AAA и b! $ T^] ADA TAA a ( t^P AN @ a$ $ T ^b AJU0AA | a 0 0 8 AAG AAA DAA, ȹ ^ BAA ABA Ya1 A I 0 4 8 BAA G0 AABA h a` 0 ^q AR A L A _P Ah eA Ⱥ 4_ NF d \ BBB B(A0A8G`e 8C0A(B BBBF 4 8A0A(B BBBA H ` ` $ h ^A AUM TAH , ^v BJH D0Y AAB ` 0 $ ܻ _t AAD kAA `/ , P_o BJH D0R AAB L ` 0 $ h AAG PAA `P n(D0Q(A T (_ BBB B(A0A8GP 8D0A(B BBBA {XJ`QXAP Y` P \ , ` BBB H(A0D8E@{ 8D0D(G BBBE m8D0A(B BBB a. @ H a BEB B(A0A8D`0 8A0A(B BBBA ca ` D b BBB B(A0A8A@8D0A(B BBB ` a @ 8 c BBA A(D0 (A ABBA a 0 8 ؾ Te BBA D(G0k (A ABBA ( Lb> 0m(G ABB H @ \c BBB A(A08G@I8A0_ (A BBBA by 0 H V BBB B(A0A8GP 8D0A(B BBBA b P c H , c+ BBB B(A0A8D@ 8A0A(B BBBA x 2b @ dd3 < d? BBB A(A0r (A BBBA Rbw 0 < pe, BEB A(D0 (A BBBA L ib 0 ( l q ADG0K DAA c 0DAA e. Ad T $ BBB B(A0A8G@o 8D0A(B BBBC HEPQHA@ , 8cE @ H L e BBB B(A0A8GP 8D0A(B BBBA d P 0 DfK AAD r GAE ACA `f2 =d H xf$ BBB B(A0A8D@ 8A0A(B BBBA H ` c @eHAPSHB@/HAPRHB@~HAPSHB@ D n BBA A(G0 (D ABBE 8F@Q8A0 _i 0 H / BBB B(A0A8GP 8D0A(B BBBA D \ iL PjXA`WXBPoXH`XXBPpXH`WXAP g" A` }k g^ ak , Tgx BAA a ABA < ( 3kT (A0S(B (H0R(A h(A0R(B ( h dg BAD AB mn , gg BMP F0} AAB H g BBE E(A0D8GP@ 8A0A(B BBBA , l' P L `j# A] h l C$ \j! AHD QAA $ djO AHA BAA xl H tj BBB A(A08F@Q8A0_ (A BBBA 4 $l 0 ( T Q BKD rGB $ zle W DBA H j BBB E(A0A8D` 8D0A(B BBBA kl ` ( 8lk FHA T AAA @ l ( X dlC AAD d AAA l pl' 8 l BBD D(A0b (A ABBA Wl 0 0 l BAA G0 DABA < l 0 ( X mF BAA ~AB l t mF BBE E(D0D8GuJGFSPJFSY 8A0A(B BBBA 9l` 0 8 Dr BAD G DAB l El ( rD AAD w AAA 4 Y BHD Q ABF fGB 8 rC BEE D(G0`(A BBB ( ( k. 0d(C BBBd T BBE B(D0A8D`" 8C0A(B BBBA 8D0A(B BBBE 3k ` H r LBB B(A0A8D 8D0A(B BBBA ( k H d \ k $ p sf AJU0CAA k 0 ( sf AAD N AAA |k! 7 qk h BEB B(D0A8G 8A0A(B BBBA EFFFIZ k , Ds BAA ABA Uk] < NBB A(A0i (A BBBA 4 Vl 0 ( T H KAG AAJ l ( sf AAD V AAA |l! P 8 L BBA A(G0 (D ABBF , 5lb 0 H { Ay d _l: | Yl Tr , BGD ABA lD O A@ E X 8 q BEB B(A0A8D` 8D0A(B BBBA hFpQhA` kH ` p 8t BEE B(A0A8GgLiAR 8A0A(B BBBA GGGV ( fl d H 4. BBB B(A0A8GP 8D0A(B BBBA XJ`IXAPXP`IXAP m{ P , ,j BAD @ ABA o ( P AAD0 AAE H o 0 ` LP Ah eA , | BAA ^ ABA [o ] BGF0 8p 0B ABA H 4 BHE E(D0D8DP 8A0A(B BBBA \ p P H | BEB B(A0A8D` 8D0A(B BBBA ;q ` Ă, Aa E q% d, v BJH D0Y AAB L q 0 @ h A BBB A(A0G@ 0A(A BBBE eq @ p( , | BAA ^ ABA q , @| Ao A H % YK T ` BBB D(A0G@f 0A(A BBBH D 0G(A BBBF , ?rH @u0G(A BBB ( ^ AFD DAE +r L , BBB D(D0V (D BBBB G (A EBBA | t 0 4 0s AAD z CAD N CAA Mt H ` BBB B(A0A8D@v 8A0A(B BBBB 8 tk @ , X BJH D0h AAB tM 0 ( Xt BAD bDB #t Ai E t L $ X cCG0 AAH o AAG X AAF `L0 t s/ 0 X BEB B(A0A8DPjXG`JhBpIPa 8D0A(B BBBA xs P @ tv BBB D(D0D@ 0D(A BBBA L u @ , l v BJH D0Y AAB 5v 0 @ D> BBB D(A0J 0C(A BBBE ( @ BAD b ABA ( u 4 D X ADPs JN \ AC u JB | u P 4 R BGF D(G0o(C ABB P Ah eA @ P BAD J0/ AABA j AABA 0 t 0 ` L BBB B(D0D8GPh 8G0A(B BBBE y 8A0A(B BBBA dt P , \ BAD Q ABA t+ 4 v BJK I(G@H(A ABB T HF L y H l BBB B(D0D8GP 8J0A(B BBBE d Ht PS 8D0A(B BBBE D 8I0A(B BBBE [ 8C0A(B BBBE 4 BBD D(DP(A ABB X /t P D t x BBB B(A0A8DP8A0A(B BBB s5 P @ T LL KBA A(G0 (A ABBD D (F ABBA Y H ~s! 0 < d 8 BGB A(A0D@u0A(A BBB Cs @ 4 H BEE E(A0D8DPv 8A0A(B BBBF 8 r2 P ( X ADD E DAE s. H BBB B(A0A8G`Y 8A0A(B BBBA |s ` 0 AAG0T AAA \AA( < p BAA _ ABA $ h s5 A ABE , ̀ BAA l ABA {sT BDD D0 $ sM 0O AABA 8 ( BBA A(D0 (A ABBA d xsD 0 G A s \ BBB B(D0A8G 8A0A(B BBBB _EWASEWAFR^B @ 4 s* KXBHeB x D 0 P} AED y AAK cDA $ A ACD vAA t Ak I 5 Ao H $ C BBB B(A0A8GP 8D0A(B BBBA p u P Z AD v AA ( ADA AAA Hv @ BBB A(D0G@_ 0A(A BBBG @ P xg @M 0G(A BBBE t0G(A BBB4 XS BBA D(B0A(A ABB x5 0 L d BGB B(D0A8G 8A0A(B BBBA 8 axe H X $ BFB B(A0D8D@ 8D0A(B BBBA ZxQ @ $ O SG ^AAA cx+ < X BGB A(A0D@~0A(A BBB D 6x5 @ $ d i AJU0FAA #x 0 \ Z BAA G0t DABJ d DABA ~ EABE D GAB w 0 H BFB B(A0A8G@ 8A0A(B BBBA l wI @ < ̄ BEE D(D0] (A BBBA w 0 I Dz A w6 0 C Aw A L w6 , ` BJH D0h AAB wM 0 e w AZ 4 0 AAG AAA W AAE ( wO W DAE dDA < dz B hH \ P p w' D \ A 0 , BAA ABA Fwb A^ < A BBB A(A0r (A BBBA H 0ww 0 H h BBE B(A0A8DPT 8A0A(B BBBA ;w P H BEB E(D0A8D 8A0A(B BBBD {wf , @ L BAA Y ABA $ p w U(H0R(A H Ćy BBB A(A0 (A BBBA M8F@F8A0 w 0 $ ؇ ADA UAA , x% 8 D K BEJ D(D0j(A BBB 0 L_ ADG j AAA bAA H 4 BEB B(A0A8D`T 8A0A(B BBBA x5 ` H BBB E(D0A8G 8D0A(B BBBA l x H $ BBB A(A0 (A BBBA q8F@N8A0 ( rx 0f8F@F8B0 L n LBB B(A0A8D 8D0A(B BBBA T y ( t H, BID YAB $ LT AAG@HAA \yT @ P { BBB A(A0 (A BBBA (A BBBE 4 Dz- 0 4 T = BAA _ DBE KAB z| < NBB A(D0o (A BBBC 9z 0 D d @ BBB B(A0D8G`= 8D0A(B BBBA Q 8I0A(I DEBE =z ` 0 ( D o E A G E \ E s{ , v BJH D0Y AAB 8{ 0 D 8 Tu BEF F(G0A8Tx8D0A(B BBB8 z O 8J0A(B BBBE $ Pf AJU0CAA <| 0 X i BBB A(A0JP@ 0D(A BBBE 0D(A BBBA X {* P L x BBE D(A0i (D BBBG K (D BBBC T JX F {: E H BEB B(A0A8D` 8A0A(B BBBA H Y{ ` h d0 VY 8 BBA A(D0 (A ABBA {P 0 H $ BBB E(D0C8D@k 8D0A(B BBBB $ z| @ $ D ؊3 AAD jAA l L| ؊E DP{ A 5|N P 8` [|I d d ( l ADD AAA AT $ ( AAD AA P | h 4 AU J [ { , , BJH D0h AAB {M 0 $ po AJU0LAA {5 0 , e D ` D {= < X BIB D(A0i (A BBBA { 0 ( 6 FDD \ DBB |( bCB $ t\ AM]0nAA ( 0 { AG e DE M DA , \ i BMP G0~ AAB @ @ BEE A(A0D@K 0D(A BBBA >{ @ H l BEB B(A0A8D`T 8D0A(B BBBA < z ` \ I AG@v AE s{D @a CA | 3 BBB B(A0A8GP*XR`LXBPk 8D0A(B BBBA XI`LXBPXF`RXBPXF`QXAP { P @ $ T = AAB rAA | {# `AA$ u AAD lAA o{7 А( Af v{0 $ Ԑ' ACDP\AA 0 j{I P H ĐP Ah eA h tU AH E D Ԑw BBB B(A0A8G`T8D0A(B BBB4 { `a 8C0A(B BBBA 4 F L y D 4 BBE B(A0A8B@8A0A(B BBB | 5| @ |) D d L BEB D(D0z (A BBBB S (A BBBB , , { 0q (D BBBA \ \ p BED D(G@^ (G ABBH s (G DDBE c (C ABBA $ ,o AJU0LAA |5 0 x BBB B(G0E8G`W 8J0C(B BBBI 8J0C(B BBBE n8C0A(B BBB $ b AJU0AA | 0 ( P BHK wAB $ 4! AIC QAA < ( 4 8C AGD L AAA ` {% x D AU { Q 40 e{ 8 <Y BBA A(D0H(A ABB ${ 0 $ ( Dl ADD `AA P z h t H | p BDE E(D0A8D`5 8D0A(B BBBA z ` ( $k FHA P AAA <{ $ , P5 AGA iAA T { , l P BJH D0k AAB zM 0 $ 3 AGE VGD z ADA " AZ A pF L y 4 D H BIE D(D0Ij 0D(A BBBA (z ܗ ؗ AU y A ėM ` BBB B(A0A8D@ 8G0D(D BBBE Q 8A0A(B BBBA L p `y @o 8A0A(B BBBE [8M0A(B BBB $ L AAD WAA D: @( 0 \k BBB B(D0A8E@ 4 D @yJ @ 8A0A(B BBBA | ` $ \p ADA gAA { z) D d @ | OBA G(G@z (A ABBA @ $ T AKA AA | z 0 H/ BBB J(D0D8J 4 Gz x 8D0A(B BBBA $ ADA VAA ( ( Dq BAG0t ABA T {z 0 $ l r AJU0OAA Jz5 0 H BBB E(I0A8D`k 8D0A(B BBBA z ` DQ AG0DD 8 z 0 P l d {- x d BIB B(A0A8GTIAaQGBdHKA 8A0A(B BBBA z ; 0 m ( D l BBB A(A0 8 p 0K 08G@I8A0X (A BBBA ( BBE D(D0 , = 0] (A BBBA D BBB B(A0A8D@8A0A(B BBB d Ą @ X 8 d- BBA D(A0 (D ABBA d 0 << AG0rA ) 0 4 ( LEG D AABC ` B | ' Ae ( DL BBB D(D0 , ӄO 0G(A BBB ( T BAD IAB 0 Ƅ 0 L BDA G CAB H S BKO E(D0F8N 8A0A(B BBBA H BBB B(D0D8GP 8A0A(B BBBE 4 ߃ P H T h BBB B(A0A8G@ 8A0A(B BBBA 4 @ BBB B(A0A8Dt 8A0A(B BBBA x 8F0A(B BBBD OOBDLANOB 8 p b k 8G0A(B BBBE C D`~ #3 ` ' BBB B(A0A8GDdAQ^A% 8D0A(B BBBA mDeBUDdA h < D BGE D(A0 (A BBBA \ 0 L BIB B(A0A8D 8A0A(B BBBA 8 щ| X T* AY A F x O < ( BBB D(D0Z (A BBBA 0 h ( @ < ` BAA G0P FABA C JABE V 0 @ @ BBB D(D0G@m 0G(A BBBE 0 g @I 0A(A BBBA ( A < D P GBD D(D0_(A ABBAF0 0 H BEB B(A0A8JP 8A0A(B BBBA P ( ܴ^ ADK | AAA L d j Ax A D L BEE E(D0D8B@]8D0A(B BBB( W AAB r AAA X , JD I AH D AB < E H T h BBE B(A0A8DPV 8A0A(B BBBA EM P ! 8 !< BBA A(G@ (D ABBF < " @D (H ABBE H (F HBBE < P "Z BAA D0~ DABB D CAB 9 0 ) A] G C D BJD D(B08M@F8A0 (D ABBA 0 H 0 "M ODB B(A0A8D@%8A0A(B BBB | ߈a @ L " BBB B(A0D8D 8D0A(B BBBF ЈG @ BGL H(G0D@_ 0A(A BBBA P @ t p .L BBB B(A0D8MZ 8D0A(B BBBE ANKAj 8A0A(B BBBA 4 4u V 8G0A(B BBBE , BAD ABA P A_ KDK t (1 BBB A(A0 (A BBBA f8D@O8B0z8D@O8B0n8D@N8B0u8F@G8A0"8D@N8A0z8D@N8A08D@O8B08D@O8B08D@N8A0z8F@G8B0 8 0 8 X 4 BBD D(D@b (C ABBA ߌ @ ( > AAD0s AAA < 0 ? BBB B(A0A8G@XHFPIHB@C 8A0A(B BBBA k 8F0A(B BBBF Q HFPE HDP]HB@ZHDP\HA@HFPFHB@MHFPFHA@ \ > @H 8G0A(B BBBE HFPGHB@HFPGHA@WHFPGHB@ G$ VF H GT BBB E(A0D8Fp 8A0A(B BBBA l p ( C BDG rAB 0 XI ODG vAAFA + H I BBB B(A0A8G@T 8D0A(B BBBA l ~ @ ( ` BDD t ABA 8 (K= D0V A ܲ G H ` BBB F(G0C8GPk 8C0A(B BBBA X P x J1 D m G u" t BHB B(A0A8DXIBBI9 8D0A(B BBBA uIBBI L @ | BBE B(D0D8GZ 8D0A(B BBBA 0 ~ HSB 8 BEA D(E0x (A ABBA $ 0m8D@\8A0 8 ( TJ BFD D(G@{ (D ABBE d 'b @ H J OBB B(A0C8GP 8A0A(B BBBA !4 P ( 0[ AAD0[ AAA 0 8 0 L] BDB D(D0X (A BBBA l Ɛ 0 @ P ADE _ AAA S(G0K(B e(G0K(A k H BEB B(A0A8D` 8A0A(B BBBA 4 ` L T J BBB A(A0 (A BBBA d (A BBBE Hi 0 K 4 e BAA X ABA c(D0K(A E L , PK BBA A(G@ (D ABBF R (D ABBA < | @D (H ABBE e (D ABBE d BBE E(D0A8G`HhEpShA`ahDpFhA` 8A0A(B BBBA $! ` $ D! (A AAD xAA l! H , ! 8 BAA } ABA ! ( ! |P Ah eA ! ,KG a _C " $ " |N AAA HAA H" * `" K( D _ A L |" K_ BBB B(A0A8DM 8A0A(B BBBA " M " $ # N CAD CAA (# ͑ @# T T# AU H l# T BBB B(A0A8Dp 8D0A(B BBBD # [v p 0 # D]f BAA G0M AABA $ }g 0 d ($ d] BHE B(D0D8J 8C0A(B BBBG 8D0A(B BBBE $ ` d $ c BBB B(A0A8DPo 8A0A(B BBBA 8A0A(B BBBA % P 8 8% BAD \ ABA P(D0N(A t% M < % \ AB A _ E [ A D A C H G B A % $ % hQ AAA ICA$ & h Az A G A ` 8& d , L& ` BMA D@ DAB |& h$ @ & i < & BBB A(A0p (D BBBA & F 0 ' ( ' h ACG w AAA L' L d' h BBB B(D0F8G 8A0A(B BBBA ' ' 8 ' 4 ' s BAD F ABE xDB 4( o P( D N ( h( 4s ADG M AAA ( ˓8 ( K ( ד ( AG r CA ( D AZ A 8 ) (sy BBA A(JPk (A ABBG P) g( P H l) Pt BBB E(D0D8D`F 8D0A(B BBBF ) k D O A ) ) du5 T` , * u BKA b ABE 0* @ L* u4 BAC G@B AABA | AABD * @ ( * V ADD y AAA * T< A_ A Z * t AY + L $+ 8w AAD@ AAH K AAK KAI ^AA t+ @ 4 + y BAD s ABA LAB + Ⱥ ( + Ժ$ BDD VAB , TAB ( (, y> ADG f AAA T, ˓6 H l, p BBB B(A0A8D`J 8D0A(B BBBA , ` $ , 7 AAD nAA - 4 - Z ACG0] FAE T AAA < P- x AAG AAA h AAB cAA - - yP A} A - * D - 0D BNB A(A0GЀ 0D(A BBBA $. I Ѐ ( D. BEE D(G0 , p. |; 0D (A BBBA 8 . l BNA A(D@V (D ABBA . Kp @ < . x BIB D(A0c (A BBBA 8/ _9 0 , X/ BJM N0 DAB / H 0 P / xU BAJ D@l AABA AHTPBXB`I@xHRPBXB`I@ / > @ @ 0 j BBG I(A0G E0A(A BBB X0 Ӓ ( x0 F AO G(E0G(B _A 0 0 ? A} H 0 Ľc BBA A(GPs (G ABBE D(D ABB , $1 P (A ABBA L T1 hx BHB B(A0A8D 8D0A(B BBBA 1 L 1 d BBB B(D0A8G| 8A0A(B BBBA 2 " 42 @ A A e A X2 # p2 2 " AU E H 2 BEE E(A0A8A@ 8C0A(B BBBA 2 J @ ( 3 00 BDA _CB 83 $~ A| T3 L l3 p BBE A(A0 (A BBBF (A BBB 3 0 , 3 Jr A qIFF A F0 4 0g BJA JP' DABA @4 7 P \4 P] LP( t4 8A BDD ^ ABA H 4 \ BGJ E(I0I8Dp 8A0A(B BBBA 4 p ( 5 T D W(J0P8C@N I A H 85 BBB E(D0D8GP 8A0A(B BBBA 5 v P 5 h0 5 G 5 @@ AM@pA 5 @ $ 6 HD AGA xAA ,6 c) D6 X6 D l6 H 6 , BBE E(A0A8G` 8A0A(B BBBA 6 ` d 6 BBB B(A0D8G`y 8D0A(B BBBA 8I0A(I DEBE T7 ` t7 7 8 7 > BEA A(D0 (A ABBA 7 =a 0 7 Ȋ 8 Ċ 8 AU 88 V AP T8 " l8 0T AN A C 8 ' ( 8 \ ACF0] AAA 8 0 ( 8 AMGrDA 9 ̉ $9 ޣ AV <9 Ar A X9 £1 l9 4 AS [D 9 , 9 ( BAA ABA 9 $ 9 9 AKA iAA : T 0 0: ̈@ AIG R AAA ALH L d: ؈ BBB B(D0C8F 8A0A(B BBBA : ˨ ( : Hg ADD _ AAA ; 7 H ; G BED D(G0R (A ABBA A(M ABB d; O Az E 4 ; L BBA A(D@(D ABB ; & @ $ ; ADA UAA ; l. 8 < N BED C(E0] (A ABBE ( P< FL 0C(C ABB |< D D d A 0 < $8 BAA D0 AABA < 0 < 4 < a BHD R ABA xAB 4= ǧ PAB X X= $ BBB A(A0J@ 0A(A BBBH 0C(A BBBD = _; @ L = hm BLJ E(A0A8Gg 8D0A(B BBBA $> * D> h Du A `> 1 | t> ؙ9 BEB B(D0A8GPr 8D0A(B BBBJ > 8A0A(B BBBE x 8A0A(B BBBE > & P 8 ? x KBA A(D0a (D ABBA P? Ѧ H d? _ BFH H(D0A8GPQ 8D0A(B BBBA ? v P ? @ 0 ? BDD G@_ AABA @ @ H 4@ c BEE E(D0D8KP 8D0A(B BBBA @ P H @ ' BBB B(D0A8D 8A0A(B BBBA @ V4 A A , A L <A BDB E(A0A8D 8A0A(B BBBA A A C A A (( L A R BBB G(A0A8G 8D0A(B BBBA 8B Mm XB A lB UH B f BEJ I(D0f (A BBBA N(A BBB 8 B BEA A(D0v (A ABBA C , 0 (C <C Q AK W AA $ `C A AND hDA C H C ̜i BEF E(D0A8G@ 8A0A(B BBBD C <: @ 8 D П BBD D(F@ (A ABBF HD @ 4 dD 8 BKK H(F@a(A ABB D դ @ p D D BBB B(A0A8D 8A0A(B BBBE NGBM`A ,E Tb @ LE `~ BDD O IBE _ IBE [ CBA E R2 E = AS A E L ( E AMGj DAA F ( $F BAA [ ABF PF ߨ ( lF = ADD _ AAA F 8 F k IFB A(A0M(D BBB 0 F BAA J AABA G , <G Ц A' E \G O E A H G , BBB B(D0A8G@q 8J0A(B BBBE 4 G LQ @D8C0A(B BBB H O H # ,H =E D e E F A K 0 PH ` AAE | AAE BGH ( H 8o AAG \ AAA H 5 l H dr BUB E(A0D 0A(B BBBD 0A(B BBBG t 0A(B BBBA 8I c $ XI T< AAA vAA 8 I u BBD A(A0Z (D ABBA I $ 0 , I 4L BDA e ABA J b* 4 $J ȫ Jt A R E Z A A B A \J 8( c xJ 4 J AGM ` GAE D ODE J 4 J IAA G@b AABE ( K Q @ AABE < @K w BFB A(D0c (A BBBA K Y 0 8 K BBA D(A0u (A ABBA K P 0 ( K AJ A R E V A A $L H" BEB B(A0A8D 8A0A(B BBBA 8F0A(B BBBE , 8G0A(B BBBE 8F0A(B BBBE 8I0A(B BBBE D 8F0A(B BBBE @ 8I0A(B BBBE M §W M 8G0A(B BBBE D 8M0A(B BBBE 8F0H(B BBBE 8M0A(B BBBE j 8M0A(B BBBE M AQ M S M ? AG uA ( M t AAA V AAA N 2 $ 4N H ADA TAA \N @ 8 tN h KIB B(A0D8G`W 8A0A(B BBBK U 8A0A(B BBBA ~ 8D0C(B BBBE ghOpOhA`_hPpNhB`hGpUhA`MhGpUhB`1hNpNhB`hHpUhA`NhGpVhB` 8D0A(B BBBE LF` 8D0A(B BBBE O ` 8J0A(B BBBE ~ 8J0A(B BBBE D 8M0A(B BBBE m 8J0A(B BBBE D 8M0A(B BBBE D 8M0A(B BBBE $ P L AIA wDA P AAA P P c AP PA( Q y AFG0Z AAA 0Q 0 $ HQ $8 AGA lAA pQ u H Q $ BBB B(A0A8A@p 8A0A(B BBBA Q 5 @ Q X BN E C H R JBB B(A0A8GPN 8A0A(B BBBA `R - P H R BEE E(D0C8GP 8A0A(B BBBA R P R @ T S < BBB B(D0D8B@YHDPXHA@A 8C0A(B BBBA XS I @ xS A A S % S 1 D S U M E b A 8 S | BNA I(DP (D ABBA T 5 P 8T ? AG uA XT pT d T n BBB B(D0C8G`} 8A0A(B BBBC ] 8G0A(B BBBK T ` U @ AY $U ߪ 8U O A@ E XU ? AS A tU . U P A U D A C A C 8 U BBA D(G@\ (D ABBA V [' @ V AS 4V N Y LV T AM DA lV 0 V ^ V H V BBH B(D0D8DPv 8J0A(B BBBE 4 V c Pj 8C0A(B BBBA 0W L Ah@i AA TW ũN @ @ lW PS BBB A(D0D@ 0L(A BBBE 0 W a @j 0C(A BBBA W $ W 9 ADA pAA X 8X G A TX } H hX BBE B(A0A8D^ 8D0A(B BBBA X 52 H X BBE B(A0D8GPB 8D0A(B BBBA Y / P | @Y BBB B(A0A8GpE 8A0A(B BBBH 8H0A(B BBBE | 8H0A(B BBBE 4 Y | ph8F0A(B BBB Y d Z `1 Dc I (Z e , <Z BJP O0\ AAB lZ Z 0 Z , Z . Z %6 H Z 6 BBB E(D0C8GP 8A0A(B BBBA [ P 0[ | X H[ \[ ) p[ x& F_ H [ BBB B(A0D8DPh 8F0A(B BBBA 0 [ :0 P_8C0A(B BBB \ R a p \ A 4\ X( Af P\ h\ B A \ ק} I A | E $ \ KY I M I _ I | \ \ BBB B(A0D8DP 8A0A(B BBBI 8A0A(B BBBE H 8D0A(B BBBB 4 P] Pe 8D0A(B BBBE H ] BBB E(D0D8D` 8A0A(B BBBA ] L ` ` ] 8 BBB B(A0A8Dpx 8A0A(B BBBA 8A0A(B BBBE L X^ g pD 8A0A(B BBBE N 8M0A(B BBBE ^ DI Q H ^ BBB B(D0A8Gp 8I0A(B BBBE 4 _ 2z pL 8C0A(B BBBA $ H_ m ADD aAA p_ L 8 _ " BBA A(Jz (A ABBA 0 _ / XBBI @ _ L GBA A(D0N (A ABBA b <` # FN $ T` G LCG0nAA H |` BBB B(D0A8G` 8D0A(B BBBA ` *9 ` ` D AY 0 a H~ BAD H@e AABA $ 8a @HHYPDXB`I@( `a t AMGiDA @ a @ KBA A(D0L (A ABBA a 0 @ a BFB D(A0J 0A(A BBBA 0b /2 ( Pb MAG0 ABA |b X 0 b H ( b tB BAA zAB b b G AG0zD c \ @ $c X4 BEB A(A0GpH 0A(A BBBA H hc pXxXBBIp]xJKBBBIp c H c 0 c BAD G0 DABA d M 0 ,d ( @d C Td hd < |d s BNB A(A0O (D BBBA d W 0 d % d @ AY 0 e 48 BJQ N0 AABA <e 0 T Xe BEE B(D0A8DP 8A0A(B BBBA ]XP`SXAP e = P e < $ e 8" ADG FJA f @ G ` (f BEB B(D0G8GPXI`SXBP 8A0A(B BBBA AXI`SXAP f P $ f `K AKD xAA f & 8 f BFD D(GPd (D ABBE , (g d Pw (C ABBA Xg lg + g AR g g g BBB B(D0D8GDOAYSRBwSRBEbA 8A0A(B BBBH #BZA2 8D0A(B BBBE [JPBGVB0 h JQB h ! A[ h X D( i P AAD n DAE X 4i BEL B(A0A8Gp 8A0A(B BBBA 6xKTxBp , i pxKPxAp i # JT i = A i j AR j [ AA A @j Xj 4 lj x f0 j / BGB B(A0A8J 8 j z X 8A0A(B BBBA d j 8" BLB E(A0D8D` 8A0A(B BBBD 5 8J0D(B BBBE \k ` 0 |k ( PCE i ABA v k , k o BAD T ABB k \ CAB @ l ( BDD G0B AABI V GABB $ dl 0 0a JAB l l l xp l ʱ ( l B BDD h GBB $ m C ABA , 0m G BDC ABA `m ` |m 9 m AH T m d( SIA A(D0M (A ABBA v (D ABBE y 0 n ( QJj AE oF H 4n XA BBB E(A0A8A@ 8D0D(I BBBE 4 n HK @Q 8D0A(B BBBA n 4) n )' QU n *. H n BJL B(D0D8B@X 8D0D(E BBBE 0 Ho ˯ @Q8D0A(B BBB |o ) o ) o o O AJ o d AH o = BBE B(A0A8Gp 8A0A(B BBBA 0 8p 3 pX8M0A(B BBB$ lp L AD X CA eA p ݮ) h p BDB F(A0A8G| 8D0A(B BBBA DFFFFS q 4 $ 8q 0 AIA bAA `q n xq q q q q q 0 q BAD D@T AABA $ $r @D MABE 4 Lr p BBG J(B0_(D ABB r t 0 r 8 r BBK D(D0r (A ABBA r 0 s P s L , 4s ' BDD ABE ds . s s s s s AZ s s P+ t $t 8t Lt 8 `t *b BEA D(D@ (A ABBA t @ t tL AJ t t +3 , u , BDD @ ABA 0u C Lu @,% `u AJ xu D, 8 u @,8 BEA A(D@ (A ABBA u , @ u 6 u ( v AQ E C ,v A ( @v AAG@ AAE lv n @ @ v Hg BDD D0m DABB Y AABA v %H 0 8 v (,A BBA A(E0 (D ABBE w @ AD vC @w k I DA 4 `w BAA Y DBE ^AB w 7 w ,P BS E Z A Z ( w ,j AND0x AAA x Ӫ 0 x ' R P ( 4x ,l AND0w DAA `x j AW A x ^+ H x 9 BBB B(D0D8E@r 8A0A(B BBBA 4 x % @wHEPWHA@dHFPSHB@ y AW 4y j H Hy D,Q BBE B(A0A8DP 8A0A(B BBBA y P y 8-X EO y @" AU E y T ( y P ADD DAA (z G> p @z - SBB E(A0A8DP 8A0A(B BBBK Z 8A0A(B BBBD ~ z p P ( z H LAG@w AAA { @ { 5 As 4{ h L{ ' BBB E(A0D8G` 8D0A(B BBBA HhXpBxBI`ihZpBxBI` { s ` H { 4-, BKB B(A0D8DP 8A0A(B BBBA 4 $| 2" BAD Jv DABB \| x| 9/ D A H B | ݪ < | | BEB D(D0y (A BBBA | 0 } : $} 8} cJ L} p: E A d l} y ( } : AG t AC g AB \ } P; BBB B(A0D8Jp~ 8D0A(B BBBA xMBBIp ~ p < ,~ @ BEB D(A0 (A BBBA l~ : 0 4 ~ P< JAG U DAA f DAE ~ 8 ~ <N BBA A(D0E (D ABBH A 0 4 0 , BAD ABB AAB h tF[ | F^ aU A f < G BBB D(D0] (A BBBF 7 0 4 pk BDA A(A0X(D ABB 4 " 0 P 3 A d # U A 4 BED G(A0m(A ABB _ 0 Ԁ " 6 AY $ - AAA gAA T ( $G BBG B(A0A8DPXK`XXAPH 8D0A(B BBBA P 8 lO BEE D(D0s(A BBB T ܁ `H BHB A(A0Gp 0A(A BBBA LxXBBIp 4 F p T h 6 Ap 8i CZ E @ BEB A(A0D@| 0A(A BBBA $ dI3 ADA cDA & AJ RD 0 ا1 kE , L BHK M` AAB | ^ ` T % p < FrA ȃ ϧ ( H ADD0 AAA 0 H $ 8 BBB E(D0D8GP 8D0A(B BBBA p K P H H BBB E(A0A8G 8A0A(B BBBA ܄ $ @ P AAA JAA $ < P P Q d R H x $ H BBB B(D0D8M`W 8A0A(B BBBA ą S ` R@ AJ k AA 4S+ 0 <S ( D AAD AA p Ƭ 8 R BED A(L0 (A ABBF Ć z 0 H < Y BBB B(A0F8D;8A0A(B BBB , $ L PS $ ` 9 ADD0mAA R$ 0 ( 7 BAD hAB ̇ 2 LAB H R BBE E(A0A8DP 8D0A(B BBBA < ҫ1 P 0 \ S KAD F ABA d$ < oFB D $ ̈ ( D _ A , D BAA D0 AAB O 0 ` 4 So BBB B(A0D8G`M 8D0A(B BBBJ { 8D0A(B BBBH Zc ` H U BBB E(D0D8GP 8A0A(B BBBC Q P 8 $ y BBD A(A0- (A ABBA ` 0 ( | V AAD J AAA 4Wk H X* BBB B(A0D8DP 8D0A(B BBBB 0 tZ AAG o AAF zDA < [ P ( d x AU 8 BBA A(A0 (A ABBA ̋ ĩ* 0 4 BID A(D@(A ABB @ H < BEB B(D0A8GP/ 8A0A(B BBBA O P T0 An Č !* H ܌ Y BBB B(A0A8DP 8D0A(B BBBA ( P $ H { AAD rAA p $ $ 8 IBB A(A0(A BBB ؍ è 0 H BBB B(A0A8DP8A0A(B BBB D _ P ( d X BHA AB AAB ( S IAD x ABE $ Ĩ- N DBA $/ 8 0 , BIA D(`(D ABB , l k ~XBBI@ J BDB A(D0D@ 0A(A BBBA 4 @HHPSHA@vHMPSHB@ 4X ( , pn BDA cAB X = ( t Wx BAA _ ABA $ f J HLJ $ Ȑ Da He E ^ D H 4 BED C(DPq(D ABB$ ( ت P|XU`VXAP P DB R ( l } BDA rAB $ c ^ ABE H BBE B(D0C8J 8A0A(B BBBA b , @ # Aa X t l # Aa ( hVv AD | AA D DB E 4 Ȓ V AAD AAA m FAA , @ @ T M BNL A(A0G 0A(A BBB * tWi ̓ AT H x BBB B(D0A8D` 8C0A(B BBBA 0 ` P d x ) D d / Ag E A Ĕ I Kz ܔ 3 V L V BIE I(D0A8G 8D0A(B BBBG T $ < t XY BRA A(M" (A ABBA _m Е L AZ $ P BGA D(G@, l; @O (A ABBA H D Z BEB B(D0A8Dp 8D0A(B BBBA +] p 0 |X BDD G0R AABA 4< 0 < B BBE A(A0g (A BBBA @ * 0 ` | AU | K Ax E G 8 Hz BBB D(A0d(D BBB 0 , l` BAA M ABA @ M H \ BFB B(A0D8G8A0A(B BBB P Ș D` $ ܘ `; AAA uAA H `} BEB E(D0D8E@~ 8A0A(B BBBA h > @ t \ H ę X BEH B(A0D8FP 8A0A(B BBBA #o P H 0 BEE I(D0D8GP 8A0A(B BBBA | & P P X l^ BGA D(G0R (A ABBC o (A ABBE r(A ABB L ^ RDD0l AAH S AAK AAA DAAL \ _ BBB B(A0A8G6 8D0A(B BBBA L ̛ j BEA D(D0* (D ABBE k (A ABBG i 0 0 8 lE AIG R AAA XAA l l L Hm^ BBD A(A0 (D ABBE (A ABBA Xnf nP 8 nS BBD D(D@q (D ABBE , H Pl @a (C ABBA 8 x nu BBA C(GPJ (A ABBA P P Н s L U BON I(A0A8D 8D0A(B BBBA D 4 i qRBBInTBBI0 | r BAD G0G AABG I 0 @ ̞ sv BDD \ IBE R IBB [CB o$ H , 0s BEE B(A0A8GP 8J0A(B BBBE 4 x + Pe 8C0A(B BBBA v BBA A(D@' (I ABBI t (G ABBE p (D ABBA a (I ABBE T (I ABBE k (G ABBE H " @ d z P4 | x AAGn AAG s AAA l ` ̠ { LBB B(A0A8D 8D0A(B BBBA ,FAAS 0 o P < G t h 4 A(V0D8B@I py ( |y AAD Y AAA ̡ ݬ yq f gE ) t zy SEB B(A0A8DP 8A0A(B BBBD ] 8A0A(B BBBE V\ P 8 BBD D(E0T (A ABBA V 0 @ { BCA N@z DABE S AABA H zA @ $ d 8i AJG0TAA w< 0 | ` ̣ ~ BBB E(A0A8H 8D0A(B BBBA XBBI 0 @ P < BAH D0k AABA c8U@BHBPI0 f 0 P | BAK [ DBI Q ABE m ABE f ABA j x KBA A(G (D ABBD ` (D ABBG P (I ABBE S (J ABBE X ϫ Q (F ABBE Z (A ABBE hE ' 8 BFA A(DP (D ABBA 4 \ ADG@c AAG AAA @ \ AJ OA ̦ &h A(X0B8B@I 4 BAA r ABA AIB ( 2# 0 D BAD G DAB x p h BBB H(A0A8G 8D0A(B BBBA [BBIbRWA ( ԃU < H P EBB B(A0A8A@} 8A0A(B BBBA @ @ 0 Dk L Ԩ X ~ BBB F(A0A8J 8C0A(B BBBA 4 $ #a &YDBI \ P" $ p L") AGF XAA $ <"5 AAA hDA ة WCA 4"M AC ̰ A A 0 L" D AH 8 \ BBA D(D`j (A ABBE ^& ` 8 ! BBA A(K@ (A ABBA ( ,e @HHVPDXB`I@ 0 $ 0 |"b KFD0GDA X ) 0 p " AY "H A? A Q , ԫ #{ LFA D0\ DAB . 0 # 4 AY ` L # BBB B(D0C8E@P 8D0A(B BBBE T 8A0A(B BBBE 0 # @V8C0A(B BBB4 $F BED A(A0o(D ABB X 0 8 $ AX T < l # BBE A(C0 (A BBBA ( P@ 0t(A BBB ح d$m AD0w AA $@ AI tA L 4 8" H @ \ $( Dc t H $ BBB B(D0D8Gpd 8D0A(B BBBA Ԯ ʮ> p x ~ BBB B(A0A8DP 8A0A(B BBBB t 8A0A(B BBBJ H 8A0A(B BBBF p l9 P ( v ADG0\ CAA Y@ 0I IAE ' < ' BBA A(G (A ABBA 4 ! H P ( LBB E(D0A8DPZ 8A0A(B BBBA 0 P (2 N c 8 )q BEA A(GP (D ABBA b P $ , 0*H AAA BAA T 8 l @*@ X g ű T* AY ı ~: D0f A X ,* BBB A(A0D@L 0D(A BBBE 0A(A BBBA < 1G @ 0 \ * BTA G@U DABA $ @ p}C v 4 Բ * BBA A(GP(A ABB 1' P ( D}F < ( ( P <+q AAD`X AAA | ` (} ( d+8 BAA pAB Գ d. \+ A| Z2 A A 0 ( | BAA JPg AABG \ <6 P x ~ ( P+T D _ A A(Y0D8B@I 4 + AAA | AAA Y EDE ް $ +7 ADA nAA 0 ` H + BBB B(A0G8G 8D0A(B BBBA M[BBI Ra ̵ `.. Al | BEB E(D0D8G 8A0A(B BBBA HRNCgJ[BRCVB h % D A O E ؾA 8 - BBD A(A0 (D ABBA ɾ 0 .F , @.t Ar @ H x BDD \ FBE R FBE [ CBA V2 8 D. BBD A(B0 (A ABBA 0$ 0 _ A H V # 8 d. L ` . t ( . BAA } ABA Ҿ ( и ., IAA _ ABA L [N BBB A(A0 (A BBBA x (A BBBE , h 8 0 (A BBBE , \t BAA J@a AAB ȹ ξ @ \ D`J A ? Ao E \ ] BEE B(D0D8GP@XS`NhGpBxGZPO8D0A(B BBB | " P `]2 Hf P D Ⱥ t] BEE E(D0D8B@X8C0A(B BBB @ H 0 BBB B(D0C8GPT 8D0A(B BBBI | ! P ( ]V BDD } ABB Ȼ e CAB @ ( ] AJJDA , $ D ]$ A A ` 8 t ^ BHA D(DG (D ABBA T ̼ p Dj A } E ^ , ^ BAA a ABA D ` KM x ^ AV ѽ ^ ^ H Խ ^V BBB B(D0A8DP 8A0A(B BBBA SR P H @ 4 BBB B(A0D8Dp 8C0A(B BBBA , 9 p~xJMxAp _. о (_m |- p_ l_ H 4 h_k BBB B(A0A8DN8A0A(B BBB 4 ! D 8A0A(B BBBA T_ ̿ L_L AG ~D = a CA ( \_y AAD ~ AAA L d _< AG h AA mN 4 ܄p IDD O ABA AGB k H_ T_ : 8 0 BBD D(G0 (D ABBA l 0 ^ A\ @ ( ^R AAD @ AAE 3 f DAA , Dg 7 0 ^ D 4 D \ M F d XG x G ؾ H Z BBE E(D0A8D 8D0A(B BBBA 8 4 BBA A(D@a (A ABBG p > @ ( ]Y ADE { DAE ˾A X CAA ]M HD ( ]W AAIIAA $ < ] ( P ]F QCA -AB | Q c( GZ A d @ m BDD o ABL S GBB CAB ½" < c P c d c x c$ A` H x BBB B(A0A8D` 8A0A(B BBBA $ ` ̈ $ (c: AAA tAA ( < S JFA g AAA h ; L | c BBB B(A0D8D 8A0A(B BBBA ܼl 0f (f? A} 0 H 4f' Ae ` $ t ؇N D q E I E 1 p f+ < f LDE D(A0D@^0D(A BBB gZ @ 4 8f6 N g L `f$ ` u t ( $ $N FD0` AA _ ,f (fZ Am A j , hf BAA k ABA ϼa 0 f $ D fH ADA AA l ؼ x* De A | A^ ̼A $ `fF AKE gAH Ѽ ADA $ hf< Az < A P |fc A] B B p & d f' BS E L 8 f BBD A(D0 (D ABBA _b 0 L Lg, BBB E(A0A8G 8D0A(B BBBA P U p k> AJ qA , ( _ ADD0 AAA ' 0 j j 8 j BBA F(D@a (D ABBA P @ 8 l k BBA D(D0x (D ABBA Q 0 $ Y LAG0BAA (% 0 k' ! 0 , O ADL W GAE TDA ` j t * BM E U H x BIB B(A0A8G 8C0A(B BBBA j( 9 AQ A e H j BEB B(D0A8D`] 8D0A(B BBBA ` ` je Ac l% 4 pd BHG ~ ABA HAB 4 Y BDG w ABA HAB j < 0 j BEB D(D0D@0C(A BBB p H @ lk BBB B(A0A8DxMAAcSIA]t 8D0A(B BBBA wMAAP U ` < mf BFB B(A0A8G 8D0A(B BBBA (LDBI , s BEB A(D0D@ 0 N @D 0D(A BBBA $ t6 A\ A W D ; X $t BAA $ x C H ABA < |t BQE A(A0G@0A(A BBB % @ u@ X g , 0u ( @ ,uQ AGA x AAA H l `u& BDB O(D0D8DP^ 8A0A(B BBBA K P $v v@ X g 4vX A] N 4 Y0 L `v BBB B(A0A8DP 4 P P{ 8A0A(B BBBA v ( vB BGD qAB v! BZ , k" X A H H v 8 \ v BBA A(K@ (A ABBA ( !p @HHVPDXB`I@ $ hwb KFD0GDA = 0 w , AY 0 w D w@ X g \ p w wB AF@yA & @ w w w 0 |@ AIG R AAA ALH , } @ J T Hw 0 h DwF BMA Gp* AAB p D| ( @|B BFK kAB ( H|m ADG S AAA @ m X t| l H l|N AD | @ | BDD G0C AABA O GABB <| 4 H t|K A{ A d mF | |; EZ E R {< {( |6 BDD hAB s AGB {H AF ? 8 8 | BDD ABB N ABA < t | BEE A(C0S (A BBBA 8}a AD I 5 f A l}" AU E 8 }u BED A(A0\ (A ABBA H e; 0 ` d zU BBB B(A0A8K 8A0A(B BBBA rVDBI $} A^ L ,}? BEB B(A0A8G 8A0A(B BBBA P d p O AM ٽ < BBA A(GЀ (A ABBA Ѐ ȁ AZ ́C AA < ( ( T @ BAD o ABB ҽ CAB ~K A~ F D - D BGB L(K0A8DP8A0A(B BBB $ b P D H X D l @J AH A \ X d O ( \7 ADG0_ DAB J 0e CAA ( @ L BKD { ABA l R $ > ADA uAA Ȃ" AU E $ |" AIG0MAA ( Ľ7 0a GAE DCA< 4 |d BBB A(D0 (A BBBD t s 0 , ( BDD D0 DAB 0 ( |}B AAD ^ DAA 8 `X BEE J(G0s(A BBB H G 0 H h D} BBB E(D0A8OPO 8D0A(B BBBA P ( 3 BDH aAB O @ @ BBE A(A0D@ 0A(A BBBA ` @ a Av F < P BEB D(A0 (A BBBA 0 @ AIG R AAA ALH , d YQ I X 0 BBE D(D0G@[ 0A(A BBBA 0A(A BBBE ػ5 @ @ @ BBE D(A0D@h 0A(A BBBF Q @ 8 ̉ BEA D(G0 (D ABBA L E A 4 h t AAG P AAE x AAA J H BBE B(D0A8DPA 8A0A(B BBBA " P $ $ = ADD nDA L AX I 4 l 3 AAG AAA O AAE oQ m DAE ~ ~( Af p ~ 0 K D x$ JF , \ `~ BAA ABA TCB ~ H ~ BBB B(A0A8G 8D0A(B BBBA $ | D HL 4 X d YEG0n DAE DAA 0 ( BAA i ABA / 8 BBA A(D@} (D ABBA , o1 @ H \ 3 Aq x 4 6 Al Ԁ Ѐ ̀ AO Ԁ Ѐ? D z ( } A{ $ D Ȁz AAA tAA l g ( ȏ$ AAD DAK $ Ār AAA lAA / $ AJD AA D g , \ `W BAD A ABB ' CAB $ ̐ CAD RAA DT AB A A I , ( D H X l @P R0y a \ d MBE B(D0D8A@e8A0A(B BBBAA@ @ , ζ AV , D xg BAD K ABA t I > L 4@ AGD0b GAE Y AAA N GAE ~ AEE p 0 H " BDB B(D0A8G` 8A0A(B BBBA l & ` Ѓ" " , NGD ABA $ 4M AFD |DA y OAAH @ < BBB B(D0D8DP 8A0A(B BBBA #e P 0 BBB B(A0D8D 4 4J a 8D0A(B BBBA 4 AX I $ 8 AAJ@}DA$ ` Z @AHXPBXB`I@ ` D BBB B(A0D8JpT 8J0A(B BBBJ h 8A0A(B BBBA ̴ p L p AAJ X AAE A AAE l AAA A GAB \ ( 8 p A BBA D(G0 (D ABBA 0 - D h ` BEE B(A0D8DP 8A0A(B BBBD X 8A0A(B BBBA D . P X d 8l BED D(DP (G ABBE JXZ`BhBpIPYXX`BhBpIP , ; Pb (C ABBA \ x T < , P BEB D(A0c (D BBBA , l ~ 0T (A BBBE D px LFB A(A0J: 0A(A BBBF m 4 BBD D(DP(C ABB < 3m P X X o BED D(DP (G ABBE KXX`BhBpIPZXZ`BhBpIP , ( Pa (C ABBA ( AF 4 AADn HAE s DAA 4 ) L AF d ( BEE D(D0DV 0G(A BBBL w 0J(A BBBH c 0J(D DBBE 0A(A BBBA ` 0J(D DBBE D 0J(D DBBE ֳ, 4 ~ AF 0 L `@ AIG R AAA ALH ~ AF T j ( L' AAD DAA 6h L 8 BBB B(A0A8Gm 8D0A(B BBBA T 6@ t }* B AY l6 `J K }, A\ Q }$ Ab ( @ 4; BMQ G(D0D@ 0D(A BBBA \ ÷0 @ , | f AJM4 AAB D P AAM@m DAE HHRPBXB`I@~HTPBXB`I@ [ @R CAA L |c BIF D(X (D ABBA {XBBI h $ }5 AAA oAA @ } BBB A(E0GP 0A(A BBBA ( ~ PHXY`DhBpIPH 4 ~8 BFB E(A0A8D 8A0A(B BBBE . ~ 8K Da L Y l ~ 0 ~ BGD G0a DBBE 4 0 + 0d CBBA w DBBE 0 h ~ BOP ^S AAB , $ BFD n ABA aM , A\ 0 f Q , H BOP TPe AAB x 0 P AX H t4 BBB B(D0A8D` 8D0A(B BBBF ` 4 hJ BG L i: ` n AY A R o- ( AAD0S DAA X 0 ` 0 BIB B(D0A8GpxaYxBpb 8A0A(B BBBA x xRH @ 7 p ` H t (J BBB B(A0A8DpR 8A0A(B BBBA g` p ( BAA AB { ( L < BEB B(A0A8Dk 8A0A(B BBBA Q @ @ KBB A(D0G@ 0A(A BBBA % @ L BBD D(G@8 (A ABBA p (A AEBE , ` @ (E ABBE <& LY 8 BBA A(D@s (A ABBA 7 @ L H BFB E(D0A8D 8D0A(B BBBA P ^ H p ܃t BHB B(A0A8Gpy 8A0A(B BBBA > p 8 P BEA D(D@ (D ABBA @ $ 4 Q AAA KAA \ Ⱥ 8 t BBD D(G(C ABB s , BKF Gp DAB p H d BEE E(D0A8GP 8A0A(B BBBA d + P ( Ȇ8 FAD ] DBE $ L b CBA H T BBB B(A0A8Dpr 8D0A(B BBBA $ N p D HJ D0@ A ` g 0 0 t h BKD D DABA ƻ 4 X BAA DBA UCB $ G < 4 BAD D0h AABA { DAB $ t 0Q CAB ( І= BDD Z GBB t CAB 8 @ BLA A(G (D ABBA ( D , Aj ` C 8 x BDD S ABA G ABB $ ܇ AF ( ԇM BDD i GBB $ S C ABA H < 0 BHB B(D0D8J`n 8A0A(B BBBA ` d BN E C < d BEB A(D0d (A BBBA 0 8 ( u JBA D(G0O(D ABB d ˻ 0 + 4 j BBA D(D0V(A ABB < 0 , Ї BAA D0 CAB , ~ 0 8 H t BIA A(GP (A ABBA , CF P (J ABBE 6 Hm = $ @ AHA sAA ( 9 < 0 P ̉4 BAA D` AABA ʻ ` 0 BAA D0 AABA d 0 ( <{ AAD _ AAA u 4 xy Ak A P ^ h ċ AG k AA 0H 89 As A C @ D D BBB B(A0A8A@z8D0A(B BBB @ @ | p T (R SBB B(A0A8GP 8D0A(B BBBL ] 8A0A(B BBBA 4 S BDG C(A0{(A ABB ̋I A A A X 8 BBB E(A0A8D` 8D0A(B BBBA hMpOhB` , M `0hMpNhA` XO sW , BJH D0b AAB h5 0 ( ċ C A H a ` N AL | = As # A\ A : L BBA A(G0H (D ABBB i (D ABBA ۻ 0 8 t AQ T ) l BBB B(J0A8JRKMB_ 8D0A(B BBBK BFAEBBXx]BENk]BENa 8K0A(B BBBE 8G0A(B BBBE 4 H ~ZEEN L L_ BBB B(A0A8D 8A0A(B BBBE H ^ tReA 8A0A(B BBBA ` BOB I(F0H8GV 8D0A(B BBBA {XBBI cp AT I , BKC Gp DAB cl p AZ 8 6 At T $ h [ AAD RAA K3 8 Z IGH E(b(D ABB 0 * ~XBBI 1 Ao D 4 ( BLP L(K0D8K@8A0A(B BBB4 | j @@ 8A0A(B BBBE OK ` BBI B(A0D8B@Y 8C0A(B BBBA Q 8D0D(B BBBB $ X ( AAD XDA H Al A @ < H $ BDB B(A0A8Gp 8A0A(B BBBA $ W> p D ȓu i x A G d (5 GG0YAA 1j 0 ,W AU , p BAA ABA 7k Ԕ H Д0 BBB B(D0A8A@ 8A0A(B BBBA h & @ 6 D q , BAA ` ABA h1 A D BBA A(E08F@F8A0_ (A ABBA d y 0 OK AD0{ AA > 0 8 ZAI AAAN JAA@ L BBB A(D0DP 0A(A BBBA l P $ BBA A(D0, Ⱦ 0U (A ABBA H t' BBB B(D0A8DP8D0A(B BBB T P H t 8+ BBB B(A0A8D@ 8A0A(B BBBA ( @ 8 i# BFK A(E0 (A ABBE ( ` 0(A ABB 8 H BBA A(D0o (A ABBA w 0 4 AAD AAA H AAB H | BBB B(A0A8GP 8D0A(B BBBA < L P < \ BBB A(A0 (A BBBA 8 G 08H@R8A08A@V8B0 $ ACD OAA , tx BAA a ABA < H dT (A0S(B (H0R(A h(A0R(B OA \ A F AW A b A $$ (^p Ad A 4 < L `^0 MaA , h BAA v ABA C $ (^r AJU0OAA 5 0 D h^ BBB B(A0A8DP8A0A(B BBB < 5 P \ ^ $ p ^4 AAD gDA ^ FPA 0 ^ AAE AAA MDA EN L_1 Ao _1 l8 4 X_ BBA A(A0n (A ABBA p < 0 _ $ _i AAIP[AA `/ Am $ `# AID RAA 8 $ ` BDD A(A0 (D ABBA ` N 0 | ` LO ` `0 An X ` BFB B(A0D8GpxXIxAp 8D0A(B BBBA p @ c( D c X ( L l BIE E(D0A8GC 8D0A(B BBBA 0c" @ Lc BHB D(I0Jv0A(A BBB 4 T c# h O A | c @ c BBB A(A0D@ 0D(A BBBA @ d AP ! 8 ! d_ BIA A(` (D ABBA , \! p qXBBI0 ! e BOM Zp( AABA ( ! \f AAD@ AAA ! h? D z " Hh? D z 8 " ph IBA D(D0p (A ABBA X" tl 0 t" hC Ay " $ " ^ ADG LDA " r KAA( " h ADD AAA # 5Z 8 4# BED A(G0 (D ABBK p# ;/ 0 # h # : @ # ( BBB D(D0F@ 0A(A BBBH # m @ H $ D BBB B(A0A8DP 8D0A(B BBBA d$ P 4 $ gc BAD R ABB AAB $ P $ G $ H $ TW FL A C % t AI M AA <% S P% A^ h% g HR A C % g 4 % JHG AAA ]A % f AHA $ % $gR ADA xDK & ) IAA$ @& <g] AL E A A D h& H & BIB B(D0A8G@ 8D0A(B BBBA & 4 & f] BID D(G0y(D ABB ' WM 0 8 4' g BED D(A0Y (D ABBA p' L0 0 ' r D0 A 0 ' 4g BCA R DABA , ' l A[BBI ( g , ( BAA DP AAB P( D P ( l( @f AKV0s AAA < ( 4gr BBE A(D0O (A BBBA ( ( DA ACD c AAA ( ) HgH FDD q ABA 0) l4 L) Q `) <g A~ B j A 8 ) H^ BIA D(G0 (D ABBG ) q 0 ` ) Pg BBB B(A0D8D`r 8D0A(B BBBA l8D0A(B BBB @* 5 ` `* t* h; dF * 8 * h LEI D(E0A (D ABBA * . 0 * T" A` + H $+ XN BBB B(A0A8DP0 8A0A(B BBBA p+ A P + < + T + BEE A(A0D@ 0D(A BBBA N 0D(A BBBA , }K @ 0, g $ D, gR AJB BAA l, l ADAD , g| BEE B(H0G8E@L8D0A(B BBBH , 8 @Q 8D0A(B BBBB I8D0A(B BBB - 4 4- g5 BDD \ DBB ACB ( l- gP AAA C AAA - 4 - ^ Df A - 0 - |gX AAF0B AAE DAA . VH 0V AAE 8. g6 N g P. g2 Ak A l. F( ( . gE BDD wAB . * AGB . H| D0C A . 0 / g AO ( / g BIG AB H/ * d/ h x/ / h / } $ / h} A_0X8F@O0nA / M 0 ( / AKV0P AAA 0 * 0 H 80 h BBB B(G0D8GP_ 8A0A(B BBBA 0 P $ 0 h% ADD WCA 0 hq 0 AY H 0 Di; BBB L(A0A8DP8D0A(B BBB D1 Ar P d1 AG0K AA 1 o 0 1 _ Dr A f 1 > 1 H P 1 i/ FBB D(D0A (D BBBA (A BBBE <2 ݿy 0 $ \2 Pkb KFD0GDA 2 0 4 2 k BBG C(A0(D ABB 2 8 0 8 2 kb FBD D(E0u (D FBBE , ,3 Z 0z (C ABBA 4 \3 ki BBA D(D@R(D ABB( 3 e @W(D ABB $ 3 lz J{ A M A ` ( 3 kT ADD w AAA 4 ,4 k BU D4 g Q $ \4 kK ADA BAA 4 9 4 8 4 BOH A(D0@ (A ABBA 4 ؿ 0 L 5 S LHK E(A0A8Je 8A0A(B BBBA X5 s! x5 k8 Ar 5 \ 8 5 k BED A(D(A ABB 5 5 $ 5 8- AAA gAA $6 hk AT @6 !V X6 Tk $ l6 Pk AAA RCA 6 Hk 6 Dk H 6 Pk BBE B(A0A8D8D0A(B BBB $ 7 ^ Z 07 k D7 L A[ ( \7 k0 BJA AB 7 % 7 l0 An 7 " $ 7 l" ADG FJA D 7 lu BEF F(G0A8Tx8D0A(B BBB8 @8 O 8J0A(B BBBE , |8 p BLK ABA $ 8 l^ AAA QDA 8 MAAD 8 BFB B(A0G8 0D(B BBBA <9 P Ac E w E `9 6 h A b H @ 9 l BBB I(F0G v0D(A BBB 9 4 ( 9 t^ BDD PAB : g NAB < 8: l BBE A(A0 (A BBBA , x: O 0C(A BBB , : CZ A I E G A ` : : ; l ; AY , 0; l PDD P ABA `; |; l ; |l ; l ; H ; pl BBB B(D0A8G` 8D0A(B BBBA < 4 ` X 8< t YFB A(A0D@e 0A(A BBBD V@ < Ľ @ < < tl) H\ < - A( < pl? KAA AAA (= @= lnG AE \= ý* H t= BBB B(A0D8D` 8A0A(B BBBA 8 = - ` 8H0A(B BBBE H = L BBE E(A0D8GPW 8A0A(B BBBE H> . P L h> / BBB B(A0A8Gg 8D0A(B BBBK > y > $m3 H` D F ` > $] BBB B(A0A8D 8A0A(B BBBA p 8H0A(B BBBE 4 \? = M 8H0A(B BBBE 4 ? l BBA A(G@(A ABB ? np @ ( ? l6 ADD c CAA @ / 8 ,@ l BKA i CBA O DBE < h@ TmW BKA D(G] (D ABBA @ 1H 4 @ XpP BAD ABB AAB @ ] 8 A BBA D(A0\ (A ABBA LA 0 $ hA p% AAC TCD A pb AH TD A 9 A(V0D8B@I A A 8 A p\ BBE D(D0@(D BBB 8B 4e 0 $ XB p1 ADA hAA B QJ B A V j B k B o D [ \ B o BIB B(A0A8DOUA_ 8A0A(B BBBE H <C 8A0A(B BBBA QOYB C C `N {O C T C p BBB L(D0A8Dp[xOQxApc8D0A(B BBB D p 8 @D \r BBA A(D` (A ABBA |D / ` ( D ACG w AAA D D D g E D E E | E Xr A L ,E `r8 BGB B(D0A8G 8D0A(B BBBA |E Z E E C AY 8 E sS BEE D(D0w(A BBB F 0 $F s AG0zA$ DF xs AFD0qDA lF ' 0 $ F sq AHA dAA F 8 F BBA G(D`N (A ABBA G G ` 4 G s BLD D(A0(A ABB TG v 0 pG t7 AG0^ AA G 8tK AI G ." T G \t BEB E(D0D8GPSXK`JhDpIPB8D0A(B BBB D H t BGH E(D0K8L@8D0A(B BBB `H % @ D H # MBB D(A0Dp0A(A BBBA 0 H Y9 pe0H(A BBBH H t BBE E(D0D8Dp 8A0A(B BBBA HI : p hI , |I @u$ I AY 8 I Duy BEE D(D0](A BBB I J 0 0 J hu` AAH ^ AAH kAA 8 8J u BBD A(G (A ABBA tJ $ $ J Lv} AAA sAA J o9 J v J + J hG AE K Xv (K X <K k BED D(B0D (A ABBE a (D ABBE A(A ABB K u ( K ADGPAA H K u BBB B(A0A8DPp 8A0A(B BBBA $L *1 P 8 DL UFG ; DBA CB$ L AAB H L uy BBB B(A0A8A@V 8D0A(B BBBA L r @ H M BBB B(A0D8G`8A0A(B BBB H `M BBB B(A0A8B@{ 8A0A(B BBBA M H @ L M P} BBB B(A0G8J8 8D0A(B BBBA 4 N 0 XXBBI TN ( hN T BDG@D ABA N @ 4 N ; BDD a GBB AAB H N BDB B(A0D8Gu 8A0A(B BBB H 0O BBB B(A0A8D`v 8A0A(B BBBA |O @ ` $ O p6 AAD fDA O O pH Al A @ O BBB A(D0L@s 0A(A BBBF <P r( @ \P z! ( pP ,4 ADG a AAA P [ ` P Xg BEE B(G0A8J 8D0A(B BBBA [BBI Q 2 8Q . KF0[A XQ 7 0 @ pQ BDO I(A0G@ 0D(A BBBA Q @ $ Q ؆_ AD i DE dC Q B R $ H (R T' BEB B(A0D8Gp 8D0A(B BBBE tR O p ( R Z TAF yAAA R R Ć 8 R p> BAA Z ABG ABD (S X/ DS h- XS W lS pj AT A S + Ai 8 S Ԇ BBA A(D0s (A ABBA S 0 4 T AAG AAA ^ AAB 8T > PT F Aw A L lT w BIB A(A0TPFXF`RXAP 0A(A BBBA T _ P T T ! A_ U ć AI U ̇ L 4U ȇ BBB B(A0A8GA 8A0A(B BBBA 8 U 8D0A(B BBBE , U ̋ BFD O ABA U M V BU $V Q <V PV AW H lV BBB B(A0D8G`o 8A0A(B BBBA V ` 8 V tu BBD D(D@ (A ABBA W @ < 0W Ly BBE D(D0D@X0D(A BBB pW @ W lW W z W , A\ W b Q W 8 W BBA A(J(D ABB 8X N L TX ( BBD D(E0X (A ABBE L (A ABBA X D 0 8 X l BBB A(C0(A BBB X 0 $ Y AAD@AA DY @ ` \Y pO BDB E(A0A8G 8A0A(B BBBA O8H0A(B BBB 4 Y 1V @8H0A(B BBB T Y ? BBB B(A0A8GPt 8A0A(B BBBA XC`FXAP PZ = P T pZ 4 BBB D(A0Hp 0D(A BBBA yxXBBIp Z 5 p Z dE A~ A [ O [ $ 0[ BBA A(E0< X[ 0n8A@U8A0[ (A ABBA 8L $ [ Dt AAD kAA [ / [ " [ p \ \ h> A| 0\ H\ t X \\ pd BEE B(A0D8G` hCpFhA`\ 8C0A(B BBBA 4 \ Q `D 8A0A(B BBBE H \ ! BBB B(A0A8D@ 8D0A(B BBBI <] @ $ \] X ADA OAA ] 4 ] BBA A(Dp(D ABB< ] pw (A ABBA C(D ABB ^ 89 Ap A 0^ 8 H^ D BBA A(GPn (D ABBA ^ > P ^ ̑K BED $ ^ * A ABA ^ ԑ ^ Б AU _ ԑ ,_ ! A[ 4 H_ BAD r(I0O(A _AB _ 2 @ _ `c BBB A(D0D@C 0A(A BBBA _ @ ` l" A_ ` I 0` lO AD B AA T` T l` { BEE H(E0D8GP 8A0A(B BBBA wXM`QXAP( ` 1A PPXK`PXBP ` | a AP 8 a BBH A(D@ (A ABBA ( \a g @wHSPDXB`I@ H a Z BBB B(A0D8G`v 8A0A(B BBBA a W ` L a BIB B(D0A8G 8A0A(B BBBA 0 Db R ZFBF]8 xb $ BEA D(E0~ (D ABBA b / 0 b : Ax b % c [ AF@NA $c e Ac @c Z Xc $) Ag tc 5 c AF@A c A]@` AA c @ c c P. AF@eA $ d `g AAD ^AA Dd ) $ \d Q AAD HAA d Q d d d ( d = BDC U ABA d AU X e BBB A(D0D@ 0C(A BBBA 0A(A BBBE 0 de l; @D 0A(A BBBE e e 4 e BAD s ABA LAB e t ( f 0w AG Q AA Q DB 8f N Pf < AF , hf 4N BDA D@~ AAB f t @ ( f 8 AAM0X AAA f ( 0 8 f i BBD D(E0v (J DDBE , 4g 8 0e (A ABBA dg I AG g g $ H g F BHA A(D`QhRpBxBI` (A ABBA ( g R `FhTpBxBN` $h e 8h & F_ Ph dh xh KP h 2 T h i BBB B(A0A8GP 8D0A(B BBBA oXL`NXAP i M P $i X ( 8i ; IDE bAA di ADA( i ؟> FDD _ DBE i =( bCB H i ȟ BBB B(A0A8A@ 8D0A(B BBBA j @ ( @j lf AAD N AAA lj ! 4 j ` BDD I ABE AAB H j `H BBB B(D0D8Dp 8D0A(B BBBA k ? p $ (k D ADD@rAA Pk { @ 0 hk $ Y AAG q AAA UAA k <P k 8 k D ; Dv k H! | k . BEB B(A0D8G] 8J0D(B BBBE _ 8D0A(B BBBA K 8G0D(E EBBE tl l l f l 4 l 8 AAD0 AAA [ HAE m I 0 $m , 8m AD0D AF AA 8 hm BED A(D0` (D ABBA m 5 0 ( m |A SAG0bAA m }o E0{ AAA n AG0G AA ( 4n x \ AAG o AAA $ `n ,6 AAD fDA n P n l D0| A p E n "T 0 n Z AK A @ n BGA D0 DABA [8U@BHBPI0 8o T 0 To ء ho ԡH AM Z AB o FA < o 3 BBB D(D0 (G BBBB ( o 0C(A BBB( p > BDD j ABB @p ] CAB ( dp V BDD } ABB p CAB L p r BBB B(A0A8D 8H0C(B BBBE q , $q Ȥ BDD a ABE $ Tq 1l N ABA l |q 0 BBB D(D0JU 0A(A BBBE 0D(A BBBA O 0A(A BBBE 0 q l 0E(A BBBE r l 4r ) Hr 4 \r @ BGH A(D@o(A ABB r Q5 @ r jd Ab8 r d\ BEA A(G@a (A ABBA s z< @ 0 s L BAA D0e AABG Ts f 0 ps D AB s H s 8 BEE B(D0A8DpK 8C0A(B BBBA s A Av E t C E L A C 0t A A_ B ^ Pt y% ( dt 8p AAD y AAA t ^7 ( t dE ADD ^ DAA H t BFB B(D0A8G`U 8D0A(B BBBA u ܦ+ D f 8 8u Dy BBA A(G0T (A ABBI H tu BBB B(D0D8Gp 8A0A(B BBBA u eh p u LX AG c CA v AU 8 v BEA A(D0Z (A ABBA \v P A xv v X v BBB B(A0A8GFYA8A0A(B BBB w \P Ah eA w @ A_ A E A Dw A] `w LO xw w ( 0 w lN BDA G0o DABE $ w M 0a CABA H w 0 AAH _ AAE A AAB I AAA QEA Hx 0 `x l BHA Gu DABA x O H x BBB B(A0A8DPo 8D0A(B BBBA x _ P H y M BBB B(A0A8G!18A0A(B BBB ` hy BEE E(D0I8GPN 8M0A(B BBBB 8D0A(B BBBA 0 y ^ PD8A0A(B BBB( z ADG0Y AAA ,z , Aj H Dz X: BBB E(D0A8GP 8A0A(B BBBA z P L z w BHB B(A0A8G 8A0A(B BBBA { \ { #& 8 4{ BBA D(D0H (A ABBA p{ ,. 8 { # BED A(DPa (A ABBA { P L { $" BBB B(A0A8I 8D0A(B BBBA ,| 5 8 L| AAM0s DAB J8U@BHBPI0 | 0XCAL | BBE B(A0D8G 8D0A(B BBBA | 8 } / BBA A(B0 (D ABBA ( T} 1 0f(A ABB 0 } <0 BAA JP AABA } i P 0 } l2 BDD G0s AABA ~ 0 H ~ 2S BHB B(D0D8Gp 8A0A(B BBBD l~ BQ p 8 ~ 9u BEA G(D0 (D ABBD ~ 7X 0 $ ~ ;I D K(J0I(A R A K H ; BBB B(A0A8Dp 8A0A(B BBBJ l p pC AD i K AA P DD BEE A(A0I@HNPEXE`I@y 0D(A BBBA g @ < pF BDB B(D0D8DIEBID 8D0A(B BBBH BNGjB[Pb3EJAe0 ܀ i zHEEI` <J BBB B(A0A8D@_ 8A0A(B BBBI 8A0A(B BBBA t B @ X XK BHB B(D0D8GPNXL`HhKpLPR 8A0A(B BBBA P ,V $ x) 8 & F_ P |) Ac l & Ad CV ܂ ) Ag l L8 BBD A(A0Z (D ABBA L )= 0 < h d BBB A(A0DP0D(A BBB 6 P 4 ȃ ADE ` AAA L(D0\(A $ $7 AAE mAA @ , X ${ BAA n ABA @ XJ BBE A(D0D@$ 0A(A BBBA @ @ $ 4 AMA bAA X 0 BBD G(D` (G ABBE LhWpBxBN`^hUpBxBI` , `Z (C ABBA 8 K BBA A(G0b (A ABBA 0 ( XKo BDD y GBB $ @ h C ABA h d | E \# B D g E F A F Ȇ T! 0 ܆ p! BHA J DABA , P @ J& AR E M ` , t 8 $ 49 AAD iDA ȇ 4 H ܇ 0L BBE E(A0A8GP 8D0A(B BBBA ( i P ( H AAD CAA H t Ȭ BEB E(D0A8G@ 8D0A(B BBBA C AA ( ܈ Юa BAA YAB U $ 9 8 , AU P d HF x A\ ܮW AU ԉ . Ad lH D j A & C AA < 0 P , ` d [o BBB B(A0D8G! 8D0A(B BBBE Z8D0A(B BBB ( Ȋ Į8 AAD /AA : J D E $ 5 8 @ X g P d x AY 4 x BDD ^ ABA AGB H ȋ 4{ BBB I(A0A8DP3 8A0A(B BBBA , w PHXV`DhBpIP ( D , ADD0DA 0 p M BDD G0k DABE $ 0z CABA H ̌ BBB B(A0A8DpZ 8D0A(B BBBA H BBB E(A0A8Dp 8A0A(B BBBA d ug p H H BBB B(A0A8DP 8A0A(B BBBE Ѝ D Az H A~ $ : AAD jDA 4 0 J AAG ^ AAA L AAB $ h : AFG0iAA 0 0 a BAA G@G AABA p @ 0 ] BDD G0y DABB $ T U 0b CABA | ! H BBB B(A0D8E@ 8D0A(B BBBA " @ \ $ X 8 T L ` AQ d d Ht BOB B(A0A8G 8D0A(B BBBA 8E0A(B BBBE ̐ ) AY ( , o AMA ]AA X p 0 $ ADA AAA HAA ̑ 3% X BDE G(D0JPj 0D(A BBBE G 0A(A BBBA T 8 P 8 t BGD D(L (A ABBA 3 ̒ $ & ADE RGA ACAH ( M! BBB B(D0A8D` 8A0A(B BBBD t !n ` 8 hQ BBG C(G0b (D ABBH Г 3 0 > 8 BBB A(A0(A BBB P 0 $ p \U AAA OAA H" 4 |} BHD C(B0`(D ABB 0 , BAA D0 AAB 4 q 0 $ P <" AAA [AA x > Y AAA Z $ AV < ȕ T BAA Gp AABA R AAB $ pI AABE 0 + D f H F H} d 0 x O: AD u CC E AI C CE ( ̖ L BDD b ABB |% _CB ( M BDD AB H Q 0 d P BAD G0 AABA 0 ` hn BBB B(A0A8D` 8D0A(B BBBA P 8A0A(B BBBE 4 `K 8J0A(B BBBE P < d H \ x 4` BBB A(A0p (A BBBE A (A BBBE ~ (D BBBA ؘ O 0 H BBB M(A0A8G 8A0A(B BBBA D p d D C H { A 5 0 O@ AIG R AAA ALH P Й O+ SAD D0j DABE Y AABA ML0 $ & 0 @ |P' BBB B(D0D8G@N 8A0A(B BBBA W 8A0A(B BBBE a 8A0A(B BBBE 8A0A(B BBBE o 8A0A(B BBBE 0 @D8A0D(B BBB $ + D f 4 < Q BAD s ABA LAB L t BBA A(E0` (G ABBE (A ABBA ě 0 L Q BBB A(A0 (D BBBF A (D BBBA , 0 0R (A BEDE ` F Ao A T 6 * AY I $ F AKE gAH ܜ ADA ADB Y L AAA @ 8 Me X M , l BDA l ABA $ & A ABE ĝ Q ؝ % - BP E U j NB E Q , L @ BBE B(D0A8D 8D0A(B BBBA Q L LBB B(A0A8D. 8D0A(B BBBA 4 t l FABS 8 4 D b A T ( h > BDD j ABB T CAB H BBB E(D0D8B@s 8D0A(B BBBA @ H $ BBB B(A0H8D`J 8D0A(B BBBA , p `hVpDxBI`$ ,7 ADA gDA ( Ƞ D BAA y DBA $ A ABE AZ 4 4 BED D(D@e(D ABB l @ | BHB B(A0A8Dp 8D0A(B BBBE 8D0A(B BBBA 8A0A(B BBBE 0 / pxxUBBIp P M d x \ M BBB A(D0e (D BBBE d (A IBBE E(D BBB : 0 6 Al ( D? P c E F $ H dG AAD wDA p ( tg AAD M AAB 0 ̣ M BGA Dq AABA 4 M BBA A(M@(D ABB8 8 { @HHRPBXB`I@^HTPBXB`I@ D t LBB B(A0A8D@8C0A(B BBB W @ ܤ @H | & 8 t BBD D(GPL (A ABBA T P p # ( fX AAD ~ AAA 8 ,M BED A(G@] (A ABBA V5 @ < M BBB D(D0t (A BBBA H /G 0 8 h BBA A(D0 (A ABBA 0 } , Ԧ BAA f ABA >D @ C BBB A(A0GP' 0D(A BBBA d " P H # BBB B(A0A8G` 8A0A(B BBBA 8 , `bhHpRhA`whApRhB` H BBE B(A0A8D` 8A0A(B BBBA l G[ ` H + BDB E(K0D8GP 8A0A(B BBBA ب 6K P BEB B(A0A8DT 8D0A(B BBBA mMFAAAGANQBQLDFS-PLBJEESHEEX<LFFN0 u i HRA , ! A_ $ H ' AIE NGA p ACAH BBB B(A0J8J`R 8G0A(B BBBE D ܪ @_ `WhUpBxBI`P 8C0A(B BBBA H $ BBB A(A0 (A BBBA q8F@Q8A0 p 0 T \ BBB A(A0 (A BBBA D8R@F8A0Y8R@I8A0 E 0 H d BEB B(A0A8Gp3 8A0A(B BBBA T " p H t / BEB B(A0A8Gp 8D0A(B BBBA 2N+ p L |B BBB B(A0D8GO 8D0A(B BBBA 0 ] P \; An E l $^ QH h BBB A(A0 (A BBBA q8F@Q8A0 Э ] 0 8 BBA A(D@c (A ABBA , (^ @ 8 H d BBA A(D@_ (A ABBA \_u @ 4 BBA A(A0(D ABB خ }` 0 ( r AAE I AAA =`v |(A0W(B D 8% X T$ l p] A` zA G` , Aa E 0`" Q A ( ܯ f AAD N AAA `! $ S ADA JAA H _ 0 ` BCD Jpq DABA _N p ( ,{ FDD o ABA ܰ _z d P p: KBB A(D0 (D BBBA (A BBB ` _$ 0 h < KBB A(D0 (D BBBA C (A BBBE Z0 ?_- 0 , BAA l ABA < _D X 4 l 0_ x H BO BBB B(A0A8Dp 8A0A(B BBBA ^. p $ AAD AA < ^= $ T x f AFDpUDA | ^ p $ Q ADD0BDA r^$ 0[CA8 ܳ BBA A(G@o (D ABBA :^ @ X 4 h BBB B(A0A8G`G 8D0A(B BBBA hApNhA` d^ ` H r BBB B(A0G8Gp 8D0A(B BBBA 0 ^ pxXBBIp $ 0 "j AAD aAA X b/ $ p "c AFA XAA b ## ĵ (# ص a H # BEB B(A0A8D`- 8A0A(B BBBA 8 a ` ` X $U BBB B(D0A8M 8D0A(B BBBA DXBBI b ܶ & &@ Ab A [ b $ &p AM E ( D b2 AE SBA A N p & AP ' 4 & BGH A(D@f(A ABB ط 5b @ $ 8'i AJU0FAA b 0 4 h' H a) J^ D ` \' BEE B(A0D8GPe8D0A(B BBB a( P $ ȸ '] Fx E E E E E D a D E E E [ E ^ A \ E E E Q E V E D < 8 t'Q BBB A(A0S (A BBBA x am 0 t) BBB B(A0A8M`0 8D0A(B BBBE ` 8A0A(B BBBE MhTpBxBI`UhRpBxBI` 4 a `P 8C0A(B BBBA D X D.- BBA A(E0O (A ABBA f8D@N8A0 a 0 ` 0 BBB B(A0A8DP 8A0A(B BBBE O 8A0A(B BBBA a- P ` @ 0 BBB B(A0A8PA 8D0A(B BBBA {UBBI vaV Ļ 2 ػ 3 a AY $ h3* ADE SGA , , _aF f DAB J CAA \ @3 p L3* h3 H t3 BEE B(D0D8C@v 8D0A(B BBBA 0 <E AIG R AAA XAA 3D BEB B(A0A8G 8A0A(B BBBA ] 8G0A(B BBBE 8M0A(B BBBE =8I0H(B BBB !` G 8F0A(B BBBE P 8F0A(B BBBE l 8M0A(B BBBE 8F0H(B BBBE 4 ; AG0c AD X ub0 0 4 p BJ BEA D(D0s(A ABB ( Bk BAE _AB Ծ )b ( B HDG0kAAA a" 0 $ 4 (C% AAD \AA , \ 0C BDA m ABA a NCI $ lC2 AGA fAA $ ؿ C7 AAD gDA $ CC ADA zAA ( "a H @ C BBB E(A0A8JP 8A0A(B BBBA `$ P 0 @D~ BAD G0a AABA `S 0 H : BBB B(D0A8DP 8D0A(B BBBA H ` P ( h Dy AAD d DAE C` HAA 8Dm A] JD ` $ pDq AMQ0LDA _ 0 0 , 9 BAA DPX AABA ` _n P $ | `D AAD0DA _9 0 $ D( AAD XDA _ D < `=n BDD D0@ GABB H DAB $ L W_) 0[ DABA t 8D 4 D_ BBA A(A0(D ABB D' D b _ 0 D BID D@y CABA n_( @ < pD P lD AF 0 h t< BHA G0a DABA _ 0 $=! , @=` BAD L ABA ?_W T=w AY I 8 =- A^ E T xC h *_ AK E C =Z _ L ^, BBB A(A0 (A BBBE \(D BBB B AT $ _b AHA UAA D B AG0f AA , h DC BDD ` ABA _ ( < J}D H(L0NA A h_+ L h=b BGB B(D0A8D 8D0A(B BBBC D /_ d d hA BBB B(A0F8K 8A0A(B BBBE G 8A0A(B BBBH _ ( W ACD k AAA Wl , b 8 @ W BDA A(F@ (D ABBA | b^ @ 8 XG BHA A(G0 (D ABBA b 0 \A A\ `A] < LY BBB A(A0 (D BBBA ` 7b 0 [n h[" $A a \[ ar Ai @ AG n HE , b Z CA S HE DH @ P LAT BLI A(A0G 0D(A BBBA b1 HB: Dj E lB0 D0k a 0 $ pBS AAA MAA $ Wb < B AQ H T B BBB B(D0A8Dp 8A0A(B BBBA a^ p |YB Ai A F E b Y D AZ $ a , < Ci BMP G0~ AAB H l 0Dw BEB B(D0A8GP 8A0A(B BBBA 4 Uah Pw 8M0A(B BBBE ,Gc NS G_ AYH X BBI B(A0D8C@s 8A0A(B BBBE l G |G H xG BBB B(D0D8GPY 8D0A(B BBBA ` P < G BBB D(D0 (C BBBA @ ae 0 ( ` Hb BAD WAB $ .a, A ABE ( (HT BAD IAB a T PW BLB D(D0DP 0A(A BBBI X 0A(A BBBA T ` P 4 t G BGA D(K@j(A ABB a` @ , H BHD G0k AAB `@ 0 HH- D h $ , `4 ADA kAA ( T W ADD0 AAA `m 0I DAE G @ tXS BBB A(A0D@P 0A(A BBBD `Q @ 4 GY BDA y ABE IAB 0 T G ADE c AAA NAA y`R `( Af H ` BBB E(A0A8Dp8A0A(B BBB ( Gi BDD [AB 4 b AGB ( X G@ BDD jAI a AAB 4 GM BDD s ABA AGB 8 G BBA A(A0 (A ABBA 5ah 0 < 8 TH BIA A(Y4 (D ABBA D x Aa QRBBI`TBBI ` |I BBB B(J0D8J 8D0A(B BBBA XBBI $ a_ D J H X JA BBB B(A0A8D` 8D0A(B BBBA an ` ( xLT BDD g ABE $ a8 _ CBA P L BAJ J0E AABE I8R@BHBPI0c8T@BHBPI0 $ l ja! 0R CABA 8 LQ BBA G(D0u (A ABBA 'a 0 ( L[ AAD D DAE a 4 0 MG BAA i DBE A ABA h $M AQ X 5aT BPB B(A0A8JNiFN8A0A(B BBBx S BEB B(A0D8M 8A0A(B BBBF p 8A0A(B BBBA }XBBI X d $ x 4W= ADD nDA 8 LW BBA A(D0 (D ABBD ,f 0 K 8 Xl BBA A(D0 (A ABBA H Hf 0 d XK 4 x TK? BED D(J0X(D DBB ( f 0A(C ABB 0 0K LDD { ABA J 9f 4 , Y9 AAG AAG v AAH d (ZR AG E e d PZP AAM@IHTPGXB`I@D DAE FHTPBXB`I@VHTPBXB`N@U CAA ne @ H [ BBB B(A0A8D` 8D0A(B BBBA h e ` $J g H J BBB B(A0A8D 8A0A(B BBBA g $ `L/ AAD _DA D Lh AAA d HLI AG0{A hM 0 Eh LL- AZ E !h [ HL4 AY E h Q TL' D b 0 g 0 D XL BFD D@y CABA x g$ @ L AU g A L' L AF H L BJB B(D0D8G`r 8A0A(B BBBA @ g ` ` N. AIO T , N BAD GpzxH\xBp$ rg pU AABA DO @O DY g 4O AU 4 8OI AC H P ^p BBB B(D0D8D` 8A0A(B BBBA zgX ` X OK BBA A(M@ (D ABBE YHRPBXB`I@RHTPBXB`I@ , VgD @s (C ABBA H H O LEE B(A0A8Dp 8D0A(B BBBA gK p It3 D n D dt BBB B(D0A8DP8A0A(B BBB8 u BBD A(G(D ABB P ZM d u AU 4 | u BBA D(D0x(D ABBH ] BBB B(A0A8D@# 8D0A(B BBBA u @ ` |f BBB B(A0A8DP 8D0A(B BBBA D 8C0A(B BBBE P Y' ( Y AP0s CA DD _ 0 X Z@ BBB B(A0A8J`VhXpBxBI` 8J0D(B BBBB 4 l `K 8C0A(B BBBA X Z BBB E(A0D8D`hKpBxBX`_ 8D0A(B BBBA 2 ` l\] A` zA @ w X \# l h AY \U AS S , \g FAA @ AAA Y ]b KODC H] ( ( < 0e ADDp DAA h ~ p H \ BBB B(A0A8GRJGA] 8 8A0A(B BBBA < a BBB A(A0 (A BBBA ( H P? 0s(A BBB$ t ab ADD@VAA ;W @ $ ai AAD0^CA R+ 0 H a BFE B(A0A8Gp 8D0A(B BBBA @ p 4 ` Ld; BDD a ABA AGB Td ( PdS BDD EAB 8 hd. Ag $ $ 8 AAD oAA H L X BED D(E0c (M ABBE A(C ABB c AQ H b BBA A(G0F (D ABBD v(D ABB c' 8 d BAA ABA k CBE L L h b BBE B(A0A8D 8D0A(B BBBA e D H S A ߈E e 8 $ e BDA A(G@ (D ABBA ` n @ 8 | f BDA D(D@ (D ABBA ֈG @ 4 fY BDA y ABE IAB f AF ( $ f AHV0Z AAA P ( 0 h $g $ | gT ACG FAA XgG A A E 9 ( pg3 BDD [JB ACB , `gE AC H Ç ( ` |gO BDG ~AB # 8 g BBD A(D0J (A ABBA Z 0 ` gp BBB E(A0A8GPm 8G0A(B BBBE 8C0A(B BBBA d 6 P H h BBB B(A0A8DP 8A0A(B BBBA P \i ( Xi1 BDG \DB 0 - ADB 4 T AID0Z8U@BHBPI0DA @ i BBB D(D0GP| 0D(A BBBA yr P \iZ G N$ A(U0B8B@I R A H 0 |i; BBB E(D0F8G`J 8D0A(B BBBA | ̇ ` Pj6 N g xj tj 8 lj BEH C(B0n (D ABBA , 9 0 D H jW BHF X DABA {XBBI 8 k BBA A(E0 (D ABBA 0 8 m BAA W ABA L AEE @ $ \ mI AAA CAA mH Ai E 4 m{ AAD \ DAE A AAA G $ mK ADA BAAL 0 n) BBB E(A0A8D 8A0A(B BBBA ąS o A[ ۅ C o) AI ]A ( b AAG e AAA 8 z P |o: Ab I l o* Ah I( oC HDE c DAE {7 m CAA @ o BBB A(A0K@ 0A(A BBBA ( 4 J @HHSPDXB`I@( ` pV HDE d AAB ߆= xCA( pE BGA wAB І p& Ad FH ( p BBB B(D0A8A@w 8D0A(B BBBA t N @ q6 Al $ ,qK AKD xAA ( ( <q DAA } AAA ݅% 8 4 q BBA D(Dp (A ABBA p I p , r BAD ABA 8 rD BDA D(DP (C ABBA P 0 s D v AT , \ sS BBB A(C0G@ 0 D @ 0A(A BBBA T t BBB B(A0A8D`x 8D0A(B BBBA hPpPhA` ` 8 L v+ D f $ d n AHD AA0 v BDD G0 AABE $ o 0T AABA ( 4wl KAA [AB 0 \w As I P ۇ- h w \ | ܇ BBB E(J0A8D_RBBI8A0A(B BBB h> Vg 8w z i$ AR E K ( < wB AID T AAA 0 h 4w BNO K DAB , c AUBBI 0 wV KAD s AAA IAA w# Aa 0 D w D0| A ` ˊ 0 t Xx H Tx BBE E(A0A8G` 8A0A(B BBBA s_ ` ( xC BAG uAB @ < x OBB B(A0M@Y 0A(B BBBA . @ ( xp AAD0y DAA l. 0 0 y AKPHKPRHA@AA N @ 0 y $ D y ADA DA l Ë: A AAE ,z 8z4 Ar & H { BJJ A(GfFMA (A ABB $ y( 8 Ҍ AY P B` JU0 h ` BKD IA AAB 4 AGD0V8U@BHBPI0AA ( xyt IAA aAB , P> W CBA VAE 0 y* Ad , H yr KFD UAB $ x A NDB y> % AT V V( y( ō yR BAA $ < w ^ ABA d y x y/ Ai @ y BJI A(A0D@s 0A(A BBBA v @ Tz G $ U 8 z+ Ai T % l zA D0| 0 $ z< AAA cNC WCA0 zj BAA G`N AABA 7 ` , 0 ze BCA Q0I AAB ` E 0 H | { BAD M`I GABE DhHpN`z AABA \ t{ BBB E(A0D8I G`A_ 8D0A(B BBBA ( $ H |% AAA [AA p > Y AAA t h| BFB B(A0A8G 8C0A(B BBBA BHENqKKAN < , ~a @ AV X $ 8 l / BHD D(D@ (C ABBA kF @ D0} A y, 0 ȀY H BEB B(A0A8Dp 8A0A(B BBBA T 1 p t , Af ( tQL ACA t AAA @8 w P X BKO H(A0GRIQA0A(A BBB , h KPA ( ԃ ADD U AAA ԍ 0 D0s A ( tP> ADA h AAA $ y MZ A O D [ ADTA h 7[ ( <` AAB o AAA 0 p BAD G DAB AJ A8 H(R0B8B@I P CA B(T0B8B@I ( X TOC BKF lAB d AAB # 0 ` BAD G0\ AABA _ 0 8 BID A(G@J (C ABBE , H @Z (C ABBA , x t BDC Z DBA , TN BAD DBF < KEG D(GP(A ABBA G 4 BGA G0 $ X ' 0O AABA ( \9 BHD gAB u4 4 TM BDD s GBB AAB l 8 A: BBD D(D0 (D ABB P O G 8 l # BBE A(D0(A BBB , ԇe BDD G ABB $ C ABA 0 Od AAG t GFE AGH 4 ` D p A P A2 0 d BAA G0a AABA +a 0 < hO BMK N(B0A8B@I ABA $ 0B s ABE $ ЇI ADG zAA D S AD F AA h H P BBE B(A0A8GpU 8D0A(B BBBJ m& p D pS BBB B(A0D8 0A(B BBBG 4 +# 8 H T HV BBD D(L0` (J DBBB A(C ABB 8 \ BEG A(B0d (D ABBA # 0 ( ćy ADD0h DAA $ 0 0 < BHA G@P MABE $ p D @a CABA ` tb BDB B(A0A8D- 8A0A(B BBBA FABS OI x h 0 L BHB B(A0G8GL 8A0A(B BBBA BFFFF` 0 ` BHA G@R MABE $ ɐ @w CABA 0 BHD D@P MABE $ L @a CABA t X BKB B(A0A8GRBBIVEEEEZDEDDDADDGGBl h ؐ r 8D0A(B BBBA |VEEEEZTBBN ` | @ BDB B(A0A8D 8A0A(B BBBA FABX o 0 BHD D@R MABE $ 4 @w CABA L \ @^ BLO F(E0A8G 8D0A(B BBBA ( $ 0 AAB AA lE h Ny BEB H(A0H8Gy 8A0A(B BBBA tAFFFFS ! TF ^ [ 8 U BBD D(G@I (A ABBA G @ 0 l ( D hY BDG HAB p ) Ag 4 ACG@`HVPRHA@h AAA 4 @ 8 ء BBA A(M@ (D ABBA 8 0 r @AHTPBXB`I@xHRPBXB`I@ ( l ҙ BAA AB = A$ ؚ= AID lAA AU њ% dH { BLA D(E0O (A ABBA m (G ABBE 8 X < 0^ (A ABBE B(G ABB , Ae A v6 ' $ 3 ADA jAA X( Aa A 6 ( 8 BAA AB 0 d ( BAA G0 DABA $ a4 0X DABE m ءH Ag A ^ A ( T BAD AB 4 ! D P w BEE E(A0C8B@N8D0A(B BBB0 ͚ @J8C0A(B BBB( L BDD p ABA ԡ9 Am E A d J 0 ܡ D ء\ AD F DA h A\ ) Ag ~ ( i AKV0 AAA [ 0 \ M BIE I(F0H8M]XBBI8D0A(B BBB l С AK A A ( СX AAA F AAA 3 9 Aw " A\ A @ 4 BBB A(A0GQ 0A(A BBBA x m H R BDB G(A0A8DP 8A0A(B BBBA P ( H' ACD P CAA 0 H V d \ V BBB B(A0G8D` 8D0A(B BBBA 8G0A(B BBBE ` L _ IGH F(bXBBI(D ABB 4 H 0 H Ti ADB f AAE \JJ ( | `Zu AD ~ DE ` CA C{ h DE D h Z BBB B(A0F8G 8A0A(B BBBA BFFFFS H 5 h [ AJ0~ DE , C 0H8U@BHBPI0P CA + D f H ؠ/ BEB B(A0A8G`p 8A0A(B BBBA v ` H @ 6 BBB B(A0D8G`u 8A0A(B BBBA ȝw ` p- ( e AGA J AAA ߝ g A[ IA $ D 4 < BBA A(D0(A ABB t U 0 ( \- EDD W AAB 0 b CAA D < BBB B(A0A8DP8D0A(B BBB (! | P ( H! BHD yAB t! M< ! <0 VY ! T# AG YA ! 56 ! L% A_ ! 7 " H (" D! A_ @" 0 T" H< AAA V AAA YAA H " dY* BBB B(D0A8G` 8D0A(B BBBA " | ` ( " (Z EAA AB # C <# D AB X# p# D Ao A # * ` # lZ LEB B(A0A8Np 8A0A(B BBBA n 8C0A(B BBBE 4 $ o ph 8C0A(B BBBE $ <$ ʝ. AAD cCA , d$ BAD DBA $ AAB $ - Bj $ m $ s ` $ Ԥ( BBB B(A0A8Gh 8D0A(B BBBA G 8G0A(B BBBE P \% 8J0D(B BBBE G 8G0A(B BBBE 8 % L BBE D(E0g (A BBBA % h 0 H & p BIB E(A0A8G 8A0A(B BBBA X& 8 x& 0 & AY & ] JO & $ & E AAD uDA ( & BAA CB $' ݟ $ 8' Ο* AAD ZDA `' П t' ' AQ ' H ' BEB B(A0D8G` 8D0A(B BBBA 4 ( 5 `a 8A0A(B BBBE 8( - Ak T( ( h( W L |( Wd BBB G(G0A8G 8C0A(B BBBH ( " 0 ( BFA J DAB ) ڞ7 H <) P BEB B(A0D8I 8A0A(B BBBA ) ) 9 ) N ) 4; ) A~ E j A d * Z BGB B(D0A8D`) 8A0A(B BBBA 8G0A(B BBBE p* ϞE ` ( * ̬? AGA g AAA * ȞK AI ( * Ĭ3 BDD W IBB $ + ˞2 [ CBA d ,+ BFB B(D0A8G 8D0A(B BBBA 8D0A(E BBBE + m$ ( + ح3 BDD W IBB $ + E2 [ CBA H , ĭ BEB B(A0D8D 8A0A(B BBBA T, ! 8 t, X AAM0s DAB J8U@BHBPI0 , ȝ 0XCAH , BLH B(A0A8G 8D0A(B BBBA - y <- % Ac T- Ȱ AU p- ֝ A( - Z ASB bBA A ] - R0 - а ADA }(H0[(B cAA . _I . 4Y, Aj 4. t I( L. 0Y AAK0w AAA $ x. >V 0f8S@DHBPI0 0 . Y= BBB B(D0D8G` 4 . 8F ` 8D0A(B BBBA / / 2 A\ $ 8/ 8X AAC PAA `/ h: 8 t/ Y BBA A(D0{ (A ABBA / R 0 4 / pY BAA GY DABE 0 ~ 0 40 S A\ L0 A\ A F D p0 5% 0 X Ax A 0 & 0 0 a AZ A 0 ! \ 1 ZZ AC I (1 ˞- 8 @1 Z BDD ABG X ABE |1 H ( 1 Ta AAD0L DAE 1 q 0Z CAA , 1 tS BAA D0F AAB 2 { 0 42 P i ` A D P2 BBB E(A0A8D`8D0A(B BBB 2 1 ` 2 D AT $ 2 L' ADD TDA ( 2 Tx AGD0d AAA , $3 a[ 0A8U@BHBPI0qAA T3 x AT ( l3 u AAD0s MAE 3 H3 0 3 ? Y ` A 0 3 BAA G0 AABA ( 4 s 0Z AABE ,4 @T G H$ D4 BF A(U0B8B@I R A $ l4 `H AAD0|DA 4 8V 0 4 p AY 4 Z $ 4 \8 AAD0mCA 5 ! 0 5 \A A <5 ? h T5 x BBK B(A0A8D`RhRpBxBI` 8D0A(B BBBA QhTpBxBI` 5 n@ ` 5 ̲' D \ B 5 r( ^ A D@ 6 IJ BEB A(A0G@$ 0D(A BBBA \6 :> @ H |6 BBB B(D0D8F` 8D0A(B BBBA 6 ` 6 $ 8 6 VFA D(FP (F ABBA 87 ` P T7 0 h7 BHD Dp DABA 7 h p D 7 V! BBB B(A0H8= 0D(B BBBF , 8 w BAA J0d AAB 08 s) 0 0 L8 BAA M0W HABB D 8 L 0R CABA E8R@BHBPI0P8T@BHBPI0 8 t 8 W SEB B(A0A8Dp 8A0A(B BBBE 8A0A(B BBBA T9 1 p ( t9 hK EDH ] DFB 9 9 tCAH 9 l BBB B(A0A8Gp 8A0A(B BBBA : p ,: AG ` KA $ P: LP AAD GAA x: O : \$ Ab : ( D : \" : : d AZ ; ڜ% d ; P AZ 8; ˜% d P; < AZ l; % dd ; ( KAA G0 DABA k DABE o AABE u FAB ( ; a$ E0V AAB < $+ D f ( 0< < AED AAA \< t< 1 H < ! BBB B(A0D8G` 8A0A(B BBBA < ` H < ػ BBB B(A0D8G`o 8A0A(B BBBA @= ` H `= + BBB B(A0D8G`y 8A0A(B BBBA = ` = PC AA = { < = t BBB A(D0 (D BBBA 8> .B 0 $ X> 6 AGA jAA H > [ BDB B(A0D8J@ 8D0A(B BBBA > ܜ @ > ' D Y E ? X4 c A K $? T 8? ] BEE B(A0A8DpxHmxAp^ 8A0A(B BBBB L ? pJ 8A0A(B BBBA y 8A0A(B BBBB ( ? l ADG0} AAA @ h` 0 $@ Ⱦ AGP AA H@ + P ( `@ ,m AHD v AAA @ s ( @ XR FAD w DBE $ @ Jd b CBA @ d$ A^ A j' f ,A ` AY HA ]' f `A L] D F E I A L: p A L A p BIE E(D0A8GG 8D0A(B BBBA A 2 B t B 4 BBB B(A0A8G 8D0A(B BBBA RBBIdTBBI B t B t BBB B(A0A8G 8D0A(B BBBA ATBBItRBBI 0C t PC [ BBB B(A0J8G 8D0A(B BBBA RBBITTBBI C t C T BBB B(A0J8G 8D0A(B BBBA TBBICRBBI `D $ D O ADA FAA D C8 L D FEE A(D0s (A EBBB A (D BBBE , E 0^ (C BBBA D <E P BBB B(D0A8P@8A0A(B BBB4 E R@ @A 8A0A(B BBBE E U L E U LFE J(A0A8G 8A0A(B BBBA F W @F - Bj XF $ lF D g E N E H A F [ E r E F h& Ad F W 4 F dA BED E(E0b(D ABB h G |* BBB B(A0A8M`hRpBxBI`S 8D0A(B BBBA LhTpBxBI` G Z ` G X# ( G AAM0p AAA G 0 H xX( H D( A^ 4 4H X BDD D(G@(A ABB lH $N @ H } AIqA < H 0\ BLE A(A0 (A BBBA H 0 I 0 I Y 4I (F Be E Y TI X hI |I PE I I x I > I ޠ I I ֠ J W J 0J N DJ XJ M lJ Р J J J H J J J J c K r K L 4K XO HK S L \K FEE D(A0[ (A BBBE A (D BBBE , K 0^ (C BBBA K K AI 8 K BKA D(G (D ABBA 4L z0 8 PL BKA D(G (D ABBA L R0 8 L T BEA A(D0Z (A ABBA L * 0 M M (M D Bc E Y L HM $ FEE D(A0[ (A BBBE A (D BBBE , M 0^ (C BBBA h M D BBB B(A0A8MPXR`BhBpIPS 8D0A(B BBBA IXT`BhBpIP 4N \ P ( TN H6 BDD W IBE $ N 2 [ CBA ( N 47 BDD W FBE $ N & [ CBA $ N O ADA FAA $O G $ 8O O ADA FAA `O d ( tO S BGA y DBE $ O 1^ M ABA ( O p BAD bDB O ;3 kAB ( P > BDD g DBB $ DP < _ CBA 4 lP y BDA s HDE SDR , P H HDE ACB P , P BKD e ABA Q H 4Q BBB E(A0D8Dp 8D0A(B BBBA Q E p Q h Q Q ( H_ Q R0 Q W BAA J0| DABA 0R a 0 8 LR x BIA D(G (A ABBA R ğx R FN L R N BHB B(A0A8G: 8A0A(B BBBA 8 S c 8E0A(B BBBE LS `S , tS v BKI DpT DAB S H p < S BBB A(A0 (D BBBA , T 0 (A BBBE 0 0T BHA ] DAB , dT 0 {XBBI T AZ T `9 T T v T j T P& U S $U X& 8U 7 8 LU `/ BBD D(D0 (A ABBA U T 0 U 8$ U U @ U $ U 8 OAG0AA V Q 0 0 4V BAA M0d DABE D hV Ġ 0R CABA E8R@BHBPI0Y8T@BHBPI0 d V U BBB A(A0M@fHRPBXB`I@~ 0G(A BBBE ^0D(A BBB W d ,W p= By DW С L A L `W | BBB B(A0A8G 8A0A(B BBBA @ W } #KQBBLB W ' X AY $ X Q D Q(P0F(A Q A HX 8 \X ) BED A(D@(A ABB 4 X x BAA v ABE FAB X l: At X J Y xD AB Y # L 8Y D BBA G(Dp (G ABBE DxXBBIp , Y F pf (C ABBA ( Y d5 BDD `DB Y ACB Z T& Ad 0 $Z h BHA G@M MABE $ XZ @w CABA Z # Z p H Z c BBA A(B0K (G ABBB k(D ABB 0 Z ADG0{ KCE DAA ([ d' Ae D @[ |1 BBB B(A0G8A@R8D0A(B BBB [ @ $ [ Tq AFDp`DA [ d" p D [ 1 BBB B(A0G8A@R8D0A(B BBB 0\ & @ 4 P\ l BBA A(J@(A ABB \ ) @ \ ͭQ \ F lY ( \ 2 BDD `DB \ ƭ ACB ] - Ak L <] FEE A(D0s (A EBBB A (D BBBE , ] j 0^ (C BBBA D ] BBB B(D0A8P@u8A0A(B BBB0 ^ @A8A0A(B BBB 8^ 4J h L^ BBB B(A0J8D`lhRpBxBI`S 8D0A(B BBBA LhTpBxBI` ^ 6 ` 8 ^ I BOH A(D0@ (A ABBA _ H (_ D <_ @ P_ < d_ x_ $ _ _ _ L _ FEE D(A0[ (A BBBE A (D BBBE , ` 0^ (C BBBA H` a- Ak @ d` BKB A(D0Gp 0D(A BBBA ` .$ @ ` BKB A(D0G 0D(A BBBA a $ ,a L @a FEE D(A0[ (A BBBE A (D BBBE , a 0^ (C BBBA ( a 6 BDD W IBE $ a 2 [ CBA ( b 7 BDD W FBE $ @b & [ CBA hb - Ak b ϫ- Ak ( b S BGA y DBE $ b M E ABA ( b K BDD }AB c ( 4c I AGD0r DAA `c ma 0 xc c ( D b c > c A L c D BBB B(A0A8G 8D0A(B BBBA d \ @ 0d BFB A(D0G@ 0M(A BBBE 0 td @d 0C(A BBBA L d DY BDB B(D0A8G 8A0A(B BBBA 4 d FDBS H 0e BIB B(A0D8E@~ 8A0A(B BBBA |e : @ e 0o e e x e } $ e p, AGE OGD f F IAA 4f X% A_ Pf C hf " AW E D f 4 G L f j BIB E(A0D8G 8A0A(B BBBA f $ g ) AGE YAA <g Pg # dg xg : At g J g D AB g ̯# g g ï H h BKB B(A0D8GV8D0A(B BBB H Th BKB B(A0D8GV8D0A(B BBB \ h BBB B(A0C8MxXBBI 8D0A(B BBB i - Ak i ? ,i M Hl A Hi 8 `i BBA A(E0 (D ABBA i J. 0 i dI A i @ R A i | AQ j ) C j lX KF v DA Dj Xj * BBB B(A0A8GyBGGfO 8C0A(B BBBA U 8M0A(B BBBE 8J0A(B BBBE L j IV AGGvY 8A0A(B BBBE 8 <k u BBA D(D0G (A ABBA xk 0 k (6 k k @Q k в+ L k >@ BHB A(G0 (A BBBA J (D EBBE 4l 5 0 Tl AY ll l < l FEE D(A0 (A BBBE , l ? 0s (C BBBA , m x+ BDD ABA 4m Pm \ dm Z xm T6 At m 6 m ` m \ AY m m n <* AG `A n ̳4 ZY 8n 4 AS Tn 8T A A H tn xV BBD D(L0` (J DBBB A(C ABB 8 n BEG A(B0\ (D ABBA n $ 0 8 o Q BLA A(G (D ABBA To ڲ po AGPA o [; P o t' 0 o | BDA D@z DABA o 6! @ p Av F ,p , @p l BAD G@V DAB pp ײH @ ` p BBB B(H0A8D 8D0A(B BBBA =SDBI p I ( q AAA ^ AAA <q 6 Tq (6 D m lq \ q 8 D d A q q P A q w $ q x2 ADA iAA r S $r x 8r t Lr p, `r 6 4 tr x9 BBA A(D@x(A ABB r @ < r d BBB A(A0D@0D(A BBB s Y @ (s ! HX Ds \s 2 Ag A xs t H@ A ( s d b AAA T AAA s 0 An ( s _ AAB S AAA t hf $t AF ( <t @ MDD ^FB ht r F ACB 4 t x BBF A(D0b(A ABB t # 0 , t BGD J0j AAB u ߱, 0 ,u 0 $ Ab Du ױ Xu 4 < lu 0 7 BBB A(K0G`Q0D(A BBB 0 u ` 0D(A BBBA H u h BBH B(D0D8D 8D0A(B BBBA ,v ֳ Lv AU hv D AB v 8 4 v 5 BAD s ABA LAB v v d v $6E BEB B(A0A8G 8D0A(B BBBE 8A0A(B BBBA `w } w | w ӵ 4 w t : BED D(A0c(A ABB w | / AM ^A x j& ` AA < x l , BBB A(A0 (D BBBA `x 0E 0 8 x < c BED D(B0E (A ABBB ( x 0N(A ABB x D 8 x @ BBA A(G@ (A ABBA 8y t @ $ Ty x G ADD {AA |y y $ Ab y ǵG $ y H ADD |AA y ҵ z z (z <z Pz dz xz z ) Ag z H z | BEB B(D0A8E@ 8D0A(B BBBA { ^ @ H ,{ 0 BBE E(D0D8GP 8A0A(B BBBA x{ P H { % BBB B(A0A8G`8D0A(B BBB $ { P ADK }AA | $| $ Ab <| ? $ P| Q ADK ~AA x| | | U | c@ | O AG ~D | o= a CA } @ } $ BIB A(D0G 0D(A BBBA d} 4 0 } BKD D DABA } r 0 } n BKA G DABA ~ < $~ e BID A(G (D ABBA d~ 8 ~ BLD A(D(D ABB 8 ~ Q BLA A(G (D ABBA ~ < 8 > BLA A(G (D ABBA P 0 l p BED G0 MABE $ 0a CABA 0 BHA G0K MABE $ \ 0w CABA 0 $ X BHA G0K MABE $ X 0w CABA 8 BFD A(G@ (M ABBE , ʺ @a (C ABBA 0 0 BHA G@Q MABE $ = @w CABA 0 H BED G0 MABE $ | x 0a CABA 8[ BBB B(D0A8G 8A0A(B BBBA HFFFFX 8A0A(B BBBE AFFFFX D Z $ d z ACD oAA $ X 0 BBB A(A0DPB 0G(A BBBE 0A(A BBBA 0 2C PP 0A(A BBBE D 4 (2" BAA D@j AABA EABE ( | @ AABE ~ AD d DA ̃ D X j BIE A(D0D6 0D(A BBBA , ; H L @6Z BBB E(A0D8D` 8A0A(B BBBA L ļ^ `D 8A0A(B BBBE D 8E0A(B BBBE 9 BBB B(A0C8GG 8A0A(B BBBA BFFFI^BFFFI^ t F $ : ADA qAA $ 0 : ADA qAA H J# Aa H < BBA A(K@UHVPDXB`I@ (A ABBA \ 7 @ 8 x d BIA D(D@ (M ABBE , @a (C ABBA ; A' D j BIE A(D0D6 0D(A BBBA H " 8 h h BLA A(G (D ABBA 8 ,!h BLA A(G (D ABBA D" < , @" BAA G0O MABE NCB4 l 9 0b CABA MAB " " D n G Ԉ ) h @# A\ 8 4#k BBD A(B0E (J CBBE ( T E 0A(C ABB H <#m BBB B(A0A8GP 8A0A(B BBBA ̉ P L @%A BBA G(Dp (G ABBE DxXBBIp , < pf (C ABBA ( l &8 BDD cDB / ACB $ &; AJ AA = 8 (] BEG A(A0[ (D ABBA 8 $( 8 L (` BBA A(E0\ (D ABBA ( 0H(A ABB ( H ȋ $(- BBB B(A0A8M8D0A(B BBB D IRBBIkTBBI0 \ ( BKD D DABA @)~ AD d DA Ќ ݼ ) G 4 *g BHD G(B0G(C ABB < 0 0 X $* BHA G0 KABE $ Yq 0e CABA * H ȍ * BHB E(D0D8G`R 8D0A(B BBBA , H+a BCA GpL DAB D p ( ` l+7 BFD gAB ݼ$ H d+D BBB B(A0A8Gp 8A0A(B BBBA : p H. ( D. , < @.[ A A t A T A F A l [K X/9 0 z BHD G| DAB < ̏ P/ FEE D(A0g (A BBBE , C 0Z (C BBBA ( < /X BEG FAB h $ /4 AAA nAA Q 4 Đ O` BDD I ABE AAB 8 w BLD A(D(D ABB 8 $/ L L /, BBB B(A0A8J\ 8D0A(B BBBA 5 $ Б 0t BBA A(G@, + @ (D ABBA L ( 16 BEB B(A0A8GD 8D0A(B BBBA < x @M MBBDBI ( 4F ADD0n AAA ! 0 4 1 Ak , 4 @ 45 B[ E N ` 2 Y A | 4 AY 4[ AY ē ' ܓ 4 4 4 B| A ' $ 4 5i AAA cAA \ $ 8 t / BBA A(G@o (D ABBA ` @ ̔ 4 4- D h 0 5 BGA J0[ CABA , p5 AW H [% d ` \5 t X5 AZ 8% d D5 @5 Е <5 AZ % d (5 4 $5` IAA gABAO P l 05- D h 8 AQ E ` 8 AQ E ` Ė 8 AQ E ` @ ` BBB A(D0G@B0D(A BBB ( 4 AU D % d \ - D h 4 t x4 BDA A(D0(D ABB 0 ȗ 4 A\ B [ A $ 05> ADA uAA H , 05 BDB E(A0A8Dp 8A0A(B BBBA x -P p ]- D h r- D h 0 Ș T6 BAD G0 DABA S( 0 ( 66 ADG0^ DAB D 3J 0a CAA H h 6 BBB A(D0t (D BBBA I(A BBB 0 $ ԙ 67 AAD gDA ( 7Y HDE d AAE ( = xCA, H $7S BAD D ABA x $ 87 47b v 8 К |7* BBD D(D0 (D ABBA 4+ 0 @ ( T8 BIB A(A0D@ 0A(A BBBA ( l @BHVPDXB`I@H ) BBB B(A0A8DP 8A0A(B BBBF 8 8D Az 8+ D f ( , +P ACD y CAA X $ p Z AKV0uAA / Am ( @ BDD rAB ܜ @8 L8 LO $ / AAA SJJ 0 AP L _ A] h 7 ( | 7 BHA T ABA $ 85 ADA lAA Н - 8 8 8 0 $ 8 BDD G0g DABE $ X I 0b CABA H 8 BBB E(A0A8D8A0A(B BBB ̞ c" p9 AH h9 AG@A $ -X @ < 9 AG@ AA ` IQ @ x : AG@A b\ @ ( :D ADG` AAA ܟ zU ` =r t=h AUP AA , ! P H D > BBB B(A0A8D@ 8A0A(B BBBA < @ 4 ,?v BJK I(G@H(A ABB@ t? BGB A(A0D@r 0A(A BBBA , ? AR D n C \ ?$ Ab @ x ? BAA G0P AABB AABA L p@7 BBB B(A0A8G 8A0A(B BBBA S , @H @ <H$ T XH h | H <H BBE B(D0D8Dp0 8A0A(B BBBA ܢ V p I LJ AGPA 0 B P H J AG@A h X @ 0 <Kj BAA G`N AABA 7 ` У \K BBB K(A0A8JSHMBF 8D0A(B BBBA mGBEVvEBE[KBBXJKEBSs 8G0A(B BBBE 4 "L FEE[ Ԥ 8Qw " Q Q $ Q) 8 L Q ` Q t QX AV L QK BLB A(D0GPxXI`RXAP 0A(A BBBA J P < " BBB A(A0j (A BBBA H @ S BBB A(A0y8D@AHBPI0A (A BBBA ! 0 < Sj BBE D(D0m (A BBBA " T@ U* AY I 0 U AT L U H ` ,U BBB B(A0A8A@: 8D0A(B BBBA @ 8 ̧ pY[ BEH G(D0t (A BBBA HQ 0 4 ( tYm AAE C DAE M AAE ` A6 ^ CAA Y ( Y AFG0U AAA Ĩ 0 ܨ Y $ Y6 AIE `AA OCA 8 L Y ` Y3 Am | L Y o Y H Щ Y& BBB B(A0A8A@ 8D0A(B BBB P @ < < p[ BBB A(A0 (D BBBA | M 0 H ]Z BEB E(A0A8DP 8A0A(B BBBA X P H BBB B(A0A8DP 8D0A(B BBBA T P t ]D Az b D0] ]' Ы ? QY $ ]C ALA rAA 0 ( ]^ BDD D`F AABA \ ~2 ` D x ]L BBB B(A0A8D`o8A0A(B BBB L `] 8A0A(B BBBA 8D0A(B BBBE 8D0A(B BBBE { 8D0A(B BBBE g 8C0A(B BBBE D 8A0A(B BBBE 8D0A(B BBBE D \ BIL D0`8L@IHEPEXA`K0 AABA ح 85 0 ]{ Ba A 5 $ ]Q AO @ ( X $^> BDD j ABB x CAB @ ^o BFB A(D0G@ 0D(A BBBA @ ( _~ BAA vAB 8 d! $ T X_@ AKA pAA $ | p_A AKA qAA 8 % BBA D(D0] (A ABBH & 0 ( @_Z AAQp@ AAA ( t_e AL E AA 0 L _ BGD D0~ CABA c* 0 @`# D ^ Y' $ Ȱ D` ADA AA D H BEB B(A0A8D`j 8D0A(B BBBA T ` t D A~ , 4 BAD CBA T ܱ ` AQ `- D h H $ ` BEE B(A0A8D`t 8A0A(B BBBA p ` ( `Q AAQpw AAA ( aX ADE { DAE ; T CAA at ADG0 , { 0A AAA P LaQ AKPCA p ( P ( ta( AAA R AAA - ̳ `a~ AJ nD aI AN`xA $ ` < aI AjC Z 8 \ a BBA A(B0{ (D ABBA dl 0 , Xb BFA D@ AAB I @ b' b+ D f , 8 AQ E ` L 8 AQ E ` H l b BEB B(A0A8G`t 8A0A(B BBBA i ` ص Tc AU % d @c @ <c BHB D(D0DP 0C(A BBBA 0 d d BAD G DAB J 8e! A[ ж " C H e BDB B(A0A8DP 8A0A(B BBBA H H P h tf@ D0{ 0 f* AG `A ( ̷ f> AIG ] AAA f 0 f BAA M DAB @ 3 ( \ `g AAA y AAA G , g BAA ABA и v 8 0h BGD D(G@{ (A ABBA ( j @ D mH D C0 \ hd BDD G0I AABA i_ 0 $ h AHZ0vAA Թ p 0 i i9 Ao ( 4 i~ BAD lDB , ` r! M KBB AAB ( <i> BDD j ABB 7 CAB , ,ie BDD G ABB $ C ABA 8 Di> A| T 4 h W BDD @ ABE AAB 8 i BBA A(A0 (D ABBA ܻ & 0 i? At E F E T ( 4 i BAD vAB ` V H | j* BEB E(D0A8B@ 8A0A(B BBBA ȼ @ k o6 $ dW ALS0tAA ( 8 W BAD LAB $ d 3 ADA jAA @ q BBB A(A0D@ 0D(A BBBA н @ Lv AX 8 $ 8v BBB A(A0l(D BBB , ` 0A (C BBBE H Lv BBE E(A0A8D@c 8C0A(B BBBA ܾ k5 @ H w) BEB B(A0A8Gp 8A0A(B BBBA H 4 p h w! A[ C j AW A H 10 An ؿ w ww G o m A(U0B8B@I ( w < w P : d w x w ( wV BDD } ABB CAB w , w D P E b A P Q 8 d Xx BBB A(A0(D BBB \ 0 % LO y) Ag y& Ad ( @ T hy h dy | I 5 AW O M @ x BBB A(A0Pu0A(A BBB 0 X vx AUBBI BBB B(A0A8JpWxXBBIp 8M0A(B BBBE N 8A0A(B BBBE y8A0A(B BBB AQ 4 ) AU E M \ T BPG I(G0A8I~[BBI8D0A(B BBB 8 BEE D(C0(C BBB \ &s BIB I(F0J8JOUBBI8D0A(B BBB \ P 9 BIB B(D0H8lXBBI8D0A(B BBB l { BIB B(J0C8G[BBIOcA8D0A(B BBB , \vt BDA D0d AAB P 5 0 $ l v5 AAC mAA < v| BAJ J0R8R@BHBPI0h GAB 4 wX 0G8T@BHBPI0M CABA $ v AJ LD D wm Q AA d xv3 JcA H v BBB B(D0D8I8A0A(B BBB \X H v BHA ]DXBBI DABA 8 H ( T < GAD [DA 0 X AAA E DAE ACA > At E C d BBB A(A0JPfXX`BhBpIP) 0D(A BBBE D0C(A BBB H < BBB B(A0G8Dp 8D0A(B BBBA p v AK v AK v" A\ d% d v ]w Au < 2 R^ T v h @ | v ADD`E AAA p HAE DHA t1 `I AAE 0 w BHD D0 AABA M 0 $ 4 y Aa A H E X \ t H E C( 8ys ADDp] AAA } p tyaS BEB B(A0A8GHmBP 8D0A(B BBBA i DEE}hEsADpAF DEEHHxDEEHHx#DpAHkAHiBI EEExDEEhmHiAx DEEd )EEErnGhASHiAHiA/EEEx (+ Ai 5 $ BBB B(A0A8DDjBI 8D0A(B BBBA GeAaEkBZEkB.EkBkKaA 2 :BeA^EkABkBDdA DeB#BkBDiA;EjBHfA ( D Q ADE w AAA p (. ( BDD g ABA , X BDD e ABA 0 (& BBB B(D0A8GP 8 ((l P 8A0A(B BBBA T 4 Ra 8 l [ BGE D(C0V (A BBBA 3+ 0 , BDA ABA 2 X3 BDH $ 4 7) F ABA \ Pe ( p 7 IAA [ ABA 0 N FCG0NAAAF0 \ KBB B(D0D8D@^8A0A(B BBBAC@ T 0 7y BEE E(D0D8E@bHKPHXB`I@P8A0A(B BBB ( GBFAI A $ 7s eBFA ( ` AAA [ AAA 7 $ 4 AAD AA \ 7g ( t x AAD \ AAA $ 7 AAD yAA, MAA w ABA 7 O d G P 4 / BBB E(D0A8MPXJ`IXAPr8F0A(B BBB y7 G D 8 BEB E(F0A8Gp8C0A(B BBB 8] DK E C 9 9 D 8 9 8 L BBA A(E0 (A ABBA c9 0 X T P L H3 y9 ` H 0 \ BEE B(A0A8D@V 8D0A(B BBBA | 95 @ $ 9 ADD AA K AG AA }9 D AE , ; ARA ]A( L g AAD@5 AAA x 9I @ H @ BBB B(A0A8G` 8D0A(B BBBA 4 9, `F 8H0A(B BBBE f AW A L 4 8- L $ ` ] ADE PAA 8r a GAB 8 ' BKM DHKPRHA@ AABA 8 @ AU 29% d 8 ( L > BDD j ABB x 8 CAB 8, Ab 8 8U AS 9 9 92 $ (9M AK < + P I9 d >9 x 29 &9J AH X9J AH( 9 BAC VAB $ ~9 AKN0qAA 9 $ 9T AR @ , T : h : | 4 96 BDD V ABE JAB @ C BAG GKSAr CAB 9 ( , < M GAA {CBA $ l Z9 IDB $ j AAD aAA 9/ 4 BBA A(D0(A ABB 8o 0 D ( D BBB B(A0A8GP8D0A(B BBB p 9: P $ ": AAD xAA 1 Af A H [:d ; ; $ ;C ACD xAA \ < BED D(D@y (G ABBB N (A ABBB (A ABBL g; @ H; ( = BDD T ABA $ D E _ A L H H :- \ p 8 Av :, 8 Av :- : D H D A := $ $ (X ADA OAA L : 0 d H{ BAA D0L AABA U: 0 x t. Ad Z Bu E Y 8 9 BBA A(DP(D ABB T ;Y AH L C < t ; BAA G0U CABE f DAB f< 4 q<< BDD _ ABB JAB ' D b ]< 4 , V BBI A(Ju(C ABB d <? 0 O BED G0o AABE $ = 0u CABA ;> AY @ BAA K0e DABA [8V@DHBPI0 , ` J BAA ABA =7 ( 0D BDK oAB 8 d\ BBA A(D0 (D ABBA }= 0 , 0 IAD g ABA ` K=^ ( | P AAD x AAA a= 8 Ag I := (= H BBB B(A0H8DP 8A0A(B BBBA , P < PAXV`DhBpIP 1= := , ?= BHG G0 AAB8 = IBB G(D0(A BBB ( V HDE d AAB @ 6>= xCA( ` K BGA }AB '> 8 { BBA A(D0N (D ABBA = 0 ( Y HDE d AAE , == xCA L 6 Al H h $ BBB B(A0D8A@j 8D0A(B BBBA X= @ X 4 Tl BDD R ABA AGB < < p 4 P << BDD _ ABB JAB $ A^ ` AV @ \ BAH D0W AABA A8V@DHBPI0 e<" 0 H BBB B(A0A8DPY 8D0A(B BBBA l P H L BFA A(GP (A ABBA _XY`DhBpIP ; P , BHD j ABA ; 4 xT AC I T AU p 1;% dH BBB A(H0m (T EBBE (D EGK< :g 0A (C BBBA G(H DBB 8 BBB A(A0(D IDB , P :? 0Y (C BBBA \ h; Ay : t! : AT x6 : : At 8 p: J P D AB l K:# AG AA 2:? $ L@ AAE pCA 1: WCA DD AB $ :# < ` 4 P \ BAA ` ABE XHB , 9( E KDE ICB 4 BBA A(A0(A ABB 97 0 H 4 BBB B(A0A8DP 8D0A(B BBBA 4 X ; BDD a GBB AAB 9 , Aj 8 4 BBA A(A0(A ABB $ 88 0 @ ( T > BDD j ABB 8 CAB x t K AG tJ )84 X CA IJ D AB , 8# 8 D LAA W JKE _ CBE ,; ( X AAE k CAE 7 I CAA AG A 7 0 D X ' Ae t /7 M yH K P$ 6& A[ T AD0A 6; 0 V H E < 6s y A @ X BAA }(E0J(A A ABA wDM 6 4* Ah 6 $ 0c AAD TCA 6 ACA( 4 Xx HDE H AAA ` P6I 8 x BBA A(E0h (D ABBA E6 0 < 8 L 4 BBA A(D0V (H ABBE (H CBBE < H 5B 0S (A ABBE I (C ABBA 8 Q BBA A(D@@(A ABB 5d @ $ 5 8 BBA A(A0 (A ABBA D 5b 0 \ ` , BBA A(E0Y (H ABBE H (H ABBE n (H ABBE ( m5 0I(C ABB 0 `K AAB \ GJE BDJ |# 4 5 H \ p 4 x6 Hd E 4T S | ` AZ 4 C, BAD ABA H p4 d AD zA 45 pc A] 4 K A 3 RT - Ab A 4* 4 4f BDD R ABB AAB 4 X 4< BDD _ ABB JAB ( \> BDD j ABB 4 CAB L H 4 0 AR 4 d4 C H L h BBB B(A0A8Dp 8A0A(B BBBA 4 p $P AN 5W H5 $ tB AAA |AA H L BBB B(A0K8D@= 8D0A(B BBBA l c5T @ 4 0i ADD0W8H@V8A0X DAA _5 0 P G5' , @ 5 H T BBD D(E0 (D ABBA F(D ABB 4% 0 H 4O BBB B(D0D8GP*8D0A(B BBB L 5 BAA M0f8U@BHBPI0r GABE D CAB X F m A t 6 2 l6 4 GY @ X GBD A(F0X (D ABBA ] 6 0 < 7 GY T 8$ h 5 | @ L AY 5 H @ BBA A(B0l (A ABBE A(C ABB F5Q 0 $ hW Bp A c D [5 X H l K5 ? &5 0 BAA D0 DABA 4 0 ( D BHA yAB $ C5H @ K[ E Q ` O52 t AY Q5 < EBE A(A0x (A BBBA 5[ 0 < x BBB A(A0c (A BBBA H 85 0 h 47 Au 8 0 H BMD Gp DABA 8H p @ BEB D(A0G` 0C(A BBBA H ( BAD L(C0C8C@T K ABA L(L0C8C@T t t BBB B(A0A8Spv 8A0A(B BBBE xPHA_pZ 8A0A(B BBBA ( Ab 7 C8 z BDA D(D@Z (D ABBA \ 7 @ 0 x L AAE U AAA fAA 0 BAA G0r DABA $ #7' 0U CABE ( d6 ADG0^ DAB 4 6J 0a CAA H X Ty BEE A(A0K (D BBBA E(D BFB 6 0 H hn BIB A(A0J (A BBBE ~(D BBB s6 0 0 l) $ D O AAD FAA l 6" R CAE 0 BAA D0 DABA 5? 0 @ BAA G0 AABA q FHBE $ 5 0 H @ BBB B(A0A8Gp 8D0A(B BBBA 4 f5e pD 8C0A(B BBBE ( ] ADD G AAA g5= $ ( AAD XDA 0 D AB 4 L H5f BDD R ABB AAB x H b5d BSG D(J0Y (H AGBE A(C ABB 8 AQ E ` Z5S AI E CH $ BBB B(A0A8DP 8D0A(B BBBA p A5w P 5% YK 4 5 BGA D(D0(C ABB R A_ E ` A @6 668 AQ E ` 8 N65 AQ B ` $ X c6 PZ B J B [ 7 Ac E M 6& 68 AQ E ` 68 AQ E ` 68 AQ E ` , 6- D h D 78 AQ E ` d 7- D h | 378 AQ E ` K7- D h `7- D h u75 AQ B ` 7 7- D h 78 AQ E ` 8 7< AX B ` X 7 l 7- D h 78 AQ E ` 7- D h 88 AQ E ` 88 AQ E ` 88- D h M88 AQ E ` 4 e8 H Y8 \ M8K AI x |88 AQ E ` 85 AQ B ` 8 @ 8i BBB A(D0G@K0D(A BBB 9 $ 9% AQ E M D H AP \ 9 p 98 AQ E ` 9% AQ E M H BBA A(M@M (J ABBB DHUPBXB`I@ ( q9! @X(C ABB H ( 4 BEA D(B0{ (M ABBE U (D ABBA , t g HDK ~ AAA L 8 P P : BAA M0R8R@BHBPI0 DABA G8T@BHBPI0 $ y8& 0 @ @ BAA M0y DABA E8U@BHBPI0 $ ?83 0X GABE J8 A[ ( 4I BGA wAB 8 ADB < 4 BBB D(H0 (D BBBA X 7, 0 T x q BBB A(A0G@ 0D(A BBBA 0H(D DBB 0 w7z @O 0H(A BBBE < BBE A(A0D@0D(A BBB D }7 @ 8 d ( AAM0| DAE D8U@BHBPI0 A7& 0D CAA 4 XG ADG0e AAA D GAB 78 0 +7 ( !7 < +7 P 57 d ALP~D 7 P @ `Z BAA M0 AABA i8U@BHBPI0 6] 0 ` AX 6 ( 0 Lr AGA Y AAA \ 6 t % Ac 6 ( ^ BAA VAB $ r6 C HBE " A\ G6 0 , D +6 X AF p 5 8 5+ BED C(A0(A ABB 4 6l BEA A(D0V(C ABB( O BDD AAB 8 6 H T BEB B(A0A8DPV 8D0A(B BBBA 6 P P Ah eA , i BMP G0~ AAB $ $ t AAD kAA L 6/ ( d Xf AAD N AAA 6! H BEB B(A0A8D`- 8A0A(B BBBA ^6 ` X BBE B(A0A8DP( 8D0A(B BBBA sXG`SXAP 4 p 6m PXG`TXAPvXG`SXBP$ $D AAD {AA 8 $ 4p AAE fAA 8| l(A0W(B H 4 X BEB B(A0A8D`1 8A0A(B BBBA 8 ` 8 BBA A(D0 (A ABBA l9D 0 L BBB B(A0A8D 8A0A(B BBBA 8 H D9 8A0A(B BBBE , ( BHA ABA 9] : H = BBB E(D0D8GP 8A0A(B BBBA 4 0 9 PX 8J0M(B BBBE 0 h ! BED DP AABA : P H d BBB B(A0A8GP 8C0A(B BBBA 9; P $ $ c AAE YAA L 95 ( d G ADD v AAA 9* 8 $P DFB A(A0x(C BBB y9J 0 $ o APJPNDA , {9- P ( D H FAG0NAAA p d9. 0 H $ BEE D(D0 (A BBBA W(D BBB, .9O 0R (A BBBE ( xK BDD x ABA 0 !:) 8 L BBB A(A0v (A BBBA 9 0 $ AV0jD 9 0 |# Aa 9; . Ad ( 9 $ @ |9 AAA ]JJ $ h = AAA aJJ 8 P BED D(D0g (D ABBE ( 9 0A(C ABB D Ak E 8 ( ! A[ @ 8 C X & l 8 4 BEA A(D@(D ABB V86 @ 8 4 H8 ( , T BHA uDK < 8 ACB ` < * t 7 D t Ar 75 7 AZ AM 4 BEA A(A0r(D ABB 8 z7" 0 0 T BGA G0l AABA L7 0 H T P D L BBB B(A0D8A@8D0A(B BBB (! 6! @ L H! BBB E(A0A8Do 8A0A(B BBBA ! r6L $ ! 6 AAD0mAA ! v6% 0 T ! K BIJ H(UJGGGGqR(D ABB , P" +6h AUBBIH " 6 BEE E(D0D8B@ 8D0A(B BBB " 6s @ 4 " e BED D(A0K(D ABB0 $# BDD G0e DABE $ X# 5^ 0 CABA # # 0 # 6 AAA L CAE uAA # h6 0 # BBB B(H0G8Gp D $$ /6 ph 8D0A(B BBBA xK\xAp H l$ BBE E(D0D8DPT 8C0A(B BBBA $ $x H $ BBB B(D0D8DP~ 8C0A(B BBBA % 6> P 0 8% 6x APD0q DAE cCA H l% 97 BBK D(B0{ (G FBBE A(D ABB ( % 7 BAD AB % h# % 8 & p- Bj $& 7 | 8& tA BEB B(A0A8G 8D0A(B BBBA } 8I0A(B BBBE 8I0A(B BBBE 8 & e7 s 8J0D(E BBBE & & Ad ' 9 8 (' BBE E(C0c (A BBBA d' K9E 0 < ' H BBB A(A0D@w0D(A BBB0 ' 09c @q 0M(H DBBE ` ' d IBB D(D0` (A BBBB W (A BBBA v (M BBBE ( \( 8 IDA AB 4 ( 9 BAA O HBE rAB $ ( ,R AKA BAA ( dT ( 97 Y] ) AZ ( 0) BBB D(A0 P \) 9c 0A (D BBBE S (D BBBA A (D BBBE ) I Aa A e ) n9 0 ) * BIB B(A0A8D` L * ?9: ` 8D0A(B BBBA 8J0A(B BBB h* ):6 N g $ * G:\ Aw E V E C * 42 Ap * c: ` * H BBB B(J0D8J 8D0A(B BBBA MBBI 8+ p:_ ( X+ 6 ECE `AAA + AX + AX H + BEE E(A0C8F`W 8D0A(B BBBA , X , 9 BKB B(A0D8GpexXBBIp(8D0A(B BBB H x, 4G BBE B(A0A8DP 8D0A(B BBBA , :K P , ;+ D f , - ; $- :0 8- L- `- t- 8 - F BBD D(D0g (A ABBA - : 0 4 - ; AM W(U0B8B@I b KE DC . V; 8 ,. K;w BBB A(A0d(D BBB H h. D BBB B(J0G8D` 8J0A(B BBBE D . :;g `HhUpBxBI`P 8C0A(B BBBA . p $ / lR AFA GAA8 8/ BBB A(A0(A BBB t/ :b 0 / ( H / $d BBB B(D0A8DP 8A0A(B BBBA / : P $ 0 (z AGA nAA <0 :# T0 h G A p0 y:% 0 O AM 0 n:* 0 4T AR 0 d:# 0 o: 1 Lt AL@bD 1 W: @ 81 > L1 5: $ `1 8 ADA oAA $ 1 :Y AAD PAA@ 1 BIE A(D0DPp 0A(A BBBA 1 9{ P H 2 " BBB B(D0A8FP8D0A(B BBB 4 `2 :l PD 8A0A(B BBBE L 2 7:- BDD G0m HABE I DABE AAB ( 2 ; UAA AB 0 3 ; AAB s DDE ADA$ H3 ) DDA ]AA p3 ;" 3 <Q AG E C 3 7< 3 x AZ`W AA 3 <$ ` 3 ^ Ak A p 4 r<! 04 D4 @ AI tA d4 G< |4 M<4 AI hA 4 ( 4 i BKA WAB 4 !< ( 4 p BBB D(D0 ( $5 ; 0C(A BBB P5 ;g D0b h5 d D0_ 5 ; 0 5 ;z D@u( 5 0R AMDP DAA 5 .<W P 0 5 L BAI G@f AABA $6 9<^ AP KA D6 w<) D Y E F d6 <) D Y E F 6 < 6 w<) D Y E F 6 <' D b 6 <) D Y E F 6 <h AP0UA< 7 < BAA D@{HBPKHA@[ DAB 0 P7 BEA DPz DABA 7 `= P 7 ^= AU 7 ]= AM xAP 7 BFB A(A0DUOKA0D(A BBB 08 q=> P8 = d8 = AU ( 8 @ BDD nAB 8 n= OCB 8 8 0 8 $ BEE B(D0C8G` 0 ,9 = `D8D0A(B BBB `9 L S BV E u @ 9 BIE A(D0D@ 0A(A BBBA 9 }<s @ 9 C AD w AA : <T ( : AP0[ DE ZC L: < 0 d: h } AIqA < : 5 BLE A(A0 (A BBBA : V< 0 : : </ D _ E F D ; BEB E(D0C8F`8D0A(B BBB d; < ` ; ; </ D _ E F D ; BBB E(D0C8Fp8D0A(B BBB < | D K H { A $< $<V 8< D p H O A \< B<F T p< L BIE A(D0DP` 0D(A BBBE D 0L(A BBBE 0 < <w Pa 0C(A BBBA ( < p AD AE _ AA (= 3<7 @= R<~ 4 T= !q AAE E DAE O AAE = =6 qCA, = @!s BLJ ABA 8 = " BBD C(D0b (A ABBA > .=l 0 , 4> "` BGA A DBE $ d> N= p DBA ( > "t AAG@J AAA > =E @ > #J > H# > D#m AD fA ? =5 0? |# A] H? = \ \? ~= BEB B(D0D8DP 8D0A(B BBBE H8G0A(B BBBH ? >} BBB B(A0A8G^8D0A(B BBB 8 @ C?P BEG A(Gp0(D ABB D@ "% X@ " AP t@ "' AJ E O @ "$ AJ B O @ " AS @ " AU @ ? AG A A @ 4 A @s BDD \ ABE AAB $ XA d", ADH OJA A (@ ADA A L"8 AJ A k A ? A ? A ? 4 B ? BEA A(C0(A ABB 8B o@ LB h@- `B @5 tB ! B @= H B @v BBH E(D0D8IF8D0A(B BBB B d! B @ C @ $C cAc 8C A LC A 4 `C AM BDD v ABE AAB C A C A& C C A C A C A 4 D A< BDD _ ABB JAB HD A \D pD A D D D cA! D pA D tAV D A D E A2 $E A 8E A@ LE 0 `E A BGD J DAB E B E B E B E sB fA[A 0 E B BLE A( ABB (F ]D fAVA 0 LF D BHE A( ABB F F ( F FL BAD AAB 4 F F BDD D(G@(A ABBH F Gy BEB H(D0D8JH8D0A(B BBB 4 DG G BDD D(G@(A ABBH |G H{ BEB H(D0D8JJ8D0A(B BBB 4 G BDD D(G@(A ABB H HN @ H H Hv BBH E(D0D8IF8D0A(B BBB hH H 4 |H H< BDD _ ABB JAB 4 H HS BDD ABB AAB H I 4 I H6 BDD V ABE JAB 4 8I H9 BED D(A0b(A ABB 4 pI H; BED D(C0b(A ABB I H ^AA I I I I I J I J I 0J Ik Fa V X , PJ Ij BDD D0W AAB J )J& Ad J 3J J *J J /J , J 0J bAA L`p AAB K J" @ K J `BB B(A0A8V0A(B BBB `K K tK L0 G h K L2 AI fA K -L A K $L K L A K L K K\ L AL $L AL] 8L L LL L `L \ tL vLb L L# HZ L L# HZ L L( L L L L L L M L $M L ( 8M L+ BDC ZAB dM L AS M L= A{ M Le Ac M 3M2 Ap M MM" M M GMA N tMk N 0N M DN M XN lN $ N M/ ADD aCA N M. Al N MI N M% VK N O O ,O M AT HO M2 cK $ `O M' AAD WDA O M= A{ O M LO O M LO O M+ Ai O M& UP P 8 P M LO 0P M LO HP N LO `P ND AB |P 5N; Cw P TN LO P [N LO P bN LO P 2 A^ E P MN: At Q kNW AL A D 8Q Nk A` A D XQ N& A` tQ AU Q N AU Q Q N? Q N= 4 Q O; BEA C(D0^(D ABB R !O FK 8R O AT PR O AL hR O AH R O) R O R O R O R O R O R N D S Nh BBB B(A0D8B@K8D0A(B BBB TS O& Ad < pS #O BEE D(D0G`{0F(A BBB S O5 S OO S O S T | T O D N ,T O @T O TT O hT O |T O T O* T O T O T O T O T O U O U O 0U |O DU mO XU ZO" lU hO# Aa U oO U dO U _O U U CO U <O V 5O 8 V .O! BPT O(m(A ABB PV R AW hV R |V R V RQ V YR V KR V =R0 Al V UR AP V OR W CR $W =R F 8W G$ 8 LW @T BGD A(F0V (C ABBA W W W W W ? W *: X P X A (X 2 <X & PX ( Af hX )J YF`fAA ( X On BKD YAB X ) X X X Y 4 Y E BGD h DBE AAB TY hY AN 4 Y c BEI D(A0G(A ABB8 Y R BEE D(A0y(A BBB Y $ Z : ADA qAA ( 0Z ? BGD nAB \Z pZ Z Z Z % Z Z ' Z @ Z { BMD D(F0PE0A(A BBB @ @[ L BBH A(H0Ge0A(A BBB [ ) [ ) [ ) [ љ" A\ $ [ י AKQ0_AAL \ . KEB B(A0A8D@8A0A(B BBBA T\ 5 As p\ AF \ \ ) \ e Ac \ \ \ ] ך ] Ϛ 0] ǚ D] X] l] ] ] J J ] ] AO ] ] A ^ AX ^ AP ( 8^ ~ NIC ^AAA 4 d^ BEA I(A0(A ABB4 ^ lv BFI D(D0S(D ABB( ^ B BHD lAB _ N HE _ 6 D q 4_ H_ \_ AF t_ _ ٛ $ _ ƛL AAA FAA _ _ _ ޛ AT ` ܛ FL $ ` ؛? ADD qAA H` \` 4 p` ؛] LHD E(B0w(A ABB ` F D0A ` +W I0Ml ` j SBB B(A0C8Gp 8H0H(B BBBE D8A0A(B BBBA \ Ha ݝ BBB B(A0A8D@ 8C0A(B BBBE A8A0A(B BBB` a f BNB B(A0D8A@] 8A0A(B BBBE 8A0A(B BBB ` b BBB B(A0D8FP^ 8C0A(B BBBE }8A0A(B BBB pb H b v BBB B(D0C8D@a8A0A(B BBB ( b N KCC yAAA 4 b ˣs BBA A(D0b(A ABB$ 4c . EFA _AA \c % pc AP c # c & AP c c %" AN E M c '& A` d 1 AU d 4 AZ <d 8 AW Xd 5 AT td /> A| H d U BBB B(G0A8GP8D0A(B BBB H d d BBB B(A0A8B@J8D0A(B BBB 0 $e BBB B(A0A8D Xe ~( H pe . ADD e A e A AT0gD e A e " e f " A` f A 0f 4 Df t BAC ^ DBE AAB 4 |f { BDA d DBE AAB f 4, TS f H A f H A4 f Hu BED A(D0\(C ABB, ,g BAA DP AAB( \g + BEA D(G g A g A g A g 0 g $ BAD D@ AAB ( h ӭ= BGL J(D0 8h ; A9 Th k Ai ph R h Z $ h b] AJD KAA$ h ] AJD KAA h ̹$ h ܹ G i iR AP 4i AS Li `i G |i G i AF i i i r i j j b j (j F <j O Pj Xm Ak hj > A| j ϻ; Ay j K AI j !K AI j T j B j 0 k A\ $k $w Z] <k A HuA Xk 1 Ao tk Y D0T k AY $ k > AAA xAA k 9 TY k 89 TY k Y9 TY l z6 \Y ,l 6 \Y Dl AY \l AY tl eZ l $s Aq l o Am l ־* Ah l A\ l A\ m A\ $ ,m ( AKD UAA $ Tm ( AKD UAA $ |m ( AKD UAA $ m E AAA AA m D m v6 m / n n 4n * Hn ̿M \n pn n # AX n n $ n = AAE oAA n ! o ! o " ,o #= Ah E J Lo @9 `o e to Z o O o D o 90 o U2 o s G o G p fz AD qC( 0p BAD AB @ \p BAA L ABE v LBE AAB $ p W ALS0tAA p 1 N_ $ p AAB AA q A $ q C. AID ]AA 0 Dq I= AIE W AAE KCA xq R< Az q v7 Au 8 q BEB H(D0(A BBB q % Ac r ! A_ $ r v AAA pAA Dr Xr N lr ? r 0 r , r r $ r P ADA GAA r B A s 8 (s BBD D(D0(D ABB 8 ds BBD D(D0(D ABB s mT s s ( s BHD AB ( t 5 BHD AB ( 4t BHD AB ( `t % BHD AB t ( t BHD AB ( t BHD AB ( t BHD AB ( $u BHD AB ( Pu v BHD AB ( |u BHD AB u f< Av ( u BHD AB ( u BHD AB ( v z BHD AB ( Dv BHD AB ( pv j BHD AB ( v BHD AB ( v Z BHD AB ( v BHD AB ( w J BHD AB ( Lw BHD AB ( xw : BHD AB ( w BHD AB ( w * BHD AB ( w : BAA rAB ( (x : BAA rAB D Tx BBB E(A0A8GP8A0A(B BBB x `N la < x o BDA G0E GABE D EAB < x BDB A(A0DP0A(A BBB 4y @6 D q Ly ^} D x dy AX |y & Ad y F D A8 y BBB D(C0(C BBB y G z , ( z H BDD zAB , Hz -~ BHD D0g AAB$ xz {n AAD eAA$ z 0 AAD `DA z 7 Hn z AR { 9 Am { G{ 4{ kH UO E T T{ ? A} l{ 7 Au { ` A^ D { BEB E(D0D8E@8A0A(B BBB { _ A] | G AE | 1t Ar <| D X| ' Ae p| | | 5 AW O M | 5 AW O M | "5 AW O M | 7V AT } q AQ 0} q( NT H} ( NT `} ( NT x} ( NT } B} } ( NT } ) B} } ( NT } B~ ~ B} ~ rG NU D 8~ BBB B(A0A8A@8A0A(B BBB$ ~ @ AAD0DA ~ ( NT ~ ( NT ~ ( NT ~ 3 NT , %l BHI L0H AAB 8 ar Ap P d x D BBB B(A0A8GP8C0A(B BBB( X IKG tCAA # ( q IDA _AB ( @ [p ICD \AB l A $ * AAD FA$ = AGA qAA = A{ 0 An g g , $ ? NHD pABA 4 T T BED D(C0{(A ABB D N AZ0kA( ā ) JAJAAA i WFA q WNA< ( Z BFE D(D0D@x0D(A BBB$ h < AGG0jAA H BBD D(E0i (J ABBE A(C ABB ܂ I Bv E K @ $ ( $ BHH AB $ P j- AAA gAA x o g _ ȃ C ܃ ; 3 + # , ' Ae 0 H &( ADE N GAB ACA | AZ Ax E ] 4 Ȅ BBA A(E0(D ABB G H~ 8% HY 4 E3 VY ( L `e BAA ]AB $ x ? ADA vAA 8 IGB A(G0(D BBB ܅ B AF 8 8 BBA D(D(C ABB 8 0 j BBA D(DT(C ABB l $ Y AAD PAA$ Y AAD PAA( BAA AB $ }b AGA VAA( 8 j BDI WAB 0 d P AAH ` GAB WCA $ AKV0^AA l^ A\ ܇ } A{ ` A^ W) AU E M ( 0 ` BAA AB \ A A t A A , BDA G0 AAB, BDA G0 AAB( BKA AB N' D W E F 8 U 4 L Fl BED D(D0P(C ABB$ zG ADA ~AA ԉ {F AD 8 O BEE D(G0p(A BBB , AR D AR $ \ K AK e AB SC AR @ AG vA $ Њ [ AGG0IAA0 X AAD D DAE AAA , 9D ( @ i BDA AB l Eq E ] A AP $ ;} ADD qAA ̋ A[ $ ACT0AAH Q: LBB B(A0A8GP8A0A(B BBB X ? AP E n$ x N AAA HAA$ L AAA FAAH Ȍ X BEE D(D0h (A BBBE A(H BBB H * BEE B(D0D8D`8D0A(B BBB d ` BBB B(A0A8DPHXK`f8A0A(B BBBEPR8G0A(B BBB ȍ ) 0 ܍ 'Y AAC I AAE AAA L ( $ = BHD AB ( P BHD AB | - $ '' ADG GIF &k AK E Y ( ؎ q AG x FE DC 4 * ADD0 CDE DCA < < G BDA D0 CDBE N CAB< | / BAA G0 CABE J AAB Џ G AD }D ^ A\ U AS ( UJ ED D ! 4 X BFD D(G0(A ABB 4! AW E C 5 Đ 3R BF E D e KP e KL 0 a/ ADH K JAE ADA P \) AU E M p e AU dF D l E P Q D w E P D ̑ BBB B(A0A8A@8C0A(B BBB + D |$ , Y AAD PAA$ T Y AAD PAA$ | Y AAD PAA ' ̒ * AT G M AF , AF D > D u \ " A p 8 _K E C 0 5L AAA q DAE KAA ē M4 [K E C a A 8 ` BBB A(A0(A BBB 8 < " BBB A(A0(D BBB 0 x ; ADE N DAE TCA $ Ԕ 2 AEA hAA 8 BEA A(D@(D ABB 8 0 L ADA AAE ACA 0 %> D0y K: q@ Q^GA E C K AA E C K AA E C $ 8 L ' \ ` BEB B(A0A8G` 8D0A(B BBBE D8C0A(B BBBT Z BDB B(J0H8DppxDKxApc8A0A(B BBB , O vK E C L ' NK E C l " AN E M = cI +( ̗ ? @ I N* PY `5 8 4 LAA Z ABB kAB D p LAA Z ABB J ABB sAB L AI ( И B8 BDD jAB $ NG AGD xAA X $ m BDB B(A0D8G!DjAM8D0A(B BBB $ q ADH aAA4 BAA ABE SAB l 1 M AG CA ^ 2 Ah E C < 4 p BDD G0u GABE D CAB t H BBB B(A0A8D 8D0A(B BBB ` AS`JA4 ` BJA Z ABA IDB 4 T Z BED D(E0(A ABB H h BIB B(A0A8GE8A0A(B BBB ؛ AZ D BEE E(A0C8FP8D0A(B BBB8 8 BBE G(A0(A BBB 8 t K BBA A(G(D ABB $ t AAD kAA / $ AAD xAA$ AAD AA @ *E $ X W AAD AA$ AAD xAA / $ AAD xAAD BBB B(A0A8GP8D0A(B BBB , 1 P 0 L g ADB J DDE FAAD ' i BBB B(A0A8A@P8D0A(B BBB$ Ȟ H K AJD vDA 4 k _ BED D(E0D(A ABB( ( P BDI }AB ` T BBE B(D0C8J 8A0A(B BBBE O8A0A(B BBB ( < BEI AB ( Af ( < P 4 d BBA D(A0~(D ABB4 BBA A(A0(D ABB4 Ԡ BBA A(A0(D ABB$ L < AAA vAA 8 4 ` BBA A(D0(D ABB $ p r ADA iAAD ! BBB E(D0A8A@8D0A(B BBB8 ! BKF D(D0(A BBB "5 Ac E K $ < (" ADA AA d " \ x " BBB B(A0A8DP 8J0A(B BBBE D8A0A(B BBB آ 6# A #" AW E D $ # ADA AA$ < $$S AAA MAA d O$ x K$ U$* k$ 0 u$ AGD@} AAE DCAD $ BEB B(D0D8A@p8D0A(B BBB 0 $%1 ( D A%d `FA gNC 0 p y% AAA KCE AAA %2 < % AS E H E H E a E Q L Q S N & G ' $ ( ' ADA AA4 P l' BED D(B0(D ABB ( ( (c Aa ̥ I(. Bk _(\ BL A E ( ( BAA AB 8 0 ) BBD D(D0(D ABB l ) ) 9 $ )Q AKA AAA$ Ц )K ADD |DA * * * 4 * H * \ ) p ) ) )< Az *4 Ar H Ч .* BKB B(A0H8G`8C0A(B BBB .J A] jA < . P . 0 d . ADJ0} AAE mAA / .% Ac Ȩ . ܨ .. TY / AO B C H .\ BBA A(B0; (D ABBE A(D ABB ` 0D AB x 70C Ac E Y Z0 4 K0| BBA D(B0h(C ABB( 0q BAD fAB 0 $ 0 8 8 0 BBB D(C0(A BBB t 2 !2 -2 92 0 Ī 12X QAE vG AAA H U2 BIB E(A0A8D`f8A0A(B BBB D 3 H X 3 BBD A(A0| (D ABBE A(A ABB 4 3@ BDD [ ABE MCB l ܫ 3 BBB E(D0D8GpT 8J0D(B BBBE mxBZxAp~8D0A(B BBB 4 L 4 BBA A(D@(D ABB4 5 BBA A(D@(A ABB( 5 AHF`AA @ j7 BBB A(D0D@v0D(A BBB X , 8 BGB B(A0A8DFPVA8D0A(B BBB 4 (9 BBA F(D0(D ABB 9 8 ԭ 9 BDB A(A0(A BBB <; BBB B(A0A8G9OYBKOBEdAKKA8A0A(B BBB @] BDH LAA Į @ G EA G A* D0e A- D0h , A GuBQ P LB GuBQ 4 t Bm AAK0P8V@DHBPI0hAA ( By G Y(U0B8B@I ^ H P( د :Cv G Y(U0B8B@I ^ E P( Cy G Y(U0B8B@I ^ H P( 0 C| G Y(U0B8B@I d E P( \ !D G Y(U0B8B@I h E P( uD G Y(U0B8B@I g E P( Ds G Y(U0B8B@I [ E P$ Eo G Y(U0B8B@I l h VE( BBA A(HPPXY`DhBpIP (C ABBE F (J ABBE D(C ABB $ t F G Y(U0B8B@I t , F AM W(U0B8B@I A ( ̱ FJ BDD |AB 0 G ADE j AAE wAA , GH Bd E T E C H P G BEE B(A0A8NP8A0A(B BBB ( !J} BCA sAB ( Ȳ rJ BHA rAB J4 An $ J2 AEA hAA $ 4 J3 ADA jAA 8 \ J^ BBA A(D0M(A ABB @ L AAK0`8V@DHBPI0Z DAE DCA ( ܳ UL FAD AB H L/ BEB B(D0D8D 8D0A(B BBB T N, Aj ( p N IDD kAB $ 3O1 AKA aAA Ĵ <O ش 1O H 2O BBA D(A0Y (D CIBE (D ABB 8 O, Aj T O H~ E C$ t UP_ AJG0JAA P ( Pn BHD \AB ܵ P P- Ic P( ST $ P2 Ap @ P A\ \ Q p P AJ E A H P BEA K(E0h (M ABBE A(D ABB ܶ 9Q E E H H C< Q} JAE K DAE F FCE AAA4 @ Q BBA A(A0(D ABB x WR3 Ai E C 0 jRZ ADK \ MAE TAA 8 ̷ R IBB A(A0q(A BBB $ Rd AAK TAA0 0 L(b AAG j GHE TAA 0 d R{ AGE a AAE ACA +SI AG @ XS VAA G0Y DADG DAB \ &T BBA A(E0K (D ABBE O (D ABBE A(D ABB X T A\ H t T BBA A(E0 (A ABBE q(D ABB ( U BHD AB $ V5 AFA jAA V ( V < V# Aa 4 T Vb BED D(B0G(D ABB V V $ Vr ADD0cDA$ ܺ Vr ADD0cDA$ 5Wr ADD0cDA , W@ D{ ` H W BEB E(A0D8G`hGpGxGEMN`8A0A(B BBB ( ,Yn GDA \AAA $ ػ nYT ADE DDA0 Y' ADE J GAE ACA 4 Y AR E C $ T Yy ADA pAA( | Y\ BDA QAB Z , Z BGA G@w AAB bZ H nZ IBB A(D0n (D EEFE L(D BBB L Z ` ZF AD 4 | Z BGA A(D0o(D GBB( K[ ADA AA ( ,\{ BFA nAB H {\p BBB B(G0A8DN8D0A(B BBB H X ] BBB B(A0A8G8D0A(B BBB 4 '^e BAA R ABE ACB 4 ܾ T^ BAA ABE ACB 4 ^e BAA R ABE ACB ( L ^ BAA AB x x t_] BHB E(A0A8Gp 8M0A(B BBBE D 8A0A(B BBBB D8A0A(B BBB U`# Aa H `` BLE B(A0A8DP8D0A(B BBB 8 X aa BEB K(A0D(A BBB b 8 b BBB K(A0(D BBB ct D o ct D o 8dt D o , dt D o4 D d BBD D(G@(A ABB | e~ AG tA fq AD gD [fp D k8 fo BBB N(A0P(C BBB g G L , yh UKI I(H0H8G@m8D0C(B BBB | h G $ i AAG0qDA$ i AAG0qDA$ 6jd ADD0UDA rj6 N g ( j/ ( < j BAA wAB 0 h jZ BDD G0A DAB L $l BIB A(D0f (A IDBE (D BBB 0 jm_ ADE H AAE ACA mR AP < m@ A~ 4 X ml BBA A(A0[(D ABB #nj A[ L A mn7 ]Y nT GrWC ( nh BAA `AB 0 nH ACD s CAE AAA $ H o AEG@DA p {o o o o o o o o o 4 $ o BBD A(D0(C ABB \ -p p $p X 'p BBD D(B0L (D ABBB M (A ABBE A(D ABB$ Sp AKG iAAX p BDB B(A0D8G'DjAX8D0A(B BBB X d s BBE B(A0F8GEkAQ8A0A(B BBB H wV BDB B(D0D8G28A0A(B BBB H R BEB B(D0D8G+8C0A(B BBB H X q BEB E(D0A8GpJ8C0A(B BBB p Ń BEB B(A0A8GEnABEEu8D0A(B BBB H % BEB B(A0A8Ds8D0A(B BBB H d k BEB E(D0D8G8A0A(B BBB :# Aa E3 YY `# Aa 0 k_ ADE H AAE ACAP , BBB H(D0A8GPXXO`eXAPm8D0A(B BBBH $L BEB B(A0D8GP*8A0A(B BBB $ AF 4 BAA DKE ACB D q ALP_D< d Ҡm ADB m HCE P KCE ACA J Au E J )E Ap E J NA Al E J 8 o~ ODA |DMW ACA ( @ BHD AB H l ) BEB B(A0D8D8D0A(B BBB $ h ADA _AA$ ͤ ADA AA$ ANA yAA 0 P AN H L P BBB E(A0A8G18A0A(B BBB ( !i BAD ^AB 8 ^ BBB A(D0(A BBB < Ϭ BAA K0P8V@DHBPI0 DAB @ T AU p $ Y AAD PAAD BBB B(A0A8Dp8D0A(B BBBP } KBB B(A0A8D8A0A(B BBBA L H IX OLB E(A0C8Dp 8A0A(B BBB , Q BAD D0q DAB A] A ck D0f n D0i( _ AID NAA ( D ? BFD AB ( p O ADD CAA 4 - BBA A(A0(A ABB 9 AW E [ 8 BBA A(A0(A ABB 8 0 AH GED C(D0d(A ABBA$ l M3 ADK `AA < X ADE ] AAE g AAE AA( BAA AB ( T FOH sAB ( @ q BAH bAB < l ^ BDD G0 HABE DAB, BKF Gp DAB ? A] AH ɾ BBD D(E0a (H ABBE (D ABB $ H l ADD `AA p ҿ2 Ap , r BAD D@` CAB$ *W AAJ@HAA< Y BFE A(D0Gp0A(A BBBH $ h BBA C(E0~ (A ABBE K(A ABB ( p v G Y(U0B8B@I h E F( Gv G Y(U0B8B@I h E F\ BBB A(G0DrGDDDDbD0A(A BBB P ( G VEE D(D0 (D IDBE A(C BBB H | BDB B(A0J8Q8A0A(B BBB T h BBB A(A0PVUBBI0A(A BBB 4 BDA A(TPt(A ABB, X c BCA T0d AAB$ AIM0lDA@ BBB A(A0G` 0D(A BBB H [ BDB B(A0J8P(8D0A(B BBB 8 T ; BEB A(A0((A BBB @ R BBE A(A0Jp40A(A BBB H BBB B(D0A8Jd8A0A(B BBB @ : BBB A(G0G0A(A BBB d x > At E C $ ~ ADA uAA 8 Av ( %B BDA wAB ;2 Ap 4 U A]A X > At E C x 0? D z $ W| ADA sAA@ BBB A(A0G@d0D(A BBB ( AD CE DC ( ( g1 ADG"AA 8 T l FEB A(A0(A BBB $ 5E ADdVDA( R ADGxAA $ Q ADpVDAl BFA A(B0U (A ABBE C (C ABBE W (A ABBE (D ABB $ | Un AAD0eAA$ n AAD0eAA@ BDA @ ABE k ABH TAB :6 AD oA < 0 P^ ADB p CAA P AAE ADA \ p n BAA J0W8X@BHBPI0k AABE D DABE D CAB L BAA J@WHXPBXB`I@} AABE N AAB z> Ab E M A C 0 D G Y(U0B8B@I n E S E F 0 x G Y(U0B8B@I n E S E F TM D H D00 > AAA f AAE KAA H d BJI B(A0A8D`<8A0A(B BBB H \ BNB B(A0A8DPf8D0A(B BBB \ D H D l E R ( \ BAA TAB 8H D l E R , `H D l E R ( L AG k AE NA x H D l E R H D l E R ( 5 AG k AE NA S D N & AT E K M D H 4 & AT E K T [ D V l Q? Ab E M A D l[ D VH BBA A(G@ (D ABBE N(C ABB N] D X0 AAG0 DAE cCA( @ AG AE NA ( l AG AE NA q D(\0T(A {\ Q BAA J@eHXPBXB`I@w AABE D DABE D CAB 4 AGD@VHUPBXB`I@bAA L P U BAA J@WHXPBXB`I@f AABE N AAB H h BBA D(B0F (C CBBE ~(D ABB 8 BBD A(I (A ABB ( V < T/ Am 0 X ge AAA v AAE bAA 8 BDA GVG AAB \ < BBB B(A0A8JfXBBI8A0A(B BBB \ ( S BBB B(A0G8D{XBBI8A0A(B BBB , BCA D0r AAB` a BBB B(A0A8GP- 8D0A(B BBBE D8C0A(B BBB ` ~ BBB B(A0D8D` 8A0A(B BBBE 8A0A(B BBB ` + BFE B(A0A8Gp 8D0A(B BBBE D8C0A(B BBB T ; BBB A(A0G@ 0D(A BBBE U0C(A BBB @ < jY BIB A(A0G70D(A BBB ` BFB E(A0A8Gpy 8D0A(B BBBE D8C0A(B BBB T BBB A(A0G@ 0A(A BBBE D0A(A BBB \ < d BBB B(A0A8GP 8A0A(B BBBE D8A0A(B BBBX BBA A(JPeXX`BhBpIP (A ABBE (A ABB 8 ]s BBB D(D0](A BBB 4 , H BKA D` AAB, x S BHD D` AAB < AG rA H : BBB E(D0A8Jo8A0A(B BBB b AX 0 + Ai H 2 Aj E A h 2 Aj E A $ TDA AA T BBB A(D0DPX 0A(A BBBE D0A(A BBB @ D BAA J DABE G CAB D t BEB B(A0A8IP8D0A(B BBB( 8 BGD AB H BIB A(D0 (A BBBE A(A BBBH H / BBB E(D0A8D8C0A(B BBB @ BAA ] ABE p DBE \AB 4 AO BDA 8 ABE ADB L X KBB E(A0D8GP8A0A(B BBBA 0 ` ` AOE o HHE ADA $ HY ADD MAAx y BJI B(A0A8DaFFFFFU_GADbT8D0A(B BBB 8 # ZH $ P (C ADD wAA 0 x CG BDD D01 DAB < V BAA J@sHXPBXB`I@ DAB D ( d BJA ]GXBBI DAB D 4 D BNO KCUBBIj DAB \ | BBB E(A0A8M~XBBI8D0A(B BBB T BBE A(A0JsXBBI0D(A BBB D 4 BCA JtXBBIQ DAB , | h BAD D0V CABD BBE B(A0A8B@8D0A(B BBBH )[ BBB B(A0D8Dp<8D0A(B BBB L @ 8 BAG M0i8R@BHBPI0t AABE N CAB n Bc E C AJ DH o BBB E(A0A8D8D0A(B BBB $ X ADD0JCA4 D BBD A(D0q(A ABB( | J F AAD =AA d $ W ADE wAA$ r ACQ0WDAH BBL B(A0A8J`8A0A(B BBB 4 X / BDD V ABE ACB V D Q ] AP GD, BMA D@ DAB = AS gA ' A] E C 8 = AS gA X ' A] E C x AP0nA Ex D@s AS A /\ D W$ s AMK0eDA$ AMK0cDA 8 )r AS \A X {k D f8 p I BDA D(GP0(A ABB \ D0W( y BDD kAB $ l ADD0AA ( , BAA AB $ X Z AAD ~AA( BAA AB ( BAA AB 8 }F ADD E(D0D8D@DHDPDXD`DhBpU $ C AGA wAA 8 < | BBB A(A0i(D BBB H x BBB B(A0A8A@8D0A(B BBB 8 o A BBB A(A0.(D BBB 8 t BBB A(A0(D BBB 8 < 4 ; BBB A(A0((D BBB 0 x 3! BAD G DAB @ ! BEE A(G0G@h0A(A BBB H .# BHE B(D0D8D8A0A(B BBB H < % BBB B(A0A8DP8D0A(B BBB K' A]0mD, ' BMA Q@ DAB c( AG A4 ) DKA DBE ACB , 0 ) BKF Gp DAB, ` * BKF Gp DAB *$ H * BBB E(A0D8G`8D0A(B BBB D f- BBB B(F0A8A@8D0A(B BBB 8 4.9 AGPlD X M.7 AGPkC ( x d.[ ADGLAA T . BEE E(D0J8A@eHPPOXK`L@L8D0A(B BBB H .* BEB A(D0m8`@AHDPW0k(A BBB H /t D oH ` 08 BFB B(A0A8G8D0A(B BBB 0 6 BAD G DAB 8 7 BBE D(H0(A BBB 4 8r BED A(D0X(D ABB T 8 h 8 | 8 8 G 9 ABE L < 90 BDA D08M@J8A0D AAB : : 0 4 :f AG t JE D JE DC H h 3: BBE B(D0D8G`8C0A(B BBB $ ;D AAD {AA $ ;x ADA oAA8 +< BBA A(A0(A ABB < @ = BDD G0 GABE D CAB 8> AD DH ? BBA A(D0 (J ABBE n(A ABB ?P HG ?$ A\ H ? BFB E(D0A8G8D0A(B BBB $ l AFY AAD PAAD rF BEE H(D0A8E@8D0A(B BBB0 F BDA J AAB \ GF BEE H(A0A8JKHBIw8D0A(B BBB < p Hn ADB v IHE B KCE ACA H H H$ BBB B(A0A8DP8D0A(B BBB I H $ I$ BKB B(A0A8A@8D0A(B BBB p rJ 0 cJn AFD R GAE AAA J2 Ah 4 Jj BEG D(A0P(A ABB$ J` A^(R0N(B ]A 4 K H K0 Af E C h *K | )K AQ X $KY BIB B(A0H8GmMPA8D0A(B BBBx !R% BHB B(A0C8GuXBBI)DAFEAXR8D0A(B BBB x p S" BHB B(A0C8GuXBBI)DACEAXR8D0A(B BBB 8 pU BNB A(K0k(A BBB D ( U BNB B(K0A8A@8D0A(B BBB8 p JV BBE D(A0(C BBB $ V> AAA xAA H W BJE B(A0C8Dpj8J0A(B BBB H YZz BBA C(C0{ (D ABBE [(A ABB l Z xZ iZ $ `Zo AKD \AA8 Z BBE D(A0(C BBB H [E BBB B(A0A8G`&8D0A(B BBB 0 X ] BAG G AAB ] ] ] ] pb GyGN ]O ApH U 4 ] BDG (I0N(A WAB $ X ^ AMG`DA ^] AIPND< ^ BAD G| DABE p DAB 0 :_ AAD m GAE AAA4 _ BFD A(G@(D ABB8 L ` BIH D(S@(A ABB 4 ` BED D(A0l(D ABB8 `; BBA A(A0-(A ABB $ a ADB AA\ $ ib BBB B(A0A8DIFDX8C0A(B BBB d A] ( dH BDG wAB d H d3 BEB B(A0A8D`8C0A(B BBB ( , eH BDG wAB X e 8 l eJ BEE G(D0i(C BBB e e H ei BED D(B0f (C ABBE \(C ABB e 0 e D e P X ef BEE E(D0G8B@NHMP]HA@A8D0A(B BBB e DE I e DB I e DB L $ e AAD AA\ ( Nfh BIB I(I0K8JZ[BBI8D0A(B BBB \ Vh BLI O(O0H8J[BBI8D0A(B BBB X j BBA A(J@WHXPBXB`I@ (A ABBE N(A ABB ` D j7 BBB A(A0JPWXX`BhBpIP 0A(A BBBE N0A(A BBBL kb BIA A(_DXBBI(D ABB \ l IGL H(O0H8J[BBI8D0A(B BBB T X $or IEQ D(O0Q[BBIc0D(A BBB 8 >q BPF J(G_(C ABB T r BIB A(A0_GXBBIi0C(A BBB $ D It AIK0sAA$ l t AIK0hAAH u BBD A(D@ (A ABBE N(A ABB H u BIA K(K0O (A ABBE K(A ABB 0 , uw ADD0\ CAE DCA4 ` 3v AJ W(U0B8B@I C CE DCD v{ BHA A(D@uHRPBXB`I@ (D ABB w BEF B(A0A8DdXBBI 8C0A(B BBBE w 8C0A(B BBBE 8D0A(B BBB p -z BBB B(G0A8D VEEEEZDEDDDBABADBly8A0A(B BBBD \ BHA _GXBBI DAB @ T À` BBB A(D0G@B0D(A BBB @ ߁` BBB A(D0G@B0D(A BBB A b U 4 N 0 H C AAB | AAE AA | ܃I AG @ ` AAD@)HKPRHA@Y DAH DA V AAA P $ H@ BBB B(A0H8D 8A0A(B BBBE L x 4 $ % AAD0AAH BBB B(A0A8D`8A0A(B BBB 8 v BBE D(A0(A BBB ( < BAA AB < h BBB A(A0 (A BBBA I 0 H 5 BEB B(A0A8D`8A0A(B BBB < BBB A(A0 (A BBBA T eI 0 H t 8I BBB B(A0A8GP 8D0A(B BBBA B P ( Ў BAA AB H . BEB B(A0A8D`8A0A(B BBB P X H BBA A(E08H@V8B0 8E f 8E n(A ABB D @R BBB B(A0A8GP8D0A(B BBB J P H R BBB B(A0A8GP 8D0A(B BBBA ` ͒ P $ A AAD ~AAH T. BBB B(A0A8GP 8D0A(B BBBA T P ( Γ BAA AB H @ , BEB B(A0A8D`8A0A(B BBB ( BAA AB 4 Z BAA (Y0R(A AB( ۙ BAA AB ( t BAA lAB $ H AAD AAH p I= BBB B(A0A8GP 8D0A(B BBB H Q BBE B(A0A8Dp 8D0A(B BBBA p H ( S BEB B(A0A8Dp 8D0A(B BBBA t 5R p g f 8 ii IBB A(A0R(A BBB ( H NIC cCAA $ # BP E K D " " `: ,, q# J, P$ +, p&% r, % , @% tA, % e, % v, & , & , P( , p & , p & , `% , P% ȝ, p% , @' , ?' P, % ̚, v1 ֚, v1 , v1 , v1 , 1 , 1 , 1 !, 1 9, 1 M, 1 ], 1 ,, l, J, , , , ֚, ̚, , ̚, , ̚, , , !, , ], _, g, o, w, , , , ], e, m, u, }, , , , , , , , , Ǟ, Ϟ, ! מ, " ߞ, # , $ , % , , , , , , Ş, ͞, ՞, ݞ, , , , , , F, ( <, ) R, * , & , ' !, ), + 4, , 8, . B, 0 N, 1 X, / c, k, r, l , U, U, q4, Ǥ, Ĥ, q4, Ǥ, Ĥ, q4, &, q4, Ǥ, Ĥ, /, q4, O, /, q4, O, q4, Ǥ, Ĥ, q4, Ǥ, Ĥ, q4, Ǥ, Ĥ, , )C, Z, Ò, ^, 4, D, P, ^, h, u, , , @ , , o ` D Y x p p 0 P s | W O } u N } bf CB( r D( J( g >( A( Qn pf f a 0g GA( wB( wB( >@( h@( 1C( ] q }f {f )E( @( yf D( Y s r &b m d \d f m d p b B( B( ` pf w :L( T( R( 2 f f N( R( R( M( K( xN( { z o q R( L( s eT( y " r P S 0 e u X3, I, X3, i^, ?, D, >, , X3, i^, X3, i^, X3, n, , , , M, ^, , , , #, -l, , , , 7, -l, , , , 7, , p' h, + , Pv( k, + l, P* l, + m, m, `+ m, 0+ , , , , , , K, 1, , , 9B, , 1, , ħ, -l, , , , 9B, , -l, , , -l, , 6n, 6n, 6n, , ҫ, , ^, , , )C, 0, )C, A, )C, , , , 6n, , t, 6n, , t, ^, )C, 6n, , t, 6n, , , 0, , ҫ, ҫ, ҫ, ҫ, ҫ, ҫ, ҫ, , , , , , , , , IJ, , , IJ, , , , W?, O, , , , , , , )C, , IJ, , )C, , ., ., , , , *\, 1\, @\, , ʏ, ., ҫ, , /, X, IJ, 6n, , IJ, , IJ, P, ݲ, , , IJ, , IJ, ݲ, , , ˲, ݲ, , , ˲, ݲ, , O, ֲ, , )C, ݲ, , O, ֲ, , , IJ, h], h], h], , , , , , , , h], h], h], , , , , , , , !, ', %, !, ', , , IJ, , IJ, , ݲ, , , ˲, 6n, , , ˫, , , ˫, , , ˫, , IJ, 6n, , , , , IJ, 6n, , , , IJ, +, 6n, , IJ, 6n, 9, F, p% U, a, m, % {, , % , , % , , `% ͳ, ۳, , % , , , % , ,, 7, D, V, @% c, P% q, `% ~, p% , % , % , % , % Ŵ, % ^k, ^k, 8. F, K, O, S, , G], K], m, @. . . . , , , , j, t, HW, D*, q, , /, , , , , , , , , , , , , u, e, , *, 7, D, K, P, X, `, n, x, }, , ,, J, Y, , , , U, sA, , Y, , , , , , , , , , , , ", , !, 2, :, E, K, R, Z, c, i, q, w, [, v, , , ?, , ǝ, , >, , , Q, , , , 4, m, , , #0, , , , , r, , , , Wq, 0, , , , , , #, *, ., , 8, , 7, @, I, M, S, Y, _, Z, , c, v, j, s, ~, , , 8, %, , E, L, Q, Y, , o, y, ~, , , , , , ?, , , , +, , , , , , , Z, /S, , , , f, (, -, , 6, , , ;, @, E, J, R, Z, V, /, :/, tA, a, , , H, k, s, , }, , , , ', Z, , , , , , , , , , G, , , , ", <v, , , , , , #, , , , , , (, , , /, , 6, , , =, H, O, U, `, L, h, S, &, , o, h, O, P, w, }, , , , , , L, , , , , , , , , , , , , ȝ, , q4, , , , , ;*, o, , , , , , (, 1, 9, B, G, ?, Q, , ", 5, X, , |, -, , `, g, , , $, r, {, , , , , , R, , , , , , , , , , +, , , ], -, ], -, , (, , ʏ, , , , , , +, U, |, V, I, j, h], , 6 1 W j G f < M Z { `~ U ] L !N ]< `^ K m "2 `9 H 'q <O m 6 V 2 ~ Ə W w Pt 1 ; : Q DF Gl E J; X- ~ / 6 8 y T 3 A ) w 5 X} Z = 5 ? X g O u Ɗ \ Y@ .x 7 F Q a C T ˆ 0. g N I xr q 1 n =t n 4 _S - y S _ 9 J[ 4l R b aH d t c 4 f6 e IK PP R \o /? ` , 0 D %M M U e _ Sb c p 4/ z C u 8 U B b \> - } R 6j wL :q r "Z 2| #j . = nu ` 6E up Y "` 3 S k { ; #i J 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 } h], ?, Ǔ, (, \, O, 1, Q, , , 2n, h], h], h], 0, j, g, , )C, 8, , E, 0, &4, , V, M{, y, , , j, , <, D, , 0, 0, C, D, D, D, , D, D, D, ^, ^, , 6D, AD, 2D, , fD, UD, C, D, , 6D, AD, 2D, 0, C, , 6D, AD, 2D, !, ^, , 6D, AD, 2D, !, p$, E, D, D, &E, D, D, D, D, V, 0, UD, , 6D, AD, 2D, d, , lD, pD, , , D, -D, D, -D, D, , D, ^, D, ^, L, D, ^, U, D, ^, ", , ^, D, ZD, n, D, yD, , D, {, ^, ^, ^, )D, ]*, I, ^, ]*, )D, ]*, )D, ]*, -D, , , , UD, D, D, UD, g, D, , g, , d, ^, g, , , 6D, AD, 2D, ^, , , 0+, , M{, , , , UD, ^., D, PD, UD, ^., D, PD, LD, , D, C, , UD, E, , UD, E, , UD, D, , UD, D, d, , UD, D, E, d, , UD, D, E, d, p$, ^, D, d, g, ^, E, ^, E, E, ^, 0, C, yD, UD, D, 0, D, UD, D, D, E, 0, D, UD, D, D, E, , 6D, AD, 2D, C, D, UD, UD, UD, E, , , , j, x1, n, -l, , ,, 5, \, &, \, &, -l, , , 1, @4, 3, &d, , +%, i1, x, 0, Q, n, Q, , \, R, , I, , , I, U, I, U, X3, ^, h], , g, , 1, , , 1, I, Q, Z, &4, 0, , 0, &, , , #, , . 0, Wp, ͝, , ˟, @N , ? , `? , ? , ? Z, ? O, ? ?, @? , ? (, ? , `? , }? @, |? , z? , x? k, @w? 2, u? l, t? C, `r? 0, p? ", o? , m? , k? , @j? , h? :, g? , `e? , c? , b? , `? I, ^? x, @]? j, [? \, Z? B, `X? 2, V? #, U? , S? , Q? , @P? y6, N? , M? , `K? q, I? O, H? ', F? , D? , @C? , A? , @? , `>? o, <? G, ;? ', 9? , 7? , @6? , 4? , 3? , `1? q, /? F, .? , ,? , *? , @)? , '? , &? d, X3, ?, R, , , , Q, c, , !, , , , , , , , , , , n, , z, J, , , ", /, j, -l, , h], , ,, \, &, \, &, \, R, 5, -l, , j, -l, , h], , ,, \, &, \, &, \, R, 5, -l, , , %, W, *, 1, 9, @, G, L, Q, V, [, a, g, l, q, , x, w, |, , , , `, , , , , , , , , , , , , , , h, , , , ), 3, C, R, b, r, ~, x, , , , , `, 2^, 8, , , , , , , , , 1 1 01 !y, 1 hM \M > -> @ > dM @cM `M `^M aM fM > [M ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ! ɚ; " ɚ; # ɚ; $ ɚ; % ɚ; & ɚ; ' ɚ; ( ɚ; ) ɚ; * ɚ; + ɚ; , ɚ; - ɚ; . ɚ; / ɚ; 0 ɚ; 1 ɚ; 2 ɚ; 3 ɚ; 4 ɚ; 5 ɚ; 6 ɚ; 7 ɚ; 8 ɚ; 9 ɚ; : ɚ; ; ɚ; < ɚ; = ɚ; > ɚ; ? ɚ; @ ɚ; A ɚ; B ɚ; C ɚ; D ɚ; E ɚ; F ɚ; G ɚ; H ɚ; I ɚ; J ɚ; K ɚ; L ɚ; M ɚ; N ɚ; O ɚ; P ɚ; Q ɚ; R ɚ; S ɚ; T ɚ; U ɚ; V ɚ; W ɚ; X ɚ; Y ɚ; Z ɚ; [ ɚ; \ ɚ; ] ɚ; ^ ɚ; _ ɚ; ` ɚ; a ɚ; b ɚ; c ɚ; d ɚ; e ɚ; f ɚ; g ɚ; h ɚ; i ɚ; j ɚ; k ɚ; l ɚ; m ɚ; n ɚ; o ɚ; p ɚ; q ɚ; r ɚ; s ɚ; t ɚ; u ɚ; v ɚ; w ɚ; x ɚ; y ɚ; z ɚ; { ɚ; | ɚ; } ɚ; ~ ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ! ɚ; " ɚ; # ɚ; $ ɚ; % ɚ; & ɚ; ' ɚ; ( ɚ; ) ɚ; * ɚ; + ɚ; , ɚ; - ɚ; . ɚ; / ɚ; 0 ɚ; 1 ɚ; 2 ɚ; 3 ɚ; 4 ɚ; 5 ɚ; 6 ɚ; 7 ɚ; 8 ɚ; 9 ɚ; : ɚ; ; ɚ; < ɚ; = ɚ; > ɚ; ? ɚ; @ ɚ; A ɚ; B ɚ; C ɚ; D ɚ; E ɚ; F ɚ; G ɚ; H ɚ; I ɚ; J ɚ; K ɚ; L ɚ; M ɚ; N ɚ; O ɚ; P ɚ; Q ɚ; R ɚ; S ɚ; T ɚ; U ɚ; V ɚ; W ɚ; X ɚ; Y ɚ; Z ɚ; [ ɚ; \ ɚ; ] ɚ; ^ ɚ; _ ɚ; ` ɚ; a ɚ; b ɚ; c ɚ; d ɚ; e ɚ; f ɚ; g ɚ; h ɚ; i ɚ; j ɚ; k ɚ; l ɚ; m ɚ; n ɚ; o ɚ; p ɚ; q ɚ; r ɚ; s ɚ; t ɚ; u ɚ; v ɚ; w ɚ; x ɚ; y ɚ; z ɚ; { ɚ; | ɚ; } ɚ; ~ ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; <dictcomp> ɚ; <genexpr> ɚ; <lambda> ɚ; <listcomp> ɚ; <module> ɚ; <setcomp> ɚ; <string> ɚ; <unknown> ɚ; } ɚ; , ɚ; }} ɚ; {{ ɚ; %% ɚ; . ɚ; .<locals> ɚ; ɚ; list index out of range ɚ; ɚ; { ɚ; % ɚ; utf-8 ɚ; False ɚ; Py_Repr ɚ; TextIOWrapper ɚ; True ɚ; WarningMessage ɚ; _ ɚ; __IOBase_closed ɚ; __abc_tpflags__ ɚ; __abs__ ɚ; __abstractmethods__ ɚ; __add__ ɚ; __aenter__ ɚ; __aexit__ ɚ; __aiter__ ɚ; __all__ ɚ; __and__ ɚ; __anext__ ɚ; __annotations__ ɚ; __args__ ɚ; __await__ ɚ; __bases__ ɚ; __bool__ ɚ; __build_class__ ɚ; __builtins__ ɚ; __bytes__ ɚ; __call__ ɚ; __cantrace__ ɚ; __class__ ɚ; __class_getitem__ ɚ; __classcell__ ɚ; __complex__ ɚ; __contains__ ɚ; __copy__ ɚ; __del__ ɚ; __delattr__ ɚ; __delete__ ɚ; __delitem__ ɚ; __dict__ ɚ; __dir__ ɚ; __divmod__ ɚ; __doc__ ɚ; __enter__ ɚ; __eq__ ɚ; __exit__ ɚ; __file__ ɚ; __float__ ɚ; __floordiv__ ɚ; __format__ ɚ; __fspath__ ɚ; __ge__ ɚ; __get__ ɚ; __getattr__ ɚ; __getattribute__ ɚ; __getinitargs__ ɚ; __getitem__ ɚ; __getnewargs__ ɚ; __getnewargs_ex__ ɚ; __getstate__ ɚ; __gt__ ɚ; __hash__ ɚ; __iadd__ ɚ; __iand__ ɚ; __ifloordiv__ ɚ; __ilshift__ ɚ; __imatmul__ ɚ; __imod__ ɚ; __import__ ɚ; __imul__ ɚ; __index__ ɚ; __init__ ɚ; __init_subclass__ ɚ; __instancecheck__ ɚ; __int__ ɚ; __invert__ ɚ; __ior__ ɚ; __ipow__ ɚ; __irshift__ ɚ; __isabstractmethod__ ɚ; __isub__ ɚ; __iter__ ɚ; __itruediv__ ɚ; __ixor__ ɚ; __le__ ɚ; __len__ ɚ; __length_hint__ ɚ; __lltrace__ ɚ; __loader__ ɚ; __lshift__ ɚ; __lt__ ɚ; __main__ ɚ; __matmul__ ɚ; __missing__ ɚ; __mod__ ɚ; __module__ ɚ; __mro_entries__ ɚ; __mul__ ɚ; __name__ ɚ; __ne__ ɚ; __neg__ ɚ; __new__ ɚ; __newobj__ ɚ; __newobj_ex__ ɚ; __next__ ɚ; __notes__ ɚ; __or__ ɚ; __orig_class__ ɚ; __origin__ ɚ; __package__ ɚ; __parameters__ ɚ; __path__ ɚ; __pos__ ɚ; __pow__ ɚ; __prepare__ ɚ; __qualname__ ɚ; __radd__ ɚ; __rand__ ɚ; __rdivmod__ ɚ; __reduce__ ɚ; __reduce_ex__ ɚ; __repr__ ɚ; __reversed__ ɚ; __rfloordiv__ ɚ; __rlshift__ ɚ; __rmatmul__ ɚ; __rmod__ ɚ; __rmul__ ɚ; __ror__ ɚ; __round__ ɚ; __rpow__ ɚ; __rrshift__ ɚ; __rshift__ ɚ; __rsub__ ɚ; __rtruediv__ ɚ; __rxor__ ɚ; __set__ ɚ; __set_name__ ɚ; __setattr__ ɚ; __setitem__ ɚ; __setstate__ ɚ; __sizeof__ ɚ; __slotnames__ ɚ; __slots__ ɚ; __spec__ ɚ; __str__ ɚ; __sub__ ɚ; __subclasscheck__ ɚ; __subclasshook__ ɚ; __truediv__ ɚ; __trunc__ ɚ; # __typing_is_unpacked_typevartuple__ ɚ; __typing_prepare_subst__ ɚ; __typing_subst__ ɚ; __typing_unpacked_tuple_args__ ɚ; __warningregistry__ ɚ; __weakref__ ɚ; __xor__ ɚ; _abc_impl ɚ; _annotation ɚ; _blksize ɚ; _bootstrap ɚ; _dealloc_warn ɚ; _finalizing ɚ; _find_and_load ɚ; _fix_up_module ɚ; _get_sourcefile ɚ; _handle_fromlist ɚ; _initializing ɚ; _is_text_encoding ɚ; _lock_unlock_module ɚ; _showwarnmsg ɚ; _shutdown ɚ; _slotnames ɚ; _strptime_time ɚ; _uninitialized_submodules ɚ; _warn_unawaited_coroutine ɚ; _xoptions ɚ; add ɚ; append ɚ; big ɚ; buffer ɚ; builtins ɚ; c_call ɚ; c_exception ɚ; c_return ɚ; call ɚ; clear ɚ; close ɚ; closed ɚ; code ɚ; copy ɚ; copyreg ɚ; decode ɚ; default ɚ; defaultaction ɚ; dictcomp ɚ; difference_update ɚ; dispatch_table ɚ; displayhook ɚ; enable ɚ; encode ɚ; encoding ɚ; end_lineno ɚ; end_offset ɚ; errors ɚ; excepthook ɚ; exception ɚ; extend ɚ; filename ɚ; fileno ɚ; fillvalue ɚ; filters ɚ; find_class ɚ; flush ɚ; genexpr ɚ; get ɚ; get_source ɚ; getattr ɚ; getstate ɚ; ignore ɚ; importlib ɚ; inf ɚ; intersection ɚ; isatty ɚ; isinstance ɚ; items ɚ; iter ɚ; join ɚ; keys ɚ; lambda ɚ; last_traceback ɚ; last_type ɚ; last_value ɚ; latin1 ɚ; len ɚ; line ɚ; lineno ɚ; listcomp ɚ; little ɚ; locale ɚ; match ɚ; metaclass ɚ; mode ɚ; modules ɚ; mro ɚ; msg ɚ; n_fields ɚ; n_sequence_fields ɚ; n_unnamed_fields ɚ; name ɚ; newlines ɚ; next ɚ; obj ɚ; offset ɚ; onceregistry ɚ; opcode ɚ; open ɚ; parent ɚ; partial ɚ; path ɚ; peek ɚ; persistent_id ɚ; persistent_load ɚ; print_file_and_line ɚ; ps1 ɚ; ps2 ɚ; raw ɚ; read ɚ; read1 ɚ; readable ɚ; readall ɚ; readinto ɚ; readinto1 ɚ; readline ɚ; reducer_override ɚ; reload ɚ; replace ɚ; reset ɚ; return ɚ; reversed ɚ; seek ɚ; seekable ɚ; send ɚ; setcomp ɚ; setstate ɚ; sort ɚ; stderr ɚ; stdin ɚ; stdout ɚ; strict ɚ; symmetric_difference_update ɚ; tell ɚ; text ɚ; threading ɚ; throw ɚ; top ɚ; truncate ɚ; unraisablehook ɚ; values ɚ; version ɚ; warnings ɚ; warnoptions ɚ; writable ɚ; write ɚ; zipimporter ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ! ɚ; " ɚ; # ɚ; $ ɚ; % ɚ; & ɚ; ' ɚ; ( ɚ; ) ɚ; * ɚ; + ɚ; , ɚ; - ɚ; . ɚ; / ɚ; 0 ɚ; 1 ɚ; 2 ɚ; 3 ɚ; 4 ɚ; 5 ɚ; 6 ɚ; 7 ɚ; 8 ɚ; 9 ɚ; : ɚ; ; ɚ; < ɚ; = ɚ; > ɚ; ? ɚ; @ ɚ; A ɚ; B ɚ; C ɚ; D ɚ; E ɚ; F ɚ; G ɚ; H ɚ; I ɚ; J ɚ; K ɚ; L ɚ; M ɚ; N ɚ; O ɚ; P ɚ; Q ɚ; R ɚ; S ɚ; T ɚ; U ɚ; V ɚ; W ɚ; X ɚ; Y ɚ; Z ɚ; [ ɚ; \ ɚ; ] ɚ; ^ ɚ; _ ɚ; ` ɚ; a ɚ; b ɚ; c ɚ; d ɚ; e ɚ; f ɚ; g ɚ; h ɚ; i ɚ; j ɚ; k ɚ; l ɚ; m ɚ; n ɚ; o ɚ; p ɚ; q ɚ; r ɚ; s ɚ; t ɚ; u ɚ; v ɚ; w ɚ; x ɚ; y ɚ; z ɚ; { ɚ; | ɚ; } ɚ; ~ ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; @ 9 y* yM `M M `N @|M M }M M `M M zM M M M M W a Z , P: X: o ` h4 = ! P 0 o o o o > o X = 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v & 6 F V f v %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% %%%%%%% !"#%%%%%% !"#%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% : : : , + , , v$ Û, R ̛, @}$ ԛ, ̙ ޛ, o , , P$ , Yt , ~$ f, $ , $ , ' `. , , , ܚ , /, S 9, P, S # [, , 0 `. , , , x , s, @ y, W/ = = , 0 = @= 01 , 8 = @= S1 , , , Ŝ, Μ, ՜, ݜ, , , , , , , , -, k \/ , # \/ 6, [/ , Y/ = = 0( Y ;Z ?, X/ = ̻ )) ;*, `]/ Q, = = % [, ` & a/ c, a/ k, a/ s, & `/ {, }D ``/ , @|' `/ , t _/ , r _/ , p _/ , I ^/ , &G ^/ , $ ^/ , ]/ ǝ, b/ = = ), ( ͝, + {/ ), ͝, + {/ ͝, + {/ & ؝, , @x/ , B w/ , + w/ , + @w/ p, + w/ Z, v/ , ! v/ , S+ @v/ H, c* v/ n, g+ u/ ,, u/ , 5 @u/ M, 5 u/ 2n, * t/ ޝ, t/ Ǥ, @t/ , v" t/ , s/ , } s/ , @s/ @, s/ , r/ t, > r/ V, v @r/ t, r/ , Y q/ G, q/ n, pO) @q/ +, % q/ , p/ L, p/ &, @p/ , . p/ ?, C o/ , o/ U, E @o/ 6, o/ , `+ n/ , j @n/ , 2 n/ n, P) m/ n, @P) m/ ;, * @m/ :, m/ , P) l/ , 0) l/ *D, b* @l/ m, p) l/ t, b* k/ 2i, b* k/ , w i/ }, ]+ `h/ |, h/ , |/ = = & @' @' , ( A 1M , 0 I 0M &, ( I 0M ' ik, &) / :, 0* @/ !, $ / <, G? `/ E, / f, - / [, / d, / K, @ / G, ~/ n, 1 ~/ Q, @ }/ Y, / = = `' ( `( n, . D, . yD, . ), 0 ), ( ), 8 , (. 4 ' ), ), , M+ , #) ͝, @N+ , M+ ˟, M+ 4 ' 2 ' 8 / G p' 3 @' @ = H `= I 4M 6 o" A 0s' -|, R+ / ie, Н( / P& ؟, 8 @= , A 4M , A = #, @ M 3M 5, , C, I, Y, / `= = `$' P' ' , d, 8 / A % 4 @>& G 3 p>& % j, S+ / z, `% @/ , / , / , + / L, P% `/ n, " / L, 0% / q, / = = % 0=& P=& 6, ( , 0 @ @= 4$ , 1 / Վ, ] / ˠ, t / ], [) / , P. = = נ, ߠ, , , , #, ?, G, \, c, z, , , p. , , š, . Ρ, ֡, , , '% ?, P( / r, @/ , P+ / , l / *, p / *, / , @/ , A / ;, * @/ hw, * / rw, @* / , @+ / w, * / A, * / f, ( / , p+ / H, * / I, ) / N, / `, \+ / [, @/ m, / k, C `/ S, ( / z, / :, + `/ ?, @/ = = % E& E& , ؑ. = ), , $ / 5, $ / , p$ / ʮ, p$ / , P' @/ , P' @/ , $ / ˢ, p$ / Ԣ, 7 4 $ B t 8 / @ = G $ H = ), ( 5, М' / ʮ, Н' / , ) / j, ) / , `) / , $ `/ , М' / ˢ, Н' / Ԣ, ), 4 ^ 8 , H = ), ( 4 ] : E W 8 , G `*) 3 ] A 9. H = 2, ;, J, T, d, r, 6, , i, ) / , ) / , $ / , $ / , `/ 3, `/ , / , $ / ʣ, p' `/ , \+ / ˕, 9 / أ, `' / , N7 / &$ , =& , / = @= $ ?& @& , / = , @ E = /, = C, 0 E 4M Q, ( A `= ^, @`( . , 0 . )C, 8 i, Ò, . ), @ 4 m' B + ; ^( 8 / C `}' @ `5M H = I = G Pi! 3 0n' , + (. , `. , [ q4, . &, ( . Ǥ, 0 . Ĥ, 8 0. 4 B `+ 8 / @ 7M H @= I = G * 3 @ P+ , , + @/ g, ! / 4 0! @ = H = G * 3 6 , c' / դ, ' P/ , ( / , Y( / , ( / , ^( `/ ;' ?, = = I' ' P' : , : , : g, @: , : , : H, `: , : , : , : ˤ, : Ò, : , : o, , A = , X A = , ` A = ͝, t+ / |, u+ / ͝, t+ / ͝, P~+ / , Ц* / ͝, 0~+ / |, `+ / ͝, r+ / |, s+ / ͝, t+ / |, @t+ / ͝, t+ / |, Pt+ / ͝, v+ / |, v+ / ͝, }+ / ͝, p|+ / |, {+ / ڥ, / ͝, l+ / |, 0m+ / ڥ, / ͝, l+ / |, o+ / ڥ, / ͝, y+ / |, z+ / ڥ, / ͝, h+ / |, j+ / ͝, q+ / ͝, q+ / ͝, r+ / , ]+ / ͝, }+ / ͝, + / |, `+ / & Z, * @/ , / > > : , : , @: O, : , n, /, : {, : , `: , , _* , , r , `* / Χ, _* / b, 0) `/ , / ק, U1 / , n* / +, W* / o, x) / ܧ, / R, / V, / , |, , x p) D @/ K* C p `> > h p( ( : , -l, + / , + / , + @/ ȋ, / b, + / , / o, / , `/ > > hM , b r, / , ( `/ , @/ %, / 0, ̴ , K , , ?' +, 1 -l, ( #, , X 7, Y , ` ȋ, + 0 E, < / o, ` / b, p ( p/ , `' @/ Q, @+& / , *& / q, ' / ܧ, / R, 0 / V, p/ W, H P/ +, / ק, N / , / : r, @: d}, : E, : v, ȋ, 0 b, R) 0 Q, 0 <R, d 0 A, 0 o, 0 , 0 > hM , P 0, `' , 8 , , ( ȋ, Q, s% , q% ܧ, % R, % q, ' W, , >& b, k% 0 q, `* 0 Q, & 0 <R, ) 0 A, I( 0 , ' @0 +, `3' `0 ק, % , & 0 ڥ, 1 , P 0, `' , 8 , , ( , q% ȋ, ܧ, % V, % q, ' W, , >& o, E' 0 , & 0 Q, ,& +, `3' `0 ק, % ڥ, 1 , b, q, Q, h <R, N A, 4 o, Q, R, V, , < W, , P 0, `' , 8 , , ( , q% ȋ, ܧ, % R, % V, % q, ' W, , >& Q, ,& +, `3' `0 ק, % , & 0 b, k% 0 Q, & 0 <R, ) 0 A, I( 0 , ' @0 q, `* 0 o, E' 0 ڥ, 1 : ٨, : , `: , , * , R, p+ ` 0 ܧ, * 0 V, + 0 , * ` 0 Q, + 0 W, 0 ק, v" ` 0 o, ` " 0 *, % 0 Q, = `0 <R, + 0 , " 0 f, } 0 b, $" 0 5, 0[+ `0 Χ, Px) 0 +, `* 0 , + 0 , ) |, ڥ, [+ \+ : C, Y, \+ @%> @ 0 b, @*0 w, o% `)0 <R, & )0 o, P9& (0 +, 6' &0 ק, g% %0 , ) $0 , u% $0 ܧ, 0% #0 R, f% #0 V, % @#0 q, @' "0 W, c% "0 , p?& , 0 , , 9 . , , ŭ, , : p, +, 20 ק, 20 , 20 Q, s% 10 , u% 10 ܧ, @00 R, % /0 V, % @/0 , % ˩, 5' ک, e% , % q, .0 W, .0 , i% ˢ, q% , ; -0 f, ( ,0 *, ! @+0 b, J P:0 w, : :0 <R, ; o, , p:0 -> hM -, U% =0 d, _( ;0 iA, T% :0 tA, U0 @/> $ B& E& : -, : iA, ' , `[0 P 0> [, " ؕ. p ! ` ) Υ , 2 b0 ͝, _ b0 e, 0 . q C, ͝, m* & s, D* e0 u, f0 4> 4> , ' @ m* `4> 4> ( E p"' Dj, `% v0 , D* u0 fr, #* `u0 t, ) s0 r, G* q0 r, `O* q0 r, M* `q0 s, /* q0 pR, "& p0 s, /* p0 r, ** `p0 r, .* p0 k, .) o0 Ol, >) o0 r, ; `o0 r, * o0 r, )* n0 >s, 8* @n0 s, ;* n0 `l, >) m0 m, I) m0 vt, W @m0 s, `?* l0 s, @* l0 s, =* l0 r, `-* k0 r, '* k0 r, ,* @k0 r, @&* j0 q, p) j0 |r, @%* `j0 r, +* j0 `R, & i0 {q, ) i0 mr, $* @i0 mq, `) i0 It, h0 <, @ g0 "J, % f0 , 7> P : t, : r, , 9 ~0 , F ~0 , `z }0 , \ {0 ?, * @{0 *, Ð z0 %, ' y0 9, #& @y0 P, ia x0 b, w0 m, 0 => z, , , , , h. , , ȫ, . ϫ, ٫, , , % L, @0 , ' 0 ^, !, 0 , + @0 L, 9o 0 , \ `0 *, a @0 4, 0 !, m= 0 D, sA 0 >, t\ 0 Q, B 0 , { 0 N, ] @0 D, C 0 O, C 0 W, >; 0 , 9 0 c, uD `0 [, 0 ?> ?> % <& =& h], q, , `0 ?> =, , , , , , Ƭ, Ϭ, , , , , , , 2, . N, j, :, s, |, , V, , ؖ. , . , 0. í, έ, , , , , 6, >, G, P, X, a, i, q, z, , , , ȫ, z, ϫ, , , , , X. ʮ, , , Ү, , , , , M, ., h, 8, D, R, h, x, , . , ȗ. I, . 0, (. , p. 4 ( B @ tM H `F> , ( ˢ, p( , + p$ ȝ, @8% 91 G, 41 ů, F 41 i, ) 31 0n, =L /1 ͯ, .1 &, Z @)1 ԯ, (1 @, , '1 V, \ '1 ۯ, .G '1 , P & &1 , 5 `&1 J, #1 @, K% !1 Q, & 1 U, ' ` 1 , dG 1 , G 1 , H 1 L, 1 !, 1 j, @1 , ] 1 , _ 1 S, 'R @1 , :& @ 1 `y, * 1 R, ` @1 h, I 1 &, ~I 1 ,, p|' 1 h, ( @1 h, ) 1 x, OG 0 /, 4 0 2, Ӎ @0 Z, 0 h, c 0 j, 0) 0 8, ' 0 I, I `0 `, PJ 0 , "4 0 z, J `0 , 1K 0 , 3 0 y, 3 0 w, K 0 , K 0 , ZN @0 , O 0 , P 0 , 6 0 , & 0 , & 0 , & 0 , 6| 0 , D `0 , ( 0 , ( 0 , ( 0 Ű, & 0 ̰, P 0 z, q @0 , 0 հ, (Q 0 ܰ, pQ @0 , Q 0 , AR 0 , R @0 , R 0 , +7 0 y, { 0 , ZS 0 ", S 0 OG, /b 0 , 2 0 *, N1 0 , 5 0 j, ) 0 5, |X `0 , S 0 , T 0 , FT `0 , T 0 , T `0 -, 6& 0 , 0{) 0 , t 0 , ` 0 $, |W 0 (, W `0 , | @0 *, ;U 0 b, |) 0 e, b 0 ^, d 0 d, e @0 o, ) 0 s, Og 0 k, h 0 r, i 0 -, *E `0 6, * 0 W, $W 0 <, @y) 0 A, &V 0 c, A 0 ], ] 0 G, % 0 M, $ @0 H, / 0 , @0 , ) @0 z, k 0 , l 0 h, ( 0 w, * 0 C, r 0 S, w 0 Z, - @0 tD, 0 `, Q- 0 j, K 0 t, @0 , P}) 0 , a `0 , 0 , l 0 , 0 , } 0 , =. 0 , + 0 ɱ, 0 ѱ, 0 0, V 0 1, `0 ٱ, / 0 ߱, & @0 , ) @0 ?, 0 :, >W @0 D, W 0 , #F @0 , E 0 x, mO @0 !y, R 0 /, 0 x, L `0 jd, ( @0 , i 0 , ; 0 , 9< @0 ', N> 0 /, > 0 #f, p( 0 4, PQ% 0 ;, m 0 E, 0 R, X `0 Z, Y 0 g, Z 0 u, 0( 0 , `<1 ` G> G> @ % B& D& : 4, : L, : !, `: &, @: ԯ, : @, @: ȝ, : Q, : 6, : , : , : ȝ, : 8, Դ, `0 @E> =, 0 E> , H F> , h uM , 0 F> o=, `0 E> Z=, `0 D> K=, 0 B> :=, 0 D> : G, : 0n, : J, : U, : S, `: , 0: `y, : h, : h, : x, P: j, : R, `: -, : c, `: ], @: x, : !y, : /, : x, : i, : ͯ, : V, `: , @: , : , : , : h, `: 2, @: h, : I, : `, , : : , ', : 0, : @: , : (, : -, @: , : , p: 1, `: ߱, : @, P: , : #f, 0: S, : ;, : Z, : `, `: E, @: R, 0: Z, : g, : t, : , : , : , : , : , : , : u, @, _ O, / [, 0 f, ` u, 1 , 2 , 4 , 3 , a , . µ, Ե, ߵ, , , , W !, V 1, $ @, % N, & ^, ' o, - , e , f , g , , , ( ն, , ) , * , , E (, F <, h G, i R, < ], l, + x, G , j , , l , , з, , , , , %, w 2, x @, y M, z X, { e, | s, S , T , m , , , ɸ, X ո, U , 5 , 8 , > , = ', 9 2, @ B, ? R, A _, 7 m, 6 x, : , , , , , ˹, ع, , o , p , ; , , (, ! 9, R, q ^, r j, " z, n , , , C , M ̺, N Ș. I , J , O , P -, Q D, R ], D v, K , L , , # , H ǻ, ջ, B , s , t , < , u , v #, ., k :, } N, ~ c, v, , \ , ] , , μ, , ^ , [ , Y , Z ), b 7, c E, d S, b, v, , , , , ҽ, , , , , , L /, M K, N d, O , P , Q , R . S վ, T , U , V ", W ?, X [, Y x, Z . [ , , , ¿, ο, ۿ, , , , , , #, 2, =, I, [, q, , , , : o=, =% &@, =% (. , 5 p. , 9 . O, ( Й. %k, P ) h. , f) H. Dj, s . , p. , b( М. , E 0. , { h. , / . , $( Н. , Z . +, =1 |> `|> ` 1, -, 1, -, 5, , 1, 3, , 1, -, ), 9, C, W, p, x, Dj, `@1 , 5 @1 , `?1 , t >1 , 4 `>1 , A1 > &@, q M1 , M1 , џ @M1 , K1 , q( J1 , fb `J1 Z|, 0 I1 , `I1 , $) H1 , F1 , } F1 , o+ E1 , 4 `E1 l, E1 [, @ D1 , f2 `C1 , 2 B1 , 4 `B1 /S, N1 > `> `: , P: , P . , p! + , ( , , W, _ @: B, 0, `. B, . , . _, @U1 > o, О. y, . , . , H. G], . K], ȟ. , . , 0. , p. , , , . r, , :/, , B/, , , , 3, , , , , , , , n/, , ,/, , v/, , , 0, -., 3, F., 6, Y, =, H, E, k0, ^, d, a, G, w, M, , , , , . , , O, 6# t1 , p( s1 ڗ, P @s1 , A r1 , r1 ܖ, `q1 !, @o* p1 , M p1 , {) o1 4W, D n1 3, D' @m1 , , l1 , K. l1 ), `5 k1 <, @& @k1 R, p& j1 l, 95 j1 , ( i1 , ( h1 n, Z) h1 [U, `#' f1 ER, p & `e1 , e1 , c1 , c1 , A a1 , ``1 , 2 _1 , + ^1 q, ) ^1 , p%) ]1 \, f \1 , ώ [1 . j Z1 . ( Z1 , Q Y1 ), Y1 \, W1 <, @* W1 S, `* V1 o, u1 `> n, U, : O, -, U1 > |3, `t1 > z, t1 > , V1 > : . o, y, p: S, , 0, , q, ( , 0 , D V, @ , X , , , З *, @ $ , 1 [ , B 1 >, 0 & 1 M , % 1 ', `1 `> @> # 4, P % 1 G, 9 @1 , `$ @1 , 0$ 1 5, P$ 1 6, `$ 1 {), @ $ @1 Q, %$ 1 ŗ, 1 ), @#$ 1 q), @$ 1 `, `1 @. ) 1 xT, @' 1 u, ' 1 , &$ 1 J, % 1 wU, &' 1 U, `1 > > : 5, : wU, `uM + br, n , I , o , i , h , h + V 4 2, ;, J, T, d, r, , , n, , , 1 > , f 1 , Di 1 , 8i 1 , [i 1 %, o 1 , @ 3 0, #, ) ', # h], U, , , , ( h. I, , `C* . , , @B* . 2, , i . , , * . , , @X* . *!, *!, Q* k2, k2, ͝, t+ @1 ͝, w+ @1 ͝, }+ @1 |, < 1 , `# 2 !, b `1 , ! 1 G, 9 `1 , v 1 , G+ `1 , u" 1 , 1 i, t' `1 , 1 , x% 1 U, -' 1 s3, & 1 w\, p! 1 /C, '& 1 c, `$ 1 Q, ) 1 J%, 1 &4, & 1 B%, 1 7, ! @1 p, + 1 , @m 1 , 1 R(, # `1 O, @1 , `% @1 , 1 [, % 1 , p.' `1 g@, 1 ^@, 1 , ! 1 v, 1 , + 1 ʜ, p @1 ;, W) @1 0, g$ 1 o, p! 1 , ! 1 R%, # `1 Q, 0G @1 $, p( 1 D, $ 1 8, `2 > @; , @; !, ; , ; c, I, U, ; ;, `; 0, ; $, , W 4, @P > R z ; ȑ, _, @M ͝, ), p' /, `> w, D M 2$ , ( `2 9, 2 , % #0, 2 @> > ; , , , g, , 0+, , , j, , , D, ]) v ]) ! i V' & o . b N N } E v : b & , U . , % A, i. 3 t, # 3 , ` `3 , @@ 3 4, ( 3 ;, < 3 @, ) 3 K, ) 3 , p+ 3 o, + 3 O, " @3 T, z( 3 &V, $ 3 q, $ 3 , p( 3 *p, 0+ 3 , $ 3 C, 3 %V, 3 Jp, + 3 Qp, + 3 @, `3 q, 0$ 3 _, ! 3 C, 3 j, p+ 3 ^, t' 3 , ' 3 P_, Њ `3 A, @3 0p, * `3 =p, P+ `3 s, % 3 {, Y+ 3 , ( 3 , P+ 3 , * 3 , ( 3 , ( @3 , `+ `3 , Z+ 3 , s% 3 , $& 3 , + 3 , + `3 Q, P 3 , R+ 3 3[, * 3 ], ( 3 ڥ, v 3 , + l t . , ( 3 ͝, k+ 3 |, 0l+ `3 , `. , . >, =, > ; 4, ; _, ; t, 0; T, `; , @; 4, , @ @> f, ( h, ( , % + x1, ` % , % 0% {, % C, % P ( , * -, % ^ , , ( , , , ), , X , % 3 M, % 3 , # . a(, z' `3 (, 7' 3 W, ( 3 ڥ, 5 @3 % &, | !, Wp, " 3 ͝, + 3 , P) `3 4, % 3 E, @g# 3 3[, p' @3 ڥ, + 3 W, ( 3 W, e, , . , 0. wm, h. , @ h], $, @ h], L, H h], Bd, H h], , X i( :( إ. , x ! * . , `{' 8. , ( :( . , . $, h], L, . Bd, .' @. , 0! b* . , 0! b* . , 0! ( . , 0! f) . , 0! b* @. , 0! c* p. , 7' :( . , ) 0) Ш. , `' ( . , h. , t . , ( l $' . wm, 8 ` h. #, P' C h], +, :( ت. 5, :( (. ?, 9 :( . I, X) ,' ȫ. Q, X) ) . Z, W) ,' 0. b, W) ) `. k, ) ,' . s, ) ) Ȭ. |, * ,' . , * ) 0. , * ,' h. , * ) . , * . , * X< 0. , ' :( , , l* :( , , * :( x. , [" q . , :( Ȯ. , * ,' . $, * ) . 0, [, ,' X. ;, [, ) . G, @z' ,' ȯ. O, @z' ) . X, ( ,' 0. `, ( ) `. i, 0 `' ,' . p, 0 `' ) Ȱ. x, 8 ( :( . , H ) :( . , P c* @. , X x. , ` . , h . , p . , x f X. , { . , Ȳ. , 3 . , a* 8. , Б) ,' p. , Б) ) . , ) ,' . , ) ) . , P. +, . 8, `W) :( . B, V ,' 8. M, V ) p. Y, p . e, Q' * . m, ! . y, p @. , p `R) . e, Q' * . I, ȫ. k, S) . s, S) Ȭ. m, @! = . y, @. , . , ( p' + . , 0 . , 8 S) (. {, P( R+ `. , p . {, P( R+ `. , p . o z o 0% ( } B , ( 3 ͝, j+ 3 |, j+ 3 ͝, + ; , ͝, + ?, *, D, , ` 3 ͝, _ 3 , `{+ 3 ͝, 0+ 3 n) (' pd* ?' + + + ? 9 n) (' pd* ?' p> M ?, *, D, D, P) 3 ͝, i+ O, `3 , 3 " " @) < , ) 3 ͝, i+ 3 |, i+ 3 , 3 ͝, 3 |, 3 , + 3 ʮ, :9 `3 0+ {, h p+ > @ . P9 ` `> + p> p> > > > > > > > > > > > > > > > > > > > > > > 0> 0> @> @> P> P> `> `> p> p> > > > > > > > > > > > > > > > > > > > > > > 0> 0> @> @> P> P> `> `> " ' X [ Z Z q `^ r X [ Z Z m q `^ o q `^ q `^ + ͝, + {, ͝, <X 3 -, {, W, p& . ; 0+, C, P' f, p' h, ' , ' , xB x1, ͝, V) , + `3 , й 3 I, + 3 , u( 3 Q, p' 3 , ' 3 , + `3 , 0+ 3 , p+ 3 &, `3 3, r 3 (, 0+ 3 ʮ, + 3 m, N) 3 p, 3 @, u( `3 e, @l( 3 G, + 3 , ) ˢ, @* % % u( % ) u( + `; m, @; p, ; , ; e, n\, p+ @3 ڥ, p+ &3 ͝, + 3 U, + @3 H, + `3 ~, + 3 , n* 3 , ( 3 , n* 3 t , ( 3 , `3 %, 0+ 3 D, # 3 , + @3 0( `+ @+ ͝, P+ 3 D, - D, i D, K ; U, ; n\, ; H, ; ~, p; , 0L P( , % 3 ͝, 3 , 8 3 D, t 3 ' ) , 8 3 D, t @3 ' 0a* R, . D, mt 3 ' c, * @. , h. h, * . r, * ȸ. ~, * . , 4 , P+ @ 4 >, % 4 \>, P 4 , Pu" 4 , * 0. , * X. , * . \, + 4 , P+ 4 3[, P! 4 ڥ, 0 @ 4 ` u p " 0! в Џ ! `! $ ` p! ! ! i! p(" ! , , , . , . , . 8, 4 ? ; !, @; >, ; \>, Z 4 Z ^ 07 @< } е' g< , @) @4 ͝, 0q+ 4 |, q+ 4 , 0* @4 ͝, 4 |, 4 `; [ , , ' 4 ͝, 4 |, 4 ͝, 4 , 4 , 4 , @4 / / , , , H C, P , x1, h , , , , , ; 4, , T) , # , T) A> , 4 $, T+ ,, @$' 6, Fn, T) A, , O, - , ! 4 ڥ, 6 ` 4 g@, @. _, p. g, . ^@, . r, 0. z, . , Ȼ. , (. , H. , . , . c, * @. , * h. ~, 0+ &4 , ' @&4 , `* &4 , @* %4 \, ! %4 , c" #4 p, h" "4 p, * "4 , aZ !4 , + !4 e, Т( 4 3[, ) 4 ! ( ! q* * ! ' * @! ! * Pp* 0! , 4 @ ? , + , -l, + , , F , , 0g# h], Q, 0g# h], q, @@% h], W, V h], o, }# h], f, , h, . , pT+ . , PT+ F|, , V , , @m* *4 , ) *4 , $ )4 ڥ, !6 (4 p%( f, #, h, @. 9, p+ `. B, s =|, M, W Z, b, @ , @m* (4 , ) (4 , $ '4 ڥ, !6 (4 p%( , Y. (4 , / (4 , f. '4 f, l, h, . , p+ `. 4|, , J , , - *4 , </ *4 , )4 , / *4 , o. *4 , 3 )4 ͝, , 7 . . 1 , , #, 0 0, _ a(, (, ͝, W W, % , @ ͝, + |, , ( +4 , jy +4 @N `r? ^, H , p? ? Z, H *, ? , H , , P , ? , H , 0, P 3, , X , ͝, }? 9? c, :6 , H $, C, P 9, g, X ], L, ` V, ͝, H\ M? `? t? @6? 7? 0, H 0, x? 4? 0, P p, , H n, , H , g, P ], , X , W?, ` , , x , AD, h , , p , , , o? `>? *? |? <? ;? 3? '? -l, H , n, P $, ?, X 5, O, ` E, ], h S, @? ? g? `e? c? m? u? ? h? Q? `? Z? U? V? @]? [? S? b? ^? `X? d, p 0( ku D z, P( `$? 3? ; , p 0( D , P( `$? 3? v) ; , p 0( I+ D , P( `$? 3? P( ; , p' D 0. Э' ' `>? ' , p $ D , $ M? $ , p $ D 2, $ M? $ F, p $ D ], $ M? $ q, p $ D , $ M? $ , H > D , $& < @j? = ; , P ' D X. , ! x? )) , H > D , $& < t? = ; , H > D . $& < t? = ; , ` D% D , D% }? A% ', H > v D 0, $& < |? = G, H > D R, $& < |? = ; o, p' D , Э' ' o? ' , p $ D , $ @w? $ , p $ D , $ @w? $ , p $ D , $ @w? $ , p $ D . $ @w? $ , p $ D . $ @w? $ ', p $ D 8, $ @w? $ O, p $ D a, $ @w? $ q, p $ D , $ @w? $ , p $ D , $ @w? $ , p $ D , $ @w? $ y6, p $ D , $ @w? $ , H > D . $& < h? = ; , H > D 8. $& < h? = ; , H > D . $& < h? = ; #, H > D ȿ. $& < h? = ; 2, H > D . $& < h? = ; B, H > D 0. $& < h? = ; \, H > D . $& < h? = ; j, H > D . $& < h? = ; x, H > D . $& < h? = ; I, H > D P. $& < h? = ; , H > D . $& < h? = ; , H > D . $& < ? = ; , H > D H. $& < ? = ; , H > D p. $& < ? = ; :, H > D . $& < `? = ; , H > D . $& < `? = ; , H > D , $& < `? = ; , H > D . $& < `? = ; , p' ( D , Э' ' "? `? ' ", P P! D . g К! ? `? ! 0, H > D . $& < `? = ; C, H > D P, $& < `? = ; l, H > D . $& < `? = ; 2, p $ D 0. $ @!? ` ? ? `? $ $ k, P ' q' D {, , ! T !? `? )) , H D# D , $& < `? = D# , H > D , $& < `? = ; @, ` D% 1v D X. D% ? ? `? A% , H > D , $& < `? = ; , H > D , $& < `? = ; (, X @b q' D , !C b T "? `? @X , H > D -, $& < `? = ; ?, H > D . $& < `? = ; O, P ' D . Ј' ? @N P' Z, H > D l, $& < @N = ; , H > D . $& < @N = ; , H > D . $& < @N = ; , X O8 D 0. x" N ? @N @? A? @C? H? D? F? I? `K? ,? .? /? N? `1? &? @)? @w? @P? ? 0, , 0, 0, , `? @j? ? z? k? , R) @.4 ͝, Z) .4 |, 0Z) -4 @; , C, `* h, ) , @* C, o h, ) C, R h, ) C, p`* h, ) , , f, ͝, + , f, M) h, m C, { , , ͝, + :( `% , & , , , C, ( Z), /4 C), `# /4 +), /4 , # .4 `; *, ; , c, @. , h. ~, `44 F, P* 44 , Ў* 34 3[, * 34 Ж) p* @* r* * `* `* * q* ; , R, 9I \, @' n, p( z, U , U , 7> , 8 , < , @ , D , 0 , P , , J, p , x , , H ", /, ( ڥ, d6 A, e J, * , ?) `64 W, ! 54 ; , ; W, C, ( , . , . ͝, + 84 C, x , . , v 4 , ) , @! T4 @, 4 o, ) `S4 O, P@" @4 r, ( `Q4 A, `k) @4 T, 0) P4 &V, `@" 4 p, ) O4 p, ) M4 , @) 4 , P) y4 , `) y4 s, p) `z4 , У z4 {, ) `{4 , ) x4 , ) |4 , ) |4 ;, P' L4 *p, ) @L4 , }4 C, ) K4 ], `' J4 q, H4 , p| G4 0p, `) F4 =p, 0) E4 %V, 4 Jp, ) 4 Qp, ) E4 q, # @C4 4, Т) `A4 @, o) @4 , ) ?4 _, ~) @>4 P_, ' 4 C, ) =4 j, 4 , 7 `~4 ^, r) <4 , 0k) ~4 , 0) ;4 O p p F `( pe) " ) , ) V4 ͝, ) `V4 |, `) V4 ; g, ; ^, ; , ; 4, ; _, 0; T, @; r, ; p, , ) @u4 ͝, o x4 Wp, ) t4 ڥ, 6 t4 , ) t4 @, ~ 4 o, ) `s4 , s4 %, ) r4 O, `3" @4 r, ' p4 A, 0) @4 T, ) p4 *, 0& @o4 &V, ! 4 p, ) `n4 p, ) `l4 , ) 4 , ˛ k4 , ) y4 , ) y4 s, `) `z4 , z4 {, ) `{4 , P) x4 , ) |4 , P) |4 ;, ) j4 *p, ) j4 , G }4 C, ) i4 ], 0' `h4 q, ) f4 H, ) e4 h, ) e4 , ) c4 0p, `) b4 =p, ) a4 Q, U `a4 %V, 8" 4 Jp, ) 4 Qp, P) `4 q, `) ^4 4, ) \4 @, pq) @\4 , ) Z4 _, ) Y4 P_, ) 4 C, ) Y4 j, l 4 , `~4 ^, ' W4 , ha ~4 , ) W4 r s Z E! ! ) , `) @x4 ͝, ) x4 |, `) w4 `; Sq, ; ^, ; , ; 4, ; _, ; T, ; r, ; p, + v" , , , v , %/, , , , z u, J , }, = , , `, , Z 4, < 3!, A, d , D, y, Y , X , [ , , , m , ? ], E , g, } ,, E, > !, F , H, , @= 0= ? ? ? ? ? ? @? ɚ; @ & & & &Cyy%%%%& ɚ; ** ɚ; `L L ɚ; ^ H 9 9 3 9 C'#w"7"7 8 8 8L %%%%% ɚ; L 0@ ɚ; 499T?? ɚ; L L ɚ; @L ɚ; H ))++ ++-- ɚ; L L L @L L L L ɚ; ~ juu ##C((D| u*Cbyytd{{ u HHSMMM ɚ; L L L @L L ɚ; L L L L L ɚ; } !! S " &Y * *zQ$**;*;%( a # * * * * * * S!!! ((** O ,-F-M N NN{**511 * ) * * * * * * * * * * * * * * * ##%%% ##%%% & S! ! ! ! ! ɚ; ; D /C D 1AC D CD C6D D ɚ; L L L L L L `L @L @L L L L ɚ; L L ɚ; !! Y * *zS "#DEEE:>>>> JJ!OJJzQ ! < *LLA%LLK''))) * * * * * * * * * * * * * * * * * * ɚ; L L ɚ; A:B((B,/B, ɚ; L L L L L L L @L L ɚ; L ɚ; (// 2d88DDD ɚ; L ɚ; n *" " "2 * * *E E E E E ɚ; `L L L ɚ; L @L `L L @L L L ɚ; ɚ; L ɚ; a t ɚ; L ɚ; ɚ; / :?? @AA A a ɚ; L L ɚ; L ɚ; -44TY4III ɚ; `L L ɚ; @L ɚ; _ J J J J J ɚ; L L ɚ; @L L `L L L L ɚ; ɚ; L L ɚ; - %dj11 ɚ; @L L L L ɚ; ɚ; L L L ɚ; L L ɚ; A ɚ; `L L L L ɚ; l !!###( %((..#55 )$ /%%'''''D%%'''' ɚ; @L ɚ; $A A5 ɚ; L L `L L ɚ; &((DD DDD <'--"4(( ! ( ( ( ( #+,,tR"8"8M$ K ɚ; L L ɚ; % 1 B- A B- A AB- -C ɚ; L L `L @L L @L L L @L L ɚ; L L ɚ; \ D ! !D ɚ; L ɚ; ; A A ɚ; @L L L @L ɚ; L ɚ; 1d d ɚ; @L L L ɚ; L ɚ; L L ɚ; ^ yI%%!!"233 %WnG ngnd##*555555 &% ɚ; L L L ɚ; L L L L `L `L ɚ; `L ? L 0~D ɚ; N 33 3 3 = D DX N N#+- - - -s4""" ɚ; L L L `L ɚ; `L P%D ɚ; 5 # # # # # #S))) $$ ɚ; `L `L ɚ; L L ɚ; T ~~h'' - ; B B8 L L#+- - - -s4""" ɚ; L L `L ɚ; L L L `L ɚ; L P%D ɚ; 5 # # # # # "C((( ## ɚ; `L `L ɚ; L ɚ; `L L ɚ; o 3C NN3*+++ Hd + +D3; X& dF{8$$T{{ ɚ; L L `L L ɚ; L @L L L L @L L ɚ; `L L ɚ; 4 V\4 0 0Fvz4000t %d+++ ' ' %%f-- - D @? )//h??? ? ? ? >"))$// / / /)00v>> > > > ? ɚ; L `L `L ɚ; < A A'&A'+A3 3 BBB# #!C C C ɚ; L L L L `L `L ɚ; L L L L L L ɚ; M (0:*D""')+& # ɚ; L `L @L L L ɚ; `L @L L `L L L ɚ; ""49-- $$T[113 ; " KK ,,T[99 : : : * 6 KK7 ?@@ B B Bt~ 6 $HHH ɚ; `L `L @L `L ɚ; L L L L L ɚ; . "I+ <K5</<K5</< E <<< K5</ < %);; = " " "! ! ! ! " ɚ; L L L ɚ; AA$ $A87A8 ɚ; `L `L @L L L `L `L ɚ; E < {&4+=&&.-- 2 > >t{ K K | ɚ; L @L L `L L L ɚ; ɚ; L L ɚ; L ɚ; 0 * 29'',,Q/ /9 ɚ; `L L ɚ; L ɚ; !! ɚ; L ɚ; !%[[ ɚ; }L L ɚ; @L L L ɚ; " "H 04$ I I I " " " X ] ] X " " X" ) ) ) ) ) ɚ; |L L {L L ɚ; L L ? @L L L L L L }L @|L ɚ; ~D11 Jgfn55 J &% %"5"M **4??? ?!+t&&tFBHJ J J J 6< ( ( " # . .t 4 4 " " " ! " J dF6j I I II ɚ; `L @L L xL xL ɚ; 6B BB ɚ; L `L L xL L L L ɚ; yL yL @yL >D PA L O@ ɚ; K ?D ~ &FF D ? ~ VY55F (. F" *%)&/%:%:"" * * *%)"""* dF6 2 2 2D"*"289KDDK&@D# K ɚ; L `L @L `L `uL L `L ɚ; N 0 ==A AA7A? ? B BB' ' B65B6 ɚ; `L @vL vL L L L `L ɚ; yL Г@ ɚ; n GFJ55= "iFOO D 76<66> >.:&.--"5"E(00 AA # > $ #' &F D 76=$77? !%F D 76:t44< * 6 "&"A! wvz488@ "&+! wv|T::B{&(, F%%% D M ɚ; `L L rL `L @rL ɚ; x " // B' ' B43B4 C C%$C%)C1 1 C>=C> D) ) D65D6 E! ! E.-E. F F&%F& ɚ; `L `L `L `L L @rL rL L @L L @vL ɚ; @vL ɚ; Ft{O,, > **400 m , , > = > > > ~ TY''tV$$$ M ɚ; L `L lL L L qL ɚ; mL lL lL lL ɚ; )#33D { ; "))$// /)00t{CC C G,33D$+FF F'..ty$+FF F ɚ; `L ɚ; @L `L `L L ɚ; iL L L L L @iL ɚ; 9D D ! ! , , ;??4 . .299$??C c--- - ,{"2:%&6TYGGGG"4$?????"4$???? t{M:: 4 *4; 7 7 ; ; ;C NN3 666K++D1111K++F333 [__TY//F%+CK " " [__TY//F%+CK " + + + + "/, , , , , , , , , , , , , , ,0 M ɚ; `L L ɚ; + AF- C E#*9F-#:F F--F14F1 ɚ; `L L `L L `L `L qL L L L @L eL @eL lL eL ɚ; fL fL P%D @fL PO@ lL eL ɚ; **** 9 # #[__TY//F%+CK " [__TY ' 'F #CK v|T**2 $ F D v}d++3 "( F 6:.. B%)Y%9%9#%>%>q%A" D vz4((0 "FOO D M ɚ; `L L ɚ; A " AA0= C CC,AD. . D;:D;E E%$E% ɚ; `L @eL L eL `L L L ɚ; ɚ; r { t{M22 3"4;// 4 4 4C NN3 . . .,T22 2 d # #F D#!' DI {"2:%&6TYGGGG ; ''/// K ** ++!' DI -ty$+FFF "U"""" M ɚ; `L L ɚ; I :E ?C E C6C%$C6% C2/C61C22C66AE E ɚ; `L L L L @L eL ``L kL L `L L lL @L eL L ɚ; lL eL @fL P%D `\L ɚ; DI & & $ $ d##$ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ $ ɚ; 155 ɚ; `L \L ɚ; WL ɚ; C ;<N P P PJ&/JJ/FJJJJ ɚ; L @L L VL yL ɚ; @TL SL `SL SL RL ɚ; 2 ??8 $ $ #Hc#+FFF F4 ɚ; PL L OL ɚ; L QL L yL ɚ; I T) + + + }}Xt,, " .t{{D8 ɚ; ML @ML ɚ; V 9C 4 4 4 = D DTY O O#'9. . . .()<dCCC ɚ; `L ɚ; L L L `L L L JL ɚ; KL `L P%D ɚ; "$"3V<<<<< ɚ; L L @HL ɚ; HL ɚ; `FL ɚ; DL ɚ; u ɚ; BL ɚ; 8 GK K \K [ 9 9 9 [ 9 D D \D = = \= [ [ [ + /00KKK ɚ; yL AL L @AL PL ML lL lL L FL L L @eL ɚ; VL @UL UL @QL NL `KL HL FL EL `CL AL }D D ɚ; @ ;<N P P P#**1:~7MNNN ɚ; <L ɚ; L @L L `L ?L yL ɚ; @TL =L @iL ɚ; ! = F||''==H F F F F F8FJ//E))&/::eCCCUCCC " 4 4Xty% P P Hf 8S%7 8 8!!! ! !D 6H 2 2~~~x~~~ F3::1fEEE ''''' vz22 C CFO C C2 &.FOO% D 5?h..!?b000&/000O**8444 6H D(E$u++&&:z*BBBBEBBB~ E **5>49eLL6 ~111ENH3M111 I#x///(F1C////#e(=>>>>>>> ~--u~--- %$9BBT:::H::: H vz22222 (222V_h4O2222"6:66GGGG6 H vz22222 (222V_h4O2222"6:66GGGG6$$$$$$ ɚ; PL L `L @8L :L 8L 7L ɚ; +D3 3 E ?E ɚ; L `:L eL L L :L 9L L L `9L `L 9L `L 8L :L L ɚ; @;L :L @ :L ɚ; / wsM4 @ @ : F(CC F F F%(\W%<%<TT# EC#((( F u ""3'' #ABB< 6"* 5 5 5H ""3,, =77g77F 2#222HHF /<3<<<<H ɚ; PL L -L 8L -L @-L 7L ɚ; $ %A A ɚ; L .L `L `.L L 0L ɚ; 0L }D `0L 0L /L /L `/L /L .L ɚ; :L ɚ; ()98DD <4 "5( #'*{+02 2 2 008UKK& 4D!3 4 4 > + 2 21f = = = ɚ; PL L OL *L 8L :L `L 7L ɚ; L L *L L yL 9L L L `9L L `L 9L ɚ; O@ @ ɚ; @ T) + + + nnX..8ssD8 ɚ; PL L ɚ; L @L L L L ɚ; `'L &L ɚ; ^ TY'' +(1H +"* D ɚ; `L L ɚ; , 99 ɚ; L L `L ɚ; $L ɚ; : y()?FF T6?##### ɚ; L `L ɚ; L L "L "L ɚ; #311 )) !5( & V T*** ! FO 6""" ɚ; PL L L *L 8L :L ɚ; L L *L @;L `:L eL ɚ; @ L ɚ; L "L ɚ; L ɚ; t ɚ; L ɚ; %%h/// ɚ; PL L ɚ; L :L ɚ; `L ɚ; GO O \O B% B% [B%H [ 0 [: 9 9 9 [ 9 \ $ $ \$ [$ 0 0 [0 [ 0 0 [0 0 0 ɚ; yL AL L @AL 9L PL ML lL lL @eL L FL L ɚ; ?L `>L >L ;L 0L *L (L %L #L L L ` L L L _B }D D ɚ; L L ɚ; L ɚ; ɚ; L `L L L ɚ; L L ɚ; L ɚ; 8 .. ɚ; ɚ; L @L L L ɚ; ` >>#uqy ) )D 4yy5NOOO 7D)- 77>>$ % % %47 ɚ; L L L @L ɚ; L L `L ɚ; L L L ɚ; a 6"" ; ; ;C NN3 &&& d + +F ~t D& ) )) ɚ; L `L ɚ; L L @L eL ML L ɚ; @ L ɚ; I * + + + @/ ??? #I ! ! 5 5 5 " , !ytV44 " (t<<< 5 5 5 5 5 5 5 < 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 !4!4 T* ( %H ' # ' & KKKKK # & t ɚ; OL L L L PL `L L ɚ; N B3"A7)B37 B$B3!B3#B$$B33B7 :B7 #C44 DD ɚ; L L L L @L eL L PL `L L ɚ; L @ L L ɚ; dC N9@@dLLMMM qyy-... qyy'3'' ) =>> > ) ( ) ) ) .EQJJ,---. .JJ ɚ; L `L `L L L L ɚ; L L L L @L L ɚ; D __S ! !! $FK ( $ $ %gv 6 6 6 3; ;t$ $ F+ @ )DD @ @ @ 77??fMMC%c5554 ? @ $, $$Q' dD ! !D |!(//$"7"7dCCCC @ 1 8 8 ? ? ? <#D))F <599;;; <599;;;; < / F+ / M5& 1 1 1 1 / / /UUUEUUC NN3 . . . . . / M ɚ; K K @K K `L L ɚ; * 3A; ;;B63E E<F& &2GG ɚ; L L L `L K `L `K `L \L eL L L @L eL ɚ; K P%D `K K ɚ; A [__T> 2 2F. D11?EJJ ! % % > >[__T>::F ''.tW== > > > > > > > >' > > > > > > > > > > > > > > > D!!! ~))/ !'5555 M ɚ; K L L ɚ; >B66B:=B: ɚ; L K `L K `L `K ɚ; K K P%D ɚ; @ $''' qyy T7E22 $ , ,, ɚ; L L ɚ; L @L K ɚ; @K ɚ; [ !S!! ( *4' 6u 6 6#'77#3 6 6 7 7 7 #XX 1!;!; 1 +/1 1 1 1## v::I )'9====& H ))KOOI~>>J HHHH M ɚ; L K K K K @K K K ɚ; .B?? D 0C?>C??D ɚ; L `L L L `L L `K L K ɚ; `K K K K @K K O@ L ɚ; kk-((G ;;z " "D 4; 6 6 NN ? & ? ?.2k ? ? ?(Q 8 8 8 { ?$ 4 4 4 *% W $ $ ((--a0G N ɚ; K L `L ɚ; L @L eL L ɚ; K K `K K 05D @K ɚ; zz T"" % 177r#H-- T7E22 A:: t~~c 2 21 566 6 OM $ii#dnnS&9&9!&<"="==G ;v/LFO0D0DW0L/L MN N $ $ +>>> ɚ; K K K L L K L @K ɚ; K K K L L ɚ; @K ɚ; < $ $T * *D |5<=== $ ɚ; `L ɚ; VL PL L \L ɚ; K ɚ; L L L ɚ; $ D C s))K ))++ . . f fk * * .s///( %% '$VV44D tV , , , ''%%f--- +h'K< ; ; s{ * * / = =NN [ 6N \>:::: ; ; ɚ; K `K K L `L `L K K `K ɚ; L L L L VL L ?L uL qL K L ɚ; K H@ ɚ; D :{###M )))M ((((( ɚ; K `K ɚ; K L L VL ?L ɚ; K ɚ; 7 &%%%4 '' H(=>>>>> ɚ; @K ɚ; @K `L K L ɚ; K ɚ; ɚ; K ɚ; rL ɚ; @L L ɚ; = ,& & & & & & \ JE JE JE JE JE JE JE JEZJ J J J J J J J* " " "J " 01 6 6 6 6 6% % %$ $ $ &@ @ @4c) c) c) c) c) c) c) c)L .2d J J J J J:' ' ' 'T 27 F F F F FR " G G G" <" " "H) ) )Z $ $ $ K1 K1 K1 K1 K1 K1 K1 K1\U0 U0 U0 U0 U0 U0 U0 U0t 8 8 8* * *, , , ,^ . . . % V #' ' 'T 6 - - - - >C " " " " "J 6" " " "J "; "; ";J) ) )? ? ? ? ? ɚ; 6 L L L L `L L L `L L L @L L @L `L @L L L L L L L L L uL qL kL L @L ``L \L L VL ?L L @L L `L L K K K @K K K K K K K K ɚ; B L `L L L `L @L L L L @L L `L L @L L eA @L L L `L L @zL L O@ vL rL PO@ mL jL `gL `L \L XL `VL `?L VL L ?L L L L L @L K `K K K K K O@ K `K `K `K `K K K }D D \D N@ ɚ; , 4 4S3s88q= 4 4 4 4 4 4 ɚ; K -L ɚ; ɚ; 999AA999 ɚ; K K ɚ; K ɚ; y33Js{8J J ɚ; L L K `K K ɚ; K ɚ; 5 ɚ; K ɚ; PYTHONCASEOK ɚ; | | :;; < " "#F G G " CC!C K K K K K K ɚ; @ ɚ; K @K ɚ; L `.L L K @K ɚ; K @[@ @K K ɚ; # FFZ ) )!X 6 66 ɚ; K ɚ; K K ɚ; K @ ɚ; K ɚ; ) t99>>>> >>$ ) )) ɚ; K ɚ; K K ɚ; K ɚ; ) ===a1= ))=== ɚ; K K ɚ; g 2 z??a a= !#"5z B B " "NHd"">22 "h6G6G6W6W " 77?4 4(""3'' "==??h&7&7&9&999 $D 6DDKK%%%% '4 D!!!!==4=== t99>>$q'>(? "hmmD)))) ɚ; K `K K K ɚ; `K `K K L K K K @K `K K ɚ; K K K ɚ; 8 > > >"& >dkk/ : : > > > ɚ; K K ɚ; K @K ɚ; 4 }} > >*4 > > > ? ? ? ɚ; K ɚ; `K ɚ; K K ɚ; - 3 3aDJJqMM 3 3 3 3 3 3 ɚ; K K ɚ; `K ɚ; V 3 3 3 3? 3 3 333A1uu4x 8T!a%&&\ !! ɚ; @K ɚ; K @K ɚ; K K ɚ; 8D>> ɚ; `K K ɚ; @K ɚ; K t$$ uu (T 11 ɚ; K ɚ; ɚ; K K K ɚ; @K @ D ɚ; dH - -- ɚ; `K ɚ; K D ɚ; % z|| dH - -- ɚ; `K K `K ɚ; K D ɚ; f 5"4((+33C>>4yy1}Q$//&"9"9"PT]]4=P=PQ ɚ; `K ɚ; `K K L K ɚ; K /L 0L K ɚ; /// ɚ; L @K ɚ; K ɚ; 6 ~~dBtHH--H (*s{*S\94%< I IB ZD ! ! T JJt Hd##### Jx D ɚ; K K K `L ɚ; T "B; 7B B; B B; B !B; ; C-CC- C(%C-'C((C- ɚ; `L L `K K `K K K K K `K ɚ; K L A K ɚ; $ ! 01C E E E #JGG$$ $ +2rr :d D T""JD$ooc**OD#t &C {!"HIIIgg 6$c BCCO 9 " " LL 9-L|$$Lr##%% N 7 > >| L LMM M#**?D,OO !21!55H % 4 2 cjllD11D 7c>>d1g_ < <8D KK ( ( dHh / // ɚ; K K L @K K @L -L K K K ɚ; L @L L `L `K @K K L L `9L K L L K L K L `L @K K K K K K @K `K K ɚ; K K K K K K K ɚ; ɚ; #+!"HIII :d D ( . .D # %*11/BB ??=83 4 4 +M**++,D&* # " *#D)) g h ) ) $ ) ) * * * &&s++I M9IMMNNN a '..sA66r: &&t,, / .%) . . / / / T, "" 3 2< 2 2 2 3 3 3$..s33A6M dMOA,> > ? ?? ɚ; @K K K K @K K K K K ɚ; L `9L K L `K @K K K K @K L `K K L L L @K K K K K ɚ; K K K u@ `K K K K ɚ; =Q t&11#66D!Y 9??$$RU+t33 )' 66 , ) ) )#CRC( )&{33 F;; F ɚ; @K K K K ɚ; A$ $BB ɚ; L K K L L `K ɚ; K K ɚ; ~ //00 $X.. ." DD 5!233 4 4 t ɚ; 8 AA ɚ; K ~K K K L K ɚ; M $ ' EMD K ɚ; ɚ; && ɚ; K K K ɚ; `|K A ɚ; n <9DD Y$ +!%DD 28<> > > >vdD242226222 ɚ; L L L @xK ɚ; L ɚ; yK @yK P%D ɚ; ɚ; a P A A3(( AC'#w*?*?@@@ L - - - - - ɚ; L L ɚ; L L @L ɚ; 0@ ɚ; ] 3 3 3 3 3 3 . . . E v&&& ɚ; ` ɚ; @xK xK L ɚ; L ɚ; yK wK uK D ɚ; v N P%' ' ' ''11FH ~#h--~<szz(1+.. >>> M ɚ; L L `L qK ɚ; L @L L qK `L eL ɚ; rK @rK qK ɚ; !HE <<<5<<##D'222'11[111 4yy2~~ETEE##D'222w 4!9 % %E u} 2858888'11[111 L ɚ; K iK iK L L ɚ; jK L L `jK @K ɚ; lK @lK lK kK `kK kK jK ɚ; ? ɚ; & d1R4j!!lZ&?@@3433##D'222'11[111 tBrE{## j(@AA;4;;KK{KKK AA ɚ; K dK cK iK L ɚ; @K L L ɚ; eK @ dK kK ɚ; I " AbDz[ Fd F F ! ɚ; K ^K iK ɚ; L ɚ; _K _K ɚ; = D$ ## 9##$;]KKK " !$ 4 4 4 3::=II #-9 9 9 9 ɚ; K @K K ɚ; \K @\K \K L L [K L `L ɚ; ]K ]K \K XA ɚ; | \ " "DKK Q KK U##$$$KK [))***KK d##$$$ K ɚ; XK cK K ɚ; XK jK @K \K XK ɚ; YK ɚ; \ " "D 'Q, EKK U##$$$ { q KK KK d##$$$ K ɚ; ^K UK K L ɚ; XK jK @K \K XK ɚ; UK ɚ; l OOO K 5 5 >''(=>>H3D$??O ! !,"5"5hqk"B"B C CC ɚ; PK RK `PK PK ɚ; RK K QK QK @QK ɚ; `RK ɚ; @L ɚ; 6> * * !..t44 :h''8$$ %cjllH== vh ? ?D D ~&A&C&C "L( x 11 % dH55 $ 4 "Y.. 6< ( ( 9 9 # . .t 4 4 968D3 9 +E' &",, <!(++A.G + 2 27 ; ; ; K ɚ; `uL `L `L `L LK KK L KK ɚ; 0 , 99!!B BB D? ? E E ɚ; L @yL L `K @K K K K K L L LK K ~K `L @LK L `L K ɚ; LK @yL Г@ L ɚ; W B>&":C@@ @ B B B>&";SAA A A A B ɚ; @K ɚ; ! )A A ɚ; EK DK DK K DK ɚ; L AK ɚ; ? , 1LL +L!!8.58H!8L.L " N N ##C(( 7D!,T266 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 44 ɚ; PL L @?K @K ?K >K ɚ; 6 B A;/ B ;A??B A?B BB ɚ; `AK AK @K `L L @K CK EK @@K K ɚ; AK @ ɚ; ''11 4 x 44 ; = = FH x 11 !228396(H3M3M:B 3 D D ɚ; PL L OL >K `L KK `L ɚ; + 99 ɚ; ?K K K LK K ~K L ɚ; Г@ ɚ; I T) + + + }}Xt,, ; 4 ɚ; 9K 9K ɚ; HH ' A8/A#AKB B \B [ [ [ ɚ; @K AK 7K 6K `AK AL CK @AL ?K PL ML ɚ; GK FK FK EK `EK BK <K `:K `7K }D D ɚ; i t 0 0 : :;;A> Q//2 '',,Q/ *FyJ/FF ɚ; L L @3K 3K ɚ; K @yL L L ɚ; 3K ɚ; c }}V_-- < --3VFO-D-DF F F,,T4 IIIII ɚ; L L ɚ; FL L `L L "L ɚ; /K /K ɚ; ++D(;;; ɚ; L ɚ; ,K ɚ; ` G G G9 9 9J J J< < < < < ɚ; L lL lL @eL ɚ; @5K 4K `1K /K -K @+K ɚ; ɚ; K ɚ; )K ɚ; ..// ɚ; L ɚ; (K ɚ; %K XK ɚ; }}Z... ɚ; L K !K K ɚ; "K ɚ; #K ɚ; L K ɚ; K ɚ; | ** 6 ==..LL 6 6 6 G#+- - -25 6 6 \*** ɚ; L L PK K ɚ; - AA A ɚ; @yL K K L QK ɚ; ` K K P%D ɚ; K K ɚ; 1 33GT459I 4 O O O ɚ; L K K ɚ; L `K ɚ; K "L P@ ɚ; @K K ɚ; M ''11 3 J -k : :M. J__[11 #2g; / / (J == 77D !) -# #K J -dHk J J%/%5%5bcc%: %*S[A%5 % +04<1+<L $ :g E E!- !F!%!;x!G!G/3}}[/I/I .2.>$5$0/" /" !34h3>!@ !@ !@ 4 $ , "6 ( + #33O]4?A A A 0(?L=H J J J J (2 ? D # ! ! ! MMM !d ==55L)), DD ##$9;GGG' M,E ( A &"&"2<"@"@K(k<PP-k<.1,.?.?A A $$[-FFFF& ɚ; L L K dK PK ^K @K K @K K K iK L K @K ɚ; Y F F E6 7B9E E32E36 FF FF F%$F% I! ! I.-I. ɚ; @yL K %K K K jK K L K ^K @K _K `dK L @[K L `jK K L K L K @UK @XK "K ɚ; K XK XA `K K K K @ @K ɚ; K ɚ; 0 0 0 / / / + + + 79 O O O O OR R R R R ɚ; (K %K "K "K K FL ɚ; *K 'K $K K K K @ K K ɚ; ɚ; @ K ɚ; # Z&&228<<< ɚ; L L ɚ; K ` K @eL ɚ; @K ɚ; d\+> ? @ @ # s4yy)) #Tyy{{ # # # # # # # # # # # # # # # # # # D#&& #$yy{{ # # # # # # # # # # # # # # # # # # ɚ; L `L ɚ; # A A#&A#B""B&)B& ɚ; *K K K K L K ɚ; `K K ɚ; J ɚ; $ 000000z$ ɚ; L L J ɚ; `J J ɚ; л@ ɚ; " " 1 1 11 1 1 = = = = [ = [# # # [ ɚ; tK @eL @yL K J ɚ; ` K K K K K K K J J ɚ; XK K ɚ; ! bj999 ɚ; L K ɚ; K J J ɚ; @J P@ ɚ; ' +&&}}]D}=== ɚ; L K @K K ɚ; |K "K ɚ; @ ɚ; &t,, $[ 0 0 $&v..LFD d # # # $[ 0 0 $ Z(( D --F &!!!!" ++,I,2C9 9 9 - $e , , , ' ' = = = = = - - - ' '(Et(+ - - - - - - - - - - ɚ; L K J K K K ɚ; 6 B C! C* C C,D D5 D00D5 ɚ; K K K `K `J J K L K ɚ; @J J J ɚ; J ɚ; V HH: : : > > > -2 - - - - - - - ɚ; %K "K "K ɚ; J J `J J A @ J ɚ; @K ɚ; **}}T"" dHk222 t RSS ! ɚ; L L K iK ɚ; @yL K jK @[K K ɚ; XA P@ ɚ; `J ɚ; 8 77 ɚ; FL ɚ; J J J @J ɚ; ɚ; L ɚ; $ %/1 0 / 1 ɚ; ɚ; DIdi 00 ɚ; `K ɚ; H 55 ' '##$L DI / / / ɚ; L `L L ɚ; L L J L ɚ; @J J ɚ; I ,,T->GGG##$N DI / / / / / ɚ; L L J L ɚ; J J ɚ; A 5 5 V 33 5 5 5 5 5 5 ɚ; K J J ɚ; ɚ; O **1- 5 5 5 5!35 5 5 5 5 5 ɚ; @ ɚ; L L J ɚ; K `J 6K ɚ; J J ɚ; @J ɚ; t ɚ; J ɚ; y ɚ; K ɚ; 1 1 11 1 1 / / / 5 5 5 [ ɚ; lL lL L FL tK @yL ɚ; K J J J J J J J J J @J ɚ; D !&t'<'<'>'>!?!? ; ' ɚ; L rL ~K J J J @J J ɚ; L ɚ; 8 *//44R "99 = z!! ɚ; L J L ɚ; L L ɚ; J @ ɚ; 1 -1-I-I-K-K*Ns{#56GGG ɚ; L J `J ɚ; J L ɚ; D 1 1 3 344 $0 0 0DK4CS4S4S$$TZ==D DK$72 A!%!@DJ%0D " #{D z ɚ; L @J `L ɚ; ~K J J J @J J L `L `L rL ɚ; D%%''((( ɚ; J ɚ; ""5)) ɚ; 5 ɚ; L `J ɚ; rL ɚ; 4$$&&''' ɚ; J ɚ; %,,TZ888 ɚ; `L rL ɚ; `J ɚ; t((**** ɚ; J ɚ; $ ɚ; L `J ɚ; rL ɚ; F( ( (" " "H H H ) ) )* * *! ! !( ( (9 9 9+ + + ɚ; J J J J ɚ; J J J `J J `J J `J J J J `J J ɚ; #D$ << ɚ; L `J ɚ; J rL ɚ; 9 ;<N P P P*11&/BBB ɚ; L @L L `L ɚ; @TL J J ɚ; t ɚ; r ɚ; r:vDAAAA ɚ; `K ɚ; "L ^A ɚ; 1K ɚ; ɚ; L L ɚ; < ##$L$(J 0 0 0 ++D(;;; ɚ; L rL L ɚ; J J ɚ; @J ɚ; & 555555 tz*** ɚ; L L @J ɚ; `J @J rL ɚ; P@ ɚ; = = = C C \C B B B9 9 9 < < <+ + + + + ɚ; AL L L FL lL lL @eL J ɚ; @rL J J J J `J @J J J J ɚ; !!8!>!>!@!@ A A + +LD& ~[%6%6~+D11!455 +((*** " 999999,,..... ɚ; L J ɚ; vL L J K L J J J J J ɚ; @J J p@ ɚ; w > %cn % N4m D D DN D tDzz!!! 4 ɚ; `J ɚ; A A A ɚ; L @J L @L eL L ɚ; J J ɚ; 2:: z||$ tt 3,T2FF 3 3 3__T**F,2C #D ) ) ) 3 ɚ; PL L ɚ; **A .A21A2 ɚ; `K K `J L J @L J ɚ; J ɚ; 6= ) ) --f55 4 4 4C N3 . . . % 1 1( ; ; FHH --f55 4 4 4C N3 . . .''11FH ..x@@ @$$Xt44*2' ɚ; PL L L `L qK `L ɚ; L L L @L eL qK ML L L `L ɚ; qK `J @ L ɚ; E eS)) --e44F!6;// B!++Hf==DD //&AAD< ;* KKK :#%&;<<< %%h/// ((488D.<D +K ɚ; PL L OL @J J L `L qK ɚ; L J L PL J `L `L L L ɚ; J PL J ɚ; w <8D}}XtV44 <4 [ ! <N # 2@>[^[h2i2i/ tK ɚ; PL L OL `L @J ɚ; L J `L `L @L J ɚ; J ɚ; H T) + + + }}Xt,, <4{ ɚ; PL L `L ɚ; L @L L PL `L ɚ; J J ɚ; J ɚ; / :999994!4dEfEEE ɚ; L L J ɚ; J J J ɚ; J p@ ɚ; HH/ / \/" \ [* [( [ > [. [ F F \ F F F ɚ; AL J J @AL J J J PL ML J ɚ; J J @J J J J J J J J D }D ɚ; ( CCFF+CCCCCC ɚ; K J `L ɚ; . D D FH NNCCCC(CCC C C C C ts{{ DII T"" "3:<<66DII DI 55#&55 ɚ; @ ɚ; L `J J KK `L ɚ; J `K K K K J L `J J ɚ; `J J ɚ; ɚ; J ɚ; J ɚ; W T) + + + ~~h'' <8O{D ; ArAA ɚ; L L `L ɚ; L @L L PL `L `L ɚ; @J J ɚ; 7 h--&xfBFH H H H ɚ; L LK L L OL `L ɚ; PA ɚ; _ ))#..q1 ty 8CJLL99BEE EEE D$ $ $ $D == ',E&,,..LL$E&L 5 "49k::I(, 6 6$ *V 3 &y- @ @ ** b >>,)i[Z`aaaaab +9 5 5 $(M 8 8 FL &ty+2F G G ttt ' ' Y! ' L L Lf$-- ** 8 >>,)*. 8 8 8 8 8 ' '(CY O O O ((488D/8kD +Kt ɚ; L L OL `J J XK J J `J J LK J ~J `L ɚ; # ,A AA9E E! E! ɚ; L K `K K J K J J K J K `J K J `K J K L L L `L ɚ; J J eA @J ɚ; 'F'F'Fr 'F'F'F ɚ; K yJ ɚ; K ɚ; A y {4#73:<<88HH!?4FG HHH |&&u-- 5 "8}}D %(EE ! 4 4$(NN3$7$7!c6 $ &~~dFLLNN C CHH #H%))(3333 4D < " "#> ? ? G'F'FX'F'F'FD $ $ $ G G ɚ; L vJ vJ `J J J uJ ɚ; '1 A A ɚ; `K wJ K `J wJ wJ L `.L L L `J K `L K K J ɚ; yJ `K L xJ ɚ; @ t$$ O!"BNNNN3t-n--- - ɚ; PL `J ɚ; K L ɚ; qJ pJ PD ɚ; * . . . . . . (' ɚ; `` ɚ; PL `J @pJ ɚ; `qJ nJ ɚ; !((333 ɚ; `L ɚ; lJ ɚ; ) ) )& $K B B B H H H 1 1 1 1f G G G> ( ( [("4 4 4 4 4 ɚ; J @qK ML qK J PL J @AL `nJ ɚ; J @J J @J J J zJ rJ mJ `kJ D ɚ; VVL ! !F 66* D 6 6[FF " ")$99FF%dH55F F&tXfEEE :!<!:$< ɚ; jJ iJ iJ `L `L ɚ; 3B BB ɚ; `L J J xL L ɚ; >D @vL ɚ; 9 %d&=&?&??J .F#%66H )) ɚ; @fJ fJ eJ ɚ; K L fJ J K J K ɚ; fJ ɚ; "JJJ ɚ; cJ ɚ; ɚ; [ +,,,355N:/1BCDEEEM$$$$$ ɚ; cJ bJ ɚ; dJ LK L @J J `nJ L J ɚ; bJ ɚ; ɚ; A ɚ; `L `L ɚ; K ɚ; ɚ; ɚ; K K ɚ; `K ɚ; K , |w& MMMM SkOOeO s 4 4O 4 4 444 4 44 1 ''''/**99 999 '- #(: % E"E!F 7 7 7 * * * * * * "?* * * *<? ? ? " " " 2 2 2. . . . . . 0R R R R0 0 0 , T-( ) ) j q(++g5 NN<:: ' #6""",T,.. H 8I I 5D0 D0 D0 D0 D0 D0N%@ %@ %@PG G G& > ( BL L L8 0 9 9 9 9 D D D FHH D47@D D D D DR@ @ @ @ @ @ @ @F< < < < < < < <<M M M M M= M M M`/ / / / / / / / d*- *- *- *- *-z< *- *- *-Z :} 22 2 2 2 2*m 2 2 2jA A A A A A A A N,+ ,+ ,+ ,+ ,+ ,+ ,+ ,+` # aF aF aF aF aF aF aF aFH[4 [4 [4 [4 [4 [4 [4 [4@ .* * *# # # % % % % % ɚ; V L K L L \K `.L 7K @`J `K EK `J @K _J `K ~K K `_J @K _J K K K @K @K @K K K K `K `K K K K L ^J \K K jK K K @K K @K K fJ 6K K `^J ^J K K L |K tK @qK jK `dK _K @[K @XK @UK QK @K @LK xL GK @5K *K ` K J J K J @rL ]J J J LK dJ K ɚ; T K `0L 0L /L K K PA A `K K K K `K K K K K K K K K A K A \A K K .L @K K A K K ~K |K {K sK @oK `gK bK ]K YK VK SK `NK PA GK 5K GK @*K @5K K *K J ` K J J `J J J K J J J @rL `J J @jJ J gJ dJ bJ `J A D A 0aA }D ɚ; D ɚ; ɚ; ZJ ɚ; $$$ A ?d ? ?@@ @ E !8tDDD D 8<< h77D (3D99 J)h66()9EEEE Z( ( ( ( %8$CD$I$I!d??()9EEEE h''''' ( $ /(.EE / / /#D))E). & & & / )4fTTrTlC ; $ KK8 #KKKK $ $ ɚ; L TJ K KK TJ SJ ɚ; % 3B' 'AD ?D D #D98D9 ɚ; L `L L ZJ VJ `K `L K K K L K UJ @L `UJ UJ TJ K TJ ɚ; VJ VJ PD @ D D @VJ ɚ; I) + + + dH - - >8O #422 4 ! ! @ T\>8>W>>?? ?Rx ɚ; L L @KJ KJ ɚ; L @L L LJ LJ KJ TJ `K ɚ; MJ LJ ɚ; > I) + + + $//22 ɚ; L L ɚ; L @L L qK ɚ; `GJ FJ ɚ; `L L ɚ; L ɚ; 'tX66 " .x+VVV V 'tX66GtW%% ,;;';;!,(48<> > >/66t<<< t ɚ; L L OL CJ KJ `L ɚ; LJ L LJ KJ TJ `K L `L ɚ; DJ +A *A ɚ; $4D(#C#C i ɚ; AJ ɚ; @ '' h??H t|h 6 7 7 :3t|h 677889C & C(II & & &!R%% % & y111 ɚ; L iJ @K `=J ɚ; 1 A? ? B ɚ; VJ `K L TJ UJ @L K >J ɚ; @>J ɚ; $4D(#C#C i ɚ; L L @J KJ ɚ; @J ɚ; `:J ɚ; dH - - : !Bh!B!BRRR R h// $*5dMJJHH |||H H-II 44 y1188::: ɚ; L L @KJ 6J `=J ɚ; A# # A10A1 ɚ; LJ ZJ LJ `L K UJ @L >J TJ ɚ; 7J `7J P%D /L .L ɚ; 9 dH - - : !Bh!B!BRRR R ɚ; L L @KJ ɚ; LJ ZJ ɚ; 3J `7J P%D ɚ; y Cs .///#3D(#C#C ikooh'' ;jl ; ;; x((C$'CK ! * (h77.9$,MM (z 3// 0#/ .s|Xw O O O s| $ $ $ $ H% V+h'CC V V V Tx T T TUU U V#$DhPWXXX ɚ; L L @J KJ @.J 6J ɚ; B D D "D5 5 E ɚ; L @L L @J L .J LJ `L K TJ L "L @L L L ɚ; 0J 0J /J /J /J ɚ; `)J ɚ; k ??8,, t 44 //////yx((( ɚ; L L `)J ɚ; (( ɚ; L ZJ `J `)J ɚ; )J 8A ɚ; m )$,77DK15 . . . $ $T\4 8 8 8 DKKKK ɚ; -1 1A&%A& ɚ; `UJ TJ UJ UJ ZJ eL ɚ; `'J ɚ; ! Nt|NXNt{NNNN ɚ; TJ `K TJ ɚ; %J $J ɚ; "%$ %$ %$Z J3 3 3 3 6 2 2 2* ; ; ;4 ( ( (V ) ) ) O O O O O ɚ; qK ML PL FL K @yL L @eL J J ɚ; @WJ OJ `IJ EJ BJ ?J @;J 9J 4J `2J *J 'J `%J `#J D ɚ; " ;,,S11!4 44 ɚ; L L ɚ; TJ L ɚ; ɚ; XoG dk !! ɚ; L J ɚ; `K UJ ɚ; S D( + +D)9 % I&= t{ " " # 4 ɚ; L L J @ J @J 6J ɚ; LJ J UJ ɚ; PK ɚ; P ]7 # # P P P @W @ @wOOOOP s" s" wwyy n " X--q111"$''))!566 X X X$%HW%H%HwWWWW X6{{ 222$%HW%H%HwWWWWbqbz ///7GGAqMMM " II 7 7 7()L)L)L.57 7 7 77 %( O(C(<)=>?%A %A!7GG -... 7799DD 7 7 7()L)L)L.57 7 7 77 jj!34477()GG)G)G.57 7 7 7 c#&:": :;v;;"666()Ig)I)I.57 7 7 7"+c$ii"7#"=(2 77K *6"R%= 9 9M ,,$%OG%O%OV]^^^^ ..$%Qg%Q%QX_```` { *O(=8JA~~$%Yg%Y%Y`ghhhhEE X(((( X X X$%HW%H%HwWWWW X6 v;;??"#@AAA"1": ..v;;"$$"#@AAA&vad|44)&B-88%fRUm44%fRUm44$VBrE]33 *6"R%= 9 9 *6"R%= 9 9 *6"R%= 9 9 +F2b5M : : -fRUm < < ,VBrE] ; ; '* 4| C ..()PW)P)PW^____z) \ 779--DD \ \ \()L)L)LSZ[[[[\t99 ))()L)L)LSZ[[[[\277;#:;;<< i@WWW ,-PW-P-PW^ _ _ __ X \ \ \()L)L)LSZ[[[[\ 5= L ;;==DDL #{{7 3 3- L L L #{{8 4 4 > >{ K KL ||C22*5gtDD8Y ;dTWX d m6 d GGL ! ! ! !BGGL ! ! ! ! !gs" s" s" s" s" s" s" s" s" s" s" s" s" s" s"h CUGTTT L ɚ; ɚ; TJ J J J @J J K J `J J J SJ L L J `J J J J `J J J J `J ɚ; 6YA B X! B<<AX! *D+*X!+ E #X!.)FX! F77DX! K"!X!" LFX!R)(X!) S*X!3A T43X!4 U X!1VX!7W>X! WA X! Y!X88YY Y ɚ; K K K ZJ J `J K J `K @K `jK @K J J @J `K `L K L ɚ; # J PD ` J J J @ J J J J BA J D J /L J ɚ; J #$ABBB HIIIO ####### J J J#$ABBB HIIIJ $ % ;<<< ɚ; `J ɚ; 5 A* .A##A* *A. ɚ; J L ZJ J `J L ɚ; J J QA J ɚ; ɚ; PK ɚ; w MVJHh 9k4s1}} 1222 w 82 T GGK T T T !D!D!D7SSS S T v;;" 899 9 "1": & & !F7!F!FWUUU U"6"R%=11 #F2b5M22 9nz1 {" T GGK T T T !D!D!D7SSS S T779%% x==I % %677 7 &/8 8 8 8 8 8 8 8 8 8 8 8 8 8 84 1}}J)++ J J J HIIIJ :h $ $$ ɚ; TJ `=J I J J @J J `J J J J `J J `J I `J ɚ; M F A F A,,BF DF D99:F FFF# #F= ɚ; ZJ K K K `jK @K J L ɚ; I ` J PD J RA I I J `RA ɚ; rBw<<1 ɚ; I @I ɚ; I ɚ; ɚ; K -dHk J JE!J t|q( &' 1 1 2!%!;x!G!G*4::L' " .'9 $6+x> > > *$ 9 9 " k nT!B$Z 8 8,GG "42;//;>>+9X99; ; ;t =bcc # #D dJ ' ' NL8LLLMMM K ɚ; L iJ 6J L K iK L @K K PK ^K dK cK ɚ; `L jK L K @I ^K @K _K I I @K L \K @\K \K `L ɚ; XA `K K dK I I ɚ; ɚ; - ^^GU + +F ^^E5 ) )F M ɚ; fJ ɚ; ɚ; \A ɚ; K ɚ; & $V , ,F 68V$ ? ? ?? ɚ; iJ fJ ɚ; I `K ɚ; "L ^A ɚ; ɚ; \ ; a4 a3 D R a4 TQ B ɚ; I `J ɚ; `J @I ɚ; _A ɚ; ɚ; BCCyJ&&&&CRCyK% || %aL dD))+<<< j) , tt ɚ; L `=J `J J `I ɚ; AA A,+A, ɚ; UJ I @L I `L ɚ; cA 0aA ɚ; @I I ɚ; q 9 " " " " 9D2K% y111 tt ɚ; L `=J ɚ; < A A ɚ; UJ >J TJ @L ɚ; cA ɚ; L ɚ; | D( + +DL)9 S S% I&=#OT\8Xabcccc , H-I lG T\955DD 6'*4(HdSSDD" ' ' '#&LLLLLL' 'w55| lGG+ + + +% D ( S7 77C 8444, F !Bh!B!BRRR R ɚ; L L I J @ J @J 6J `=J KJ K K ɚ; * C8B B"B B" CC ɚ; LJ J L TJ `K UJ >J I L I @L ZJ ɚ; I eA I P%D `7J ɚ; .L ɚ; K ɚ; ɚ; PK ɚ; @K @K ɚ; k 9 8 8 8 E E E E E E E E & & & & ] + '"21226 [ tCyy " fO fO fO fO fO%3 fO fO fO^ d+ ud+ 5 5 5" " " >{ { {J/ : *(% (% (%\ & & &P T/* + + @ @ @ & 2 2 2 S S S S S ɚ; . @K `L @K @K `I L K \K L `J L `K @K VJ L ZJ UJ L .J J `J J @5K J LJ KJ LJ `UJ @J J J >J I I ^J \K I I I I @I @J ɚ; ! [J pjA ZJ YJ jA jA @"J "J /L iA iA !J J J J `J @I @I @I @I I I I I `I I ɚ; " $(G N ɚ; I ɚ; ɚ; `I ɚ; `I I `I ɚ; ) (,% """"" ɚ; L I ɚ; K ɚ; J # # # # # # # # # ɚ; ɚ; I I `I ɚ; " ɚ; ɚ; I I ɚ; 6 !%''/$eYII&IIC cNNNJ ɚ; I I I L PL ɚ; K I ɚ; !h// / ɚ; @I ɚ; I ɚ; PL I ɚ; I ɚ; I ɚ; %c844 4 ɚ; I ɚ; I ɚ; ?CN??S-=??d K K K K 6?#4#466T B B B B,5cNN *]J(; ( 5M55D A A A A ///d ; ; ; ; A*=AA M M M M Q2MQQ ɚ; PL `L I @I I I ɚ; `L I @I ɚ; I I 0~D I `I I I `I ɚ; C ɚ; I ɚ; I ɚ; # ɚ; PL ɚ; I ɚ; I ɚ; 0 0 0 5 5 5 5 5 5 ! ! ! ɚ; I I I I ɚ; I I I I I I `I `I `I D ɚ; 3- . . I $ $D"7<< $ $DCt,,Eu 4e<< $ d### $ |))++ e 50% 8 8 MM$ ' 2 2C J ɚ; PL `I I @}L ɚ; L L I ɚ; @I ɚ; III ɚ; I I ɚ; I I ɚ; I I @I I I @I I I ɚ; : 9 *# # # # #+ # # #(# # # # #< # # #( x ; 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 63 3 3 3 3 $ 3 3 3 3 00000000 G t# # #L G ɚ; A A+*A+ ɚ; I @AL `I AL I |L I I I I @I I I @I I I L I L I I I ɚ; I I I `I I I I I pA `I I 0A I I I I B ɚ; h }}S66< "NOO "4 "4 ( ( (%6D " ɚ; PL I I `I I L ɚ; ~K `I I I I ɚ; 0 6 *DN,GBtHH&& & ɚ; L ɚ; I ɚ; ɚ; X :: EI?C ! & & & & & ɚ; ɚ; I I pA `I I }D ɚ; " "! ɚ; I ɚ; * "! ɚ; I ɚ; F ," " " "&" " " " " " ɚ; ɚ; I I @I I ?C ɚ; ɚ; ɚ; I ɚ; I ɚ; I ɚ; q ɚ; @I ɚ; I ɚ; s " " " " ɚ; ɚ; `I I `I `I I I `I ?C A ɚ; # ##D&111 ɚ; `I ɚ; @I ɚ; ! &&& ɚ; `I ɚ; { a ɚ; kr ɚ; ɚ; " " " " " " " " ɚ; @I ɚ; I I I I I I @I ~I ?C A ɚ; ɚ; ɚ; zI ɚ; "! ɚ; L I @I ɚ; xI ɚ; wI ɚ; ɚ; x ɚ; sI A ɚ; qI ɚ; s " " " " ɚ; ɚ; I {I `yI wI vI rI pI ?C A ɚ; # ##D&111 ɚ; L ɚ; I ɚ; L I @I ɚ; @ {U" ! 0 0t{E J J899o ɚ; L I @I K `I I ɚ; lI ɚ; ! &&& ɚ; I ɚ; Q ɚ; Ah ɚ; L @8L ɚ; ɚ; ɚ; " " " ɚ; lI ɚ; oI @nI lI @kI iI @hI gI eI ?C A ɚ; , ɚ; `I ɚ; aI ɚ; 9 VT[99h $ ɚ; L @K K I ɚ; `I ɚ; _I ɚ; & 2774==!!!!! ɚ; ɚ; \I ɚ; ɚ; YI ɚ; G ((( Q;;6Q;; JJLLLLL ;;; ɚ; 2 " " " $* * * * H H H H H ɚ; \I ɚ; I _I `]I [I `XI VI TI SI RI PI ?C A ɚ; B $ !%!4!4!6!6 0 ɚ; L `I ɚ; `I KI KI @KI KI JI ɚ; LI ɚ; !! ɚ; L I ɚ; 8 ? # " 4 9 9$/ J JDO "DO 199 E zzt''500axx +**,, +**400?W,D )-T4;)G)G&,,% D#)$4dkBB +Hl $ / / / > >E5zz1}} % %}}}} #<== 1DO OOx 'OO ? @ 199_F " 4DOO _VeV,F "oeff 5DO ɚ; L K `AI AI @I K @I `@I K @I `I ɚ; # C D/ AD**D/ ɚ; JI @KI KI `I KI J @BI BI ɚ; BI A ɚ; @ ɚ; K `AI ɚ; AI ɚ; ? ?1%D"4?##q(( #'/!"4"& :66q9K:2%. 99X966D 7 tS)) 7dmmD.A.A 7 tU++704 e0D0D7DII1AI 6 66D DLDOOTO22E u::>> !8D a5zzA~~ b T_4 */*. +0(T_*D# B # > >q A $Qx "'("5"5u"5"E"Ea"H ?22&*&<&A&A%)&L&L&*o'6DO / + . 4+ > > ??E?::1=D$A ]. ^ ɚ; L K BI :I K @I 9I 9I ɚ; JI KI BI @KI L K :I ɚ; ;I A A :I A A ɚ; # yy{{x((( ɚ; L 1I BI K ɚ; BI ɚ; 2I ɚ; 0 ɚ; KI @KI KI JI ɚ; /I ɚ; - ((( ɚ; `I ɚ; `-I ɚ; $ }} K ɚ; L ɚ; +I ɚ; ɚ; N 2" " " "N N N N`I I I IV ) ) ) ) $* * * * H H H H H ɚ; L KI `2I ɚ; I II GI <I @4I 0I .I +I )I (I `'I @&I $I #I ?C A pA A ɚ; < fVV,, fVV,, ɚ; L `I I I ɚ; `I I I ɚ; I ɚ; { %%% ɚ; I ɚ; {##D))) ɚ; L K ɚ; I ɚ; {$$X... ɚ; L 1I ɚ; I `2I ɚ; DK ɚ; I ɚ; { &&& ɚ; L K ɚ; I ɚ; {%%d+++ ɚ; L vL ɚ; I \I ɚ; d ((( Q;;6Q;; K ;;; ɚ; `I I I ɚ; H $& & & &* * * */ / / /! ! ! ' ' ', , , $* * * * H H H H H ɚ; `2I \I ɚ; I !I I I @I I I I I I @I I I I ` I I I ?C ЁB D A ɚ; J * fVV,, fVV,, ɚ; L `I I I ɚ; `I I I ɚ; I ɚ; 6 { %% ![[t{ ; ;l ɚ; I ɚ; P <;''))DD;''--D ![[t{ ; ;l ɚ; L K K I ɚ; I ɚ; BI ɚ; C { !! ![[t{ ; ;l--- ɚ; L 1I K I ɚ; I BI ɚ; A ɚ; 2 DK ![[t{ ; ;l ɚ; L K I ɚ; I ɚ; `+I ɚ; 2 ![[t{ ; ;l{ &&& ɚ; L K @H ɚ; I ɚ; A xx~~ ![[t{ ; ;l{ &&& ɚ; L vL K @H ɚ; I ɚ; ɚ; 0 ɚ; I I ɚ; : ((( ((((( ɚ; L WI ɚ; I I ɚ; wt{D))) ɚ; L ɚ; `I ɚ; VI ɚ; ɚ; L L @}L SI ɚ; `I ɚ; ,t~/FFGGG ɚ; L QI ɚ; `L ɚ; QI ɚ; ɚ; ) M M ! 8 . . . . ' ' ' ' ' ' ) ) ) ) $* * * * H H H H H ɚ; H `H `2I \I ɚ; I I I I @ I `H H H H H @H H H H H @H H ?C ЁB D A ɚ; > $cz =4 3 3D h t'8$:KVTT ɚ; H `L *L H ɚ; 3A A2 ɚ; I I I I ɚ; @H H ɚ; j 2 % }%%I}%%I tY -y/? -y/Ev O OB %B$B I ɚ; `L H `H `H H H ɚ; I I I I H `H ɚ; H ɚ; I ɚ; H ɚ; ( "" ɚ; I ɚ; H ɚ; H ɚ; I `I H ɚ; `H ɚ; , X 1G(### N ɚ; @H ɚ; I I H ɚ; H ɚ; I I ɚ; H ɚ; ( (( ɚ; I I ɚ; H ɚ; .#H--f????G && LLL ^^B % %F ɚ; H L H I H ɚ; I ɚ; H ɚ; .#H--f????G && LLL ^^C & &F ɚ; H L @H I H ɚ; I ɚ; H ɚ; AAa ɚ; K @K ɚ; ɚ; H ɚ; H H ɚ; L A!!## !AvvAaDDAaDD H ɚ; H <L H @H ɚ; ɚ; `H ɚ; ɚ; K ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; , I I I I @I I I I @I I I I @I I I I @I I I `I I I I I I I `I I I `I I I I `I I I I I I I @I ɚ; E E E E +=C D DDE - - -0 $ # $ # # # =H #"C) II #"C) I & & & & & & & &>@" @" @" @" @" @" @" @"D& & & & & & & & P " " " " "!3 " " "D/ / / / / / / / b" " " " " !3 " " " VHH HH HH HH HH5 HH HH HHXxH xH xH xH xH5 xH xH xHxVH VH VH VH VH VH VH VHtsH sH sH sH sH sH sH sHn/ / / /b" " " "L# # ## # # ) ) )) ) ) $ ( . L**M L**M!\),,N +|,? @ @ *l+= > >% m44 MMN # " z SZG<<CJ CIw ::CIII ɚ; # )$)AE E'&E' ɚ; < L H L `H H I I @I @I I I @I H I I I I I I @I ~K I I @K `I I I oI I I I I I I `I I I `I I I I @H H @I `I I I I I I H H `H ɚ; : I D @I A @A A A A @A I I I I `I `I }I I oI I dI oI NI I @"I I ` I I H I K H `H H H H H H H H H H H H `H H H A A ?C ɚ; g } C(Q 8 8 8 I8IIII J JJ ɚ; ɚ; @L L H `L ɚ; H `H 05D H H ɚ; k!GGG ɚ; K H ɚ; H ɚ; n$GGG ɚ; K H ɚ; H ɚ; !)GGG ɚ; K `H ɚ; H ɚ; o%GGG ɚ; K @H ɚ; H ɚ; H ɚ; @H H `H K K QK @H H H @H H @QK H ɚ; H K H H K QK @H H H H @H H H `H H H H @H H @QK ɚ; ! !H8 P P P J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J K K K" #' " " " " "S[CK " " " "% % % % % % % %* * * * *S(& * * *& & & & & & & & & 6 ~~~ # #EE"""" & E *%%%%%% ())))) DD ɚ; +D DD ɚ; & H K I @H H `H K K QK @H H H @H H @QK H H H H H I H H H `H H @H H I H H L ɚ; `H @H A 0A H H H H B H H H H `H H A ɚ; ɚ; 5555 ɚ; ɚ; ɚ; w )C " " " "A##:f%-)))))) $ " ! ! ! 4 ɚ; H H @xK H ɚ; H `L ɚ; ɚ; H `H `L ɚ; ɚ; I @AL ɚ; H @H H ɚ; ɚ; # ) !![11 1 ɚ; @H `H `L ɚ; ɚ; [ I ^ [ $ L11 ɚ; I @AL H ɚ; @H H @H ɚ; @H ɚ; H ɚ; H H ɚ; ) ) !![&'7KK K ɚ; H `H `L ɚ; ɚ; I ^ ^ B B B [ ɚ; I @AL ɚ; H H `H H H }D ɚ; ɚ; H ɚ; # - !![11 1 ɚ; H `H `L ɚ; ɚ; [ I ^ [ $ L11 ɚ; I @AL H ɚ; H H H ɚ; ! ɚ; H ɚ; % - !![+>> > ɚ; H `H `L ɚ; ɚ; \ I! ! ^! [ ɚ; I @AL ɚ; H H `H H ɚ; , ZZ%%%%%%%%% ɚ; H ɚ; @H ɚ; ! ɚ; H ɚ; H ɚ; ? ;z #%%C >$$R((C ɚ; H ɚ; k O++m,, , , , , , , , MNN N 12 DD ɚ; 3 AA ɚ; H `H L H ɚ; H }H ɚ; 2 . !![+")8X? ? ? ɚ; @H `H `L ɚ; H H }H ɚ; I& & & ! ! ^! ^ O O O [ ɚ; I H H }H @AL ɚ; @H H H ~H {H @zH }D ɚ; H `H `L ɚ; ɚ; [ I ^ [ $ L11 ɚ; I @AL H ɚ; H wH vH ɚ; ɚ; tH ɚ; ɚ; # (??!!Z<< < ɚ; H `H `L ɚ; ɚ; \ I ^ [ ɚ; I @AL ɚ; H sH rH qH ɚ; ɚ; % * !!^Z@@ @ ɚ; H `H `L ɚ; ɚ; M I ^ [ ɚ; I @AL ɚ; H nH mH ɚ; yy ɚ; ɚ; kH ɚ; ɚ; +I ɚ; iH ɚ; ; ;z #%%C >$$R((C ɚ; L H H SI ɚ; @H ɚ; hH ɚ; T B JJ} % % % @AA A }- DD ɚ; + A A ɚ; `H L +I ɚ; `fH fH ɚ; 2 ) !!Z"('7< < < ɚ; @H `H `L ɚ; ɚ; I ^ ^ B B B [ ɚ; I @AL ɚ; @H jH hH fH dH cH }D ɚ; q ɚ; ! %<<!!Y// / ɚ; H `H `L ɚ; ɚ; M I ^ [ ɚ; I @AL ɚ; H `H _H ɚ; L K ɚ; # ) !!^44 4 ɚ; H `H `L ɚ; ɚ; [ I ^ [ $ L11 ɚ; I @AL H ɚ; H `]H \H ɚ; ' * !!i^LL L ɚ; H `H `L ɚ; ɚ; 2 I [ ɚ; @AL ɚ; H YH ɚ; 4'' JCIINNHJ J J fudm , , H&V&X&&DD '' H G>D G G H H HwwsFD111 ɚ; PL @L L UH TH ɚ; ~K `L vL UH K ɚ; VH VH ɚ; J J J! 1 J J J ɚ; K `QH ɚ; RH ɚ; t} " "~dmA6F'G'G "77##%% %4YY J Jt}SbS7I J J JKK4 4 dmB /004 4 4 5 ɚ; L ɚ; UH K RH ɚ; `RH `PH PH OH ɚ; T }D Q>$q'#:#:SbS ??DH,D$x&666 ɚ; UH vL @XH @H ɚ; ɚ; $&& 7D # $ $ ) )"4#6q#9:: * *!/Q!8!8 * 7D77&&t,,5 (1+t}55 * |H crc]F )H$XuX??? ɚ; ɚ; L `J KH TH UH ɚ; ~K UH K vL @XH @H ɚ; ɚ; I 2 2 2 2 25 5 5 5 57 7 7 @ @ @ @ @ @ @ @ @ ɚ; ɚ; ɚ; @XH WH RH MH KH `HH ɚ; * -U-Utcld.B-U-U-U-U-U-U ɚ; K ɚ; ɚ; `FH FH ɚ; i ht#t t s))C 5E >X % U#-U-U-U-Uu-U-U-U*U*UU ɚ; CH ɚ; DH vL L `J ɚ; FH /B EH `DH ɚ; #|$$ Cyy#t 6 >Z ' '# #.553#3555 hu#|$$ | 99 ɚ; ɚ; H AH L DH @H ɚ; AH @AH ɚ; u ɚ; L L L ɚ; ! (??!!Z00 0 ɚ; PL H ɚ; @H `H `L ɚ; ɚ; \ I ^ [ $ $9:: ɚ; I @AL @XH ɚ; @H =H `<H ɚ; a %%% "! ! t99s5zz ! !5 D5 uu !t ɚ; B %%% "! !4yy3u::%<$++e*<*<< ɚ; H `L ɚ; a %%% "! ! t99s5zz ! !5 D4 uu t ɚ; L L 9H ɚ; H `L ɚ; ɚ; B %%% "! !4yyCJJ&=4;;u+=+== ɚ; H `L ɚ; s2ww ɚ; @0H ɚ; ' "M"MUu}}5}}}}"M"M ɚ; D %** "! !"""M"M"M"Me"M"M"MMMM ɚ; @-H ɚ; + E}} uu t ɚ; L L @}L ɚ; @+H ɚ; / 55q155a5555555 ɚ; K K @)H ɚ; E %** "! !55T5M555""5))) ɚ; L L 'H ɚ; H `L 0H ɚ; `(H ɚ; 9 #: #:U&+5&8&8 $)&8&8&8&8#: #: ɚ; K @}L L ɚ; } %%% / eX.. &%%''..E"" #: #: #: #:d #: #: #: : : : ɚ; `%H ɚ; 9 #9 #9U&+4&7&7 $)&7&7&7&7#9 #9 ɚ; K @}L L ɚ; } %%% / eX.. &%%''..E"" #9 #9 #9 #9e #9 #9 #9 9 9 9 ɚ; @"H ɚ; R %%% / eX.. &%%''..Eu .. ɚ; H H `L 0H ɚ; 8# ɚ; 6 ɚ; ɚ; 4? ɚ; M[ ɚ; M2 ɚ; k3w{ II !a% T AaB "b/H,; ;A IAA a2g!r' "" I ! T s77 MA 77A ɚ; L `H H H H K `H ɚ; L H `K ɚ; ` H `CB @CB CB CB BB BB ɚ; I = = = = = = > > > [N N N H * * * G: : :9 9 9/ / / H ɚ; @AL 0H +H H ɚ; H 9H 7H 6H 4H 2H @1H .H +H )H &H #H ` H H H ɚ; @H ɚ; H ɚ; 1 5// ! U ɚ; @L `H ɚ; H ɚ; Y $ZZ %HHEE % % % $ % U ɚ; ! 4 ɚ; +I @L `H ɚ; `H ɚ; @ DD ɚ; eL @L ɚ; @ H ɚ; ' E HHUOOOO ɚ; ɚ; / Ri E LL ɚ; `H ɚ; :: JJLLLL b#&& -((,, $ $D==LL''''HHUOOOO ɚ; H 0H `H ɚ; C :: JJLLLL $ $ U#### ɚ; L `/H @}L ɚ; `H ɚ; I" " ^" " " ^" ɚ; I `H `H eL ɚ; H H H H H H H ` H H H @H ɚ; 5 9 NNN ɚ; ɚ; @H ɚ; ; II 4 55 ɚ; ɚ; ~~ ɚ; H ɚ; G ɚ; ɚ; @H ɚ; G ɚ; $ ɚ; H ɚ; G ɚ; E %)) "! !DJJLL!!T%++--%8%888 ɚ; @H `L G ɚ; I O ^ 9 9 9 LLL ɚ; I ɚ; @H H H H G G `G G G D ɚ; ɚ; L G ɚ; 4=!!! ɚ; `G ɚ; 7>>tDDD ɚ; `L ɚ; G ɚ; W I " " "E E E $ L11 ɚ; @AL H ɚ; H bB G G G ɚ; dm## ɚ; & = ɚ; P I [$ $ $! ! ! ! ! ɚ; H G @G G ɚ; 2ww ɚ; PL `/H ɚ; L ɚ; U U , c"A :+e + 55 ɚ; L `J @K @}L @H ɚ; ,, ɚ; `G @L ɚ; ɚ; < = , ,C c*+ + + + + , , ɚ; P I [, , ,, , , , , ɚ; @AL 0H ɚ; @H G @G G ɚ; A = C c"AEzzQ%ZZtt (u ɚ; L @}L @K @H ɚ; 7 = % %C-$ $ $ $ $ % % ɚ; `G ɚ; 7 I % % % % % ɚ; ɚ; H `G G ɚ; ɚ; L @K ɚ; T IE S L $-''NNN ɚ; L @K @}L ɚ; (( ɚ; @L @G ɚ; G ɚ; Y %tDzz""CC % % % $ %S IEz ɚ; 2 ɚ; +I @L ɚ; G ɚ; @ DD ɚ; G @L ɚ; G ɚ; eW % % " ' ' !#JS ' UF # # " zz|| ' ' !#JS ' $ " " U !S **,, JC DII ɚ; L L L @K @}L ɚ; @H L ɚ; G ɚ; > 9 DIII ɚ; L @K ɚ; ɚ; @L ɚ; G ɚ; ɚ; I ^ ^ vxxH ' $ ɚ; I @K @G eL G @L G ɚ; H G G G G G @G G `G 0lB D ɚ; Y GQ FF ɚ; L @K @H ɚ; '' ɚ; ɚ; 3 AEzzQ%ZZtt (u ɚ; L @}L @H ɚ; D %D **++ Aq'MMMM ɚ; L @K ɚ; G ɚ; D E)1--E q CII D la$hh G EzzQ%ZZ FA la$hh ɚ; L @}L @BI G @K @H ɚ; A A$#A$ ɚ; K I L ɚ; @G ɚ; / ??a5jjAJJ1JJJJ?? ɚ; K @H @}L ɚ; ɚ; & ????d?????? ɚ; ` ɚ; G ɚ; `G G ɚ; ɚ; I O ^ .@ @ @ @ @ ɚ; I `J L ɚ; H `G G G @G `G G G vB ɚ; III ɚ; ɚ; @H G ɚ; ɚ; L `J ɚ; ɚ; L `J @}L ɚ; I ɚ; G ɚ; " CIIu%%%%% ɚ; 9L ɚ; `G ɚ; @ DD ɚ; && ɚ; eL I ɚ; G ɚ; ^ IIq!t 8 8A#'!A;Q DGT!A#a%[[ 8 8 ɚ; L H @K ɚ; G ɚ; G ɚ; @ T>>&\\F A KKNNNN ɚ; L @H ɚ; vL ɚ; G ɚ; K K ɚ; L `J @H ɚ; G ɚ; E"" # # # ɚ; `J ɚ; G ɚ; F ɚ; L ɚ; ɚ; ɚ; I ^ ^ ^& & & 8 8 8 $ $ $ ɚ; I 9L `G eL `H ɚ; H G G G G G G G G G `G G ЁB ɚ; ɚ; ɚ; @H H H H @H H H H @H H H H @H H H H @H H H H @H H H H @H ɚ; I I ɚ; % ( ' ' ' ' ' ' ' tDI tCyy tBxx dd3ii T$$yy{{++,, 4RWWYY(( T$$ryy{{++,, Dbhhjj))** TT"XX tDD" . .// dd5588nn%%T$$uuQ$Y / /0011 tDDKK tDDHH~~ dd2hh tDDKK DOO d299;; T"((** tDM"" D///$$ % % DKK cee$s)) 2 2 2 2 2' 2 2 2 2"& & & & & & & & R 9 2 2 2 2 2g 2 2 2 2" M &- - - - - ] - - - ` ( ( (2 2 2 2 2 2 2 2 2$ x & . ! ! ! $ % % % " # # # $ % % % # $ $ $ - & ' ' ' . ! ! ! $ % % % , , . ! ! ! , - - - - - - - - ` 9 g 2 2 2 2 2' 2 2 2 2" ) ;@ ;@ ;@ ;@ ;@L ;@ ;@ ;@z V V V &; ; ; ; ; ; ; ; ;(G G G G G* G G GT Y M M M M M M M M` C 1 1 1 1 1j 1 1 1f 2 2 2 2 2% 2 2 2 ! ! ! ! !{C ! ! ! ) , , , , , S , , ,, : % % % % %j % % % K O O O O OW O O Od =@ =@ =@ =@ =@z: =@ =@ =@~ % # % * E I ? ? ? ? ?h ? ? ?D # # # # # ɚ; S I I I L L vL K H G @H @H @G XK G G G G G G G G G L @G G G G @G G G G @G G H G H G `H H @H H I H H @H H H H @H H H H @XH UH RH @H H I H @H H H @H H H G H ~K L K @H :I H ɚ; H H B H B H B H H H `H H H B H @H `H H H H H H yH @H `uH H pH H lH H aH @H ^H H ZH H XH H `GH @XH `BH >H @;H @H @H H H H G @H G H G H G @H G H G H `G H G @H G H ɚ; ɚ; L G ɚ; +/999dhhh?? ɚ; G ɚ; G `G G ɚ; 8 IOO D ɚ; L ɚ; ! % ɚ; L G ɚ; I @ @ @ ɚ; ɚ; G G G G D ɚ; N 3 3 3 #,1 3 3 ( GLLh 7 7 3 3 3 3 ɚ; ɚ; K G SJ `G ɚ; ɚ; X 3 3 3 3 3'+ 3 3 3 ɚ; ` @ ɚ; L K SJ G `G ɚ; `G G G G G ɚ; @G ɚ; < F ( H (W555 % 7799D% % % % % % % % % % % % % % % ;Dzz$'' T\** ɚ; L K J ɚ; 3 AA AA AA A A"!A" ɚ; G G K G G G ɚ; PC G ɚ; N t| - -99T\** *64;.:JK K ɚ; @G G G G ɚ; G G ɚ; `G ɚ; C vv '=>> + +A$,q/****+ $-'k --C)++ " k #::E ɚ; L G @K @K ɚ; 5A? ? B B ɚ; @G G G `L G I I ɚ; G B `G ɚ; ɚ; i . . H3 3 3 3+ + + L L L ɚ; G @G ɚ; G @G `G G G G B ɚ; 8 8 ɚ; G ɚ; " uz4(4((( ɚ; L L L @G ɚ; @G G ɚ; < 8 8 8) ) ) ) ) ɚ; ɚ; G G G G ɚ; f 8 8 8 8 8v 8 8 8v) ) ) ) )f ) ) ) ) ) ɚ; L @K G G G ɚ; G G G G G G G ɚ; B Z uu 4 ɚ; `G K K L ɚ; G ɚ; O WT]] Z uu < # ## ɚ; `G K K L G K ɚ; G ɚ; O WQZZ Z uu < # ## ɚ; K K ɚ; `G K K L G K ɚ; G ɚ; 78 $$ ɚ; `G K J ɚ; ~G ɚ; `G K J ɚ; }G ɚ; `G K `{G ɚ; {G ɚ; 78 %% ɚ; ɚ; `G K yG ɚ; yG ɚ; RR adT5M * * % #bi## $ $ QB QB" 1 1::bqb6MMM I ɚ; <L `wG wG @K @I ɚ; vL ~K `K `G @K wG K wG ɚ; xG ɚ; $ I " # I "$ ɚ; `wG wG ɚ; `tG tG ɚ; tG ɚ; . B B B ɚ; qG qG `wG wG ɚ; `G K @G ɚ; rG ɚ; , # B # B B ɚ; @oG oG `wG wG ɚ; `G oG @G ɚ; oG ɚ; wws||H .ggfoo x--wwvH( 1 h&& }Q./699(|Qxyy\11 Q M h&& ae8O ɚ; K -L `lG lG kG kG `kG kG ɚ; `K K ɚ; lG ɚ; FX [ [ a [FF 5 ! ! [HHx P P78{7K P P Q QVZ [ T( THIItST T T T ɚ; gG L `gG gG K ɚ; L :I `L ɚ; hG @hG ɚ; G G @G G G G @G G G G @G ɚ; $ $ $$ $ $% % % & & & & & & & & & $$ $ $ . T T T T T ɚ; `G K G G @G G G @G G G @G G G lG gG ɚ; G B @G @G G }G |G `zG xG uG sG @pG mG iG eG ɚ; $ vu ɚ; B @^G ɚ; IaLL H a 8022H#455==c4HHA 5 /4 4A88H&788 8!"8"2"#))C"6"68 8 8 ɚ; K ɚ; `G @K :I L ZG `ZG ZG YG ɚ; @[G [G /L 0L ɚ; x IaLL a J;r{1~~ 5 5c4 @ @ F F H HII Iyyd##))+++ ɚ; `G @K :I WG VG K ɚ; @[G /L 0L ɚ; :\ ɚ; ! A!U "1" fc""A ||C ALLA 6 6 t 5 ɚ; K -L `lG SG ɚ; `G @K :I L ɚ; `TG @B 0L /L TG ɚ; \/ ɚ; 9T??D$ !HsNN$.t$4$4! kRY&& / /A (mmOGV '&)t++ +, +#*L $ 'W 4 4==??l&8&8&:&:::#*L"(K & 0{2d : : )C / %.KK 4KN$ 6 6 7 )"## .% 7 7 #% 3 3k)) ~| 4 $VT:E:::: ɚ; `QG -L QG PG PG `PG K PG OG ɚ; CD D ,E ɚ; `G @K :I bG `K K `L `L QG QG gG ɚ; B 0L @^G K ɚ; d & ! A 1vv{{ a (CFE(JJCFE'J &#&& 1:q rr **j88AAaEJJsE**E{{!BQB%xZZUQY//F||!BQB%xWfW:qz) ) 1: RaR5!ABB%< RaR5!8O ɚ; K -L `lG PG HG @HG @BI `J HG ɚ; `G @K :I IG HG ɚ; IG B 0L /L K @IG ɚ; ! A D a==DAq AA !A#d"" Q !A#d""2A2!""$D ;;t $D t8T> ɚ; K QG I @K @K K ɚ; `G @K ]G bG K ɚ; DG ɚ; O ! A!U 8$QtT:::$Qc3777 ɚ; 0L /L ɚ; @@G ɚ; 88A; ɚ; >G ɚ; Q Xd^^ Z 0 uu < # ## ɚ; @=G ɚ; B Xd^^ Z uu 4 ɚ; 9T??D D 4==DD!!JD$ ,Q4+ddl+ t KK d # # * *4 0 0zz||qzz||++u ɚ; QG `K K K 8G ɚ; `G @K ]G `G bG `9G K K ɚ; 8G ɚ; 9T??D$ ??5 ! ! c$iiqA a%%DG=#6#666 Q a%%DG=#6#666 "":m, 2: % % J{+EE EEE rz* 566Avv1Q3i k5 ) ) 3 +k22Kz~~j11 , & & x 1 111 GH - -{;;H$ );x(( d122h ɚ; 4G @K H 3G 3G `3G 3G ɚ; C C*)C* ɚ; `G @K :I L ]G K @L VG TJ KK WG ɚ; 5G `5G 5G 4G 4G `4G ɚ; $ 9T??D$ t D 0 0K - =DgNN"j$// d??s$K '&-7$>* rr(C E$iiG '// uQw :: #D$iiG $ 1 q4 +++ $ $ $q4x ! $ '\\EAIeai'(G33q E!GHH~ d))! JJw / /E vv,C8"?$&K 2;s;K;K0L$M$MEE$+CLE# 8 8 8 '# 785LCC " ( ( (7T>)C #aKEEE( &[[EAIeai'(F22q eai )*e33E!GHH~ d))! JJv . .E vv,C>"?$&K 2;s;K;K0L$M$MEE$+CLE# > > > & 4v =>5LCC " ( ( (6E>D00C #aKEEE( 2A2h uqy ) .AMM1HCQJE U519_-A .AMM) " BJr{37G7G,H I I ' ) ) ) "SLEEE)u QJE 1HC W '//X J ɚ; ɚ; ,G ,G +G +G `+G +G *G K *G `J `*G @I *G @}L ɚ; o (D+ +EE H ,AG. .HH H('H(L #AK% %K=<K=L#"L#&AN( (N:9N: ɚ; `G @K :I ,G ,G `,G K `J L WG VG @L ɚ; .G -G J -G `-G -G ɚ; y dE " " CFFFFCFFF||FC((!$'' ??3 $ cMF;;s##D 3 #e**nn8 uQx6 1 1!HHqV##q55U1Q3Z6 1 1 ac!A#gFAA!VV 4 4V aFAAQ #e**nn !e ! LL '' ɚ; -L `lG `G ``G TJ G @K ɚ; `G @K :I bG L `K G K ɚ; G 3C 0L /L `dG ɚ; b 9T??D ;; dE " " *,,CC)++CC D>> ɚ; G ɚ; O +#HTNN33 3$ + + +$T** * * * + ɚ; A A ɚ; G aG K L G ɚ; G ɚ; ) ɚ; ( ɚ; & ɚ; B B B ɚ; LuutnnD(( HHXd^^ $ $ $ #D)) T{{ C "(++ ' #D):):D$A$ABBD ;"222EEEE ' tnnD((, ɚ; G @L G G ɚ; * 1B" 7*B" " C , B;:B;; C C ɚ; L `cG G cG `bG aG KK K G L ɚ; PB ɚ; ɚ; ɚ; B B ɚ; Z $ X BQBx : :(..+/9tD$'''T9 : : :;&666 .d 3 3H 4''7; ItHd 3 3 3IIIIII ( D #4[[ d ' ' $;&&&&&&+/9tD$'''T' : :0 ɚ; G K G G ɚ; J "3 C C (A70C6C 7 BC B C !C'C C ɚ; G K G G G ɚ; B ɚ; \\.\NUL ɚ; \\ ɚ; \\?\UNC\ ɚ; \\?\ ɚ; h ~~ dE " " $ F(J $N*,,C~~"+g*>*>!?!???$} @ F'J #N)++C~~'!2!222#|__V,, #%++ #T??D 5$T**D " " " 1 c"gg&&D0D>>DDDDDD 5 5 5 !{ .t44DDDDDD 5 !doof 5 5 ! z** +&c*oo.>.>)?? S[[\\* !$U++t33 D ! ! ! ;"222 D ! ɚ; TJ HG ` G G G G G G ɚ; B /D E. .D>> E. E))E.G& & H5 H HH ɚ; aG :I `G @G `cG WG _G K L cG G L K L G G ɚ; `B B B B G @IG K G ɚ; <<<A!<a<<< ɚ; :::1:Q::: ɚ; 9T??D$ } .,--- Ie EHUOO,, 8D>>**",Y"7"7 Z *8 4 4 I K HZ$8$8 8 8 * KK ) * * * =<!1!1#!6!6<<< :: 4 4::: *i00 FB||x||++ FAA8s:q 01IabbMA MX z><AS T $Ye<<< ɚ; @BI -L `G ``G @G G G G @G G G G @K @G G G ɚ; !D2F F ;G ɚ; `G @K :I L `G aG bG `cG G G `L `L QG L QG gG ɚ; G 3C 0L `dG `G G G `G G ^G ɚ; ; QQQaz!))FC"8"8">">"@"@AAQQQ ɚ; K K `lG -L ɚ; bG K ɚ; ' <<<1qwws||<<< ɚ; 3 >>$!Q2A2# >>>>>> ɚ; K I K -L ɚ; & --A1------ ɚ; K I K ɚ; # 999q9Q&[[![[[ ɚ; F ɚ; w B@AAA #bi'' ( (E%(E"" !QQQQQ5QQQ <<<< <<< P>>>>+>>>>>FEE P P P DEE4 O P s------- . .! 3 3 >?? ? q!1!1&#!>!>?? tC 9999V999PPPPKPPP bMM & &DAqBqEzz HSWWH%F %05(((( ~ & $\:E:::: ɚ; @@@ ɚ; `QG `F F cG 3G F `wG wG @K @I TJ `lG `G -L ɚ; % % G B! G !B<<DG %G= ɚ; L ~K `K `G @K :I L bG G wG K wG `L `L QG gG ɚ; F `F 0L /L F F `F F F F F F ^G ɚ; F ɚ; G @G ɚ; G ɚ; `9G ɚ; \G \G [G ɚ; & `cG cG bG G bG TJ KK G G G @G G `bG G bG @G G aG aG `aG aG `G `G ``G -L `G _G `lG lG _G `_G _G ^G G G @G ^G ɚ; A A A !,- - - - - - - - - - 8 8 8 8$ , , ,, , , , , ,$ () ) )^. . .l .8 8 8 (0 $ $ $ $ %%%%%%% :- - - zj j j`3+!!!!!!Z+ + + +W (( (( (('( '( '( '( '(((f " +###### + + + + GGG ]>>>>>>>> ( ( (T/ / /b "' < < < < < < HHH~ &gc+> ? ? > 3c 3 5 5a 8A = + + + +p1 1 1h #""""""" DD ɚ; i = AA8A? ?B B B B+*B+2B< <CC C C)(C)D! !D*)D* ɚ; 9 `G ``G lG -L `G `lG _G _G `G L K QG ]G F \G `ZG \G ZG [G YG `cG L cG bG G bG lG TJ KK `bG bG @`J `9G aG aG `aG `!G aG G G `G G @G G G G `_G L G _G ^G ^G F @G ɚ; 0 dG `dG 0L dG /L cG cG D C \G C @WG TG RG LG DG BG @G @?G =G `;G 9G C 6G .G !G ?C @ G `G G P C G C G G ?C G G @F F B D ɚ; $ ts ɚ; :I ɚ; /L ɚ; 9Q<< ɚ; K ɚ; F ɚ; , ! A 1++C << ɚ; K -L ɚ; `G @K `F L ɚ; `TG ɚ; ! A 1++C D !HsNNRY"" A||C T]]3 / / a ~| 4 $VQ33333 K ɚ; `QH K -L H ɚ; A)B ,B= ɚ; `G @K `F `K L K `L `L QG QG gG ɚ; F ɚ; ! A 1++C qA2A2!""$D CII %%{{3 : ɚ; K -L @K @K K ɚ; F ɚ; N ! A!U Cv 6 66 ɚ; K -L lG ɚ; `G @K :I QG lG ɚ; /L ɚ; " ! A RaR5!8O ɚ; K ɚ; `G @K ɚ; F ɚ; ; ! A 1++C qA QRR5L ɚ; K -L @K ɚ; `G @K `F `K ɚ; @@G ɚ; m ! A 1++C qA RaR5D CII %%{{3 K ɚ; K -L @K @K ɚ; `G @K `F `K K ɚ; >G ɚ; Q Xd^^ Z 0 uu < # ## ɚ; K ɚ; 22 ɚ; `G =G K L `L K <G K ɚ; `F ɚ; B Z uu 4 ɚ; ,, ɚ; `G =G K L ɚ; :G ɚ; ' Xd^^ < # # 5 Z uu 9T??D$ "dE""dD!! f F Xf Z uu 9D 9D t||t 9D 9D t||t 5 ɚ; `wG wG @F F F F ɚ; ! 2 AA$B9 9C C ɚ; `G =G K <G K K L @K :I `_G tG `tG ɚ; F 3C `dG ɚ; 3 9T??D$ ??5 ! ! 4..C #qA1uu IIAvv # # << 44; z&)HH JJJJ KKK AaCy dE " " &tW%%D LL&&EE KKK <CLI 5 5 $ ;x((t$$H tABBx (D( ɚ; 4G -L @K @F 3G F `K ɚ; H B B)(B)-+C C('C(?D DDE E+*E+ ɚ; `G @K :I L `F HG K @F L F F F @L L @F L `.L WG K ɚ; @F `5G F F F /L ɚ; \$(\w+|\{[^}]*\}) ɚ; 9T??D$ t K D III #8"(CCI!"j$// d??K B IIIzz"6AAH * A F4OO vvayy1wwqzz ??5 ! ! dmmC&8&8 ":D BJr{4/@/@$ABB 8D8e#DD A DLDD AAA ( K ɚ; ɚ; F xL @BI F K @K <L F @}L K ɚ; 9AF& & F54F5 ɚ; `G @K :I @F F `K F xL F K F @F L K WG VG @L ɚ; F `"C -G `-G F ɚ; \ y dE " " J;~bk$.?.? @ @AAIT I d##*s* ɚ; `G @K :I WG `!G VG ɚ; G ɚ; h y dE " " CECFFCECF 5==J //#.. OOCE " " +/??3q5+A+A O 3 Ds|##y )" 7 7 &&&& xx .&-D{s ɚ; -L F J `F F G F F ɚ; `G @K :I L G eL ɚ; G 3C /L `dG ɚ; ` 9T??D ;; dE " " *,,CC)++CC D>> ɚ; G ɚ; `G @K cG :I @G K aG ɚ; @F ɚ; > y""H Xbqb\8VR@@HD" 4== ɚ; `F ɚ; `G @K F `G ɚ; F ɚ; $ T{{ ABBx , s++ a tv~~ 6>> "4[[ d6>> ff55D tT"" /'""B l2:..GG GGG D d??=D 2 GT**E11 W r{7';';VTJJb +d##U* * W Y , \ : ɚ; K @L -L `G ``G F K F `F ɚ; )C C)(C) ɚ; :I cG K G `G =G K <G K K F @G ɚ; 3C /L `dG ɚ; @@@Aa@a@@@ ɚ; >>>1A>Q>>> ɚ; K K ɚ; .. ɚ; Z .,--- 9T??D$ } % @@ !5!5c!:!:@@@ >> 3 3C 8 8>>> j) 455 6 68s:q 01IabbMA MX ~|5G H $Ye<<< ɚ; @BI `G -L ``G G G @K G ɚ; "BD =D 5D; ɚ; L `G @K :I `G G G `L `L QG L QG gG ɚ; G `G 3C /L `dG F F ^G ɚ; # 9994tzz#999 ɚ; K -L ɚ; G ɚ; / 55!2A2# 555555 ɚ; K K -L ɚ; ɚ; # :::a:a6kkkkk ɚ; K @I `G ɚ; . PPPq::::1:::PPP ɚ; ɚ; K K `G ɚ; F ɚ; B@AAA #bi'' ( (E%(E"" 99995999 P5555u55555FEE P P P DEE4 O P QPPPKPPP bMM DAqBqEzzBQB *3rr7(((( ~ & $\:E:::: ɚ; @@ ɚ; `QG F cG `wG wG F @K @I TJ `G -L ɚ; % D, / B D, B((BD, ,%E ɚ; L ~K `K `G @K :I L wG K wG `L `L QG gG ɚ; F `F /L F F F F ^G ɚ; ɚ; `!G ɚ; & `cG cG bG G bG TJ KK G G G @G G `bG G bG @G G aG aG `aG aG `G G G @G `G ``G -L `G _G `lG lG _G `_G _G ^G ^G ɚ; L : "7 7 7 (0 $ $ $ V6) 6) 6)z . . .j0+$$$$$$T+ + + +Q % % %$ $ $ $ $%` "' < < <~ "lh 6 ! ! ! !R# # # # # ɚ; +A5 5B ?B ɚ; * `G ``G lG -L `G _G `lG _G `G L K QG `F `cG cG G bG lG bG TJ KK `bG bG aG aG F @F `aG `J `!G aG L `G `_G F `.L _G ^G ^G ɚ; % F `dG /L K @F F D @C `F F F @F F `F F F F F F F F F ?C F F F ?C F F K F F D ɚ; 799 ɚ; K ɚ; ! 666a!A$#+++++ ɚ; K H ɚ; ɚ; R 7FN### 7 7 7663v;;6666667 ɚ; L ɚ; #<< ɚ; vL `L G ɚ; F ɚ; > (NN!7!7 HHXb\ " " " " " N!7!7 ɚ; L yJ ɚ; `F F F ɚ; `F ɚ; & D!!JD$ &Z%% d T[ . . TH - - - - - D dE " " *))D 4<< F dD tz$ / / ɚ; `F @K K F ɚ; $ A A)(A)&B8 8!C C ɚ; G G F J `G :I `J K @G ɚ; F KC F ɚ; $KKKD!!JD$ &Z%% d &4 & $KKKK EE Z%% d &4 & & & & & & & & & ɚ; @K K ɚ; A A#"A# ɚ; F G K ɚ; F ɚ; C JD$ T[ . . 3C JD$ t DD ɚ; L L @K K ɚ; +A< < B B ɚ; G G F F @F K ɚ; F ɚ; 7 x Iigw <<< gw < << ɚ; vF uF uF ɚ; L vF vF @K ɚ; `wF wF ɚ; ` DGI S\\ GENNN (1 (1' 1 , ,EE$ E &GENNN(1 (1 (1 (1 (1 (1 (1 (1 + EJ''''uz*** 1v 1 / $II+%*%5%5%7%7 " + + + &+ + %/I 1 $$UZ000O' 1 (1 (1 (1 (1 (1 (1 (1 (1 (1 (1 (1 (1 (1 (1 (1V !4 {DI J JGtC))H J&&"2"2 J 7G[IIIIIIIII J J " F FH XwEE E E E E E E E E4 ɚ; ɚ; vF uF uF G sF `sF sF rF J tF rF sF `bG KK G ɚ; < 7<EAA& A" A& E!A""A&%E& B0 B=EBEB,+E, B;8E:B;;AE?DE D# E"D##$EEE ɚ; F K +I tF sF `bG vF ɚ; B *c7G_fMMMSkk F3fEEEGS(Z/??? EBJw$?$? E$(M'4;;$G$G E!%je.D.D")7O E E E E E E E E E %LLLLLE%LLLL ɚ; vF uF mF mF fF fF ɚ; A*C C+ ɚ; L vF @K K gF gF K G K @G `gF :I ɚ; `hF hF pC ]C ɚ; mF ɚ; mF ɚ; mF mF ɚ; U^^ !<_<$$" E:D & ~~ <<>> )KK%%% * u---NN4((( '')) - t,,, D 04%/ / / / #ODDT71C1C D & D D"&tE5"Q"Q"Q & 2 2 2&* e"'**U*"C"C T8j#8GGG &GCLLL " IdmGT%[[&I&I I "i 6 6G %eWg&-w I I I I I I I I I e e 04%/ / / / / / 0 0 ɚ; ɚ; fF cF cF vF uF mF sF G sF @cF J fF cF bF J ɚ; \ AB C )CC CCCCC>AE E5 E00E59AG G- ɚ; F WG tF K sF G K gF gF @G `gF ɚ; ]C P]C ]C ɚ; $ ɚ; ]F ɚ; @]F ɚ; - r(C 4crcC ɚ; `F ɚ; [F ɚ; 4 ɚ; XF ɚ; XF ɚ; - r(C D$ss)S!!!!! ɚ; VF ɚ; `VF ɚ; T4 ɚ; `L L ɚ; SF ɚ; T4 ɚ; `L L ZF ɚ; SF ɚ; QF ɚ; = + ' |D $!!!!!I c""I t||~~),, 9S$'' Ih ) ) ) ) ) )!#56 HHHHHH H N ɚ; `L L ZF PF @PF PF G G L @)H OF ɚ; $ B##C4B;; CCC ɚ; `F ]F K KK F WG `K `J wJ K ɚ; @`J ɚ; PATH ɚ; y OOO { " " 0 0 h 555 II III " 0 ' \ ($DF F F & i( $Iu)E)E$ $Y / / )0 0 0 0 0 0 0 0 0 0 0 0 0 0 0, ??7 # ## ɚ; ZF G @JF ɚ; X CAC A$!C#A$$ C/B 7C B C B )CCC ɚ; K KF JF QG `L JF L @L :I VG _G G `G ɚ; LF KF kC `KF ɚ; + ""&& ɚ; L K GF FF FF @FF ɚ; GF FF FF @FF FF ɚ; ` *Jt~~c 2 23EE * * *3--T ) * &&& ɚ; # > ɚ; FF GF @L @FF ɚ; E nnS!! ''sE 3 ɚ; GF FF `BF FF ɚ; _ ^^C(( * :&&& * * *3--T ) * ɚ; L @K ?F ɚ; 0 A ɚ; GF `@F FF @L ɚ; I DJ & &C..%% % % % % & & ɚ; L @K ɚ; vL FF FF ɚ; 4: ɚ; FF ɚ; c $ $ U ~~c"" C C(8(8(?(? C C$ $ $ $ $ $ ɚ; K @K @}L L ɚ; FF @FF ɚ; lK ɚ; ] )) $ $ $ $ "j . . 0 0$ $ $ 1O0000 ɚ; L 8F ɚ; FF ɚ; 9F 9F @9F ɚ; Dzz ɚ; G ɚ; d?? DICy ɚ; L @K @}L ɚ; E ɚ; L L ɚ; @L ɚ; < %)) "! !4jj 5 ɚ; < %)) "! !5kk 4 ɚ; L L L ɚ; @H `L G @L ɚ; ' ' ' * * *& & & 1 1 1 ɚ; G ɚ; @GF DF BF @F `>F <F `;F `7F @6F 5F 3F 2F 0F ɚ; 7 eS)) O 6e9M MNNNL ɚ; L `L L ɚ; /F ɚ; 6#;;$$&& & ɚ; @K ɚ; IG ɚ; H eS)) O 6e9M MNNN<<*;<< < ɚ; L `L L ɚ; /F [G ɚ; <<*;<< < ɚ; ɚ; @}L ɚ; ɚ; [G ɚ; t|| ' ' ' ' '!--// ) )JC#(D3 ) ,.. = = = = = = = = = = D6 ɚ; @@ ɚ; .F GF K @K @}L ɚ; L K L ZG @GF ɚ; @`J -F +F *F (F ɚ; ;;sG $ $$ ɚ; K ɚ; %F ɚ; 7 %'' M 4tE{{7K KLL L ɚ; @}L ɚ; :I `L L ɚ; $F ɚ; ||C))) ɚ; @K ɚ; -G ɚ; !F ɚ; = (## h $ $ ??8V44 4O ɚ; @K L ɚ; F ɚ; = (## h & & ??8V44 4O ɚ; ɚ; ɚ; @K :I ɚ; F ɚ; i (**H * , ,F X ɚ; @@ ɚ; WG VG ɚ; L ZG F ɚ; @ F @F ɚ; $ .. > <== = C47 C ABB Bff 3 ;Dt$$$$DtS))))) %$ c x 3 #COO c c?? -c222 ɚ; `L L ZF F F F @F ɚ; A6 6B ɚ; ~K vL `L L F F `F F F F ɚ; F `F ɚ; tT4777 ɚ; @F ]F ɚ; F ɚ; tT3777 ɚ; @F `F ɚ; F ɚ; tT4888 ɚ; @F XF ɚ; @ F ɚ; tT3888 ɚ; @F VF ɚ; `F ɚ; dD$''' ɚ; F ɚ; F ɚ; ) 2htT49c222 ɚ; F ɚ; F ɚ; tT4((( ɚ; `L L ɚ; F ɚ; @ F ɚ; ) 2hdD"Is333 ɚ; `L L ZF ɚ; F ɚ; E ɚ; E E ɚ; E E ɚ; K E ɚ; #s## R DtCyy PQQ Q z ! ! . 566 6 >>Y . JKK K 3;; ##C*.T+5?,5 $ 7 7D t{D11 1 ##C*.T*4/,5 $ 7 7D tz400 0 ɚ; E H @E E ɚ; L `L L L @E E E E ɚ; E 0C `E E K ЕC pC ɚ; !DL DJJJ ɚ; L `I E ɚ; E E ɚ; N L **JQtt||!!!Q& ɚ; L E ɚ; E E `E ɚ; @`J ɚ; 4<.. . ɚ; L ɚ; E ɚ; %% % ɚ; E ɚ; n ' ' ' / / / & & & & & ɚ; ɚ; E E `E @E E E E ɚ; | b# M@488KLLL III $##H-- 272tY B4 B B B6 B BB ɚ; K H L L H ɚ; K `L L H H ɚ; E H ɚ; $e %% T I9 ((.. 9 9 9 9l + + 9 #%.%7 8 9 9 9 9 )c5\** C !!' (:(,Y(@"B "BC C C ɚ; E E ɚ; A 3A8 ɚ; L :I L `L L `L `L ɚ; E E E ɚ; "! ɚ; L ɚ; @E ɚ; ! (??!(L99 9 ɚ; PL I ɚ; @E `H `L ɚ; ɚ; ` MM" " " [ $ L11 ɚ; I I @AL H ɚ; @E E E E ɚ; DI!DL)=D & & & ɚ; L E E ɚ; E E ɚ; # & &t| 4 4 4 DIII ɚ; E E ɚ; K ɚ; JJLLLLL ɚ; ɚ; ) y E299$)DDD** ɚ; `L ɚ; @E E ɚ; _ > > > + + + + + ɚ; ɚ; E E E E E E ɚ; = &&t,,! $ ɚ; @`J E ɚ; @`J E E E ɚ; E ɚ; K ɚ; K ɚ; ɚ; ɚ; C ɚ; F F F F ɚ; F `F F ɚ; -G @!F ɚ; `%F JF ɚ; H @H ɚ; \F ZF @XF UF XF VF ɚ; mF mF ɚ; F @F F ɚ; ɚ; `G ``G -L `G _G lG `lG _G ɚ; F ɚ; F ɚ; `lG `G ``G -L `G F _G _G H H H WG VG F `F lG ɚ; `H ɚ; 0 + + + + + +tDI ! 7 7 7 f DG w ))))))) LLL NN$$U++,,, V^^ DG w III NN$$R(())) &&&&&&& +3 4 44 I 7 U wyyH# # # 355DD H%%%D G$$$D G$$$D F###D G$$$D F###D G$$$D H%%%D G$$$D F###D J'''D H%%%D I&&&D H%%%D G$$$D G$$$O 355DD H%%% ! 355DD G$$$D G$$$D G$$$D I&&&D I&&&D H%%%HHTNNND J'''D G$$$D G$$$D J'''wy )ggj 1 1 ) _i(((K 355DD H%%%, D G$$$D F###D I&&&D G$$$wx % ]G$$$D F###D G$$$D F###D F###D G$$$D F### # @& & &, 4 444 5 5 5== == == ==~P! P! P!d v $<?""+'E'E.eTX . . . . .`60 60 60p NN7 ! ! ! " " " GGG H H H @)$ )$ )$ )$Z 5 4 4 4 4 4 4 4G G G G G~ G G GR < . % % % % $, 3 4 4 4 , x ee H * * * * NN*+++ < XZZ ( 76?? PA778,, PA1A1A PA F Hy NN666777 3 3 368 8 88 8 89 9 99 9 9 NN???@@@ 78 *( ( ( 3 3 3 NNHi())) 79 ,) ) ) 4 4 4 NNIz*+++ <9 1 1 1 1,& & & & & & & &, NN7C C C CC C C> wx F FO2 2 2 2 2sw 2 2 2$ 4<<+ + + + + + + +" % < ɚ; H A A('A(0A7 7A?>A?3C CCD DD ɚ; j I L K K E `H L vL K H L E F @F F `J F L @E F @`J E F `G ``G -L `G _G lG `lG _G K `F F L F E `E E E H H H F @F F `vF vF F gF `gF \F ZF @XF UF XF VF SF F H @H @GF `(F K `%F JF #F FF :I -G @!F F WG VG F `F F @F F F F F F F F @E `.L @E E `F `E @K I @E E @E ɚ; F аC C F F `J G D ЯC F C @`J @F F F C F F `F F F F `F F F K F `F F F F `J `F F F F `F F @G F F `F F F `K F `F F F F `F F wJ F F `F F F F `F F F F `F F F F `F F F F `F C `F `F F C `tF nF `vF pC dF ^F gF [F YF `WF TF RF PF C @MF GF ЭC `/F @GF &F `$F C "F @ F PC `F F F ]F C F F F F F C F F F F F E @E F @E F K `E E E @E E E @K E @E E E E pC 0C C D C pC ɚ; 4 y ( gCJ''''''( ( ɚ; L ɚ; L L L `L ɚ; 0~D ɚ; e ', C gooc"" %% %% ɚ; `QG G ɚ; 5 AA ɚ; `G `G K `cG ɚ; `I @K ɚ; 3 ##%% & & L 3MM ! 1 < ! S S S 44AJJ 3 D 7??1<88ALL 3 D # ɚ; <L @E ɚ; W > A. AA. A(%A.'A((A.-A.7)B!!B;:B;?)C))DD ɚ; L L `L `L `G `G K `L @vL ɚ; E C ɚ; v A%%Kx % % }} W + % % HHSMMM OOG $ $ $CHQQQK ɚ; `E E G E ɚ; L L E ɚ; E ɚ; { A w~~d## &tnn 8h H H ɚ; I `J @E ɚ; AA%% A21A2 ɚ; L L `G G E `L ɚ; E ɚ; L E ɚ; 8 $&& w||GT**H Xh Z # #dn 4 )1 - -0J J9X99::: 0H 0 0111 R\( 3 3h G G G || GAts## zz||r!! ??#:;; JJJ {{}} ' 6 6 W +--"'..2E2E-HOOC((( OOG,,, ;BB1Q3QQ :' ' ' ' 8i 8#,.. I : :F & 1 1 3 3 : : d4icj99999:3#*EEEE 0 ɚ; E E L K @L H G E E @E ɚ; h A AA (C) ) C76C7<AJ'$G&&J''A>G&%J'&B.JJ'JJ''J+.J+ ɚ; E `G =G K K E E @E H K wG L E "L K E G L L `L `L E @E E BI ɚ; `E E E `E E PC L C `E 0~D E E ɚ; T D D Dd f%% D.2ooc.B.B DT D D D ɚ; K ɚ; K L ɚ; E ɚ; + + +,,,$&& #G,,G[ + % % $$$ 7## D De D D DEu / /7D+.... ɚ; E E E CH ɚ; 3B BB ɚ; @E E E L `G wJ K 8L E ɚ; `E E @E ɚ; y ur8 Y!7!7 :<<29;; & &4r8 Y!7!7 :<<29;; & &4 4 ɚ; L L E L `G E F @E E ɚ; E F E E @E ɚ; ! w!!"',"5666 ɚ; L ɚ; `G aG ɚ; E F E ɚ; z~~ .55H |888t7 7 7 w$z~~i((/Cxh''' |x CN xY #"22A2"668 8 8 8C " "" ɚ; E `E @L ɚ; `G K L `.L E @K ɚ; E C E @`J E `5G `E K E AK E ɚ; G w$J&&sB// >>I>>>> |x CN 5555 J J71: J J J J JJ ɚ; E `E ɚ; L @K `G E `.L E ɚ; @`J E @E K E E `E ɚ; NN ɚ; `E `E ɚ; E ɚ; 5 }}H $ !(++I ɚ; E ɚ; E E E E ɚ; @E ɚ; Q *+++#%%I +BGMM) 4 4 +9k*** ɚ; E `E ɚ; @E @E E `G @G E ɚ; `E E ɚ; ) L 55D N N 4 6S==~&G~&&u%%%! * *w||FF$1C4DRaR4H$H$35 5 ##D)))) * ' ' ' VUO L L M M M M ɚ; E @E @L TJ E E ɚ; L @E `G -L L E @K ɚ; E /L @E E E E ɚ; U ,---"8,, - - 7== ! ! - w , , , ɚ; E E E ɚ; @E E `G @G E ɚ; `E E ɚ; G v~~"!!)BHM!)BHMMM ɚ; G ɚ; `G -L E G E @E ɚ; E 0L E E E @E ɚ; / &/ S]KKH |BQB6!!(1 M O O )1) >T U U b4E 3 t , ,D ,GB ++ ,wr{++ F mY/000 RW\\$ 22D")DEEE$-1 t H ɚ; SJ G zE ɚ; E G L }E `.L }E L `G KK ``G `G {E ɚ; }E }E `}E }E |E {E 0L {E @{E {E zE ɚ; !)++HMMM ɚ; E G G ɚ; F //88888 DD ɚ; ɚ; @qE ɚ; (( ɚ; @rE K ɚ; OOO FF xB77 # \(A(A # #$9 : : : : # #O 4 4 4 # # % % % % D . . 0 0A 5 5 gll27#5#5c#:#:#46 6G **73333 OOM * * * * *+ 6 5 ɚ; @@ ɚ; oE oE `mE rE @qE ɚ; 0 %A: : BB C6 6 DD ɚ; oE oE L `oE oE K nE `G aG `nE I ɚ; sE sE rE `5G rE pE ɚ; " .+ .+ .+` 0C ɚ; nE ɚ; L iE ɚ; sE @jE ɚ; > 7>>( # # ɚ; K `gE ɚ; `G G ɚ; ɚ; 3 *C |x $9S$@$@,.J7L,MM S))^ rwz : :;;JGQ'//'**KCI M GLL- 0 0 GLLm 4 4" O %&q) , 1 1 1 *Q * *$;;$(NN3$7$7MCE ))++++--C !KKMME <<<&+kkmm $) * * * * * * * * * * * * * * * * (32 S_ cj\222 & OOAsz * * * * |H $ ɚ; ɚ; E ZF dE cE @cE cE bE bE @bE @L @K @}L ɚ; B F77F;>F; ɚ; `G K L `.L dE dE G `G KK @dE K E K TJ dE E @E 9L E ɚ; K @hE hE @fE fE PC eE `eE eE ɚ; \E K bF ɚ; \E L L L L L E ɚ; \E \E \E lK G ɚ; / x?** / / / 9 / NCLNN + + + J '''. / / / / / / / / / , + + + + +/ ɚ; XE K bF ɚ; ) + &. +. B*A!B%%B* ɚ; XE L L L L L E ɚ; YE XE `XE lK G ɚ; I ""KCH {##K /11%k22K!+..K IIINNN KKK 9 ɚ; TE E ɚ; L E E cE E E E E E `zE `vE L TE iE [E XE ɚ; TE ɚ; % BGMM$$7$7 x& ɚ; ɚ; `G @G ɚ; G NE ɚ; D 8ABB<D MM ')) n 8 & &C Esss$ % % % % c ' ' ' ?I??66)+<+<???@@@ ?I??66)+<+<???@@@ 7#377888 F i i bjoof%%&&& HQKKKKK & & HQKKKKK % HQKKKKK HQKKKKK hoodchqk2:%> >??@@@ ɚ; ɚ; G L `JE `E G G KE ɚ; L `KE E @E `L E @E `E E `G `G KE JE ɚ; OE @OE OE NE OH ME LE SL K LE LE KE KE ɚ; / E EN J ( ( ( ( & & & . & 4 4 4n 4 @# # #0 K K K " B 7 7 7 4, , ,90 90 90v1 1 1h/ / /(/ / /( > y DFFF4 4 4l z GIIIII ɚ; ( L `G E H K TJ dE @E E E `E @E E E E E E E E `E E E @E E E E E `zE `vE iE cE [E XE `TE L EE JE ɚ; E E @E `E @E E E `E `E E E E E E E `E @~E vE `uE hE ]E YE UE QE `EE D ɚ; ɚ; &= ɚ; DE D ɚ; ɚ; (? ɚ; BE @ D ɚ; AE `@E ɚ; @E ɚ; AE >E ɚ; >E ɚ; AE <E ɚ; <E ɚ; AE :E ɚ; ;E ɚ; AE 9E ɚ; @9E ɚ; $<<7 "" ɚ; AE 7E ɚ; `7E ɚ; $<<8 ## ɚ; AE 5E ɚ; 5E ɚ; 3E ɚ; 2E ɚ; 5 ɚ; ɚ; 1E ɚ; y D ICczS D!!! ! KK 774== ɚ; ɚ; -E -E `-E -E ɚ; `.E ɚ; .E /E ɚ; K ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ` ɚ; ɚ; @ ɚ; k # # ## # ## # ## # ## # ## # #$ $ $ ss s s s s s s s gos s s s s gos s s s s gos s s /8 "' %) " % # DD ɚ; D DD ɚ; U `+E +E *E *E `*E *E )E )E `)E )E CE AE `@E >E <E :E 9E 7E 5E (E (E `(E G `>E `<E G 8E <G @5E 3E @2E 0E (E 'E 'E `'E 'E &E &E `&E &E %E %E `%E %E $E $E `$E $E #E #E `#E #E "E "E `"E "E E !E !E `!E !E E `.E .E E E E ` E E E E @ E E E E E ` E E E @E E E L ɚ; = DE BE AE D D D D D `D @D `?E `=E `;E 9E 7E 6E @4E 2E 1E 0E D D D D D D `D @D D /E K /E H I @I K K E `/E K `J /E +E D ɚ; -| < << ɚ; PK ɚ; L ^K @K ɚ; @E ɚ; ??3 B B Ad4jj A A A B B B E E eff w 6 66 ɚ; L L E ɚ; L L AH @L ɚ; L E E ɚ; 3; $%%%T" >4 ?D | !6!=!=d!C!CDDDK N N N 5 < <T B BCC M N ɚ; L `L ɚ; A# #.B ɚ; L `L L `L `L ɚ; @E E E ɚ; ɚ; K ɚ; } " /3ooc.B.BL|D'***Hs{"" ))#..q1 zlCCCF P $o ! P P P)9{ 9 9,49 9?GI I INOP P K(K000X& >4 ?D | !6!=!=d!C!CDDDK N N N 5 < <T B BCC M N ɚ; L L ` E @J @)H L `L ɚ; $ &A. . B8BBC. ..D ɚ; L E L L `L `K `L L `L ɚ; ` E %D E E P%D E E ɚ; #I [__T " "F # c4 #' " D ( K%% #( % '''' ɚ; L L ɚ; N &A+ *B% + B8 BB BBBBB% BB% % B. ɚ; L L E L @L ɚ; ɚ; L(Q 8 8 8 8 d%f%% 6=$ / / 7!' F 6:.. K%+%7%B%B3%G%G%J" ɚ; ɚ; L L L `L ɚ; @L L L L ɚ; E 05D ɚ; ; _S ɚ; `L E ɚ; E E ɚ; g L(Q 8 8 8 8 T+D+++F++ 6< . . 6 $F ɚ; ɚ; L L L L `L ɚ; @L L ɚ; E 05D ɚ; ; _S ɚ; `L `D ɚ; E E ɚ; D D ɚ; X & & 6& $F E !__X 6 6 E)1F&&)1)<)<S)A)A!)DF&& 0 3tV5d555f55 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 ɚ; ɚ; L L L L L L `L ɚ; 3 B A+B A.+B -A..B BB ɚ; E L L L `L ɚ; ɚ; K ɚ; a $ M H$4 4 4 4 _S 6 6 6 6 6 %$ ɚ; ` ɚ; `L D ɚ; @L L E E ɚ; D E 05D @D ɚ; * **4<< , & ! + 2 + 2 &&t[99[HH - ?!224>>+ 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 .2 \*!224DD !) ** 5 $ " "+//"3"3 3 3JC *,,-2 c**IcN++r*S//B/BBB-2 c*++D111 !CK//$xx2ck-&@#A#AAA ( *1m *1 *1 *1 2 2 2 ...!&!1W+ 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2 + 2Z tT""" ɚ; ɚ; L @D L D D D @D @K @}L ɚ; AF#>DF##F'*F' ɚ; @K L `D L `L lL L L @L D D ɚ; `D L D D `D ɚ; . d###d ɚ; L @D ɚ; `D ɚ; D ɚ; 9 UU1# 1# 1#f ɚ; ɚ; `D D D D ɚ; 0 v}-- @ >?? ? @ @ ɚ; `L ɚ; L `L ɚ; lL D ɚ; ss664+B6+B+B'C'C ɚ; ɚ; L L PL `L ɚ; , (((CCCCCC ɚ; `` ɚ; PL `L ɚ; D ɚ; D `D ɚ; ! !!&))) ɚ; L `L ɚ; D `L ɚ; {((... ɚ; L `L ɚ; `L lL ɚ; x !% K #)?#7#7#9#9 Z $*$4 [! ( 0 0 V %* \"'3$& ɚ; ɚ; L L L ɚ; `L D L `D ɚ; @D L D ɚ; UU@ @ \@ D D [D / / /' ' ' ' ' ɚ; AL D @AL D lL lL ɚ; D @D D `D D D D ɚ; E ɚ; xL ɚ; K ɚ; QK ɚ; K ɚ; @K ɚ; jK ɚ; `L ɚ; L ɚ; @L ɚ; kL ɚ; E ɚ; 3 3 ( ( ( ( ( ( % % % % % % ( ( ( ( ( ( " " " " " " - - - - - - 2 2 2 2 2 2 2 2 2 2 2 2 . . . . . . 2 2 2 2 2 2 8 8 8 8 8 8 % % % % % % = = = 7 7 7 >* * * *Z ( ( (2 ( $%% %% %%P< < < < < %" < < < ~$' $' $' $' $' $' $' $' $' $' ɚ; " I E kL @L L `L `L jK @K K QK K xL D E L E L D ^K E E PL E @E D D D `D D ɚ; @E ID ID PID ID HD HD PHD HD GD GD PGD GD E E @E `E E @ E D D D `D D D D ɚ; . .1C CC ɚ; K K 6K ɚ; D ɚ; @rL ɚ; K ɚ; J ɚ; J ɚ; J ɚ; J ɚ; GK ɚ; K `^J ^J K 6K ɚ; ?L ɚ; VL ɚ; L ɚ; % ? ? " " " " " " ' ' ' ' ' ' & & & & & &) ) ) ) ) ) ) ) ) ) ) ) ) ) 7 6 6 6 6 6 + + + + + + + + + + + + 1 1 1 1 1 1 5 5 5 5 5 5 4 4 4 4 4 4 0 0 0 0 0 0D D D D D ɚ; L VL ?L `L K `^J ^J K 6K GK J J J J K @rL D ɚ; D RD QD QD 0QD PD PD pPD 0PD OD OD pOD D ɚ; & ** ɚ; D D L D ɚ; b = % %ck(&; < < < < D $ H ɚ; L D ɚ; *4 A A ɚ; D D L @L L ɚ; @ +)-);A)>CK & & DM* ɚ; D L D ɚ; G MM ɚ; ɚ; D D D D @D ɚ; -3XX5DNNN ɚ; L @}L ɚ; @}L @K D D ɚ; @ DN 2 2 ?@@ @ HQKj ɚ; L ɚ; D D L L `KE @}L ɚ; D ɚ; ^ ' ɚ; ɚ; L L ɚ; D @}L D L `KE ɚ; ɚ; A 6 6 6! ! ! ( ( ( ( ( ɚ; ɚ; D @D D D ɚ; @vL ɚ; <((( H("'$*!%$*%-"* , , , { ɚ; ɚ; D D D D @D D `L D L ɚ; @L `L @L L "L ɚ; D p^D ɚ; $+KK E X =+~e/D/D = =!(1 $ \Hh = = == = = = = = = = = = = = = = = = = = = = = = = = = = = = = = ɚ; ɚ; D D D @D D D D D ɚ; 4 A0"A A0A A0 A !A00A47A4 ɚ; @L D D L @D ɚ; D ɚ; D @D ɚ; @L ɚ; l 3 ;e9::: ((--NHa & x v~!&H"4"4 ++AFSL99 #5 ;??8,, *(E(E % % % % % % #FHxF H H D $$ % % % I~''11 J ? I I I K U # # 9 8HSbSM 8 8 8 8 8 9CeCJJxb):B??@@bHI |e(83444 &2 z ! !X%6%6{%C%C !%?@@ @ G ${ 2M&}e<< < G G Gs{**%9:HHHF G G G G [F ~eFCKL M M M&x(( & & &eF1II A%& |e5@AAA T4 ɚ; D rF @D @)H D @L `L G `D `L ɚ; ` A B0B B; D F8A FF G1 1H6 HH6I I4I//I4 ɚ; L L L L L @L `L D @D PL `L `L L K L `L D `L FL ɚ; D PdD D dD D .L D D @D D D @D D D D D ɚ; LLLL ɚ; @D D ɚ; HZ//':8V'L'L $Hh'?'G'G $Hh ...##. ;z*3L & o T< + + + ɚ; ɚ; D D D K D ɚ; := A6%A11A6 ɚ; D @D D L dE @E @L `KE @D ɚ; D lK ɚ; X * 38 < < Hh E lHhGGG r<8DDD ɚ; D D D @D D ɚ; D @D @D ɚ; D ɚ; IY'J I ,"9-- ", I C %% (yy#(1++7 8 8=@ A ", I ++++ ɚ; ɚ; rF @D D K ɚ; # A B 4A??BB B ɚ; L D L L ɚ; D D ɚ; D ɚ; * !!!!!!7??2;u#5#566L l # # qy|| | \, ' ' 4116688UF33D 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 ; ɚ; ɚ; D D D D @L ɚ; $ A$$A(+A($B55B9<B9 ɚ; D D `G `G VG H K `K ɚ; rD "L ɚ; @D D ɚ; D ɚ; ""3''*H$$$$$$|I&&HO H~~ E)) >> "n 4 4 "O(DJJ'' ? *(I>> e lH)1uF F F F 9%%% (@'A'A $Hh X&& I+ ** I I ) 0 9 {L$,hB BBF$&& I I I I I I I I I I I I I I **** I I I I I I I I I I I I I I I I I I I I I I I ***** **** ɚ; ɚ; D D D @D D D `D D D D D D ɚ; !G -F=2E8/ F; G E(( E54E58E< <F?E< F G FG FG F< < G G G? G/.G?/ G<9G?;G<<G? ɚ; L D D L D @D L 9L D D D L @D `H L ɚ; D D pvD `D D 0vD ɚ; ɚ; ɚ; ɚ; ɚ; `L ɚ; * T#YY & . ( ( ( ( (V ( ( ( /3&*)- 4 )-,0/3 )4 ; ; ; ; zM M M M MY M M M+ + + +8 '+(- E E E E< $/ , , , ,& 4 4 4 4n z s38}}q 1 CCCCCC HQKCHQK((((( ɚ; L D D H `G L D @K D D @D @D L D L @D D D D D D `KE `L ɚ; @D D D `D D D D D D D D @D `D D D D D @D 0~D }D }D P}D }D ɚ; @D D ɚ; LLL ɚ; @D D ɚ; ɚ; ɚ; D L ɚ; zDFFFFF ɚ; `D @D @D D `TE ɚ; D @D D @D D D D ɚ; D ɚ; ɚ; ɚ; . ɚ; `L ɚ; D ɚ; = zDFFFFF ɚ; `D `TE ɚ; D ɚ; n ɚ; `D `L ɚ; D ɚ; <frozen frozen_only> ɚ; D pD D `TE `TE D t d d S ɚ; <frozen __phello__.spam> ɚ; <frozen __phello__.ham.eggs> ɚ; <frozen __phello__.ham> ɚ; D pD D `TE `TE D t d d S ɚ; <frozen __phello__> ɚ; initialized ɚ; D pD D `TE `TE D t d d S ɚ; Hello world! ɚ; PD D D D D D e Zd ZdZdS ɚ; TestFrozenUtf8_4 ɚ; pD D D @D @D D e Zd ZdZdS ɚ; ɚ; TestFrozenUtf8_2 ɚ; D D D @D @D D e Zd ZdZdS ɚ; <frozen __hello__> ɚ; ɚ; TestFrozenUtf8_1 ɚ; importlib.util ɚ; importlib.machinery ɚ; ! No module specified for execution ɚ; |D {D zD 0zD yD @D D D vD |d}| d d }ddlm} || }d}t | j dk rt | j dk rd }t |t d s|r't || \ }}t ||||| S t j d| t \ } } }t | 5 } t | 5 | j j } t# || ||| | cddd cddd t j | S # t( $ r Y S w xY w# 1 swxY w Y ddd n # 1 swxY w Y t j | dS # t( $ r Y dS w xY w# t j | w # t( $ r Y w w xY wxY w ɚ; is_NullImporter ɚ; importer ɚ; path_name ɚ; NullImporter ɚ; imp ɚ; get_importer ɚ; <run_path> ɚ; E x e c u t e c o d e l o c a t e d a t t h e s p e c i f i e d f i l e s y s t e m l o c a t i o n . p a t h _ n a m e - - f i l e s y s t e m l o c a t i o n o f a P y t h o n s c r i p t , z i p f i l e , o r d i r e c t o r y c o n t a i n i n g a t o p l e v e l _ _ m a i n _ _ . p y s c r i p t . O p t i o n a l a r g u m e n t s : i n i t _ g l o b a l s - - d i c t i o n a r y u s e d t o p r e - p o p u l a t e t h e m o d u l e s g l o b a l s d i c t i o n a r y b e f o r e t h e c o d e i s e x e c u t e d . r u n _ n a m e - - i f n o t N o n e , t h i s w i l l b e u s e d t o s e t _ _ n a m e _ _ ; o t h e r w i s e , ' < r u n _ p a t h > ' w i l l b e u s e d f o r _ _ n a m e _ _ . R e t u r n s t h e r e s u l t i n g m o d u l e g l o b a l s d i c t i o n a r y . ɚ; uD PuD tD tD @tD @D D D rD ddl m} t j t j | }t j | 5 } || }d d d n # 1 swxY w Y |Ot j | 5 }t | |d }d d d n # 1 swxY w Y ||fS ɚ; decoded_path ɚ; _get_code_from_file ɚ; pkgutil ɚ; read_code ɚ; PrD qD qD 0qD pD @D D D oD d}t j | }t j |= t | |t j |< S # t $ r9}|t | v r" | d|dt j d | d }~ww xY w# |t j |< w xY w ɚ; saved_main ɚ; main_name ɚ; module in ɚ; can't find ɚ; ? oD poD oD @tD @D D D nD t | \ } }}|| }|rt |||| S t |i ||| S ɚ; alter_sys ɚ; run_name ɚ; E x e c u t e a m o d u l e ' s c o d e w i t h o u t i m p o r t i n g i t . m o d _ n a m e - - a n a b s o l u t e m o d u l e n a m e o r p a c k a g e n a m e . O p t i o n a l a r g u m e n t s : i n i t _ g l o b a l s - - d i c t i o n a r y u s e d t o p r e - p o p u l a t e t h e m o d u l e s g l o b a l s d i c t i o n a r y b e f o r e t h e c o d e i s e x e c u t e d . r u n _ n a m e - - i f n o t N o n e , t h i s w i l l b e u s e d f o r s e t t i n g _ _ n a m e _ _ ; o t h e r w i s e , _ _ n a m e _ _ w i l l b e s e t t o m o d _ n a m e + ' _ _ m a i n _ _ ' i f t h e n a m e d m o d u l e i s a p a c k a g e a n d t o j u s t m o d _ n a m e o t h e r w i s e . a l t e r _ s y s - - i f T r u e , s y s . a r g v [ 0 ] i s u p d a t e d w i t h t h e v a l u e o f _ _ f i l e _ _ a n d s y s . m o d u l e s [ _ _ n a m e _ _ ] i s u p d a t e d w i t h a t e m p o r a r y m o d u l e o b j e c t f o r t h e m o d u l e b e i n g e x e c u t e d . B o t h a r e r e s t o r e d t o t h e i r o r i g i n a l v a l u e s b e f o r e t h e f u n c t i o n r e t u r n s . R e t u r n s t h e r e s u l t i n g m o d u l e g l o b a l s d i c t i o n a r y . ɚ; 0nD mD `mD mD lD @D D D kD |s| dk rt | t \ } }}nt t \ } }}n<# t $ r/}t j d|}t j | Y d}~nd}~ww xY wt j d j }|r|j t j d< t ||dd| S ɚ; main_globals ɚ; alter_argv ɚ; _run_module_as_main ɚ; _get_main_module_details ɚ; Runs the designated module in the __main__ namespace Note that the executed module will have full access to the __main__ namespace. If this is not desirable, the run_module() function should be used to run the module code in a fresh namespace. At the very least, these variables in __main__ will be overwritten: __name__ __file__ __cached__ __loader__ __package__ ɚ; kD D @D @D @D @kD e Zd ZdZdS ɚ; B Error that _run_module_as_main() should report without a traceback ɚ; _Error ɚ; pjD piD hD i 0hD yD @D D D dD | d r |d | d \ }}}|r t | nG# t $ r:}|j (|j |k r | |j dz s Y d }~nd }~ww xY wt j | }|Et |d s5ddl m } d | | } |t | t j | }n# t t t" t$ f$ rc} d}| d r|d | d d d | d z } || | t) | j | | d } ~ ww xY w| |d| z |j i| dk s| d r |d | dz } t/ | | S # |$ r%}| t j vr ||d| d d }~ww xY w|j } | |d| z | | } n+# t $ r } |t | |d }~ww xY w| |d| z | || fS ɚ; pkg_main_name ɚ; existing ɚ; _get_module_details ɚ; util ɚ; RuntimeWarning ɚ; No code object available for %s ɚ; 0 %r is a namespace package and cannot be executed ɚ; - is a package and cannot be directly executed ɚ; ; ɚ; % Cannot use package as __main__ module ɚ; .__main__ ɚ; No module named %s ɚ; ' as the module name. ɚ; ' instead of ' ɚ; . Try using ' ɚ; : Error while finding module specification for {!r} ({}: {}) ɚ; {mod_name!r} found in sys.modules after import of package {pkg_name!r}, but prior to execution of {mod_name!r}; this may result in unpredictable behaviour ɚ; # Relative module names not supported ɚ; cD pcD cD [ bD @bD @D @D @D aD ||n|j }t | 5 }t | 5 |j j }t | |||||| ddd n # 1 swxY w Y ddd n # 1 swxY w Y | S ɚ; mod_globals ɚ; temp_module ɚ; _run_module_code ɚ; 5 Helper to run code in new namespace with sys modified ɚ; m `D p`D A _D _D @D @D @D ^D || | |d}|}d} n |j }|j }|j } ||j }| ||| d||| t | | |S ɚ; fname ɚ; script_name ɚ; pkg_name ɚ; mod_spec ɚ; init_globals ɚ; run_globals ɚ; _run_code ɚ; ) Helper to run code in nominated namespace ɚ; ^D ]D 1 @D D D ]D e Zd Zd Zd Zd ZdS ɚ; # \D \D < P\D \D @D D [D | j | _ | j t j d< d S ɚ; _ModifiedArgv0.__exit__ ɚ; K [D 0[D 6 ZD @D D `ZD | j | j urt d t j d | _ | j t j d< d S ɚ; _ModifiedArgv0.__enter__ ɚ; Already preserving saved value ɚ; $ D ZD 2 YD \D @D @D `YD || _ t x| _ | _ d S ɚ; _ModifiedArgv0.__init__ ɚ; _sentinel ɚ; _saved_value ɚ; _ModifiedArgv0 ɚ; YD XD @D D D XD e Zd ZdZd Zd Zd ZdS ɚ; C \D WD * P\D \D @D D @WD | j r | j d t j | j < nt j | j = g | _ d S ɚ; _TempModule.__exit__ ɚ; Z D VD VD ! pVD \D @D `D UD | j } | j t j | n# t $ r Y nw xY w| j t j |< | S ɚ; _TempModule.__enter__ ɚ; % D pUD pVD \D @D D UD || _ t | | _ g | _ d S ɚ; _TempModule.__init__ ɚ; <frozen runpy> ɚ; _saved_module ɚ; mod_name ɚ; C Temporarily replace a module in sys.modules with an empty namespace ɚ; _TempModule ɚ; run_path ɚ; run_module ɚ; Z runpy.py - locating and running Python code using the module namespace Provides support for locating and running Python scripts using the Python module namespace instead of the native filesystem. This allows Python code to play nicely with non-filesystem based PEP 302 importers when locating support scripts as well as when importing modules. ɚ; 0OD ND D D D ND t t z t z S ɚ; all_suffixes ɚ; <frozen importlib.machinery> ɚ; A Returns a list of all recognized module suffixes for this process ɚ; 9 The machinery of importlib: finders, loaders, hooks, etc. ɚ; contextlib ɚ; ( FD FD E D D @ED e Zd ZdZed Zed Zd Zd Z d Z dS ɚ; { DD pDD 4 0DD CD E lL D @CD | j |j _ | j |_ i }|j |d< |j |d< t j |d< d|d< ||j _ t |_ dS ɚ; LazyLoader.exec_module ɚ; RLock ɚ; Make the module load lazily. ɚ; D CD 1 BD \D E lL D BD | j | S ɚ; LazyLoader.create_module ɚ; D PBD - BD \D E D AD | | || _ d S ɚ; LazyLoader.__init__ ɚ; pAD 0AD ' @D @D E D `D @@D fdS ɚ; LazyLoader.factory ɚ; factory ɚ; _LazyLoader__check_eager_loader ɚ; D + ?D ?D E @D @?D | i | S ɚ; $ LazyLoader.factory.<locals>.<lambda> ɚ; > Construct a callable which returns the eager loader made lazy. ɚ; " ?D >D " >D E D D >D t | d st d d S ɚ; LazyLoader.__check_eager_loader ɚ; __check_eager_loader ɚ; loader must define exec_module() ɚ; K A loader that creates a module which defers loading until attribute access. ɚ; LazyLoader ɚ; =D p=D E `D `D =D e Zd ZdZd Zd ZdS ɚ; ( <D <D P<D \D E D ;D | | t | | dS ɚ; _LazyModule.__delattr__ ɚ; delattr ɚ; / Trigger the load and then perform the deletion. ɚ; p;D :D `:D 9D 9D E D @7D t | d }|j }|d 5 t | d t u rH|d r't | | cddd S d|d< t | d }|j }|d }|}i }| D ]@\ } } | |vr| || < t || t || k r| || < A|j | |t j v rCt | t t j | k rt d|d | | t j | _ ddd n # 1 swxY w Y t! | | S ɚ; attrs_updated ɚ; attrs_now ɚ; attrs_then ɚ; original_name ɚ; attr ɚ; _LazyModule.__getattribute__ ɚ; ModuleType ɚ; types ɚ; . substituted in sys.modules during a lazy load ɚ; module object for ɚ; is_loading ɚ; 8 Trigger the load of the module and return the attribute. ɚ; K A subclass of the module type which triggers loading upon attribute access. ɚ; _LazyModule ɚ; ? 6D 6D P6D 6D E D D `5D t j dt d t j fd }|S ɚ; module_for_loader ɚ; 4D 4D 4D 3D 3D E D @D @2D t | 5 }| |_ | | }|r||_ n8| d d |_ n# t t f$ r Y nw xY w | |g|R i |cd d d S # 1 swxY w Y d S ɚ; 4 module_for_loader.<locals>.module_for_loader_wrapper ɚ; module_for_loader_wrapper ɚ; * Decorator to handle selecting the proper module for loaders. The decorated function is passed the module to use instead of the module name. The module passed in to the function is either from sys.modules if it already exists or is a new module. If the module is new, then __name__ is set the first argument to the method, __loader__ is set to self, and __package__ is set accordingly (if self.is_package() is defined) will be set before it is passed to the decorated function (if self.is_package() does not work for the module it will be set post-load). If an exception is raised and the decorator created the module it is subsequently removed from sys.modules. The decorator assumes that the decorated function takes the module name as the second argument. ɚ; # 2D 1D 1D 6D E D D 1D t j fd }|S ɚ; set_loader ɚ; D 0D p0D 0D /D E `D D /D t j dt d | g|R i |}t |dd | |_ |S ɚ; & set_loader.<locals>.set_loader_wrapper ɚ; set_loader_wrapper ɚ; N Set __loader__ on the returned module. This function is deprecated. ɚ; # .D 1D .D 6D E @E @E @.D t j fd }|S ɚ; set_package ɚ; wraps ɚ; functools ɚ; z -D P-D ,D ,D E E E +D t j dt d | i |}t |dd A|j |_ t |d s%|j d d |_ |S ɚ; ( set_package.<locals>.set_package_wrapper ɚ; set_package_wrapper ɚ; k The import system now takes care of this automatically; this decorator is slated for removal in Python 3.12 ɚ; O Set __package__ on the returned module. This function is deprecated. ɚ; +D P+D *D # w *D CD E E E `)D K | t j v }t j | }|s3 t t | }d|_ |t j | < |V n1# t $ r$ |s t j | = n# t $ r Y nw xY wY nw xY wd|_ d S # d|_ w xY w ɚ; _module_to_load ɚ; __initializing__ ɚ; (D P(D 'D J p'D @bD E PL PL %D | d rt | | n| }|t j vrt| d d }|rEt |dg } |j }n,# t $ r }t d|d|| |d}~ww xY wd}t || S t j | }|dS |j }|"t d | |S # t $ r$ t d | dw xY w ɚ; parent_name ɚ; while trying to find ɚ; __path__ attribute not found on ɚ; Return the spec for the specified module. First, sys.modules is checked to see if the module was already imported. If so, then sys.modules[name].__spec__ is returned. If that happens to be set to None, then ValueError is raised. If the module is not in sys.modules, then sys.meta_path is searched for a suitable spec with the value of 'path' given to the finders. None is returned if no spec could be found. If the name is for submodule (contains a dot), the parent module is automatically imported. The name and package arguments work the same as importlib.import_module(). In other words, relative module names (with leading dots) work. ɚ; $D $D @$D + #D pD E E E #D | t j vrt | | S t j | }|dS |j }|"t d | |S # t $ r$ t d | dw xY wɚ; _find_spec_from_path ɚ; {}.__spec__ is not set ɚ; {}.__spec__ is None ɚ; Return the spec for the specified module. First, sys.modules is checked to see if the module was already imported. If so, then sys.modules[name].__spec__ is returned. If that happens to be set to None, then ValueError is raised. If the module is not in sys.modules, then sys.meta_path is searched for a suitable spec with the value of 'path' given to the finders. None is returned if no spec could be found. Dotted names do not have their parent packages implicitly imported. You will most likely need to explicitly import all parent packages in the proper order for a submodule to get the correct spec. ɚ; g "D P"D !D pD E E E !D | d s| S |s t dt | d d}| D ]}|dk r n|dz }t | |d || S ɚ; character ɚ; resolve_name ɚ; % (required for relative module names) ɚ; no package specified for ɚ; D D P D E ^K ^K D t j t | S ɚ; <frozen importlib.util> ɚ; B Return the hash of *source_bytes* as used in hash-based pyc files. ɚ; contextmanager ɚ; Loader ɚ; - Utility code for constructing importers, etc. ɚ; _stat ɚ; FILE_ATTRIBUTE_VIRTUAL ɚ; FILE_ATTRIBUTE_TEMPORARY ɚ; FILE_ATTRIBUTE_SYSTEM ɚ; FILE_ATTRIBUTE_SPARSE_FILE ɚ; FILE_ATTRIBUTE_REPARSE_POINT ɚ; FILE_ATTRIBUTE_READONLY ɚ; FILE_ATTRIBUTE_OFFLINE ɚ; FILE_ATTRIBUTE_NO_SCRUB_DATA ɚ; " FILE_ATTRIBUTE_NOT_CONTENT_INDEXED ɚ; FILE_ATTRIBUTE_NORMAL ɚ; FILE_ATTRIBUTE_INTEGRITY_STREAM ɚ; FILE_ATTRIBUTE_ENCRYPTED ɚ; FILE_ATTRIBUTE_DIRECTORY ɚ; FILE_ATTRIBUTE_DEVICE ɚ; FILE_ATTRIBUTE_COMPRESSED ɚ; FILE_ATTRIBUTE_ARCHIVE ɚ; SF_SNAPSHOT ɚ; SF_NOUNLINK ɚ; SF_APPEND ɚ; SF_IMMUTABLE ɚ; SF_ARCHIVED ɚ; UF_COMPRESSED ɚ; UF_NOUNLINK ɚ; UF_OPAQUE ɚ; UF_APPEND ɚ; UF_IMMUTABLE ɚ; UF_NODUMP ɚ; S_IXOTH ɚ; S_IWOTH ɚ; S_IROTH ɚ; S_IRWXO ɚ; S_IXGRP ɚ; S_IWGRP ɚ; S_IRGRP ɚ; S_IRWXG ɚ; S_IXUSR ɚ; S_IWUSR ɚ; S_IRUSR ɚ; S_IRWXU ɚ; S_IEXEC ɚ; S_IWRITE ɚ; S_IREAD ɚ; S_ISVTX ɚ; S_ENFMT ɚ; S_ISGID ɚ; S_ISUID ɚ; S_IFWHT ɚ; S_IFPORT ɚ; S_IFDOOR ɚ; ST_CTIME ɚ; ST_MTIME ɚ; ST_ATIME ɚ; ST_SIZE ɚ; ST_GID ɚ; ST_UID ɚ; ST_NLINK ɚ; ST_DEV ɚ; ST_INO ɚ; ST_MODE ɚ; _ D pD D D CE .E .E D g }t D ]?}|D ]%\ }}| |z |k r| | n&| d @d | S ɚ; char ɚ; bit ɚ; table ɚ; perm ɚ; filemode ɚ; _filemode_table ɚ; ; Convert a file's mode to a string of the form '-rwxrwxrwx'. ɚ; T ɚ; S ɚ; - ɚ; l ɚ; D V D CE 0E 0E `D dS ɚ; S_ISWHT ɚ; ' Return True if mode is from a whiteout. ɚ; 0D R D CE @2E @2E `D dS ɚ; S_ISPORT ɚ; * Return True if mode is from an event port. ɚ; D N D CE 3E 3E `D dS ɚ; S_ISDOOR ɚ; # Return True if mode is from a door. ɚ; D pD J D CE @5E @5E D t | t k S ɚ; S_ISSOCK ɚ; S_IFSOCK ɚ; % Return True if mode is from a socket. ɚ; D D F D CE <G <G `D t | t k S ɚ; S_IFLNK ɚ; , Return True if mode is from a symbolic link. ɚ; 0D D B D CE 8E 8E `D t | t k S ɚ; S_ISFIFO ɚ; S_IFIFO ɚ; 0 Return True if mode is from a FIFO (named pipe). ɚ; D pD > D CE G G `D t | t k S ɚ; S_IFREG ɚ; + Return True if mode is from a regular file. ɚ; 0D D : D CE `<E `<E `D t | t k S ɚ; S_ISBLK ɚ; S_IFBLK ɚ; 8 Return True if mode is from a block special device file. ɚ; D pD 6 D CE `>E `>E `D t | t k S ɚ; S_ISCHR ɚ; S_IFCHR ɚ; < Return True if mode is from a character special device file. ɚ; 0D D 2 D CE G G `D t | t k S ɚ; S_IFDIR ɚ; ( Return True if mode is from a directory. ɚ; D D CE AE AE ` D | dz S ɚ; S_IFMT ɚ; L Return the portion of the file's mode that describes the file type. ɚ; D D CE CE CE D | dz S ɚ; S_IMODE ɚ; <frozen stat> ɚ; M Return the portion of the file's mode that can be set by os.chmod(). ɚ; o Constants/functions for interpreting results of os.stat() and os.lstat(). Suggested usage: from stat import * ɚ; no_site ɚ; D D t D @D E JE JE D d} t j dd }|st }t }t d t j D ]}t d|d t d d }t d|d || d t d |d || d t d t t j d g }d|v r| t d|v r| t |rt t j | t rt j d d S t du rt j d d S t t j d d S t j d d S d d l}t | | t j d t j fz t j d d S ɚ; user_base ɚ; _script ɚ; dedent ɚ; textwrap ɚ; argv ɚ; --user-site ɚ; --user-base ɚ; ENABLE_USER_SITE: ɚ; USER_SITE: ɚ; USER_BASE: ɚ; & D D PD E G NE D | !t j | rdS dS ɚ; _script.<locals>.exists ɚ; doesn't exist ɚ; , ɚ; ɚ; sys.path = [ ɚ; %s [--user-base] [--user-site] Without arguments print some useful information With arguments print the value of USER_BASE and/or USER_SITE separated by '%s'. Exit codes with --user-base or --user-site: 0 - user site directory is enabled 1 - user site directory is disabled by user 2 - user site directory is disabled by super user or for security reasons >2 - unknown error ɚ; D D R D \D E `TE `TE C t j dd } t }| t j k rt t | }t t at | }t | }t t t t j j st t t rt! dS dS ɚ; orig_path ɚ; main ɚ; isolated ɚ; Add standard site-specific directories to the module search path. This function is called automatically when this module is imported, unless the python interpreter was started with the -S flag. ɚ; PC C @C > C CD E XE XE C ddl } dS # t $ r}|j dk rn Y d}~dS d}~ww xY w# t $ rr}t j j r t j t j n6t j d|j j d|d Y d}~dS Y d}~dS d}~ww xY w ɚ; execusercustomize ɚ; 9 Error in usercustomize; set PYTHONVERBOSE for traceback: ɚ; usercustomize ɚ; , Run custom user specific code, if available. ɚ; pC C @C * C CD E [E [E C ddl } dS # t $ r}|j dk rn Y d}~dS d}~ww xY w# t $ rr}t j j r t j t j n6t j d|j j d|d Y d}~dS Y d}~dS d}~ww xY w ɚ; execsitecustomize ɚ; 9 Error in sitecustomize; set PYTHONVERBOSE for traceback: ɚ; sitecustomize ɚ; , Run custom site specific code, if available. ɚ; 2 C C C 0C C E cE cE C t j }t j dk r#d|v r t j d x}t _ n t j }t j t j | \ }}t j | }d t _ d}d t j || t j || fD }|r+|d }d} t |d 5 } | D ]} d | v r| d \ } }} | } | } | d k r| } t| d k r | t _ d d d n # 1 swxY w Y |xt _ t _ t% | t j g | dk r&t& dt j nt j gad a| S ɚ; system_site ɚ; virtual_conf ɚ; candidate_confs ɚ; conf_basename ɚ; site_prefix ɚ; exe_dir ɚ; venv ɚ; exec_prefix ɚ; _home ɚ; executable ɚ; _base_executable ɚ; home ɚ; include-system-site-packages ɚ; = ɚ; true ɚ; ( C C \D E gE `C g | ]#}t j | !|$S ɚ; conffile ɚ; venv.<locals>.<listcomp> ɚ; pyvenv.cfg ɚ; __PYVENV_LAUNCHER__ ɚ; 0C C C E iE iE @C d } | t _ dS ɚ; enablerlcompleter ɚ; __interactivehook__ ɚ; % C 0C C pC C E nE mE `C dd l } dd ldd l}n# t $ r Y d S w xY wt dd }|d|v r d n d n# t $ r Y nw xY w dk rt j t j d d n# t $ r Y nw xY wfd }| | d S d S ɚ; readline_doc ɚ; , enablerlcompleter.<locals>.register_readline ɚ; register_readline ɚ; read_history_file ɚ; get_current_history_length ɚ; read_init_file ɚ; parse_and_bind ɚ; rlcompleter ɚ; atexit ɚ; + D 0C C C `C E rE qE C d S # t $ r Y d S w xY w ɚ; history ɚ; C enablerlcompleter.<locals>.register_readline.<locals>.write_history ɚ; write_history ɚ; write_history_file ɚ; .python_history ɚ; tab: complete ɚ; bind ^I rl_complete ɚ; libedit ɚ; j Enable default readline configuration on interactive prompts, by registering a sys.__interactivehook__. If the readline module can be imported, the hook will set the Tab key as completion key and register ~/.python_history as history file. This can be overridden in the sitecustomize or usercustomize module, or in a PYTHONSTARTUP file. ɚ; D C E `vE `vE @C t j t _ d S ɚ; sethelper ɚ; a C C C CD E `zE `zE @C t j dt j t _ t j dd dk r t j dd t _ n t j dd t _ g g }} t t dd }|s>t t d r)t j t j }|ra| d d g | t j |t j |t j g t j d d | | t _ dS ɚ; here ɚ; setcopyright ɚ; ' See https://www.python.org/psf/license/ ɚ; license ɚ; LICENSE ɚ; LICENSE.txt ɚ; Thanks to CWI, CNRI, BeOpen.com, Zope Corporation and a cast of thousands for supporting Python development. See www.python.org for more information. ɚ; ? Jython is maintained by the Jython developers (www.jython.org). ɚ; credits ɚ; java ɚ; copyright ɚ; ) Set 'copyright' and 'credits' in builtins ɚ; V C C PC E E E C t j dk rd} nd} t j d| t _ t j d| t _ dS ɚ; setquit ɚ; _sitebuiltins ɚ; exit ɚ; quit ɚ; Ctrl-D (i.e. EOF) ɚ; Ctrl-Z plus Return ɚ; Define new builtins 'quit' and 'exit'. These are objects which make the interpreter exit when called. The repr of each object contains a hint at how it works. ɚ; S C 0C C CD E E E `C t d t | D ]1}t j | rt || 2| S ɚ; addsitepackages ɚ; Processing global site-packages ɚ; Add site-packages to sys.path ɚ; C pC d C lD E E E C g }t }| t } | D ]}|r||v r | | t j dk rt j g}t j dk r| d |D ]N}t j ||dt j dd z d }| | O| | | t j |dd |S ɚ; libdir ɚ; libdirs ɚ; sitepackages ɚ; prefixes ɚ; getsitepackages ɚ; platlibdir ɚ; PREFIXES ɚ; Lib ɚ; site-packages ɚ; python%d.%d ɚ; lib ɚ; Returns a list containing all global site-packages directories. For each directory present in ``prefixes`` (or the global ``PREFIXES``), this function will find its `site-packages` subdirectory depending on the system environment, and will return a list of full paths. ɚ; V pC C U C \D E E E @C t d t }t r/t j | rt || | S ɚ; user_site ɚ; addusersitepackages ɚ; Processing user site-packages ɚ; Add a per user site-package to sys.path Each user has its own python directory with site-packages in the home directory. ɚ; 1 C C D pC E @E @E C t } t | dant | at S ɚ; getusersitepackages ɚ; ENABLE_USER_SITE ɚ; USER_SITE ɚ; Returns the user-specific site-packages directory path. If the global variable ``USER_SITE`` is not initialized yet, this function will also set it. ɚ; C C 7 E E E @C t t a t S ɚ; getuserbase ɚ; USER_BASE ɚ; Returns the `user base` directory path. The `user base` directory can be used to store data. If the global variable ``USER_BASE`` is not initialized yet, this function will also set it. ɚ; } C 0C * C CD E E E C t j }t j dk r(t j dd }| d| dS t j dk rt j r| dS | d|d d|d d S ɚ; ver_nodot ɚ; userbase ɚ; _get_path ɚ; winver ɚ; /site-packages ɚ; /lib/python ɚ; /lib/python/site-packages ɚ; \site-packages ɚ; \Python ɚ; C C C CD E `E `E C t j dd } | r| S t j dv rd S d }t j dk r-t j d pd} ||d S t j dk r9t j r- |dd t j d t j d d z S |dd S ɚ; env_base ɚ; _getuserbase ɚ; _framework ɚ; .local ɚ; Library ɚ; Python ɚ; APPDATA ɚ; 1 D 0C C E `E E C t j t j j | S ɚ; _getuserbase.<locals>.joinuser ɚ; joinuser ɚ; wasi ɚ; emscripten ɚ; PYTHONUSERBASE ɚ; C C E E E C t j j rdS t t d r?t t d r*t j t j k rdS t t d r?t t d r*t j t j k rdS dS ɚ; check_enableusersite ɚ; no_user_site ɚ; getegid ɚ; getgid ɚ; geteuid ɚ; , Check if user site directory is safe for inclusion The function tests for the command line flag (including environment var), process uid/gid equal to effective uid/gid. None: Disabled for security reasons False: Disabled by user (command line option) True: Safe and enabled ɚ; pC C C 0C @tD E E E C t d| |t }d}nd}t | \ } }||vr4t j | | | t j | }n# t $ r Y dS w xY wd |D }t | D ]}t | || |rd}|S ɚ; sitedircase ɚ; addsitedir ɚ; 3 C pC 0C \D E `E C g | ].}| d | d ,|/S ɚ; addsitedir.<locals>.<listcomp> ɚ; .pth ɚ; Adding directory: ɚ; T Add 'sitedir' argument to sys.path if missing and handle .pth files in 'sitedir' ɚ; C C C pC yD E E E C |t }d}nd}t j | | } t j | }n# t $ r Y dS w xY wt |dd t j z s t |dd t j z rt d| dS t d| t j t j | d }n# t $ r Y dS w xY w|5 t | D ]\ }}| d r | d k r5 | d rt# | [| }t' | | \ } } | |vrSt j | r4t* j | | | # t0 $ r t3 d |dz | t* j ddl } | j t+ j D ]7} | D ] }t3 d|z t* j !8t3 dt* j Y nw xY wddd n # 1 swxY w Y |rd}|S ɚ; record ɚ; sitedir ɚ; addpackage ɚ; exc_info ɚ; format_exception ɚ; traceback ɚ; strip ɚ; FILE_ATTRIBUTE_HIDDEN ɚ; UF_HIDDEN ɚ; Remainder of file ignored ɚ; ɚ; " Error processing line {:d} of {}: ɚ; import ɚ; Processing .pth file: ɚ; Skipping hidden .pth file: ɚ; st_file_attributes ɚ; st_flags ɚ; Process a .pth file within the site-packages directory: For each line in the file, either combine it with sitedir to a path and add that to known_paths, or execute it if it starts with 'import '. ɚ; w C C C pC pD E E E C t } t j D ]Y} t j | r't | \ }}| | J# t $ r Y Vw xY w| S ɚ; itemcase ɚ; _init_pathinfo ɚ; E Return a set containing all existing file system items from sys.path. ɚ; s C 0C C pD E E E C g } t }t j D ]B}t | \ }}||vr*| | | | C| t j dd< |S ɚ; dircase ɚ; known_paths ɚ; L ɚ; removeduppaths ɚ; K Remove duplicate entries from sys.path along with making them absolute ɚ; C 0C C j pC \D E E E C t t j D ]} d} | j j }n3# t $ r& | j j j }n# t $ r Y nw xY wY nw xY w|dvrJ t j | j | _ n # t t t f$ r Y nw xY w t j | j | _ # t t t f$ r Y w xY wdS ɚ; loader_module ɚ; abs_paths ɚ; E Set all module __file__ and __cached__ attributes to an absolute path ɚ; f D pC C a C \D E E E @C t j j | } t j | }n# t $ r Y nw xY w|t j | fS ɚ; makepath ɚ; 1 C C \ pC E @E @E C t j j r t | t j d S d S ɚ; _trace ɚ; <frozen site> ɚ; Append module search paths for third-party packages to sys.path. **************************************************************** * This module is automatically imported during initialization. * **************************************************************** This will append site-specific paths to the module search path. On Unix (including Mac OSX), it starts with sys.prefix and sys.exec_prefix (if different) and appends lib/python<version>/site-packages. On other platforms (such as Windows), it tries each of the prefixes directly, as well as with lib/site-packages appended. The resulting directories, if they exist, are appended to sys.path, and also inspected for path configuration files. If a file named "pyvenv.cfg" exists one directory above sys.executable, sys.prefix and sys.exec_prefix are set to that directory and it is also checked for site-packages (sys.base_prefix and sys.base_exec_prefix will always be the "real" prefixes of the Python installation). If "pyvenv.cfg" (a bootstrap configuration file) contains the key "include-system-site-packages" set to anything other than "false" (case-insensitive), the system-level prefixes will still also be searched for site-packages; otherwise they won't. All of the resulting site-specific directories, if they exist, are appended to sys.path, and also inspected for path configuration files. A path configuration file is a file whose name has the form <package>.pth; its contents are additional directories (one per line) to be added to sys.path. Non-existing directories (or non-directories) are never added to sys.path; no directory is added to sys.path more than once. Blank lines and lines beginning with '#' are skipped. Lines starting with 'import' are executed. For example, suppose sys.prefix and sys.exec_prefix are set to /usr/local and there is a directory /usr/local/lib/python2.5/site-packages with three subdirectories, foo, bar and spam, and two path configuration files, foo.pth and bar.pth. Assume foo.pth contains the following: # foo package configuration foo bar bletch and bar.pth contains: # bar package configuration bar Then the following directories are added to sys.path, in this order: /usr/local/lib/python2.5/site-packages/bar /usr/local/lib/python2.5/site-packages/foo Note that bletch is omitted because it doesn't exist; bar precedes foo because bar.pth comes alphabetically before foo.pth; and spam is omitted because it is not mentioned in either path configuration file. The readline module is also automatically configured to enable completion for systems that support it. This can be overridden in sitecustomize, usercustomize or PYTHONSTARTUP. Starting Python in isolated mode (-I) disables automatic readline configuration. After these operations, an attempt is made to import a module named sitecustomize, which can perform arbitrary additional site-specific customizations. If this import fails with an ImportError exception, it is silently ignored. ɚ; supports_follow_symlinks ɚ; supports_fd ɚ; supports_effective_ids ɚ; supports_dir_fd ɚ; ntpath ɚ; posixpath ɚ; _names ɚ; _collections_abc ɚ; + 0C ЪC T C CD F @E @E C ddl } |j | }t | ||j S ɚ; add_dll_directory ɚ; _add_dll_directory ɚ; O Add a path to the DLL search path. This search path is used when resolving dependencies for imported extension modules (the module itself is resolved through sys.path), and also by ctypes. Remove the directory by calling close() on the returned object or using it in a with statement. ɚ; ЩC PC C F E E C e Zd Zd Zd Zd Zd Zd ZdS ɚ; $ C PC O ZD F E C | j rd | j S dS ɚ; _AddedDllDirectory.__repr__ ɚ; <AddedDllDirectory()> ɚ; <AddedDllDirectory({!r})> ɚ; D C M P\D \D F E `C | d S ɚ; _AddedDllDirectory.__exit__ ɚ; D K ZD F E C | S ɚ; _AddedDllDirectory.__enter__ ɚ; $ D C H ZD F E C | | j d | _ d S ɚ; _AddedDllDirectory.close ɚ; D PC D C pD F E C || _ || _ || _ d S ɚ; remove_dll_directory ɚ; cookie ɚ; _AddedDllDirectory.__init__ ɚ; _remove_dll_directory ɚ; _cookie ɚ; _AddedDllDirectory ɚ; / PC ФC 0 F @E @E C e Zd ZdZej d Zed Z ee Z dS ɚ; ! C C 9 pC \D F E C | t u rt |d S t S ɚ; PathLike.__subclasshook__ ɚ; ТC C 4 ZD F E @C t ɚ; PathLike.__fspath__ ɚ; 9 Return the file system path representation of the object. ɚ; C Abstract base class for implementing the file system path protocol. ɚ; PathLike ɚ; C pC C C CD F `E `E C t | t t f r| S t | } | | }n6# t $ r) t |d r t d|j z w xY wt |t t f r|S t d |j t | j ɚ; path_repr ɚ; path_type ɚ; _fspath ɚ; 7 expected {}.__fspath__() to return str or bytes, not {} ɚ; / expected str, bytes or os.PathLike object, not ɚ; a Return the path representation of a path-like object. If str or bytes is passed in, it is returned unchanged. Otherwise the os.PathLike interface is used to get the path representation. If the path representation is not str or bytes, TypeError is raised. If the provided path is not str, bytes, or os.PathLike, TypeError is raised. ɚ; f pC C C lD F `F `F C t | t s t dt | z dd l}d|vr| | } |j | |||g|R i |S ɚ; & invalid fd type (%s, expected integer) ɚ; C C F E E `C e Zd Zd Zd Zd Zd Zd Zd ZdS ɚ; D 0C ZD F E C t | j S ɚ; _wrap_close.__iter__ ɚ; D C pC \D F E C t | j | S ɚ; _wrap_close.__getattr__ ɚ; D C P\D \D F E `C | d S ɚ; _wrap_close.__exit__ ɚ; D ZD F E C | S ɚ; _wrap_close.__enter__ ɚ; M КC pC 0C \D F E C | j | j }|dk rd S t dk r|S |dz S ɚ; returncode ɚ; _wrap_close.close ɚ; wait ɚ; D pC 0C CD F E C || _ || _ d S ɚ; _wrap_close.__init__ ɚ; _proc ɚ; _stream ɚ; pC C C D F @E @E `C t | t s t dt | z |dvrt d|z |dk s|t d dd l}|dk r4| | dd|j | }t |j | S | | dd|j | }t |j | S ɚ; proc ɚ; cmd ɚ; popen ɚ; _wrap_close ɚ; PIPE ɚ; Popen ɚ; subprocess ɚ; bufsize ɚ; shell ɚ; + popen() does not support unbuffered streams ɚ; invalid mode %r ɚ; w ɚ; & invalid cmd type (%s, expected string) ɚ; # 0C C C pD F @E @E C |d }t | ||dd | S ɚ; spawnlpe ɚ; ] spawnlpe(mode, file, *args, env) -> integer Execute file (which is looked for along $PATH) with arguments from args in a subprocess with the supplied environment. If mode == P_NOWAIT return the pid of the process. If mode == P_WAIT return the process's exit code if it exits normally; otherwise return -SIG, where SIG is the signal that killed it. ɚ; C C pC CD F F F C t | || S ɚ; spawnlp ɚ; W spawnlp(mode, file, *args) -> integer Execute file (which is looked for along $PATH) with arguments from args in a subprocess with the supplied environment. If mode == P_NOWAIT return the pid of the process. If mode == P_WAIT return the process's exit code if it exits normally; otherwise return -SIG, where SIG is the signal that killed it. ɚ; # C C C pD F F F @C |d }t | ||dd | S ɚ; spawnle ɚ; : spawnle(mode, file, *args, env) -> integer Execute file with arguments from args in a subprocess with the supplied environment. If mode == P_NOWAIT return the pid of the process. If mode == P_WAIT return the process's exit code if it exits normally; otherwise return -SIG, where SIG is the signal that killed it. ɚ; C БC pC CD F F F C t | || S ɚ; spawnl ɚ; spawnl(mode, file, *args) -> integer Execute file with arguments from args in a subprocess. If mode == P_NOWAIT return the pid of the process. If mode == P_WAIT return the process's exit code if it exits normally; otherwise return -SIG, where SIG is the signal that killed it. ɚ; PC C C pD F F F C t | |||t S ɚ; spawnvpe ɚ; \ spawnvpe(mode, file, args, env) -> integer Execute file (which is looked for along $PATH) with arguments from args in a subprocess with the supplied environment. If mode == P_NOWAIT return the pid of the process. If mode == P_WAIT return the process's exit code if it exits normally; otherwise return -SIG, where SIG is the signal that killed it. ɚ; C PC pC CD F F F C t | ||dt S ɚ; spawnvp ɚ; 8 spawnvp(mode, file, args) -> integer Execute file (which is looked for along $PATH) with arguments from args in a subprocess. If mode == P_NOWAIT return the pid of the process. If mode == P_WAIT return the process's exit code if it exits normally; otherwise return -SIG, where SIG is the signal that killed it. ɚ; ЏC C s C pD F F F @C t | |||t S ɚ; spawnve ɚ; : spawnve(mode, file, args, env) -> integer Execute file with arguments from args in a subprocess with the specified environment. If mode == P_NOWAIT return the pid of the process. If mode == P_WAIT return the process's exit code if it exits normally; otherwise return -SIG, where SIG is the signal that killed it. ɚ; C ЎC j pC CD F F F C t | ||dt S ɚ; spawnv(mode, file, args) -> integer Execute file with arguments from args in a subprocess. If mode == P_NOWAIT return the pid of the process. If mode == P_WAIT return the process's exit code if it exits normally; otherwise return -SIG, where SIG is the signal that killed it. ɚ; 0C C `C O C @D F @F @F C t |t t f st d |r|d st d t }|s8 | ||| n |||| d S d S # t d Y d S xY w| t k r|S t |d \ }}t | r$t | S ɚ; sts ɚ; wpid ɚ; pid ɚ; func ɚ; _spawnvef ɚ; waitstatus_to_exitcode ɚ; WIFSTOPPED ɚ; waitpid ɚ; " argv first element cannot be empty ɚ; argv must be a tuple or a list ɚ; P_NOWAITO ɚ; P_NOWAIT ɚ; P_WAIT ɚ; spawnv ɚ; fork ɚ; 9 C PC " C C F F F C t j t j fd} fd}| |fS ɚ; _fscodec ɚ; getfilesystemencodeerrors ɚ; > ЉC pC 2 0C C F VG F C t | } t | t r| S | S ɚ; _fscodec.<locals>.fsdecode ɚ; Decode filename (an os.PathLike, bytes, or str) from the filesystem encoding with 'surrogateescape' error handler, return str unchanged. On Windows, use 'strict' error handler if the file system encoding is 'mbcs' (which is the default encoding). ɚ; > PC C & 0C C F WG F C t | } t | t r| S | S ɚ; _fscodec.<locals>.fsencode ɚ; Encode filename (an os.PathLike, bytes, or str) to the filesystem encoding with 'surrogateescape' error handler, return bytes unchanged. On Windows, use 'strict' error handler if the file system encoding is 'mbcs' (which is the default encoding). ɚ; PC C ІC \D F @!F @!F C t | | S ɚ; getenvb ɚ; Get an environment variable, return None if it doesn't exist. The optional second argument can specify an alternate default. key, default and the result are bytes. ɚ; < PC C C F #F #F @C t | t s$t dt | j z | S ɚ; _check_bytes ɚ; bytes expected, not %s ɚ; C ЄC ІC \D F `%F `%F C t | | S ɚ; getenv ɚ; Get an environment variable, return None if it doesn't exist. The optional second argument can specify an alternate default. key, default and the result are str. ɚ; 0C ЃC PC C F `(F `(F C t dk rAd } | t }fd}i }t D ]\ }}|| || < n&t j fdfd}}t }t |||| S ɚ; _createenviron ɚ; C pC 0C C F )F C | d S ɚ; _createenviron.<locals>.decode ɚ; Q pC C 0C C F `+F C t | t s$t dt | j z | d S ɚ; _createenviron.<locals>.encode ɚ; D PC C C F GF ,F ~C | S ɚ; ! _createenviron.<locals>.encodekey ɚ; < ~C 0~C C F .F `.F }C t | t s$t dt | j z | S ɚ; ! _createenviron.<locals>.check_str ɚ; check_str ɚ; str expected, not %s ɚ; + 0}C |C F @GF @GF {C e Zd Zd Zd Zd Zd Zd Zd Zd Z d Z d Z d Z d Z d Zd S ɚ; C D 0{C zC CD F 1F zC t |t st S t | }| | |S ɚ; _Environ.__ror__ ɚ; C D 0{C zC CD F `3F zC t |t st S t | }| | |S ɚ; _Environ.__or__ ɚ; D yC yC \D F 4F `yC | | | S ɚ; _Environ.__ior__ ɚ; D 0yC CD F G 5F xC || vr|| |< | | S ɚ; _Environ.setdefault ɚ; D xC ZD F 7F `xC t | S ɚ; _Environ.copy ɚ; @ xC wC wC 6D F 8F wC d fd j D }d| dS ɚ; formatted_items ɚ; _Environ.__repr__ ɚ; }) ɚ; environ({ ɚ; < vC vC 3 0vC ,D F ;F uC K | ]4\ }} | d | V 5dS ɚ; $ _Environ.__repr__.<locals>.<genexpr> ɚ; D PuC ZD F `<F uC t | j S ɚ; _Environ.__len__ ɚ; 5 D tC # tC CD F >F tC K t | j }|D ]}| | V d S ɚ; _Environ.__iter__ ɚ; N D sC `sC 0sC CD F @F rC | | }t | | j |= d S # t $ r t | d w xY w ɚ; encodedkey ɚ; _Environ.__delitem__ ɚ; unsetenv ɚ; G D PrC 0yC CD F BF qC | | }| | }t || || j |< d S ɚ; _Environ.__setitem__ ɚ; putenv ɚ; V D pqC qC 0yC CD F DF pC | j | | }n # t $ r t | d w xY w| | S ɚ; _Environ.__getitem__ ɚ; & D 0pC oC @tD F EF `oC || _ || _ || _ || _ || _ d S ɚ; _Environ.__init__ ɚ; _data ɚ; decodevalue ɚ; encodevalue ɚ; decodekey ɚ; encodekey ɚ; _Environ ɚ; oC PnC mC k pmC pD F F F kC ddl }| t } | 5 | dt | d }n# t $ r d}Y nw xY wt rZ | d }|t d |}n# t t f$ r Y nw xY w|$t |t rt | }ddd n # 1 swxY w Y |t }| t S ɚ; path_listb ɚ; supports_bytes_environ ɚ; simplefilter ɚ; catch_warnings ɚ; * env cannot contain 'PATH' and b'PATH' keys ɚ; PATH ɚ; Returns the sequence of directories that will be searched for the named executable (similar to a shell) when launching a process. *env* must be an environment variable dict or None. If *env* is None, os.environ will be used. ɚ; PkC jC @jC K iC 9D F SF SF `hC | t }||f}nt }|f}t }t j | r || g|R d S d }t | }t dk r$t | } t t | }|D ]Y}t j || } ||g|R "# t t f$ r } | } Y d } ~ :d } ~ wt $ r} | } || }Y d } ~ Rd } ~ ww xY w||| ɚ; last_exc ɚ; saved_exc ɚ; argrest ɚ; exec_func ɚ; 0hC gC @ gC CD F VF VF `gC t | || dS ɚ; execvpe(file, args, env) Execute the executable file (which is searched for along $PATH) with argument list args and environment env, replacing the current process. args may be a list or tuple of strings. ɚ; 0gC gC 8 fC \D F XF XF fC t | | dS ɚ; _execvpe ɚ; execvp(file, args) Execute the executable file (which is searched for along $PATH) with argument list args, replacing the current process. args may be a list or tuple of strings. ɚ; $ pfC 0fC / gC CD F UF UF eC |d }t | |dd | dS ɚ; execlpe ɚ; execvpe ɚ; execlpe(file, *args, env) Execute the executable file (which is searched for along $PATH) with argument list args and environment env, replacing the current process. ɚ; eC PeC ( fC \D F @XF @XF eC t | | dS ɚ; execlp ɚ; execvp ɚ; execlp(file, *args) Execute the executable file (which is searched for along $PATH) with argument list args, replacing the current process. ɚ; $ dC dC gC CD F ZF ZF dC |d }t | |dd | dS ɚ; env ɚ; execle ɚ; execle(file, *args, env) Execute the executable file with argument list args and environment env, replacing the current process. ɚ; cC cC fC \D F \F \F `cC t | | dS ɚ; execl ɚ; execv ɚ; p execl(file, *args) Execute the executable file with argument list args, replacing the current process. ɚ; cC PbC aC # aC `C F `gF `gF ]C K t | }g }g }|s|rd ng } |D ]} | j } |rt | } | r-| | | | | n| | r# t $ r> | r| | n# t $ r Y nw xY wY w xY w|r|||| fV | |nt || D ]} |s4|rt | | d } n | J | \ } } | d } t | t t z | } n$# t $ r}| || Y d }~ud }~ww xY w |s"t j | t | r/t j || }t | ||||| E d {V t! | # t! | w xY w|s |||| fV d S d S ɚ; err ɚ; dirfd ɚ; entries ɚ; isbytes ɚ; toppath ɚ; \C [C [C # P[C lD F gF gF ZC K t j d| |||| t | } |st | d| }t | t t z | } |s;t j |j rOt j |t | r-t || t | t ||| E d{V t | dS # t | w xY w ɚ; topfd ɚ; orig_st ɚ; fwalk ɚ; _fwalk ɚ; O_NONBLOCK ɚ; O_RDONLY ɚ; os.fwalk ɚ; Directory tree generator. This behaves exactly like walk(), except that it yields a 4-tuple dirpath, dirnames, filenames, dirfd `dirpath`, `dirnames` and `filenames` are identical to walk() output, and `dirfd` is a file descriptor referring to the directory `dirpath`. The advantage of fwalk() over walk() is that it's safe against symlink races (when follow_symlinks is False). If dir_fd is not None, it should be a file descriptor open to a directory, and top should be relative; top will then be relative to that directory. (dir_fd is always supported for fwalk.) Caution: Since fwalk() yields file descriptors, those are only valid until the next iteration step, so you should dup() them if you want to keep them for a longer period. Example: import os for root, dirs, files, rootfd in os.fwalk('python/Lib/email'): print(root, "consumes", end="") print(sum(os.stat(name, dir_fd=rootfd).st_size for name in files), end="") print("bytes in", len(files), "non-directory files") if 'CVS' in dirs: dirs.remove('CVS') # don't visit CVS directories ɚ; dir_fd ɚ; follow_symlinks ɚ; +D pYC XC # Y WC WC F vF vF SC K g }g }g } t | }n%# t $ r}| || Y d }~d S d }~ww xY w|5 t | } n# t $ r Y nw xY wn0# t $ r#}| || Y d }~d d d d S d }~ww xY w | } n# t $ r d} Y nw xY w| r| | j n| | j |sN| rL|rd} n+ | } n# t $ r d} Y nw xY w| } | r| | j d d d n # 1 swxY w Y |rW| ||fV t j t j }} |D ]3} || | }|s | | st |||| E d {V 4d S |D ]}t |||| E d {V | ||fV d S ɚ; walk_into ɚ; error ɚ; scandir_it ɚ; walk_dirs ɚ; nondirs ɚ; is_symlink ɚ; is_dir ɚ; 8 SC PSC RC pD F `vF `vF RC t j d| ||| t t | ||| S ɚ; followlinks ɚ; onerror ɚ; topdown ɚ; walk ɚ; _walk ɚ; audit ɚ; os.walk ɚ; & Directory tree generator. For each directory in the directory tree rooted at top (including top itself, but excluding '.' and '..'), yields a 3-tuple dirpath, dirnames, filenames dirpath is a string, the path to the directory. dirnames is a list of the names of the subdirectories in dirpath (including symlinks to directories, and excluding '.' and '..'). filenames is a list of the names of the non-directory files in dirpath. Note that the names in the lists are just names, with no path components. To get a full path (which begins with top) to a file or directory in dirpath, do os.path.join(dirpath, name). If optional arg 'topdown' is true or not specified, the triple for a directory is generated before the triples for any of its subdirectories (directories are generated top down). If topdown is false, the triple for a directory is generated after the triples for all of its subdirectories (directories are generated bottom up). When topdown is true, the caller can modify the dirnames list in-place (e.g., via del or slice assignment), and walk will only recurse into the subdirectories whose names remain in dirnames; this can be used to prune the search, or to impose a specific order of visiting. Modifying dirnames when topdown is false has no effect on the behavior of os.walk(), since the directories in dirnames have already been generated by the time dirnames itself is generated. No matter the value of topdown, the list of subdirectories is retrieved before the tuples for the directory and its subdirectories are generated. By default errors from the os.scandir() call are ignored. If optional arg 'onerror' is specified, it should be a function; it will be called with one argument, an OSError instance. It can report the error to continue with the walk, or raise the exception to abort the walk. Note that the filename is available as the filename attribute of the exception object. By default, os.walk does not follow symbolic links to subdirectories on systems that support them. In order to get this functionality, set the optional argument 'followlinks' to true. Caution: if you pass a relative pathname for top, don't change the current working directory between resumptions of walk. walk never changes the current directory, and assumes that the client doesn't either. Example: import os from os.path import join, getsize for root, dirs, files in os.walk('python/Lib/email'): print(root, "consumes ") print(sum(getsize(join(root, name)) for name in files), end=" ") print("bytes in", len(files), "non-directory files") if 'CVS' in dirs: dirs.remove('CVS') # don't visit CVS directories ɚ; PRC QC QC PQC pD F F F `PC t j | \ }}|r%|r#t j | st | t | | t j | \ }}|r%|r% t | dS # t $ r Y dS w xY wdS dS ɚ; renames ɚ; < renames(old, new) Super-rename; create directories as necessary and delete any left empty. Works like rename, except creation of any intermediate directories needed to make the new pathname good is attempted first. After the rename, directories corresponding to rightmost path segments of the old name will be pruned until either the whole path is consumed or a nonempty directory is found. Note: this function can fail with the new directory structure made if you lack permissions needed to unlink the leaf directory or file. ɚ; 0PC OC OC POC CD F @F @F @NC t | t j | \ }}|st j | \ }}|rA|rA t | n# t $ r Y dS w xY wt j | \ }}|r|=dS dS dS dS ɚ; removedirs ɚ; removedirs(name) Super-rmdir; remove a leaf directory and all empty intermediate ones. Works like rmdir except that, if the leaf directory is successfully removed, directories corresponding to rightmost path segments will be pruned away until either the whole path is consumed or an error occurs. Errors during this latter phase are ignored -- they generally mean that a directory was not empty. ɚ; MC pMC MC LC @tD F F F @KC t j | \ }}|st j | \ }}|rr|rpt j | s\ t || n# t $ r Y nw xY wt }t |t rt t d }||k rdS t | | dS # t $ r |rt j | s Y dS w xY w ɚ; cdir ɚ; makedirs ɚ; exist_ok ɚ; makedirs(name [, mode=0o777][, exist_ok=False]) Super-mkdir; create a leaf directory and all intermediate ones. Works like mkdir, except that any intermediate path segment (not just the rightmost) will be created if it does not exist. If the target directory already exists, raise an OSError if exist_ok is False. Otherwise no exception is raised. This is recursive. ɚ; MS_WINDOWS ɚ; HAVE_LSTAT ɚ; HAVE_LUTIMES ɚ; HAVE_LCHOWN ɚ; lchown ɚ; HAVE_LCHMOD ɚ; chflags ɚ; HAVE_LCHFLAGS ɚ; HAVE_FSTATVFS ɚ; fstatvfs ɚ; statvfs ɚ; pathconf ɚ; HAVE_FPATHCONF ɚ; HAVE_FUTIMES ɚ; HAVE_FUTIMENS ɚ; HAVE_FTRUNCATE ɚ; execve ɚ; HAVE_FEXECVE ɚ; scandir ɚ; HAVE_FDOPENDIR ɚ; HAVE_FCHOWN ɚ; HAVE_FCHMOD ɚ; chdir ɚ; HAVE_FCHDIR ɚ; HAVE_UTIMENSAT ɚ; rmdir ɚ; HAVE_UNLINKAT ɚ; symlink ɚ; HAVE_SYMLINKAT ɚ; rename ɚ; HAVE_RENAMEAT ɚ; HAVE_READLINKAT ɚ; HAVE_OPENAT ɚ; mknod ɚ; HAVE_MKNODAT ɚ; mkfifo ɚ; HAVE_MKFIFOAT ɚ; HAVE_MKDIRAT ɚ; link ɚ; HAVE_LINKAT ɚ; utime ɚ; HAVE_FUTIMESAT ɚ; HAVE_FSTATAT ɚ; chown ɚ; HAVE_FCHOWNAT ɚ; chmod ɚ; HAVE_FCHMODAT ɚ; access ɚ; HAVE_FACCESSAT ɚ; > D JC h pJC \D F F F JC |t v r0| t v r)t t | d S d S d S ɚ; _add ɚ; _set ɚ; _globals ɚ; os.path ɚ; no os specific module found ɚ; ɚ; _have_functions ɚ; _exit ɚ; ? IC pIC IC , HC F @F @F `HC t | j S # t $ r d t | D cY S w xY w ɚ; _get_exports_list ɚ; 0HC 0 GC \D F F GC g | ]}|d dk |S ɚ; % _get_exports_list.<locals>.<listcomp> ɚ; D PGC ) P%D F F F GC | t v S ɚ; _exists ɚ; <frozen os> ɚ; fdopen ɚ; get_exec_path ɚ; linesep ɚ; N OS routines for NT or Posix depending on what system we're on. This exports: - all functions from posix or nt, e.g. unlink, stat, etc. - os.path is either posixpath or ntpath - os.name is either 'posix' or 'nt' - os.curdir is a string representing the current directory (always '.') - os.pardir is a string representing the parent directory (always '..') - os.sep is the (or a most common) pathname separator ('/' or '\\') - os.extsep is the extension separator (always '.') - os.altsep is the alternate pathname separator (None or '/') - os.pathsep is the component separator used in $PATH etc - os.linesep is the line separator in text files ('\r' or '\n' or '\r\n') - os.defpath is the default search path for executables - os.devnull is the file path of the null device ('/dev/null', etc.) Programs that import and use 'os' stand a better chance of being portable between different platforms. Of course, they must then only use functions that are defined by all platforms (e.g., unlink and opendir), and leave all pathname manipulation to os.path (e.g., split and join). ɚ; T >C 0>C =C P=C =C F ^G ^G ;C | st d t t t j | } t | d t rd d nd d fd| D } t fd| D \ }n # t $ r t d d w xY w fd |D }t | }t | }|}t | D ] \ }}||| k r |d | } n |r n d d }| | z S # t t f$ r t j d g| R w xY wɚ; :C % :C @:C F F 9C g | ]}fd |D S ɚ; % 9C @:C F F @9C g | ] }||k | S ɚ; 9C 3 ! 8C @:C F `F `8C K | ]}|d d k V d S ɚ; 08C 7C @:C F F 7C g | ]}| S ɚ; > 6C 06C 5C p5C @bD F ^G ^G 3C | st d t j | } t | t rd}d}d}nd}d}d}||}nt j | } d t | | D }d t | | D }t t ||g }|gt | |z z ||d z }|s|S t | S # t t t t f$ r t j d | | w xY w ɚ; p3C \D F @G 3C g | ]}||S ɚ; p3C \D F @G 2C g | ]}||S ɚ; u p2C 1C 1C 0C yD F F F .C t | t rd}d}d}nd}d}d}t | r |dd }|} |r0| | \ }}}|r||k r%||k r/| r*t | \ } }||k rt | || } n|} Zt | | } t j | } t j | j } n# t $ r |r d} Y nw xY w| s| } | |v r4|| } | |rt j | nt | | dfS d || < t | t j | || \ } } | st | | dfS | || < |0| d fS ɚ; is_link ɚ; newpath ɚ; A .C 0.C -C pD F `_G `_G `-C t j | } t | dd | |i \ }}t | S ɚ; ok ɚ; _joinrealpath ɚ; l Return the canonical path of the specified filename, eliminating any symbolic links encountered in the path. ɚ; 0-C ,C p,C \D F `G `G +C t j | } t | sLt | t rt j }nt j }t || } t | S ɚ; Return an absolute path. ɚ; 0+C *C ^ 0*C @bD F aG aG (C t j | } t | t r d}d}d}d}nd}d}d}d}| |k r|S | | }|r2| |d z r| |d z sd }| | }g }|D ]M}|||fv r ||k s|s|r|r"|d |k r| | 7|r| N|}| | } |r||z | z } | p|S ɚ; comp ɚ; new_comps ɚ; initial_slashes ɚ; dotdot ɚ; empty ɚ; p P(C 'C PD F aG aG `'C t j | } t | t r5t j t t j | pdS t | pdS ɚ; &C %C %C % %C $C F `aG `aG "C t j | } t | t rSd| vr| S t s ddl}| d|j at j }d}d}t t dd }nHd| vr| S t s ddl}| d |j a t j }d }d }t j }d} || | }|sn| d \ }}| d } | | r | | r | d d } |7t j t j t j | } n|| } | |d } | d| | z } t% | }| | z } n# t& $ r |}Y nw xY w| S ɚ; j ɚ; end ɚ; group ɚ; span ɚ; _varprog ɚ; re ɚ; _varprogb ɚ; \$(\w+|\{[^}]*\}) ɚ; Z Expand shell variables of form $var and ${var}. Unknown variables are left unchanged. ɚ; !C !C C C @bD F aG aG C t j | } t | t rd}nd}| | s| S t | }| |d }|dk rt | }|dk rxdt j vrW ddl }n# t $ r | cY S w xY w | t j j }n# t $ r | cY S w xY wt j d }nw ddl }n# t $ r | cY S w xY w| d| }t |t rt |d } | | }n# t $ r | cY S w xY w|j }|t" j dk r| S t | t rt j | }d }nd }| | }|| |d z p|S ɚ; pwent ɚ; getpwnam ɚ; pw_dir ɚ; getuid ɚ; getpwuid ɚ; pwd ɚ; vxworks ɚ; ASCII ɚ; HOME ɚ; O Expand ~ and ~user constructions. If user or $HOME is unknown, do nothing. ɚ; P C C @ C C @D F aG aG `C t j | }t j |j rdS n# t t f$ r Y dS w xY wt j | } t | t rt | d }nt | d }t | } t j | }n# t t f$ r Y dS w xY w|j }|j }||k rdS |j }|j }||k rdS dS ɚ; ino2 ɚ; ino1 ɚ; dev2 ɚ; dev1 ɚ; $ Test whether a path is a mount point ɚ; 1 0C C C PD F bG bG C t j | n# t t f$ r Y dS w xY wdS ɚ; N C PC C C \D F `bG `bG @C t j | }n # t t t f$ r Y dS w xY wt j |j S ɚ; & Test whether a path is a symbolic link ɚ; u C C PC pD F KK KK C t j | } t | }| | dz }| d| }|r+||t | z k r| | }|S ɚ; F pC C C CD F TJ TJ `C t j | } t | }| | dz }| |d S ɚ; ! 0C C C F bG bG @C t j | } | dd | fS ɚ; J Split a pathname into drive and path. On Posix, drive is always empty. ɚ; J C C u PC CD F bG bG C t j | } t | t rd}d}nd}d}t j | |d | S ɚ; C C d 0C D F G G `C t j | } t | }| | dz }| d| | |d }}|r+||t | z k r| | }||fS ɚ; Split a pathname. Returns tuple "(head, tail)" where "tail" is everything after the final slash. Either part may be empty. ɚ; C C @C G C D F C t j | } t | }| } |s |dd |z t t j | D ]?}| | r|}|r| | r||z }7|||z z }@n/# t t t f$ r t j d| g|R w xY w|S ɚ; Join two or more pathname components, inserting '/' as needed. If any component is an absolute path, all previous path components will be discarded. An empty last part will result in a path that ends with a separator. ɚ; 9 C 0 C < C \D F cG cG C t j | } t | }| | S ɚ; P C C 4 C F `cG `cG C t j | S ɚ; 6 Normalize case of pathname. Has no effect under Posix ɚ; C P C ) PD F `F `F C t | t rdS dS ɚ; _get_sep ɚ; <frozen posixpath> ɚ; /dev/null ɚ; /bin:/usr/bin ɚ; Common operations on Posix pathnames. Instead of importing this module directly, import os and refer to this module as os.path. The "os.path" name is an alias for this module on Posix systems; on other systems (e.g. Windows), os.path provides the same operations in a manner specific to that platform, and is an alias to another module (e.g. ntpath). Some of this can actually be useful on non-Posix systems too, e.g. for manipulation of the pathname component of URLs. ɚ; _winapi ɚ; _isdir ɚ; B B B B B ^G ^G ^G B | st d t t t j | } t | d t rdd d ndd d fd | D }fd |D } t fd |D \ }n # t $ r t d d w xY wt t d |D dk rt d t | d \ }}| } fd|D } fd|D }t | }t | }t | D ] \ } } | || k r |d | } n |d t | }|r|z n|} | | z S # t t" f$ r t% j dg| R w xY w ɚ; common ɚ; split_paths ɚ; drivesplits ɚ; B @ :C @:C ^G F 9C g | ]}fd |D S ɚ; @ 9C @:C ^G F @9C g | ] }||k | S ɚ; ) commonpath.<locals>.<listcomp>.<listcomp> ɚ; > 9C @:C ^G F B g | ] }||k | S ɚ; Paths don't have the same drive ɚ; D 3 9 PB CD ^G `F B K | ] \ }}|V d S ɚ; % Can't mix absolute and relative paths ɚ; 9C 3 2 B ,D ^G `F B K | ]\ }}|d d k V d S ɚ; commonpath.<locals>.<genexpr> ɚ; 08C / B ,D ^G F B g | ]\ }}| S ɚ; = B . 0B ?D ^G F B g | ]7}t | 8S ɚ; commonpath.<locals>.<listcomp> ɚ; % commonpath() arg is an empty sequence ɚ; D Given a sequence of path names, returns the longest common sub-path. ɚ; B PB B PB WC ^G ^G ^G B t j | } t | t rd}d}d}nd}d}d}||}| st d t j | } t t | }t t | }t | \ }}t | \ } } t | t | k rt d | d | d | | D } d | | D } d } t | | D ],\ }}t | t | k r n| dz } -|gt | | z z | | d z }|s|S t | S # t t t t t f$ r t# j d| | w xY w ɚ; rel_list ɚ; e2 ɚ; e1 ɚ; path_list ɚ; start_list ɚ; path_rest ɚ; path_drive ɚ; start_rest ɚ; start_drive ɚ; path_abs ɚ; start_abs ɚ; p3C \D ^G @G B g | ]}||S ɚ; p3C \D ^G @G B g | ]}||S ɚ; relpath.<locals>.<listcomp> ɚ; , start on mount ɚ; path is on mount ɚ; no path specified ɚ; # Return a relative version of a path ɚ; getwindowsversion ɚ; B PB B PB _D ^G `_G `_G B t | } t | t rSd}d}d}t j }t | t t j t k rdS n@d}d}d}t j }t | t t k rdS | | }|s t | st || } t | } d }np# t $ r8}|r t t | d t | } Y d }~n3d }~wt $ r#}|r |j }t# | } Y d }~nd }~ww xY w|s| | r| | r|| t% | d z } n| t% | d } t | | k r| } n6# t $ r }Y d }~n'd }~wt $ r}|j |k r| } Y d }~nd }~ww xY w| S ɚ; spath ɚ; initial_winerror ɚ; had_prefix ɚ; new_unc_prefix ɚ; \\.\NUL ɚ; \\?\ ɚ; pB B B q 0B @tD ^G G G B d}| d d }| r t | } |rt | | n| S # t $ r}|j |vr t | }|| k r|rt || n|cY d }~S n# t $ r Y nw xY wt | \ } }| r |s | |z cY d }~S |rt || n|}Y d }~nd }~ww xY w| |S ɚ; new_path ɚ; _getfinalpathname_nonstrict ɚ; B B B G 0B D ^G G G B d}t }t | |vr| t | | }t | } t | s<t | s|} nht t t | | } n,# t $ r}|j |v rY d }~n% d }~wt $ r Y nw xY wt | |v| S ɚ; ex ɚ; old_path ɚ; allowed_winerror ɚ; _readlink_deep ɚ; winerror ɚ; _nt_readlink ɚ; readlink ɚ; _getfinalpathname ɚ; D B PB B : PD ^G `G `G B t t | S # t t f$ r t | cY S w xY wɚ; & Return the absolute version of a path. ɚ; _getfullpathname ɚ; PB ,C " p,C \D ^G G G B t j | } t | sLt | t rt j }nt j }t || } t | S ɚ; cwd ɚ; _abspath_fallback ɚ; getcwdb ɚ; Return the absolute version of a path as a fallback function in case `nt._getfullpathname` is not available or raises OSError. See bpo-31047 for more. ɚ; t 0B B B @D ^G aG aG B t j | } t | t r d}d}d}d}nd}d}d}d}| || } t | \ }} | | r||z }| | } | | }d }|t | k r|| r || |k r||= n\|| |k rK|d k r ||d z |k r||d z |d z = |d z }n*|d k r| | r||= n |d z }n|d z }|t | k |s|s| | || | z S ɚ; comps ɚ; p P(C 'C PD ^G aG aG `'C t j | } t | t r5t j t t j | pdS t | pdS ɚ; 0 Normalize path, eliminating double slashes, etc. ɚ; _path_normpath ɚ; pB B B | B @B ^G `aG `aG B t j | } t | t rOd| vrd| vr| S ddl}t |j |j z dz d }d}d}d}d }d}t t d d }n6d | vrd | vr| S ddl}|j |j z dz }d }d }d}d}d }t j }| dd } d} t | } | | k r | | | dz } | |k re| | dz d } t | } | | } | | | d| dz z z } n# t $ r | | | z z } | dz } Y nw xY w| |k r| | dz | dz |k r | | z } | dz } n`| | dz d } t | } | | } | d| } |7t j t j t j | }n|| }n# t $ r || z |z }Y nw xY w| |z } n# t $ r | || z z } | dz } Y nw xY w| |k r| | dz | dz |k r | | z } | dz } n}| | dz | dz |k r| | dz d } t | } | | } | d| } |7t j t j t j | }n|| }n# t $ r ||z | z |z }Y nw xY w| |z } n# t $ r | ||z | z z } | dz } Y nw xY w| dd } | dz } | | | dz } | r!| |v r | | z } | dz } | | | dz } | r| |v |7t j t j t j | }n|| }n# t $ r || z }Y nw xY w| |z } | r| dz } n| | z } | dz } | | k | S ɚ; var ɚ; pathlen ɚ; res ɚ; dollar ɚ; rbrace ɚ; brace ɚ; percent ɚ; quote ɚ; varchars ɚ; digits ɚ; ascii_letters ɚ; string ɚ; ' ɚ; $ ɚ; environb ɚ; _- ɚ; f Expand shell variables of the forms $var, ${var} and %var%. Unknown variables are left unchanged. ɚ; pB B B ? B @D ^G aG aG B t j | } t | t rd}nd}| | s| S dt | }}||k r9| | t | vr"|dz }||k r| | t | v"dt j v rt j d }nVdt j vr| S t j d }n# t $ r d}Y nw xY wt |t j d }|dk r| d| }t |t rt j | }t j d }||k r2|t | k r| S t t | | }t | t rt j | }|| |d z S ɚ; current_user ɚ; target_user ɚ; drive ɚ; userhome ɚ; tilde ɚ; USERNAME ɚ; HOMEDRIVE ɚ; HOMEPATH ɚ; USERPROFILE ɚ; ~ ɚ; L Expand ~ and ~user constructs. If user or $HOME is unknown, do nothing. ɚ; B 0B " B @tD ^G aG aG B t j | } t | }t | } t | \ }}|r|d |v r| p||v S |r||v rdS t ra| | }t | | }| | k S dS ɚ; y ɚ; a Test whether a path is a mount point (a drive root, the root of a share, or a mounted volume) ɚ; _getvolumepathname ɚ; 1 0C C C C \D ^G bG bG @B t j | }n# t t f$ r Y dS w xY wdS ɚ; C Test whether a path exists. Returns True for broken symbolic links ɚ; N B PC C C \D ^G `bG `bG B t j | }n # t t t f$ r Y dS w xY wt j |j S ɚ; S_ISLNK ɚ; lstat ɚ; h Test whether a path is a symbolic link. This will always return false for Windows prior to 6.0. ɚ; PB 08C C ^G KK KK B t | d S ɚ; - Returns the directory component of a pathname ɚ; B 08C C ^G TJ TJ B t | d S ɚ; ) Returns the final component of a pathname ɚ; X pB C C ^G bG bG B t j | } t | t rt j | ddd S t j | ddd S ɚ; B PB B @tD ^G G G B t j | } t | }t | \ }} t | }|r!| |dz |vr|dz }|r | |dz |v| d| | |d }}| | p|}||z |fS ɚ; ~ Split a pathname. Return tuple (head, tail) where tail is everything after the final slash. Either part may be empty. ɚ; . pB B pB @bD ^G bG bG B t j | } t | dk rt | t r d}d}d}d}nd}d}d}d }| || }|d d |dz k r|d d |k rd nd}| || }|d k r | | d d fS | ||dz }|d k r | | d d fS | d | | |d fS |dd |k r| d d | dd fS | d d | fS ɚ; index2 ɚ; normp ɚ; unc_prefix ɚ; find ɚ; upper ɚ; \\?\UNC\ ɚ; Split a pathname into drive/UNC sharepoint and relative path specifiers. Returns a 2-tuple (drive_or_unc, path); either part may be empty. If you assign result = splitdrive(p) It is always true that: result[0] + result[1] == p If the path contained a drive letter, drive_or_unc will contain everything up to and including the colon. e.g. splitdrive("c:/dir") returns ("c:", "/dir") If the path contained a UNC path, the drive_or_unc will contain the host name and share up to but not including the fourth directory separator character. e.g. splitdrive("//host/computer/dir") returns ("//host/computer", "/dir") Paths cannot contain both a drive letter and a UNC path. ɚ; D PB B `B k B _D ^G B t j | } t | t rd}d}d}nd}d}d} |s | d d |z t | \ }}t t j | D ]x}t | \ }} | r| d |v r |s|s|}| })|r7||k r1| | k r|}| }`|}|r|d |vr||z }|| z }y|r"|d |vr|r|dd |k r||z |z S ||z S # t t t f$ r t j d | g|R w xY wɚ; p_path ɚ; p_drive ɚ; result_path ɚ; result_drive ɚ; colon ɚ; seps ɚ; paths ɚ; genericpath ɚ; BytesWarning ɚ; B B W PB pD ^G cG cG B t j | } t | t rd}d}d}nd}d}d}| dd || } | | s| |d rd S d S ɚ; colon_sep ɚ; :\ ɚ; Test whether a path is absolute ɚ; B B F C ^G `cG `cG B t j | } t | t rLt j t j | dd S | dd S ɚ; fsdecode ɚ; fsencode ɚ; B B 3 B \D ^G `cG `cG B t j | } | s| S t | t rnt j }| |d dd } t t t | } | |d S t t t | dd S ɚ; _LCMAP_LOWERCASE ɚ; _LOCALE_NAME_INVARIANT ɚ; _LCMapStringEx ɚ; getfilesystemencoding ɚ; surrogateescape ɚ; n Normalize case of pathname. Makes all characters lowercase and all slashes into backslashes. ɚ; LCMAP_LOWERCASE ɚ; LOCALE_NAME_INVARIANT ɚ; LCMapStringEx ɚ; B P C # PD ^G ]G ]G @B t | t rdS dS ɚ; _get_bothseps ɚ; <frozen ntpath> ɚ; \/ ɚ; commonpath ɚ; relpath ɚ; supports_unicode_filenames ɚ; realpath ɚ; devnull ɚ; defpath ɚ; pathsep ɚ; pardir ɚ; curdir ɚ; abspath ɚ; normpath ɚ; expandvars ɚ; expanduser ɚ; ismount ɚ; lexists ɚ; islink ɚ; splitext ɚ; splitdrive ɚ; isabs ɚ; normcase ɚ; nul ɚ; .;C:\bin ɚ; ; ɚ; .. ɚ; Common pathname manipulations, WindowsNT/95 version. Instead of importing this module directly, import os and refer to this module as os.path. ɚ; p B PB B D `G gG gG B dx}}|D ]P}t |t rd}t |t rd}2t | d|j j d |r|rt d d d S d S ɚ; hasbytes ɚ; hasstr ɚ; funcname ɚ; _check_arg_types ɚ; . Can't mix strings and bytes in path components ɚ; ; () argument must be str, bytes, or os.PathLike object, not ɚ; B PB y жB @D `G lG lG B | | }|r%| | }t || }| | }||k r;|dz }||k r0| ||dz |k r| d| | |d fS |dz }||k 0| | dd fS ɚ; filenameIndex ɚ; dotIndex ɚ; altsepIndex ɚ; sepIndex ɚ; extsep ɚ; altsep ɚ; _splitext ɚ; Split the extension from a pathname. Extension is everything from the last dot to the end, ignoring leading dots. Returns "(root, ext)"; ext may be empty. ɚ; 9 B PB k B pD `G G G B t j | }t j | }t || S ɚ; fp2 ɚ; fp1 ɚ; fstat ɚ; : Test whether two open file objects reference the same file ɚ; 9 PB B ^ B pD `G G G @B t j | }t j | }t || S ɚ; f2 ɚ; f1 ɚ; Test whether two pathnames reference the same actual file or directory This is determined by the device number and i-node number and raises an exception if an os.stat() call on either pathname fails. ɚ; ! B вB W B \D `G @G @G B | j |j k o| j |j k S ɚ; st_dev ɚ; st_ino ɚ; 5 Test whether two stat buffers reference the same file ɚ; бB PB E B D `G G G B | sdS t | d t t f s't t t j | } t | }t | }t | D ] \ }}||| k r |d| c S |S ɚ; s2 ɚ; s1 ɚ; enumerate ɚ; min ɚ; G Given a list of pathnames, returns the longest common leading component ɚ; B B ? pB `G G G B t j | j S ɚ; st_ctime ɚ; A Return the metadata change time of a file, reported by os.stat(). ɚ; B B : pB `G @G @G B t j | j S ɚ; st_atime ɚ; = Return the last access time of a file, reported by os.stat(). ɚ; pB 0B 5 pB `G G G B t j | j S ɚ; C Return the last modification time of a file, reported by os.stat(). ɚ; B B 0 pB `G G G `B t j | j S ɚ; 1 Return the size of a file, reported by os.stat(). ɚ; H 0B ЬB C ' B \D `G @G @G B t j | }n# t t f$ r Y dS w xY wt j |j S ɚ; S_ISDIR ɚ; < Return true if the pathname refers to an existing directory. ɚ; H ЫB pB C C \D `G G G B t j | }n# t t f$ r Y dS w xY wt j |j S ɚ; S_ISREG ɚ; % Test whether a path is a regular file ɚ; 1 B PB C PD `G G G B t j | n# t t f$ r Y dS w xY wdS ɚ; <frozen genericpath> ɚ; D Test whether a path exists. Returns False for broken symbolic links ɚ; samestat ɚ; sameopenfile ɚ; samefile ɚ; isfile ɚ; isdir ɚ; getsize ɚ; getmtime ɚ; getctime ɚ; getatime ɚ; exists ɚ; commonprefix ɚ; Path operations common to more than one OS Do not use directly. The OS specific modules import the appropriate functions from this module themselves. ɚ; B PB X G G G B e Zd ZdZd Zd ZdS ɚ; \D B e PB pD G G B dd l } |j |i |S ɚ; _Helper.__call__ ɚ; help ɚ; pydoc ɚ; B b ZD G @G `B dS ɚ; _Helper.__repr__ ɚ; H Type help() for interactive help, or help(object) for help about object. ɚ; 3 Define the builtin 'help'. This is a wrapper around pydoc.help that provides a helpful message when 'help' is typed at the Python interactive prompt. Calling help() at the Python prompt starts an interactive help session. Calling help(thing) prints help for the python object 'thing'. ɚ; _Helper ɚ; B pB G G G B e Zd ZdZdZd dZd Zd Zd ZdS ɚ; 0B ТB B C 0B D G G B | d}d} t ||| j z D ] }t | j | || j z }d }|t | }|dvrd }||dk rd S n# t $ r Y d S w xY ww ɚ; prompt ɚ; _Printer.__call__ ɚ; q ɚ; 0 Hit Return for more, or q (and Return) to quit: ɚ; Z B 0B < ZD G G B | t | j | j k rd | j S d| j fdz z S ɚ; _Printer.__repr__ ɚ; MAXLINES ɚ; _Printer__setup ɚ; ! Type %s() to see the full %s text ɚ; PB ОB `B , B pD G @G G B | j rd S d }| j D ]Q} t |d 5 }| }d d d n # 1 swxY w Y n# t $ r Y Nw xY w|s| j }| d | _ t | j | _ d S ɚ; _Printer.__setup ɚ; __setup ɚ; _Printer__linecnt ɚ; split ɚ; ɚ; 2 B PB # B B G G B dd l || _ || _ d | _ fd|D | _ d S ɚ; dirs ɚ; _Printer.__init__ ɚ; _Printer__filenames ɚ; _Printer__lines ɚ; _Printer__data ɚ; _Printer__name ɚ; ( B ( B @B G G B g | ]"}D ] }j || #S ɚ; os ɚ; dir ɚ; % _Printer.__init__.<locals>.<listcomp> ɚ; n interactive prompt objects for printing the license text, a list of contributors and the copyright notice. ɚ; _Printer ɚ; pB B G G G B e Zd Zd Zd ZddZdS ɚ; 7 D 0B B B \D G @G @B t j n# Y nxY wt | ɚ; Quitter.__call__ ɚ; SystemExit ɚ; B B ZD G G `B d| j d| j dS ɚ; Quitter.__repr__ ɚ; to exit ɚ; () or ɚ; Use ɚ; D B 0B CD G G B || _ || _ d S ɚ; Quitter.__init__ ɚ; <frozen _sitebuiltins> ɚ; eof ɚ; Quitter ɚ; = The objects used by the site module to add custom builtins. ɚ; async_generator ɚ; coroutine ɚ; generator ɚ; mappingproxy ɚ; dict_items ɚ; dict_values ɚ; dict_keys ɚ; zip_iterator ɚ; zip ɚ; tuple_iterator ɚ; str_iterator ɚ; set_iterator ɚ; longrange_iterator ɚ; range_iterator ɚ; list_reverseiterator ɚ; list_iterator ɚ; dict_itemiterator ɚ; dict_valueiterator ɚ; dict_keyiterator ɚ; bytearray_iterator ɚ; bytes_iterator ɚ; EllipsisType ɚ; B B 0B H H H B e Zd ZdZdZed Zed Zed Zd Z d Z d Z d Z dd Z d Zd ZdS ɚ; D B [ PB \D H G B | | | S ɚ; MutableSequence.__iadd__ ɚ; ЀB B U YD \D H `H `G @B | | | = dS ɚ; MutableSequence.remove ɚ; v S.remove(value) -- remove first occurrence of value. Raise ValueError if the value is not present. ɚ; B M B CD H eL `G B | | }| |= |S ɚ; MutableSequence.pop ɚ; S.pop([index]) -> item -- remove and return item at index (default last). Raise IndexError if list is empty or index is out of range. ɚ; 0 PB B F ~B CD H G @~B || u rt | }|D ]}| | dS ɚ; MutableSequence.extend ɚ; M S.extend(iterable) -- extend sequence by appending elements from the iterable ɚ; J }B }B @ p}B CD H `G G |B t | }t |dz D ]%}| ||z dz | | c| |< | ||z dz < &dS ɚ; MutableSequence.reverse ɚ; reverse ɚ; ! S.reverse() -- reverse *IN PLACE* ɚ; ) |B p|B |B 8 ZD H G {B | # t $ r Y dS w xY w ɚ; MutableSequence.clear ɚ; , S.clear() -> None -- remove all items from S ɚ; & p{B 0{B 4 YD \D H G zB | t | | dS ɚ; MutableSequence.append ɚ; : S.append(value) -- append value to the end of the sequence ɚ; zB PzB / zB CD H 9L G yB t ɚ; MutableSequence.insert ɚ; 3 S.insert(index, value) -- insert value before index ɚ; D PzB + yB \D H G @yB t ɚ; MutableSequence.__delitem__ ɚ; D PzB ' zB CD H G @yB t ɚ; MutableSequence.__setitem__ ɚ; All the operations on a read-write sequence. Concrete subclasses must provide __new__ or __init__, __getitem__, __setitem__, __delitem__, __len__, and insert(). ɚ; xB xB H @H @H @xB e Zd ZdZdZdS ɚ; M This unifies bytes and bytearray. XXX Should add all their methods. ɚ; ( wB wB H H H @vB e Zd ZdZdZdZed Zd Zd Z d Z d d Z d Z d S ɚ; uB uB YD @uB H L G tB t fd| D S ɚ; Sequence.count ɚ; sum ɚ; tB 3 ptB @:C H G tB K | ]}|u s|k d V dS ɚ; ! Sequence.count.<locals>.<genexpr> ɚ; B S.count(value) -> integer -- return number of occurrences of value ɚ; sB PsB sB rB @tD H `J G qB |&|dk r t t | |z d }||dk r|t | z }|}|||k r3 | | }n# t $ r Y n w xY w||u s||k r|S |dz }|-||k 3t ɚ; stop ɚ; Sequence.index ɚ; S.index(value, [start, [stop]]) -> integer -- return first index of value. Raises ValueError if the value is not present. Supporting start and stop arguments is optional, but recommended. ɚ; ; D pqB # 0qB \D H G pB K t t t | D ] }| | V d S ɚ; Sequence.__reversed__ ɚ; range ɚ; +D ppB CD H @G pB | D ]}||u s||k r dS dS ɚ; Sequence.__contains__ ɚ; * oB PzB `oB # 0oB CD H G nB K d} | | }|V |dz }# t $ r Y d S w xY w ɚ; Sequence.__iter__ ɚ; D PzB yB \D H G @yB t ɚ; Sequence.__getitem__ ɚ; All the operations on a read-only sequence. Concrete subclasses must override __new__ or __init__, __getitem__, and __len__. ɚ; > nB pmB v H H H `lB e Zd ZdZdZed Zed Z e Z e fdZ d Z d Z d dZ d d Zd S ɚ; ! kB kB `kB 0kB CD H G `G jB | | S # t $ r || |< Y nw xY w|S ɚ; MutableMapping.setdefault ɚ; setdefault ɚ; @ D.setdefault(k[,d]) -> D.get(k,d), also set D[k]=d if k not in D ɚ; jB 0jB iB D H @L `G hB t |t r|D ] }|| | |< n@t |d r#| D ] }|| | |< n |D ] \ }}|| |< | D ] \ }}|| |< dS ɚ; MutableMapping.update ɚ; K D.update([E, ]**F) -> None. Update D from mapping/iterable E and F. If E present and has a .keys() method, does: for k in E: D[k] = E[k] If E present and lacks .keys() method, does: for (k, v) in E: D[k] = v In either case, this is followed by: for k, v in F.items(): D[k] = v ɚ; ) hB PhB |B ZD H `G gB | # t $ r Y dS w xY w ɚ; MutableMapping.clear ɚ; , D.clear() -> None. Remove all items from D. ɚ; D gB 0gB fB 0yC CD H G `G `fB t t | }n# t $ r t dw xY w| | }| |= ||fS ɚ; MutableMapping.popitem ɚ; popitem ɚ; D.popitem() -> (k, v), remove and return some (key, value) pair as a 2-tuple; but raise KeyError if D is empty. ɚ; + 0fB eB eB PeB pD H eL G dB | | }| |= |S # t $ r || j u r |cY S w xY w ɚ; MutableMapping.pop ɚ; _MutableMapping__marker ɚ; D.pop(k[,d]) -> v, remove specified key and return the corresponding value. If key is not found, d is returned if given, otherwise KeyError is raised. ɚ; D kB dB \D H `G @dB t ɚ; MutableMapping.__delitem__ ɚ; D kB 0yC CD H G @dB t ɚ; MutableMapping.__setitem__ ɚ; A MutableMapping is a generic container for associating key/value pairs. This class provides concrete generic implementations of all methods except for __getitem__, __setitem__, __delitem__, __iter__, and __len__. ɚ; cB cB c H H H cB e Zd ZdZd Zd ZdS ɚ; D bB # n dB \D H G bB K | j D ]}| j | V d S ɚ; ValuesView.__iter__ ɚ; ' +D bB g 0bB pD H G aB | j D ] }| j | }||u s||k r dS dS ɚ; ValuesView.__contains__ ɚ; PaB `B J H @H @H @`B e Zd ZdZed Zd Zd ZdS ɚ; D bB # [ dB \D H G _B K | j D ]}|| j | fV d S ɚ; ItemsView.__iter__ ɚ; / _B p_B _B R ^B D H `G @^B |\ }} | j | }||u p||k S # t $ r Y dS w xY w ɚ; ItemsView.__contains__ ɚ; D ^B N ]B \D H 0H G ]B t | S ɚ; ItemsView._from_iterable ɚ; 0]B `B 8 H H H \B e Zd ZdZed Zd Zd ZdS ɚ; D bB # C ZD H G @\B K | j E d {V d S ɚ; KeysView.__iter__ ɚ; D bB @ dB \D H G \B || j v S ɚ; KeysView.__contains__ ɚ; D ^B < ]B \D H 0H `G ]B t | S ɚ; KeysView._from_iterable ɚ; [B 0[B ( H H H ZB e Zd ZdZd Zd Zd Z ee Z dS ɚ; pZB 0ZB 2 ZD H G YB d | S ɚ; MappingView.__repr__ ɚ; & {0.__class__.__name__}({0._mapping!r}) ɚ; D YB / ZD H G `YB t | j S ɚ; MappingView.__len__ ɚ; D bB , 0YB \D H G XB || _ d S ɚ; mapping ɚ; MappingView.__init__ ɚ; _mapping ɚ; - PXB WB H @H @H VB e Zd ZdZdZdZed Zd dZd Z d Z d Z d Z d Z dZdS ɚ; a D pVB yC \D H @G UB t |t st S t | t | k S ɚ; Mapping.__eq__ ɚ; dict ɚ; UB pUB ZD H G UB t | S ɚ; Mapping.values ɚ; 6 D.values() -> an object providing a view on D's values ɚ; TB TB ZD H @G `TB t | S ɚ; Mapping.items ɚ; < D.items() -> a set-like object providing a view on D's items ɚ; 0TB SB ZD H G SB t | S ɚ; Mapping.keys ɚ; : D.keys() -> a set-like object providing a view on D's keys ɚ; +D kB `SB dB \D H G SB | | dS # t $ r Y dS w xY w ɚ; Mapping.__contains__ ɚ; RB kB RB 0kB CD H H RB | | S # t $ r |cY S w xY w ɚ; Mapping.get ɚ; < D.get(k[,d]) -> D[k] if k in D, else d. d defaults to None. ɚ; D kB dB \D H H @dB t ɚ; Mapping.__getitem__ ɚ; A Mapping is a generic container for associating key/value pairs. This class provides concrete generic implementations of all methods except for __getitem__, __iter__, and __len__. ɚ; 6 QB PB H H H OB e Zd ZdZdZed Zed Zd Zd Z d Z d Z d Z d Z d Zd S ɚ; 6 D OB pOB CD H H NB || u r| n|D ]}| | | S ɚ; MutableSet.__isub__ ɚ; z D NB pOB CD H H MB || u r| n^t |t s| | }|D ]1}|| v r| | | | 2| S ɚ; MutableSet.__ixor__ ɚ; D MB pOB CD H H MB | |z D ]}| | | S ɚ; MutableSet.__iand__ ɚ; D LB pOB CD H ` H LB |D ]}| | | S ɚ; MutableSet.__ior__ ɚ; ) PLB LB |B ZD H H KB | # t $ r Y dS w xY w ɚ; MutableSet.clear ɚ; 6 This is slow (creates N new iterators!) but effective. ɚ; N PKB JB JB pOB CD H eL H JB t | } t | }n# t $ r t dw xY w| | |S ɚ; MutableSet.pop ɚ; 2 Return the popped value. Raise KeyError if empty. ɚ; + IB IB YD \D H `H H @IB || vrt | | | dS ɚ; MutableSet.remove ɚ; remove ɚ; 5 Remove an element. If not a member, raise a KeyError. ɚ; IB C YD \D H `H H @C t ɚ; MutableSet.discard ɚ; discard ɚ; 8 Remove an element. Do not raise an exception if absent. ɚ; HB C YD \D H H @C t ɚ; MutableSet.add ɚ; Add an element. ɚ; A mutable set is a finite, iterable container. This class provides concrete generic implementations of all methods except for __contains__, __iter__, __len__, add(), and discard(). To override the comparisons (presumably for speed, as the semantics are fixed), all you have to do is redefine __le__ and then the other operations will automatically follow suit. ɚ; @ HB 0GB H H H EB e Zd ZdZdZd Zd Zd Zd Zd Z e d Z d Z e Z d Zd ZeZd Zd Zd ZeZd ZdS ɚ; PEB DB x DB lD H H H CB t j }d|z dz }t | }d|dz z }||z }| D ]'}t | }|||dz z dz dz z }||z }(||dz |dz z z }|d z d z }||z }||k r||dz z }|d k rd }|S ɚ; hx ɚ; h ɚ; n ɚ; MASK ɚ; MAX ɚ; Set._hash ɚ; _hash ɚ; maxsize ɚ; + Compute the hash value of a set. Note that we don't define __hash__: not all sets are hashable. But if you define a hashable set type, its __hash__ should call this function. This must be compatible __eq__. All sets ought to compare equal if they contain the same elements, regardless of how they are implemented, and regardless of the order of the elements; so there's not much freedom for __eq__ or __hash__. We match the algorithm used by the built-in frozenset type. ɚ; R D pBB o yC \D H H AB t |t s1t |t st S | | }| |z || z z S ɚ; Set.__xor__ ɚ; i AB pBB g yC 6D H "H AB t |t s1t |t st S | } fd|D S ɚ; Set.__rsub__ ɚ; D 3 l @B @:C H #H `@B K | ] }|v|V d S ɚ; Set.__rsub__.<locals>.<genexpr> ɚ; i 0@B pBB _ yC @uB H %H ?B t t s1t t st S | | fd| D S ɚ; Set.__sub__ ɚ; D 3 d P?B @:C H @&H >B K | ] }|v|V d S ɚ; Set.__sub__.<locals>.<genexpr> ɚ; @ >B P>B W >B CD H (H =B t |t st S d | |fD }| | S ɚ; chain ɚ; Set.__or__ ɚ; D 3 Z P=B CD H )H <B K | ] }|D ]}|V d S ɚ; e ɚ; Set.__or__.<locals>.<genexpr> ɚ; <B P p<B CD H +H *H <B |D ] }|| v r dS dS ɚ; Set.isdisjoint ɚ; isdisjoint ɚ; 1 Return True if two sets have a null intersection. ɚ; ? ;B P>B I yC 6D H -H @;B t |t st S fd|D S ɚ; Set.__and__ ɚ; D 3 L @B @:C H .H :B K | ] }|v |V d S ɚ; Set.__and__.<locals>.<genexpr> ɚ; :B @ ]B \D H 0H /H `:B | | S ɚ; it ɚ; Set._from_iterable ɚ; _from_iterable ɚ; Construct an instance of the class from any iterable input. Must override this method if the class constructor signature does not accept an iterable for an input. ɚ; R D :B ; yC \D H 2H 9B t |t st S t | t | k o| | S ɚ; Set.__eq__ ɚ; M P9B 8B 1 8B CD H @4H 8B t |t st S t | t | k rdS |D ] }|| vr dS dS ɚ; Set.__ge__ ɚ; R D 7B , yC \D H 5H 7B t |t st S t | t | k o| | S ɚ; Set.__gt__ ɚ; R D :B ' yC \D H 7H 7B t |t st S t | t | k o| | S ɚ; Set.__lt__ ɚ; M P9B 8B 8B CD H `9H 6B t |t st S t | t | k rdS | D ] }||vr dS dS ɚ; elem ɚ; Set.__le__ ɚ; Z A set is a finite, iterable container. This class provides concrete generic implementations of all methods except for __contains__, __iter__ and __len__. To override the comparisons (presumably for speed, as the semantics are fixed), redefine __le__ and __ge__, then the other operations will automatically follow suit. ɚ; * 06B 5B H @H @H 5B e Zd ZdZed Zed Z ee Z dS ɚ; ! 4B 4B p4B \D H `=H 4B | t u rt |d S t S ɚ; Callable.__subclasshook__ ɚ; _B 3B CD H >H 3B dS ɚ; Callable.__call__ ɚ; 03B 2B p2B H RH RH 1B t | t rt | S t | t r#| j dk r| j S | j d| j S | t u rdS t | t r| j S t | S ɚ; FunctionType ɚ; repr ɚ; ... ɚ; Return the repr() of an object, special-casing types (internal helper). Copied from :mod:`typing` since collections.abc shouldn't depend on that module. ɚ; [ P1B 0B 0B 6D H UH UH 0B t u rdS t t rdS t d} j dk ot fd|D S ɚ; names ɚ; Ellipsis ɚ; D /B 3 P/B @:C H `EH .B K | ]}j |k V d S ɚ; ! _is_param_expr.<locals>.<genexpr> ɚ; typing ɚ; _ConcatenateGenericAlias ɚ; ParamSpec ɚ; | Checks if obj matches either a list of types, ``...``, ``ParamSpec`` or ``_ConcatenateGenericAlias`` from typing.py ɚ; .B .B -B H @XH @XH -B e Zd ZdZdZ fdZ fdZd Z fdZ xZ S ɚ; ,B 0,B +B +B H @KH *B t |t s|f}t | j dk r4t | j d r|rt |d s|f}t | j }t |d t t f s|d }|d d }||f}t t t | S ɚ; new_args ɚ; ! _CallableGenericAlias.__getitem__ ɚ; _ 0*B )B P\D \D H MH @)B | j }t | dk rt |d s t |d d |d f}t t |ffS ɚ; _CallableGenericAlias.__reduce__ ɚ; (B p(B 0(B C H OH @'B t | j dk r:t | j d r t S dd d | j d d D dt | j d dS ɚ; _CallableGenericAlias.__repr__ ɚ; ] ɚ; ], ɚ; 'B &B \D H QH &B g | ]}t | S ɚ; a ɚ; 2 _CallableGenericAlias.__repr__.<locals>.<listcomp> ɚ; _type_repr ɚ; collections.abc.Callable[[ ɚ; 0&B %B P%B +B H `UH @$B t |t rt | dk st d |\ }}t |t t f rg ||R }n!t | st d| t | || S ɚ; t_result ɚ; t_args ɚ; _CallableGenericAlias.__new__ ɚ; _is_param_expr ɚ; F Expected a list of types, an ellipsis, ParamSpec, or Concatenate. Got ɚ; 6 Callable must be used as Callable[[arg, ...], result]. ɚ; Represent `Callable[argtypes, resulttype]`. This sets ``__args__`` to a tuple containing the flattened ``argtypes`` followed by ``resulttype``. Example: ``Callable[[int, str], float]`` sets ``__args__`` to ``(int, str, float)``. ɚ; _CallableGenericAlias ɚ; #B #B H H H #B e Zd ZdZed ZdS ɚ; # "B "B p4B \D H ZH "B | t u rt |ddd S t S ɚ; Collection.__subclasshook__ ɚ; * !B P!B H H H B e Zd ZdZed Zed Z ee Z dS ɚ; ! B P B p4B \D H ]H B | t u rt |d S t S ɚ; Container.__subclasshook__ ɚ; _B B \D H ^H 3B dS ɚ; Container.__contains__ ɚ; P B B u H H H @ B e Zd ZdZed Zed ZdS ɚ; ! B B } p4B \D H `H ` B | t u rt |d S t S ɚ; Sized.__subclasshook__ ɚ; \D y ZD H aH B dS ɚ; Sized.__len__ ɚ; 1 B 0 B B H @H @H `B e Zd ZdZd Zed Zedd Zd Ze d Z dS ɚ; % B B j p4B \D H dH `B | t u rt |ddddd S t S ɚ; Generator.__subclasshook__ ɚ; C 0B B B ` ZD H eH B | t t d # t t f$ r Y dS w xY w ɚ; Generator.close ɚ; generator ignored GeneratorExit ɚ; . Raise GeneratorExit inside generator. ɚ; * B B S 0B pD H gH B ||| | }|| | }| ɚ; Generator.throw ɚ; g Raise an exception in the generator. Return next yielded value or raise StopIteration. ɚ; B PB L YD \D H iH B t ɚ; Generator.send ɚ; c Send a value into the generator. Return next yielded value or raise StopIteration. ɚ; B B F ZD H kH @B | d S ɚ; Generator.__next__ ɚ; ^ Return the next item from the generator. When exhausted, raise StopIteration. ɚ; B pB 2 H H H B e Zd ZdZed Zed ZdS ɚ; " B pB ; p4B \D H nH B | t u rt |dd S t S ɚ; Reversible.__subclasshook__ ɚ; D # 6 ZD H oH B K d S ɚ; Reversible.__reversed__ ɚ; " pB B H H H `B e Zd ZdZed Zd Zed ZdS ɚ; " 0B B p4B \D H rH B | t u rt |dd S t S ɚ; Iterator.__subclasshook__ ɚ; D ZD H @sH @B | S ɚ; Iterator.__iter__ ɚ; B PB ZD H tH B t ɚ; Iterator.__next__ ɚ; K Return the next item from the iterator. When exhausted, raise StopIteration ɚ; * pB B H H H `B e Zd ZdZed Zed Z ee Z dS ɚ; ! 0B B p4B \D H wH 4B | t u rt |d S t S ɚ; Iterable.__subclasshook__ ɚ; D # ZD H xH B K d S ɚ; Iterable.__iter__ ɚ; 1 pB B H @H @H B e Zd ZdZd Zed Zedd Zd Ze d Z dS ɚ; % B B p4B \D H `{H B | t u rt |ddddd S t S ɚ; AsyncGenerator.__subclasshook__ ɚ; K B B @ B ZD H }H }H B K | t d{V t d # t t f$ r Y dS w xY w ɚ; AsyncGenerator.aclose ɚ; aclose ɚ; , asynchronous generator ignored GeneratorExit ɚ; , p B B 0B pD H H @H B K ||| | }|| | }| ɚ; AsyncGenerator.athrow ɚ; athrow ɚ; y Raise an exception in the asynchronous generator. Return next yielded value or raise StopAsyncIteration. ɚ; B B YD \D H H H @ B K t ɚ; AsyncGenerator.asend ɚ; u Send a value into the asynchronous generator. Return next yielded value or raise StopAsyncIteration. ɚ; B B ZD H H `B K | d d{V S ɚ; AsyncGenerator.__anext__ ɚ; asend ɚ; p Return the next item from the asynchronous generator. When exhausted, raise StopAsyncIteration. ɚ; " B B H H H B e Zd ZdZed Zd Zed ZdS ɚ; " B B p4B \D H H B | t u rt |dd S t S ɚ; AsyncIterator.__subclasshook__ ɚ; D ZD H H @B | S ɚ; AsyncIterator.__aiter__ ɚ; B B ZD H `H B K t ɚ; AsyncIterator.__anext__ ɚ; StopAsyncIteration ɚ; @ Return the next item or raise StopAsyncIteration when exhausted. ɚ; * PB B H H H @B e Zd ZdZed Zed Z ee Z dS ɚ; ! B B p4B \D H H `B | t u rt |d S t S ɚ; AsyncIterable.__subclasshook__ ɚ; D 0B ZD H H B t S ɚ; AsyncIterable.__aiter__ ɚ; . pB B z H H H @B e Zd ZdZed Zedd Zd Zed Z dS ɚ; $ B B p4B \D H H @ B | t u rt |dddd S t S ɚ; Coroutine.__subclasshook__ ɚ; C B B B ZD H H B | t t d # t t f$ r Y dS w xY w ɚ; Coroutine.close ɚ; GeneratorExit ɚ; coroutine ignored GeneratorExit ɚ; . Raise GeneratorExit inside coroutine. ɚ; * A B 0B pD H H B ||| | }|| | }| ɚ; val ɚ; typ ɚ; Coroutine.throw ɚ; with_traceback ɚ; g Raise an exception in the coroutine. Return next yielded value or raise StopIteration. ɚ; A PB ~ YD \D H H B t ɚ; Coroutine.send ɚ; c Send a value into the coroutine. Return next yielded value or raise StopIteration. ɚ; * 0A A i H @H @H A e Zd ZdZed Zed Z ee Z dS ɚ; GenericAlias ɚ; ! A A q p4B \D H @H @A | t u rt |d S t S ɚ; Awaitable.__subclasshook__ ɚ; D # m ZD H H A K d V d S ɚ; Awaitable.__await__ ɚ; A 0A Z H H H @ B e Zd ZdZed Zed ZdS ɚ; ! A A b p4B \D H H 4B | t u rt |d S t S ɚ; Hashable.__subclasshook__ ɚ; \D ^ ZD H H B dS ɚ; Hashable.__hash__ ɚ; @ pA 0A N A D H `H `H A | j }|D ]3}|D ]%}||j v r|j | t c c S n &t c S 4dS ɚ; B ɚ; methods ɚ; C ɚ; _check_methods ɚ; __mro__ ɚ; D F H H H A K d W V d S ɚ; _ag ɚ; D @ H H H A K d S ɚ; _coro ɚ; D # > H `A K d V S ɚ; collections.abc ɚ; ByteString ɚ; MutableSequence ɚ; Sequence ɚ; ValuesView ɚ; ItemsView ɚ; KeysView ɚ; MappingView ɚ; MutableMapping ɚ; Mapping ɚ; MutableSet ɚ; Set ɚ; Collection ɚ; Callable ɚ; Container ɚ; Sized ɚ; Reversible ɚ; Generator ɚ; Iterator ɚ; Iterable ɚ; Hashable ɚ; AsyncGenerator ɚ; AsyncIterator ɚ; AsyncIterable ɚ; Coroutine ɚ; Awaitable ɚ; D H @H @H A d S ɚ; _f ɚ; <frozen _collections_abc> ɚ; j Abstract Base Classes (ABCs) for collections, according to PEP 3119. Unit tests are in test_collections. ɚ; klass ɚ; __author__ ɚ; _WindowsConsoleIO ɚ; A PA a H H H A e Zd Zej j ZdS ɚ; _TextIOBase ɚ; A pA ^ H H H A e Zd Zej j ZdS ɚ; _BufferedIOBase ɚ; A A [ H H H @A e Zd Zej j ZdS ɚ; _RawIOBase ɚ; A A X H H H `A e Zd Zej j ZdS ɚ; _IOBase ɚ; io ɚ; P A A = PA \D H A | dk r/dd l }| dt d t at S t dt d| ɚ; <frozen io> ɚ; has no attribute ɚ; module ɚ; + OpenWrapper is deprecated, use open instead ɚ; OpenWrapper ɚ; text_encoding ɚ; DEFAULT_BUFFER_SIZE ɚ; SEEK_END ɚ; SEEK_CUR ɚ; SEEK_SET ɚ; UnsupportedOperation ɚ; TextIOBase ɚ; BufferedRandom ɚ; BufferedRWPair ɚ; BufferedWriter ɚ; BufferedReader ɚ; BufferedIOBase ɚ; StringIO ɚ; RawIOBase ɚ; IOBase ɚ; BlockingIOError ɚ; Guido van Rossum <guido@python.org>, Mike Verdone <mike.verdone@gmail.com>, Mark Russell <mark.russell@zen.co.uk>, Antoine Pitrou <solipsis@pitrou.net>, Amaury Forgeot d'Arc <amauryfa@gmail.com>, Benjamin Peterson <benjamin@python.org> ɚ; The io module provides the Python interfaces to stream handling. The builtin open function is defined in this module. At the top of the I/O hierarchy is the abstract base class IOBase. It defines the basic interface to a stream. Note, however, that there is no separation between reading and writing to streams; implementations are allowed to raise an OSError if they do not support a given operation. Extending IOBase is RawIOBase which deals simply with the reading and writing of raw bytes to a stream. FileIO subclasses RawIOBase to provide an interface to OS files. BufferedIOBase deals with buffering on a raw byte stream (RawIOBase). Its subclasses, BufferedWriter, BufferedReader, and BufferedRWPair buffer streams that are readable, writable, and both respectively. BufferedRandom provides a buffered interface to random access streams. BytesIO is a simple stream of in-memory bytes. Another IOBase subclass, TextIOBase, deals with the encoding and decoding of streams into text. TextIOWrapper, which extends it, is a buffered text interface to a buffered raw stream (`BufferedIOBase`). Finally, StringIO is an in-memory stream for text. Argument names are not part of the specification, and only the arguments of open() are intended to be used as keyword arguments. data: DEFAULT_BUFFER_SIZE An int containing the default buffer size used by the module's buffered I/O classes. open() uses the file's blksize (as obtained by os.stat) if possible. ɚ; encodings ɚ; _false ɚ; byteorder ɚ; SystemError ɚ; why ɚ; _codecs ɚ; latin-1 ɚ; namereplace ɚ; backslashreplace ɚ; xmlcharrefreplace ɚ; . pA 0A > A pD @I H H @A i }| D ]\ }}||vr|||< d||< |S ɚ; v ɚ; k ɚ; decoding_map ɚ; make_encoding_map ɚ; Creates an encoding map from a decoding map. If a target mapping in the decoding map occurs multiple times, then that target is mapped to None (undefined mapping), causing an exception when encountered by the charmap codec during translation. One example where this happens is cp875.py which decodes multiple character to \u001a. ɚ; A 4 A @I @H @H A d | D S ɚ; rng ɚ; make_identity_dict ɚ; < PA \D @I H A i | ]}||S ɚ; & make_identity_dict.<locals>.<dictcomp> ɚ; make_identity_dict(rng) -> dict Return a dictionary where elements of the rng sequence are mapped to themselves. ɚ; Y A pA + A lD @I I I @A K t | |fi |}| D ] }| | }|r|V | dd }|r|V dS dS ɚ; Decoding iterator. Decodes the input strings from the iterator using an IncrementalDecoder. errors and kwargs are passed through to the IncrementalDecoder constructor. ɚ; Y A A + PA lD @I I I A K t | |fi |}| D ] }| | }|r|V | dd }|r|V dS dS ɚ; output ɚ; iterator ɚ; Encoding iterator. Encodes the input strings from the iterator using an IncrementalEncoder. errors and kwargs are passed through to the IncrementalEncoder constructor. ɚ; PA A PC @I I I A t | j S ɚ; Lookup up the codec for the given encoding and return its StreamWriter class or factory function. Raises a LookupError in case the encoding cannot be found. ɚ; A PA PC @I `I `I A t | j S ɚ; Lookup up the codec for the given encoding and return its StreamReader class or factory function. Raises a LookupError in case the encoding cannot be found. ɚ; ( A A A \D @I I I A t | j }|t | |S ɚ; decoder ɚ; Lookup up the codec for the given encoding and return its IncrementalDecoder class or factory function. Raises a LookupError in case the encoding cannot be found or the codecs doesn't provide an incremental decoder. ɚ; ( A A pA \D @I I I A t | j }|t | |S ɚ; encoder ɚ; LookupError ɚ; Lookup up the codec for the given encoding and return its IncrementalEncoder class or factory function. Raises a LookupError in case the encoding cannot be found or the codecs doesn't provide an incremental encoder. ɚ; 0A A PC @I `I `I A t | j S ɚ; Lookup up the codec for the given encoding and return its decoder function. Raises a LookupError in case the encoding cannot be found. ɚ; pA 0A PC @I I I A t | j S ɚ; Lookup up the codec for the given encoding and return its encoder function. Raises a LookupError in case the encoding cannot be found. ɚ; [ A pA A lD @I I I `A ||}t | }t | }t | |j |j |j |j | }||_ ||_ |S ɚ; sr ɚ; file_info ɚ; data_info ɚ; Return a wrapped version of file which provides transparent encoding translation. Data written to the wrapped file is decoded according to the given data_encoding and then encoded to the underlying file using file_encoding. The intermediate data type will usually be Unicode but depends on the specified codecs. Bytes read from the file are decoded using file_encoding and then passed back to the caller encoded using data_encoding. If file_encoding is not given, it defaults to data_encoding. errors may be given to define the error handling. It defaults to 'strict' which causes ValueErrors to be raised in case an encoding error occurs. The returned wrapped file object provides two extra attributes .data_encoding and .file_encoding which reflect the given parameters of the same name. The attributes can be used for introspection by Python programs. ɚ; u 0A A `A s A @D @I A | d|vr|dz }t j | || }||S t | }t ||j |j | }||_ |S # | xY w ɚ; srw ɚ; buffering ɚ; b ɚ; Open an encoded file using the given mode and return a wrapped version providing transparent encoding/decoding. Note: The wrapped version will only accept the object format defined by the codecs, i.e. Unicode objects for most builtin codecs. Output is also codec dependent and will usually be Unicode as well. If encoding is not None, then the underlying encoded files are always opened in binary mode. The default file mode is 'r', meaning to open the file in read mode. encoding specifies the encoding which is to be used for the file. errors may be given to define the error handling. It defaults to 'strict' which causes ValueErrors to be raised in case an encoding error occurs. buffering has the same meaning as for the builtin open() API. It defaults to -1 which means that the default buffer size will be used. The returned wrapped file object provides an extra attribute .encoding which allows querying the used encoding. This attribute is only available if an encoding was specified as parameter. ɚ; ? 0A PA @I I I A e Zd ZdZdZdZ ddZddZddZdd Z d Z d Z d Z d Z d ZddZefdZd Zd Zd ZdS ɚ; file_encoding ɚ; data_encoding ɚ; pA 0A n A \D @I H A t d| j j z ɚ; StreamRecoder.__reduce_ex__ ɚ; D pA k A pD @I @H A | j d S ɚ; StreamRecoder.__exit__ ɚ; D h ZD @I `H @B | S ɚ; StreamRecoder.__enter__ ɚ; A PA a A CD @I H A || j | S ɚ; StreamRecoder.__getattr__ ɚ; 9 D A [ PA CD @I @H A | j || | j || d S ɚ; StreamRecoder.seek ɚ; 5 D A V ZD @I H @A | j | j d S ɚ; StreamRecoder.reset ɚ; N A A P PA pD @I \I H A d | }| || j \ }}| j | S ɚ; StreamRecoder.writelines ɚ; 9 D pA K 0A CD @I H A | || j \ }}| j | S ɚ; bytesdecoded ɚ; StreamRecoder.write ɚ; D H ZD @I H @B | S ɚ; StreamRecoder.__iter__ ɚ; 5 A 0A A A CD @I @H A t | j }| || j \ }}|S ɚ; StreamRecoder.__next__ ɚ; N PA A ; A pD @I `2I H A | j }| || j \ }}| d S ɚ; StreamRecoder.readlines ɚ; W D pA 2 A pD @I H A || j }n| j | }| || j \ }}|S ɚ; StreamRecoder.readline ɚ; ; D 0A , A pD @I I A | j | }| || j \ }}|S ɚ; bytesencoded ɚ; StreamRecoder.read ɚ; A A 0A A lD @I `I @A || _ || _ || _ ||| | _ ||| | _ || _ dS ɚ; StreamRecoder.__init__ ɚ; Creates a StreamRecoder instance which implements a two-way conversion: encode and decode work on the frontend (the data visible to .read() and .write()) while Reader and Writer work on the backend (the data in stream). You can use these objects to do transparent transcodings from e.g. latin-1 to utf-8 and back. stream must be a file-like object. encode and decode must adhere to the Codec interface; Reader and Writer must be factory functions or classes providing the StreamReader and StreamWriter interfaces resp. Error handling is done in the same way as defined for the StreamWriter/Readers. ɚ; B StreamRecoder instances translate data from one encoding to another. They use the complete set of APIs returned by the codecs.lookup() function to implement their task. Data written to the StreamRecoder is first decoded into an intermediate format (depending on the "decode" codec) and then written to the underlying stream using an instance of the provided Writer class. In the other direction, data is read from the underlying stream using a Reader instance and then encoded and returned to the caller. ɚ; < PA pA @I I I A e Zd ZdZdZddZddZddZdd Zd Z d Z d Z d Z d Z ddZefdZd Zd Zd ZdS ɚ; pA 0A A \D @I I A t d| j j z ɚ; StreamReaderWriter.__reduce_ex__ ɚ; D pA A pD @I I A | j d S ɚ; StreamReaderWriter.__exit__ ɚ; D ZD @I I @B | S ɚ; StreamReaderWriter.__enter__ ɚ; A PA A CD @I `I A || j | S ɚ; StreamReaderWriter.__getattr__ ɚ; ` \D мA PA CD @I @I A | j || | j |dk r!|dk r | j d S d S d S ɚ; StreamReaderWriter.seek ɚ; 5 D A ZD @I I @A | j | j d S ɚ; StreamReaderWriter.reset ɚ; D A A \D @I \I @I `A | j | S ɚ; StreamReaderWriter.writelines ɚ; D 0A A \D @I I A | j | S ɚ; StreamReaderWriter.write ɚ; D ZD @I I @B | S ɚ; StreamReaderWriter.__iter__ ɚ; A pA ZD @I I A t | j S ɚ; StreamReaderWriter.__next__ ɚ; D A A \D @I `2I I `A | j | S ɚ; StreamReaderWriter.readlines ɚ; D 0A A \D @I I A | j | S ɚ; StreamReaderWriter.readline ɚ; D pA A \D @I @ I A | j | S ɚ; StreamReaderWriter.read ɚ; 3 A A 0A D @I @ I A || _ ||| | _ ||| | _ || _ dS ɚ; Writer ɚ; Reader ɚ; StreamReaderWriter.__init__ ɚ; writer ɚ; reader ɚ; R Creates a StreamReaderWriter instance. stream must be a Stream-like object. Reader, Writer must be factory functions or classes providing the StreamReader, StreamWriter interface resp. Error handling is done in the same way as defined for the StreamWriter/Readers. ɚ; unknown ɚ; StreamReaderWriter instances allow wrapping streams which work in both read and write modes. The design is such that one can use the factory functions returned by the codec.lookup() function to construct the instance. ɚ; 8 еA A @I I I A e Zd ZeZddZddZddZdd Zdd Z d Z dd Z d Z d Z efdZd Zd Zd ZdS ɚ; pA 0A A \D @I $I A t d| j j z ɚ; StreamReader.__reduce_ex__ ɚ; D pA A pD @I %I A | j d S ɚ; StreamReader.__exit__ ɚ; D ZD @I 'I @B | S ɚ; StreamReader.__enter__ ɚ; A PA A CD @I @(I A || j | S ɚ; StreamReader.__getattr__ ɚ; D ZD @I `)I @B | S ɚ; StreamReader.__iter__ ɚ; A PA A \D @I *I A | }|r|S t ɚ; StreamReader.__next__ ɚ; StopIteration ɚ; 4 Return the next decoded line from the input stream. ɚ; 2 pA 0A } PA CD @I -I A | j || | dS ɚ; StreamReader.seek ɚ; p Set the input stream's current position. Resets the codec buffers used for keeping state. ɚ; A 0A p ZD @I /I A d| _ | j | _ d| _ dS ɚ; StreamReader.reset ɚ; Resets the codec buffers used for keeping internal state. Note that no stream repositioning should take place. This method is primarily intended to be able to recover from decoding errors. ɚ; * A PA a A pD @I `2I 2I A | }| | S ɚ; sizehint ɚ; StreamReader.readlines ɚ; readlines ɚ; S Read all lines available on the input stream and return them as a list. Line breaks are implemented using the codec's decoder method and are included in the list entries. sizehint, if given, is ignored since there is no efficient way to finding the true end-of-line. ɚ; B A pA A @bD @I @:I A | j rf| j d }| j d= t | j dk r| j d | _ d| _ |s | d d }|S |pd}| j } | |d }|rnt |t r| d s*t |t r/| d r|| dd z }||z }| d }|rt | dk rv|d }|d= t | dk r$|d xx | j z cc< || _ d| _ n|d | j z | _ |s | d d }n|d }|d d d }||k r7| j |dd | j z | _ |r|}n|}n2|r|!|r |s | d d }n |d k r|dz }|S ɚ; line0withoutend ɚ; line0withend ɚ; readsize ɚ; StreamReader.readline ɚ; bytes ɚ; ɚ; Read one line from the input stream and return the decoded data. size, if given, is passed as size argument to the read() method. ɚ; 0A A @A ШA 9D @I AI A | j r+| j | j | _ d| _ |dk r|} |dk rt | j |k rn|dk r| j }n| j | }| j |z }|sn | || j \ }}np# t $ rc}|rV| |d|j | j \ }}| d } t | dk r n Y d}~nd}~ww xY w||d | _ | xj |z c_ |sn|dk r| j } | j | _ n#| j d| } | j |d | _ | S ɚ; lines ɚ; decodedbytes ɚ; newchars ɚ; newdata ɚ; firstline ɚ; chars ɚ; StreamReader.read ɚ; splitlines ɚ; start ɚ; keepends ɚ; Decodes data from the stream self.stream and returns the resulting object. chars indicates the number of decoded code points or bytes to return. read() will never return more data than requested, but it might return less, if there is not enough available. size indicates the approximate maximum number of decoded bytes or code points to read for decoding. The decoder can modify this setting as appropriate. The default value -1 indicates to read and decode as much as possible. size is intended to prevent having to decode huge files in one step. If firstline is true, and a UnicodeDecodeError happens after the first line terminator in the input only the first line will be returned, the rest of the input will be kept until the next call to read(). The method should use a greedy read strategy, meaning that it should read as much data as is allowed within the definition of the encoding and the given size, e.g. if optional encoding endings or state markers are available on the stream, these should be read too. ɚ; D C A CD @I HI @A t ɚ; StreamReader.decode ɚ; D A A pA CD @I `JI A || _ || _ d| _ | | _ | j | _ d| _ dS ɚ; StreamReader.__init__ ɚ; linebuffer ɚ; charbuffer ɚ; _empty_charbuffer ɚ; charbuffertype ɚ; bytebuffer ɚ; Creates a StreamReader instance. stream must be a file-like object open for reading. The StreamReader may use different error handling schemes by providing the errors keyword argument. These parameters are predefined: 'strict' - raise a ValueError (or a subclass) 'ignore' - ignore the character and continue with the next 'replace'- replace with a suitable replacement character 'backslashreplace' - Replace with backslashed escape sequences; The set of allowed parameter values can be extended via register_error. ɚ; & PA A Z @I I I A e Zd Zd dZd Zd Zd ZddZefdZ d Z d Z d Z d S ɚ; pA 0A A \D @I @QI A t d| j j z ɚ; proto ɚ; StreamWriter.__reduce_ex__ ɚ; can't serialize %s ɚ; D pA A pD @I @SI A | j d S ɚ; tb ɚ; StreamWriter.__exit__ ɚ; D ZD @I `TI @B | S ɚ; StreamWriter.__enter__ ɚ; A PA A CD @I UI A || j | S ɚ; StreamWriter.__getattr__ ɚ; ? Inherit all other methods from the underlying stream. ɚ; B \D 0A PA CD @I XI @A | j || |dk r |dk r| d S d S d S ɚ; whence ɚ; StreamWriter.seek ɚ; A ZD @I YI A dS ɚ; StreamWriter.reset ɚ; 2 Resets the codec buffers used for keeping internal state. Calling this method should ensure that the data on the output is put into a clean state, that allows appending of new fresh data without having to rescan the whole stream to recover state. ɚ; + A PA | A \D @I \I \I A | d | dS ɚ; StreamWriter.writelines ɚ; writelines ɚ; [ Writes the concatenated list of strings to the stream using .write(). ɚ; ; A PA u A pD @I ^I A | || j \ }}| j | dS ɚ; StreamWriter.write ɚ; > Writes the object's contents encoded to self.stream. ɚ; PA A \ pA CD @I ``I A || _ || _ dS ɚ; StreamWriter.__init__ ɚ; stream ɚ; w Creates a StreamWriter instance. stream must be a file-like object open for writing. The StreamWriter may use different error handling schemes by providing the errors keyword argument. These parameters are predefined: 'strict' - raise a ValueError (or a subclass) 'ignore' - ignore the character and continue with the next 'replace'- replace with a suitable replacement character 'xmlcharrefreplace' - Replace with the appropriate XML character reference. 'backslashreplace' - Replace with backslashed escape sequences. 'namereplace' - Replace with \N{...} escape sequences. The set of allowed parameter values can be extended via register_error. ɚ; 0A A / @I oI oI A e Zd ZdZd dZd Zd dZd Zd Zd Z d S ɚ; \D pA O 0A \D @I fI A |d | _ d S ɚ; # BufferedIncrementalDecoder.setstate ɚ; \D pA K ZD @I gI A | j dfS ɚ; # BufferedIncrementalDecoder.getstate ɚ; $ A pA G ZD @I @iI A t | d| _ d S ɚ; BufferedIncrementalDecoder.reset ɚ; ; D КA ? pA @tD @I jI A | j |z }| || j | \ }}||d | _ |S ɚ; ! BufferedIncrementalDecoder.decode ɚ; D C : A pD @I lI lI @C t ɚ; ) BufferedIncrementalDecoder._buffer_decode ɚ; _buffer_decode ɚ; % A PA 5 A \D @I mI A t | | d| _ d S ɚ; # BufferedIncrementalDecoder.__init__ ɚ; This subclass of IncrementalDecoder can be used as the baseclass for an incremental decoder if the decoder must be able to handle incomplete byte sequences. ɚ; BufferedIncrementalDecoder ɚ; A A @I I I A e Zd ZdZd dZd dZd Zd Zd Zd S ɚ; A ' 0A \D @I @qI A dS ɚ; IncrementalDecoder.setstate ɚ; Set the current state of the decoder. state must have been returned by getstate(). The effect of setstate((b"", 0)) must be equivalent to reset(). ɚ; pA ZD @I `sI A dS ɚ; IncrementalDecoder.getstate ɚ; Return the current state of the decoder. This must be a (buffered_input, additional_state_info) tuple. buffered_input must be a bytes object containing bytes that were passed to decode() that have not yet been converted. additional_state_info must be a non-negative integer representing the state of the decoder WITHOUT yet having processed the contents of buffered_input. In the initial state and after reset(), getstate() must return (b"", 0). ɚ; A ZD @I vI A dS ɚ; IncrementalDecoder.reset ɚ; 9 Reset the decoder to the initial state. ɚ; pA C 0A CD @I xI A t ɚ; IncrementalDecoder.decode ɚ; @ Decode input and returns the resulting object. ɚ; A pA A \D @I @zI A || _ dS ɚ; IncrementalDecoder.__init__ ɚ; Create an IncrementalDecoder instance. The IncrementalDecoder may use different error handling schemes by providing the errors keyword argument. See the module docstring for a list of possible values. ɚ; An IncrementalDecoder decodes an input in multiple steps. The input can be passed piece by piece to the decode() method. The IncrementalDecoder remembers the state of the decoding process between calls to decode(). ɚ; A A @I I I @A e Zd ZdZd dZd Zd dZd Zd Zd Z d S ɚ; A pA 0A \D @I ~I A |pd| _ d S ɚ; # BufferedIncrementalEncoder.setstate ɚ; \D pA ZD @I I A | j pdS ɚ; # BufferedIncrementalEncoder.getstate ɚ; $ A PA ZD @I I A t | d| _ d S ɚ; BufferedIncrementalEncoder.reset ɚ; ; D A pA @tD @I I A | j |z }| || j | \ }}||d | _ |S ɚ; consumed ɚ; result ɚ; ! BufferedIncrementalEncoder.encode ɚ; D C A pD @I @I I @C t ɚ; ) BufferedIncrementalEncoder._buffer_encode ɚ; _buffer_encode ɚ; % A pA A \D @I I A t | | d| _ d S ɚ; # BufferedIncrementalEncoder.__init__ ɚ; This subclass of IncrementalEncoder can be used as the baseclass for an incremental encoder if the encoder must keep some of the output in a buffer between calls to encode(). ɚ; BufferedIncrementalEncoder ɚ; pA A @I `I `I @A e Zd ZdZd dZd dZd Zd Zd Zd S ɚ; A 0A \D @I I A dS ɚ; IncrementalEncoder.setstate ɚ; l Set the current state of the encoder. state must have been returned by getstate(). ɚ; ЍA ZD @I I A dS ɚ; IncrementalEncoder.getstate ɚ; : Return the current state of the encoder. ɚ; PA ZD @I I A dS ɚ; IncrementalEncoder.reset ɚ; : Resets the encoder to the initial state. ɚ; A C 0A CD @I I A t ɚ; final ɚ; IncrementalEncoder.encode ɚ; A Encodes input and returns the resulting object. ɚ; ЌA A A \D @I @I @A || _ d| _ dS ɚ; IncrementalEncoder.__init__ ɚ; Creates an IncrementalEncoder instance. The IncrementalEncoder may use different error handling schemes by providing the errors keyword argument. See the module docstring for a list of possible values. ɚ; An IncrementalEncoder encodes an input in multiple steps. The input can be passed piece by piece to the encode() method. The IncrementalEncoder remembers the state of the encoding process between calls to encode(). ɚ; A A r @I I I A e Zd ZdZddZddZdS ɚ; ЊA C A CD @I I A t ɚ; Codec.decode ɚ; Decodes the object input and returns a tuple (output object, length consumed). input must be an object which provides the bf_getreadbuf buffer slot. Python strings, buffer objects and memory mapped files are examples of objects providing this slot. errors defines the error handling to apply. It defaults to 'strict' handling. The method may not store state in the Codec instance. Use StreamReader for codecs which have to keep state in order to make decoding efficient. The decoder must be able to handle zero length input and return an empty object of the output object type in this situation. ɚ; PA C A CD @I `I A t ɚ; input ɚ; Codec.encode ɚ; # Encodes the object input and returns a tuple (output object, length consumed). errors defines the error handling to apply. It defaults to 'strict' handling. The method may not store state in the Codec instance. Use StreamWriter for codecs which have to keep state in order to make encoding efficient. The encoder must be able to handle zero length input and return an empty object of the output object type in this situation. ɚ; 9 Defines the interface for stateless encoders/decoders. The .encode()/.decode() methods may use different error handling schemes by providing the errors argument. These string values are predefined: 'strict' - raise a ValueError error (or a subclass) 'ignore' - ignore the character and continue with the next 'replace' - replace with a suitable replacement character; Python will use the official U+FFFD REPLACEMENT CHARACTER for the builtin Unicode codecs on decoding and '?' on encoding. 'surrogateescape' - replace with private code points U+DCnn. 'xmlcharrefreplace' - Replace with the appropriate XML character reference (only for encoding). 'backslashreplace' - Replace with backslashed escape sequences. 'namereplace' - Replace with \N{...} escape sequences (only for encoding). The set of allowed values can be extended via register_error. ɚ; A 0A S @I I I A e Zd ZdZdZ ddddZd ZdS ɚ; 0 0A ЇA m ZD @I I `A d| j j | j j | j t | fz S ɚ; CodecInfo.__repr__ ɚ; % <%s.%s object for encoding %s at %#x> ɚ; \ D A ^ pA _D @I I A t | ||||f } || _ || _ || _ || _ || _ || _ || _ ||| _ | S ɚ; CodecInfo.__new__ ɚ; <frozen codecs> ɚ; streamreader ɚ; streamwriter ɚ; incrementaldecoder ɚ; incrementalencoder ɚ; 0 Codec details when looking up the codec registry ɚ; lookup_error ɚ; register_error ɚ; namereplace_errors ɚ; backslashreplace_errors ɚ; xmlcharrefreplace_errors ɚ; replace_errors ɚ; ignore_errors ɚ; strict_errors ɚ; iterdecode ɚ; iterencode ɚ; getwriter ɚ; getreader ɚ; getincrementaldecoder ɚ; getincrementalencoder ɚ; getdecoder ɚ; getencoder ɚ; StreamRecoder ɚ; StreamReaderWriter ɚ; StreamWriter ɚ; StreamReader ɚ; IncrementalDecoder ɚ; IncrementalEncoder ɚ; Codec ɚ; CodecInfo ɚ; BOM_UTF32_BE ɚ; BOM_UTF32_LE ɚ; BOM_UTF32 ɚ; BOM_UTF16_BE ɚ; BOM_UTF16_LE ɚ; BOM_UTF16 ɚ; BOM_UTF8 ɚ; BOM64_LE ɚ; BOM64_BE ɚ; BOM32_LE ɚ; BOM32_BE ɚ; BOM_LE ɚ; BOM_BE ɚ; BOM ɚ; EncodedFile ɚ; lookup ɚ; % Failed to load the builtin codecs: %s ɚ; codecs -- Python Codec Registry, API and helpers. Written by Marc-Andre Lemburg (mal@lemburg.com). (c) Copyright CNRI, All Rights Reserved. NO WARRANTY. ɚ; _py_abc ɚ; _abc ɚ; ЀA xB I I I A e Zd ZdZdZdS ɚ; V Helper class that provides a standard way to create an ABC using inheritance. ɚ; ABC ɚ; 0A A PA D I I I ~A t | d s| S t }| j D ]M}t |dd D ]9}t | |d }t |dd r| | :N| j D ]+\ }}t |dd r| | ,t | | _ | S ɚ; scls ɚ; abstracts ɚ; update_abstractmethods ɚ; frozenset ɚ; Recalculate the set of abstract methods of an abstract class. If a class has had one of its abstract methods implemented after the class was created, the method will not be considered implemented until this function is called. Alternatively, if a new abstract method has been added to the class, it will only be considered an abstract method of the class after this function is called. This function should be called before any use is made of the class, usually in class decorators that add methods to the subject class. Returns cls, to allow usage as a class decorator. If cls is not an instance of ABCMeta, does nothing. ɚ; abc ɚ; $ }A }A \ -B I I I |A e Zd ZdZ fdZd Zd Zd Zd dZd Z d Z xZ S ɚ; {A {A p{A I I @I {A t | dS ɚ; ABCMeta._abc_caches_clear ɚ; _abc_caches_clear ɚ; , Clear the caches (for debugging or testing). ɚ; zA zA p{A I I @I `zA t | dS ɚ; ABCMeta._abc_registry_clear ɚ; _abc_registry_clear ɚ; . Clear the registry (for debugging or testing). ɚ; yA yA } 0yA @tD I I I xA t d| j d| j | t dt | t | \ }}}}t d|| t d|| t d|| t d|| d S ɚ; _abc_negative_cache_version ɚ; _abc_negative_cache ɚ; _abc_cache ɚ; _abc_registry ɚ; ABCMeta._dump_registry ɚ; _dump_registry ɚ; _abc_negative_cache_version: ɚ; _abc_negative_cache: ɚ; _abc_cache: ɚ; _abc_registry: ɚ; Inv. counter: ɚ; Class: ɚ; ' Debug helper to print the ABC registry. ɚ; wA wA y pC \D I `I @wA t | | S ɚ; ABCMeta.__subclasscheck__ ɚ; ' Override for issubclass(subclass, cls). ɚ; wA vA u vA \D I @I @wA t | | S ɚ; instance ɚ; ABCMeta.__instancecheck__ ɚ; ' Override for isinstance(instance, cls). ɚ; PvA vA n pC \D I I I uA t | | S ɚ; subclass ɚ; ABCMeta.register ɚ; register ɚ; { Register a virtual subclass of an ABC. Returns the subclass, to allow usage as a class decorator. ɚ; 0 D uA i 0uA 3D I `I tA t j | |||fi |}t | |S ɚ; namespace ɚ; bases ɚ; mcls ɚ; ABCMeta.__new__ ɚ; Metaclass for defining Abstract Base Classes (ABCs). Use this metaclass to create an ABC. An ABC can be subclassed directly, and then acts as a mix-in class. You can also register unrelated concrete classes (even built-in classes) and unrelated ABCs as 'virtual subclasses' -- these and their descendants will be considered subclasses of the registering ABC by the built-in issubclass() function, but the registering ABC won't show up in their MRO (Method Resolution Order) nor will method implementations defined by the registering ABC be callable (not even via super()). ɚ; ABCMeta ɚ; _reset_caches ɚ; _reset_registry ɚ; _get_dump ɚ; _abc_subclasscheck ɚ; _abc_instancecheck ɚ; _abc_register ɚ; _abc_init ɚ; get_cache_token ɚ; ptA tA D I I I sA e Zd ZdZdZdS ɚ; A decorator indicating abstract properties. Deprecated, use 'property' with 'abstractmethod' instead: class C(ABC): @property @abstractmethod def my_abstract_property(self): ... ɚ; abstractproperty ɚ; PsA rA 0 -B I I I `rA e Zd ZdZdZ fdZ xZS ɚ; , pA 0rA ? qA @:C I I qA d|_ t | d S ɚ; abstractstaticmethod.__init__ ɚ; A decorator indicating abstract staticmethods. Deprecated, use 'staticmethod' with 'abstractmethod' instead: class C(ABC): @staticmethod @abstractmethod def my_abstract_staticmethod(...): ... ɚ; abstractstaticmethod ɚ; 0qA rA -B I `I `I `rA e Zd ZdZdZ fdZ xZS ɚ; , pA 0rA + qA @:C I I qA d|_ t | d S ɚ; callable ɚ; abstractclassmethod.__init__ ɚ; A decorator indicating abstract classmethods. Deprecated, use 'classmethod' with 'abstractmethod' instead: class C(ABC): @classmethod @abstractmethod def my_abstract_classmethod(cls, ...): ... ɚ; abstractclassmethod ɚ; pA pA ppA I I I pA d| _ | S ɚ; funcobj ɚ; abstractmethod ɚ; <frozen abc> ɚ; I A decorator indicating abstract methods. Requires that the metaclass is ABCMeta or derived from it. A class that has a metaclass derived from ABCMeta cannot be instantiated unless all of its abstract methods are overridden. The abstract methods can be called using any of the normal 'super' call mechanisms. abstractmethod() may be used to declare abstract methods for properties and descriptors. Usage: class C(metaclass=ABCMeta): @abstractmethod def my_abstract_method(self, arg1, arg2, argN): ... ɚ; 3 Abstract Base Classes (ABCs) according to PEP 3119. ɚ; _frozen_importlib ɚ; iA phA hA pgA C `ZJ @J @J eA t | | }d }t D ]\ }}}||z }t j d| j t |d | j | }|d } t | j | } d } |r. t | | ||| } n)# t $ r } | }Y d } ~ nd } ~ ww xY wt | | } | |d } | || fc S # t $ r Y w xY w|rd| } t | | |t d|| ɚ; import_error ɚ; module load failed: ɚ; trying {}{}{} ɚ; M PeA dA dA pdA CD `ZJ @I @I cA |dd dv sJ |d d } | j | }t | j | S # t $ r Y d S w xY w ɚ; o 0cA bA bA 0bA @tD `ZJ I I `aA |dd dv sJ |d d }| j | }|d }|d }|d }t || |fS # t t t f$ r Y dS w xY w ɚ; uncompressed_size ɚ; IndexError ɚ; o ɚ; c ɚ; < `A p`A 0`A \D `ZJ I I _A t j | dz dz | dz dz | dz |dz |dz dz |dz dz d d d f S ɚ; d ɚ; _parse_dostime ɚ; mktime ɚ; # 0_A ^A ^A \D `ZJ I I @^A t | }t || dd S ɚ; _compile_source ɚ; / ]A p]A 0]A `ZJ I I \A | dd } | dd } | S ɚ; _normalize_line_endings ɚ; O [A 0[A ZA C `ZJ I I XA ||d}t j ||| }|dz dk }|rt|dz dk }t j dk rZ|st j dk rHt | | } | 6t j t j | } t j || || nnt | | \ } } | rYt t |dd | rt |dd | k rt j d | d S t j |d d } t | t st# d |d | S ɚ; _unmarshal_code ɚ; _get_mtime_and_size_of_source ɚ; _get_pyc_source ɚ; is not a code object ɚ; compiled module ɚ; 9C PXA y XA \D `ZJ I I WA t | |z dk S ɚ; t2 ɚ; t1 ɚ; _eq_mtime ɚ; abs ɚ; 0WA VA VA K pUA WC `ZJ >J >J RA |\ }}}}}}}} |dk rt d t j | 5 } | | n"# t $ r t d| | w xY w| d } t | dk rt d | d d dk rt d | | t | d d } t | d d } d| z | z }||z } | | n"# t $ r t d| | w xY w| | }t | |k rt d d d d n # 1 swxY w Y |dk r|S t }n # t $ r t d w xY w ||d S ɚ; raw_data ɚ; datapath ɚ; zipimport: can't read data ɚ; bad local file header: ɚ; negative data size ɚ; QA QA @QA 6 QA `ZJ J J PA t r#t j d t d da ddlm} n1# t $ r$ t j d t d w xY w da n# da w xY wt j d | S ɚ; _get_decompress_func ɚ; zlib ɚ; _importing_zlib ɚ; zipimport: zlib available ɚ; decompress ɚ; ) can't decompress data; zlib not available ɚ; zipimport: zlib UNAVAILABLE ɚ; ! " # $ % & ' ( ) * + , - . / 0 1 2 3 4 5 6 7 8 9 : ; < = > ? @ A B C D E F G H I J K L M N O P Q R S T U V W X Y Z [ \ ] ^ _ ` a b c d e f g h i j k l m n o p q r s t u v w x y z { | } ~ # %%%%$%a%b%V%U%c%Q%W%]%\%[%%%4%,% % %<%^%_%Z%T%i%f%`%P%l%g%h%d%e%Y%X%R%S%k%j%% %%%%%% ")"a" e"d" #!# H" " " % ɚ; k NA MA LA KA `KA `ZJ `UJ `UJ CA t j | }n"# t $ r t d| | w xY w|5 | } | t d | }| t }n"# t $ r t d| | w xY wt | t k rt d| | |d d t k rB | dd | }n"# t $ r t d| | w xY wt |t z t z d } | | | }n"# t $ r t d| | w xY w| t }|dk rt d| | |||t z }t | t k rt d| | |t | z |z }t |d d } t |d d } || k rt d | | || k rt d | | || z }|| z } | dk rt d| | i } d} | | n"# t $ r t d| | w xY w | d }t | dk rt d |d d dk rnt | dk rt d t |dd }t |dd }t |d d }t |dd }t |d d }t |d d }t |dd }t |dd }t |dd }t |dd }t |dd }||z |z } || k rt d | | || z } | | }n"# t $ r t d| | w xY wt | |k rt d| | t | | |z | |z k rt d| | n"# t $ r t d| | w xY w|d z r| }nT | d }n=# t" $ r0 | d t& }Y nw xY w| d t* }t- j | | }||||||||f}|| |< | d!z } | | n# | | w xY w d d d n # 1 swxY w Y t1 j d"| | | S ɚ; t ɚ; file_offset ɚ; comment_size ɚ; extra_size ɚ; name_size ɚ; data_size ɚ; crc ɚ; date ɚ; time ɚ; compress ɚ; arc_offset ɚ; header_offset ɚ; header_size ɚ; pos ɚ; max_comment_start ɚ; file_size ɚ; header_position ɚ; start_offset ɚ; fp ɚ; cp437_table ɚ; translate ɚ; UnicodeDecodeError ɚ; MAX_COMMENT_LEN ɚ; STRING_END_ARCHIVE ɚ; END_CENTRAL_DIR_SIZE ɚ; ! zipimport: found {} names in {!r} ɚ; ascii ɚ; bad local header offset: ɚ; EOF read where not expected ɚ; & bad central directory size or offset: ɚ; bad central directory offset: ɚ; bad central directory size: ɚ; corrupt Zip file: ɚ; not a Zip file: ɚ; can't read Zip file: ɚ; can't open Zip file: ɚ; 3 D BA r PBA lD `ZJ LJ LJ AA t | | }t D ]\ }}}||z }|| j v r|c S d S ɚ; isbytecode ɚ; _zip_searchorder ɚ; D AA i PAA CD `ZJ KJ KJ AA |t z }|| j v S ɚ; dirpath ɚ; $ @A @A e P@A \D `ZJ LJ LJ ?A | j | d d z S ɚ; __init__.pyc ɚ; 3 0?A p>A . `ZJ @=A e Zd ZdZd ZddZddZddZd Zd Z d Z d Z d Z d Z d Zd Zd ZdS ɚ; =A <A S ZD `ZJ `$J `<A d| j t | j dS ɚ; zipimporter.__repr__ ɚ; "> ɚ; <zipimporter object " ɚ; i 0<A ;A ;A I ZD `ZJ J 'J :A t | j | _ | j t | j < dS # t $ r+ t | j d i | _ Y dS w xY w ɚ; zipimporter.invalidate_caches ɚ; ) Reload the file data of the archive path. ɚ; = :A 0:A 9A : 9A CD `ZJ J )J 9A | | sdS n# t $ r Y dS w xY wddlm} || | S ɚ; zipimporter.get_resource_reader ɚ; ZipReader ɚ; Return the ResourceReader for a package in a zip file. If 'fullname' is a package within the zip file, return the 'ResourceReader' object for the package. Otherwise return None. ɚ; n p8A p7A 7A 6A @bD `ZJ @eL .J 5A d}t j |t t | | \ }}}t j | }|t |t s t | }|t j |< | |_ |r2t | | }t j | j | }|g|_ t |d s t |_ t j |j || t' ||j n# t j |= xY w t j | }n!# t( $ r t+ d|d w xY wt- j d|| |S ɚ; mod ɚ; zipimporter.load_module ɚ; _module_type ɚ; import {} # loaded from Zip {} ɚ; not found in sys.modules ɚ; Loaded module ɚ; r zipimport.zipimporter.load_module() is deprecated and slated for removal in Python 3.12; use exec_module() instead ɚ; @ load_module(fullname) -> module. Load the module specified by 'fullname'. 'fullname' must be the fully qualified (dotted) module name. It returns the imported module, or raises ZipImportError if it could not be imported. Deprecated since Python 3.10. Use exec_module() instead. ɚ; ) 4A p4A 04A CD `ZJ L 3J 3A t | | }|t d|| |S ɚ; zipimporter.is_package ɚ; is_package(fullname) -> bool. Return True if the module specified by fullname is a package. Raise ZipImportError if the module couldn't be found. ɚ; p3A 2A 2A P2A @tD `ZJ 7J `1A t | | }|t d|| t | | }|rt j |d }n| d} | j | }n# t $ r Y dS w xY wt | j | S ɚ; fullpath ɚ; zipimporter.get_source ɚ; can't find module ɚ; get_source(fullname) -> source string. Return the source code for the specified module. Raise ZipImportError if the module couldn't be found, return None if the archive does contain the module, but has no source for it. ɚ; 01A 0A 0A D `ZJ @yL :J @0A t | | \ }}}|S ɚ; zipimporter.get_filename ɚ; get_filename(fullname) -> filename string. Return the filename for the specified module or raise ZipImportError if it couldn't be imported. ɚ; /A p/A /A .A pD `ZJ K =J -A t r | t t }|}| | j t z r$|t | j t z d } | j | }n # t $ r t dd| w xY wt | j | S ɚ; toc_entry ɚ; zipimporter.get_data ɚ; _get_data ɚ; get_data(pathname) -> string with file data. Return the data associated with 'pathname'. Raise OSError if the file wasn't found. ɚ; -A 0A 0A D `ZJ FL `@J `-A t | | \ }}}|S ɚ; ispackage ɚ; zipimporter.get_code ɚ; _get_module_code ɚ; get_code(fullname) -> code object. Return the code object for the specified module. Raise ZipImportError if the module couldn't be imported. ɚ; -A ,A 0,A lD `ZJ PL DJ @+A t | | }|t j || | S t | | }t | | rE| j t | }t j |dd }|j | |S dS ɚ; module_info ɚ; zipimporter.find_spec ɚ; k Create a ModuleSpec for the specified module. Returns None if the module cannot be found. ɚ; 7 *A 0*A )A CD `ZJ ML `FJ )A t j dt | || d S ɚ; zipimporter.find_module ɚ; f zipimporter.find_module() is deprecated and slated for removal in Python 3.12; use find_spec() instead ɚ; find_module(fullname, path=None) -> self or None. Search for a module specified by 'fullname'. 'fullname' must be the fully qualified (dotted) module name. It returns the zipimporter instance itself if the module was found, or None if it wasn't. The optional 'path' argument is ignored -- it's there for compatibility with the importer protocol. Deprecated since Python 3.10. Use find_spec() instead. ɚ; j P)A (A m p(A D `ZJ qK KJ 'A t j dt t | | }|| g fS t | | }t | | rd| j t | gfS dg fS ɚ; modpath ɚ; mi ɚ; zipimporter.find_loader ɚ; _is_dir ɚ; _get_module_path ɚ; _get_module_info ɚ; f zipimporter.find_loader() is deprecated and slated for removal in Python 3.12; use find_spec() instead ɚ; / find_loader(fullname, path=None) -> self, str or None. Search for a module specified by 'fullname'. 'fullname' must be the fully qualified (dotted) module name. It returns the zipimporter instance itself if the module was found, a string containing the full path name if it's possibly a portion of a namespace package, or None otherwise. The optional 'path' argument is ignored -- it's there for compatibility with the importer protocol. Deprecated since Python 3.10. Use find_spec() instead. ɚ; 0'A P&A %A @ %A lD `ZJ @TJ #A t |t s t dt | |st d| t r | t t }g } t j | }|j dz dk rt d| n]# t t f$ rH t j | \ }}||k rt d| |}| | Y nw xY w t | }n)# t $ r t# | }|t |< Y nw xY w|| _ || _ t j |d d d | _ | j r| xj t z c_ d S d S ɚ; files ɚ; basename ɚ; zipimporter.__init__ ɚ; prefix ɚ; archive ɚ; _files ɚ; _read_directory ɚ; _zip_directory_cache ɚ; alt_path_sep ɚ; not a Zip file ɚ; archive path is empty ɚ; expected str, not ɚ; zipimporter(archivepath) -> zipimporter object Create a new zipimporter instance. 'archivepath' must be a path to a zipfile, or to a specific path inside a zipfile. For example, it can be '/tmp/myimport.zip', or '/tmp/myimport.zip/mydirectory', if mydirectory is a valid directory inside the archive. 'ZipImportError is raised if 'archivepath' doesn't point to a valid Zip archive. The 'archive' attribute of zipimporter objects contains the name of the zipfile targeted. ɚ; P#A #A " `ZJ ZJ ZJ "A e Zd ZdS ɚ; <frozen zipimport> ɚ; ZipImportError ɚ; P zipimport provides support for importing Python modules from Zip archives. This module exports three objects: - zipimporter: a class; its constructor takes a path to a Zip archive. - ZipImportError: exception raised by zipimporter objects. It's a subclass of ImportError, so it can be caught as ImportError, too. - _zip_directory_cache: a dict, mapping archive paths to zip directory info dicts, as used in zipimporter._files. It is usually not needed to use the zipimport module explicitly; it is used by the builtin import mechanism for sys.path items that are paths to Zip archives. ɚ; _NamespaceLoader ɚ; OPTIMIZED_BYTECODE_SUFFIXES ɚ; DEBUG_BYTECODE_SUFFIXES ɚ; __code__ ɚ; % _CASE_INSENSITIVE_PLATFORMS_BYTES_KEY ɚ; _pathseps_with_colon ɚ; all ɚ; posix ɚ; nt ɚ; p A A A \D @K K K @A t | t }t j t j | g t j t dS ɚ; supported_loaders ɚ; ) Install the path-based import components. ɚ; D A A @K dJ dJ A | a d S ɚ; _bootstrap_module ɚ; _set_bootstrap_module ɚ; < PA A A CD @K LK LK @A t t j f} t t f}t t f}| ||gS ɚ; bytecode ɚ; source ɚ; extensions ɚ; extension_suffixes ɚ; _ Returns a list of file-based module loaders. Each item is a tuple (loader, suffixes). ɚ; A A @A A @tD @K A | d }| d }|s1|r|j }n'||k rt || }nt || }|st ||| } || d< || d< || d< || d< d S # t $ r Y d S w xY w ɚ; cpathname ɚ; pathname ɚ; ns ɚ; , PA A @K J J A e Zd ZdZd Zd ZeZd Zd Z d dZ d Z e d Z d ZdS ɚ; A P A ZD @K `lJ A d | j S ɚ; FileFinder.__repr__ ɚ; FileFinder({!r}) ɚ; A A @ A @K `nJ nJ A fd}|S ɚ; FileFinder.path_hook ɚ; path_hook ɚ; + A p A 0 A C @K @pJ oJ A t | st d| | gR S ɚ; 6 FileFinder.path_hook.<locals>.path_hook_for_FileFinder ɚ; path_hook_for_FileFinder ɚ; only directories are supported ɚ; - Path hook for importlib.machinery.FileFinder. ɚ; A class method which returns a closure to use on sys.path_hook which will return an instance using the specified loaders and the path called on the closure. If the path called on the closure is not a directory, ImportError is raised. ɚ; 2 P A A @A z A @bD @K J vJ @A | j } t j |pt j }n # t t t f$ r g }Y nw xY wt j d st | | _ nut }|D ]]}| d \ }}}|r)d || }n|}| | ^|| _ t j t rd |D | _ dS dS ɚ; new_name ɚ; lower_suffix_contents ɚ; contents ɚ; FileFinder._fill_cache ɚ; NotADirectoryError ɚ; PermissionError ɚ; listdir ɚ; A A \D @K @yJ `A h | ]}| S ɚ; fn ɚ; ) FileFinder._fill_cache.<locals>.<setcomp> ɚ; D Fill the cache of potential modules and packages for this directory. ɚ; A A A G A C @K PL J A d}| d d } t | j pt j j }n# t $ r d}Y nw xY w|| j k r| || _ t r | j }| }n | j }|}||v rqt | j | }| j D ]E\ } } d| z } t || } t | r | | || |g| c S Ft# | }| j D ]\ } } t | j || z } n# t$ $ r Y dS w xY wt& d| d || z |v r*t | r| | || d| c S |r@t& d | t& |d } |g| _ | S dS ɚ; full_path ɚ; init_filename ɚ; base_path ɚ; cache_module ɚ; cache ɚ; tail_module ɚ; is_namespace ɚ; FileFinder.find_spec ɚ; _fill_cache ɚ; possible namespace for {} ɚ; trying {} ɚ; o Try to find a spec for the specified module. Returns the matching spec, or None if not found. ɚ; P A PGD B @ lD @K J J @ ||| }t |||| S ɚ; FileFinder._get_spec ɚ; F P@ @ 3 @ CD @K qK @J @ t j dt | | }|dg fS |j |j pg fS ɚ; FileFinder.find_loader ɚ; e FileFinder.find_loader() is deprecated and slated for removal in Python 3.12; use find_spec() instead ɚ; Try to find a loader for the specified module, or the namespace package portions. Returns (loader, list-of-portions). This method is deprecated. Use find_spec() instead. ɚ; @ @ - ZD @K J J `@ d| _ dS ɚ; FileFinder.invalidate_caches ɚ; Invalidate the directory mtime. ɚ; @ @ 0@ @ @K J @ g }|D ]&\ }| fd|D '|| _ |r|dk rt j | _ n=t | s't t j | | _ n|| _ d| _ t | _ t | _ dS ɚ; loaders ɚ; loader_details ɚ; FileFinder.__init__ ɚ; _relaxed_path_cache ɚ; _path_cache ɚ; _path_mtime ɚ; _loaders ɚ; D 3 @ @:C @K J @@ K | ]}|fV d S ɚ; & FileFinder.__init__.<locals>.<genexpr> ɚ; Initialize with the path to search on and a variable number of 2-tuples containing the loader and the file suffixes the loader recognizes. ɚ; File-based finder. Interactions with the file system are cached for performance, being refreshed when the directory the finder is handling has been modified. ɚ; FileFinder ɚ; d @ @ m @K J J @ e Zd ZdZed Zed Zed Zed Z ed d Z ed d Z ed d Z ed Z dS ɚ; @ P@ @ CD @K J J @ ddl m} |j | i |S ɚ; PathFinder.find_distributions ɚ; find_distributions ɚ; Find distributions. Return an iterable of all Distribution instances capable of loading the metadata for packages matching ``context.name`` (or all names if ``None`` indicated) along the paths in the list of directories ``context.path``. ɚ; < 0@ @ p@ pD @K ML J @ t j dt | || }|dS |j S ɚ; PathFinder.find_module ɚ; e PathFinder.find_module() is deprecated and slated for removal in Python 3.12; use find_spec() instead ɚ; find the module on sys.path or 'path' based on sys.path_hooks and sys.path_importer_cache. This method is deprecated. Use find_spec() instead. ɚ; b @ P@ @ @tD @K PL J @@ | t j }| ||| }|dS |j /|j }|r$d|_ t ||| j |_ |S dS |S ɚ; PathFinder.find_spec ɚ; Try to find a spec for 'fullname' on sys.path or 'path'. The search is based on sys.path_hooks and sys.path_importer_cache. ɚ; @ P@ @ @bD @K J J @ g }|D ]}t |t s| | }|xt |d r| || }n| || }|o|j |c S |j }|t d | | t |d }||_ |S ɚ; entry ɚ; namespace_path ɚ; PathFinder._get_spec ɚ; _get_spec ɚ; spec missing loader ɚ; ? Find the loader or namespace_path for this module/package name. ɚ; P@ @ p@ lD @K J J @@ t |d rPt | d}t j |t | | \ }}nNt | d}t j |t | | }g }|t || S t |d }||_ |S ɚ; PathFinder._legacy_get_spec ɚ; _legacy_get_spec ɚ; 5 .find_spec() not found; falling back to find_loader() ɚ; w @ @ `@ 0@ CD @K J J `@ |dk r& t j }n# t $ r Y dS w xY w t j | }n4# t $ r' | | }|t j |< Y nw xY w|S ɚ; PathFinder._path_importer_cache ɚ; _path_importer_cache ɚ; FileNotFoundError ɚ; Get the finder for the path entry from sys.path_importer_cache. If the path entry is not in the cache, find the appropriate finder and cache it. If no finder is available, store None. ɚ; a 0@ @ @ P@ \D @K J J @ t j &t j st j dt t j D ] } || c S # t $ r Y w xY wdS ɚ; hook ɚ; PathFinder._path_hooks ɚ; _path_hooks ɚ; path_hooks ɚ; sys.path_hooks is empty ɚ; . Search sys.path_hooks for a finder for 'path'. ɚ; P@ @ q @ CD @K J `J @ t t j D ]H\ } }|t | st j | = $t |d r| It xj dz c_ ddl m } | dS ɚ; PathFinder.invalidate_caches ɚ; importlib.metadata ɚ; path_importer_cache ɚ; MetadataPathFinder ɚ; invalidate_caches ɚ; } Call the invalidate_caches() method on all path entry finders stored in sys.path_importer_caches (where implemented). ɚ; > Meta path finder for sys.path and package __path__ attributes. ɚ; PathFinder ɚ; * 0@ @ 8 @K @rL @rL @ e Zd Zd Zed Zd Zd Zd Zd Z d Z d Z d Z d S ɚ; p@ 0@ b @ CD @K J J @ ddl m} || j S ɚ; # NamespaceLoader.get_resource_reader ɚ; NamespaceReader ɚ; < @ @ V P@A \D @K @eL J @@ t d| j t | | S ɚ; NamespaceLoader.load_module ɚ; & namespace module loaded with path {!r} ɚ; b Load a namespace module. This method is deprecated. Use exec_module() instead. ɚ; D S @ \D @K lL J @ d S ɚ; NamespaceLoader.exec_module ɚ; @ P BD \D @K lL J A dS ɚ; NamespaceLoader.create_module ɚ; 0@ @ M P@A \D @K FL @J @ t dddd S ɚ; NamespaceLoader.get_code ɚ; A J P@A \D @K `J `@ dS ɚ; NamespaceLoader.get_source ɚ; pA G P@A \D @K L J @ dS ɚ; NamespaceLoader.is_package ɚ; 5 @ @ < HC @K L J @ t j dt d | j S ɚ; NamespaceLoader.module_repr ɚ; <module {!r} (namespace)> ɚ; Q NamespaceLoader.module_repr() is deprecated and slated for removal in Python 3.12 ɚ; D @ 9 @ pD @K J @@ t ||| | _ d S ɚ; NamespaceLoader.__init__ ɚ; , @ @ @K J J @ e Zd ZdZdZd Zd Zd Zd Zd Z d Z d Z d Z d Z d Zd ZdS ɚ; D @ 1 p@ \D @K J @ | j | d S ɚ; _NamespacePath.append ɚ; D @ . p@ \D @K J @ || v S ɚ; item ɚ; _NamespacePath.__contains__ ɚ; p@ 0@ + ZD @K J @ d | j S ɚ; _NamespacePath.__repr__ ɚ; _NamespacePath({!r}) ɚ; " D @ ( ZD @K J `@ t | S ɚ; _NamespacePath.__len__ ɚ; D 0@ % @ CD @K J @ || j |< d S ɚ; _NamespacePath.__setitem__ ɚ; D @ " yB \D @K J `@ | | S ɚ; index ɚ; _NamespacePath.__getitem__ ɚ; " D 0@ ZD @K J @ t | S ɚ; _NamespacePath.__iter__ ɚ; D p@ 0@ CD @K J J `@ t | }|| j k s| j | j k rJ| | j | }||j |j r |j | _ || _ | j | _ | j S ɚ; parent_path ɚ; _NamespacePath._recalculate ɚ; _recalculate ɚ; 8 D @ @ CD @K J J `@ | \ }}t t j | | S ɚ; path_attr_name ɚ; parent_module_name ɚ; _NamespacePath._get_parent_path ɚ; + @ @ p@ pD @K J J @ | j d \ }}}|dk rdS |dfS ɚ; dot ɚ; & _NamespacePath._find_parent_path_names ɚ; _find_parent_path_names ɚ; > Returns a tuple of (parent-module-name, parent-path-attr-name) ɚ; J D P@ @ pD @K J @ || _ || _ t | | _ | j | _ || _ d S ɚ; path_finder ɚ; _NamespacePath.__init__ ɚ; _path_finder ɚ; _last_epoch ɚ; _epoch ɚ; _last_parent_path ɚ; _get_parent_path ɚ; & Represents a namespace package's path. It uses the module name to find its parent module, and from there it looks up the parent's __path__. When this changes, the module's own path is recomputed, using path_finder. For top-level modules, the parent module's path is sys.path. ɚ; _NamespacePath ɚ; , 0@ @ @K K K @ e Zd ZdZd Zd Zd Zd Zd Zd Z d Z d Z e d Z d S ɚ; p@ PD P@A \D @K @yL J @ | j S ɚ; ExtensionFileLoader.get_filename ɚ; @ P@A \D @K @J @ dS ɚ; ExtensionFileLoader.get_source ɚ; 5 Return None as extension modules have no source code. ɚ; p@ P@A \D @K FL J @ dS ɚ; ExtensionFileLoader.get_code ɚ; ? Return None as an extension module cannot create a code object. ɚ; < 0@ @ @ @@ @K L J @ t | j d t fdt D S ɚ; ExtensionFileLoader.is_package ɚ; any ɚ; @ 3 P@ @:C @K J @ K | ] }d |z k V dS ɚ; file_name ɚ; suffix ɚ; 1 ExtensionFileLoader.is_package.<locals>.<genexpr> ɚ; 1 Return True if the extension module is a package. ɚ; N @ 0@ @ \D @K lL J @ t t j | t d| j | j dS ɚ; ExtensionFileLoader.exec_module ɚ; exec_dynamic ɚ; ( extension module {!r} executed from {!r} ɚ; Initialize an extension module ɚ; N p@ @ @ CD @K lL @J @@ t t j | }t d|j | j |S ɚ; ! ExtensionFileLoader.create_module ɚ; create_dynamic ɚ; & extension module {!r} loaded from {!r} ɚ; ( Create an uninitialized extension module ɚ; * D @ ZD @K J @ t | j t | j z S ɚ; ExtensionFileLoader.__hash__ ɚ; ! D @ yC \D @K J @ | j |j k o| j |j k S ɚ; ExtensionFileLoader.__eq__ ɚ; D XA @ CD @K `J @ || _ || _ d S ɚ; ExtensionFileLoader.__init__ ɚ; ] Loader for extension modules. The constructor is designed to work with FileFinder. ɚ; P@ @ @K J J @ e Zd ZdZd Zd ZdS ɚ; P@ P@A \D @K J @ dS ɚ; SourcelessFileLoader.get_source ɚ; ' Return None as there is no source code. ɚ; h @ @ 0@ D @K FL `J @ | | }| | }||d}t ||| t t | dd || S ɚ; SourcelessFileLoader.get_code ɚ; - Loader which handles sourceless file imports. ɚ; SourcelessFileLoader ɚ; @ p@ v @K J J @ e Zd ZdZd Zd ZdddZdS ɚ; 8 P@ @ @@ @ @bD @K "K J @ t | \ }}g }|rGt | s8t | \ }}| | |rt | 8t | D ]g}t || } t j | (# t $ r Y 4t $ r(}t d|| Y d}~ dS d}~ww xY w t ||| t d| dS # t $ r'}t d|| Y d}~dS d}~ww xY w ɚ; SourceFileLoader.set_data ɚ; FileExistsError ɚ; mkdir ɚ; created {!r} ɚ; could not create {!r}: {!r} ɚ; Write bytes data to a file. ɚ; ( @ p@ @ D @K "K J @ t | }| ||| S ɚ; SourceFileLoader._cache_bytecode ɚ; _mode ɚ; p@ 0@ z @ CD @K %K `J @ t | }|j |j dS ɚ; SourceFileLoader.path_stats ɚ; st_size ɚ; st_mtime ɚ; ! Return the metadata for the path. ɚ; > Concrete implementation of SourceLoader using the file system. ɚ; SourceFileLoader ɚ; ; о@ 0@ D -B @K ` K ` K @ e Zd ZdZd Zd Zd Ze fd Zed Z d Z ed Z xZ S ɚ; @ @ p p@ CD @K J J @ ddl m} || S ɚ; FileLoader.get_resource_reader ɚ; get_resource_reader ɚ; importlib.readers ɚ; FileReader ɚ; @ @ @ g p@ CD @K K K @ t | t t f rOt j t | 5 }| cddd S # 1 swxY w Y dS t j |d 5 }| cddd S # 1 swxY w Y dS ɚ; FileLoader.get_data ɚ; open_code ɚ; ExtensionFileLoader ɚ; r ɚ; ' Return the data from path as raw bytes. ɚ; p@ PD b P@A \D @K @yL K @ | j S ɚ; FileLoader.get_filename ɚ; : Return the path to the source file as found by the finder. ɚ; * @ @ V p@ @:C @K @eL K @ t t | | S ɚ; FileLoader.load_module ɚ; super ɚ; d Load a module from a file. This method is deprecated. Use exec_module() instead. ɚ; * D @ S ZD @K K @ t | j t | j z S ɚ; FileLoader.__hash__ ɚ; hash ɚ; ! D @ O yC \D @K K @ | j |j k o| j |j k S ɚ; FileLoader.__eq__ ɚ; з@ XA I )A CD @K K @ || _ || _ dS ɚ; FileLoader.__init__ ɚ; K Cache the module name and the path to the file found by the finder. ɚ; g Base file loader class which implements the loader protocol methods that require file system usage. ɚ; FileLoader ɚ; @ @ @K *K *K @ e Zd Zd Zd Zd Zd Zd ZdddZd Z d S ɚ; s д@ г@ @@ @ @B @K FL K @ | | }d}d}d}d}d} t | } | | } t | d } | | } ||d} t | || } t | dd } | dz dk }|rm| d z dk }t j d k rS|st j d k rA| | }t j t | }t | ||| nt | || d || t d || t | ||| S # t t" f$ r Y n6w xY w# t$ $ r Y n&w xY w# t$ $ r Y nw xY w# t& $ r d}Y nw xY w|| | }| || }t d| t* j su|s|q|r(|t j | }t/ ||| } n t1 ||t3 | } | ||| n# t& $ r Y nw xY w|S ɚ; code_object ɚ; bytes_data ɚ; st ɚ; check_source ɚ; hash_based ɚ; SourceLoader.get_code ɚ; dont_write_bytecode ɚ; _RAW_MAGIC_NUMBER ɚ; check_hash_based_pycs ɚ; memoryview ɚ; code object from {} ɚ; {} matches {} ɚ; size ɚ; always ɚ; never ɚ; Concrete implementation of InspectLoader.get_code. Reading of bytecode requires path_stats to be implemented. To write bytecode, set_data must also be implemented. ɚ; & @ P@ @ pD @K K K @ t t ||dd| S ɚ; SourceLoader.source_to_code ɚ; source_to_code ɚ; compile ɚ; dont_inherit ɚ; Return the code object compiled from source. The 'data' argument can be any object type that compile() supports. ɚ; _optimize ɚ; ` @ @ @@ @ D @K ` K @@ | | } | | }n$# t $ r}t d| |d}~ww xY wt | S ɚ; SourceLoader.get_source ɚ; get_data ɚ; ' source not available through get_data() ɚ; 4 Concrete implementation of InspectLoader.get_source. ɚ; @ Ъ@ CD @K "K K A dS ɚ; SourceLoader.set_data ɚ; Optional method which writes data (bytes) to a file path (a str). Implementing this method allows for the writing of bytecode files. ɚ; @ P@ @ pD @K "K "K @ | || S ɚ; cache_path ɚ; SourceLoader._cache_bytecode ɚ; _cache_bytecode ɚ; set_data ɚ; Optional method which writes data (bytes) to a file path (a str). Implementing this method allows for the writing of bytecode files. The source path is needed in order to correctly transfer permissions ɚ; p@ 0@ @ \D @K %K %K @ d| | iS ɚ; SourceLoader.path_stats ɚ; path_stats ɚ; Optional method returning a metadata dict for the specified path (a str). Possible keys: - 'mtime' (mandatory) is the numeric timestamp of last source code modification; - 'size' (optional) is the size in bytes of the source code. Implementing this method allows the loader to read bytecode files. Raises OSError when the path cannot be handled. ɚ; p@ 0@ @ \D @K (K (K @ t ɚ; SourceLoader.path_mtime ɚ; path_mtime ɚ; Optional method that returns the modification time (an int) for the specified path (a str). Raises OSError when the path cannot be handled. ɚ; SourceLoader ɚ; @ @ @K @5K @5K `@ e Zd ZdZd Zd Zd Zd ZdS ɚ; 0@ @ P@A \D @K @eL @,K @ t | | S ɚ; _LoaderBasics.load_module ɚ; This method is deprecated. ɚ; l p@ @ @ CD @K lL .K @ | |j }|'t d |j t t ||j dS ɚ; _LoaderBasics.exec_module ɚ; 4 cannot load module {!r} when get_code() returns None ɚ; Execute the module. ɚ; @ BD \D @K lL 0K A dS ɚ; _LoaderBasics.create_module ɚ; * Use default semantics for module creation. ɚ; l @ P@ @ D @K L 3K @@ t | | d }| dd d }| d d }|dk o|dk S ɚ; tail_name ɚ; filename_base ɚ; _LoaderBasics.is_package ɚ; Concrete implementation of InspectLoader.is_package by checking if the path returned by get_filename has a filename of '__init__.py'. ɚ; S Base class of common code needed by both SourceLoader and SourcelessFileLoader. ɚ; _LoaderBasics ɚ; A @ @ S @K GK GK @ e Zd ZdZdZdZeodev Ze d Z e d Z e d d Z e d d ZdS ɚ; EXTENSION_SUFFIXES ɚ; _MS_WINDOWS ɚ; < @ @ p@ pD @K ML 8K `@ t j dt | || }||j S dS ɚ; ! WindowsRegistryFinder.find_module ɚ; p WindowsRegistryFinder.find_module() is deprecated and slated for removal in Python 3.12; use find_spec() instead ɚ; j Find module named in the registry. This method is deprecated. Use find_spec() instead. ɚ; 0@ @ `@ u @ @D @K PL `<K @ | | }|d S t | n# t $ r Y d S w xY wt D ]R\ }}| t | r+t | ||| | }|c S Sd S ɚ; WindowsRegistryFinder.find_spec ɚ; @ @ @ f P@ @tD @K ?K ?K @ | j r| j }n| j }| |dt j d d z } | | 5 }t j |d }d d d n # 1 swxY w Y n# t $ r Y d S w xY w|S ɚ; filepath ɚ; hkey ɚ; registry_key ɚ; & WindowsRegistryFinder._search_registry ɚ; _search_registry ɚ; QueryValue ɚ; version_info ɚ; REGISTRY_KEY ɚ; REGISTRY_KEY_DEBUG ɚ; DEBUG_BUILD ɚ; sys_version ɚ; %d.%d ɚ; P D @ @@ _ @ @K CK CK @ t j t j | S # t $ r" t j t j | cY S w xY w ɚ; $ WindowsRegistryFinder._open_registry ɚ; _open_registry ɚ; HKEY_LOCAL_MACHINE ɚ; HKEY_CURRENT_USER ɚ; OpenKey ɚ; winreg ɚ; _d.pyd ɚ; A Software\Python\PythonCore\{sys_version}\Modules\{fullname}\Debug ɚ; ; Software\Python\PythonCore\{sys_version}\Modules\{fullname} ɚ; > Meta path finder for modules declared in the Windows registry. ɚ; WindowsRegistryFinder ɚ; @ 0@ @ P@ @bD @K xL xL @ |:d}t |d r' | | }ng# t $ r Y n[w xY wnVt j | }t | s3 t t j | }n# t $ r Y nw xY wt | || }d|_ |Mt D ]<\ }}| t | r || | }||_ n=dS |t u rAt |d r0 | | }|rg |_ n# t $ r Y n w xY wn||_ |j g k r1|r/t' | d }|j | |S ɚ; dirname ɚ; suffixes ɚ; loader_class ɚ; _POPULATE ɚ; _get_supported_file_loaders ɚ; = Return a module spec based on a file location. To indicate that the module is a package, set submodule_search_locations to a list of directory paths. An empty list is sufficient, though its not otherwise useful to the import system. The loader must take a spec as its only __init__() arg. ɚ; v p@ @ @ D @K QK QK @ ddl }t j | j }| | }t j dd }| | |d S ɚ; newline_decoder ɚ; source_bytes_readline ɚ; source_bytes ɚ; decode_source ɚ; IncrementalNewlineDecoder ɚ; detect_encoding ɚ; BytesIO ɚ; tokenize ɚ; y Decode bytes representing source code and return the string. Universal newline support is used in the decoding. ɚ; Б@ p@ @ D @K @UK @UK @@ t t }d|dz z }| t | t | dk sJ | | | t j | |S ɚ; checked ɚ; _code_to_hash_pyc ɚ; & Produce the data for a hash-based pyc. ɚ; @ @ P@ pD @K @XK @XK @ t t }| t d | t | | t | | t j | |S ɚ; mtime ɚ; _code_to_timestamp_pyc ɚ; dumps ɚ; bytearray ɚ; + Produce the data for a timestamp-based pyc. ɚ; P@ Ѝ@ p@ D @K @[K @[K @ t j | }t |t r4t d| |t j || |S t d | || ɚ; _compile_bytecode ɚ; _fix_co_filename ɚ; _code_type ɚ; loads ɚ; marshal ɚ; Non-code object in {!r} ɚ; code object from {!r} ɚ; # Compile bytecode as found in a pyc. ɚ; ! P@ @ @ pD @K _K _K @ | dd |k rt d|fi |dS ɚ; source_hash ɚ; _validate_hash_pyc ɚ; . hash in bytecode doesn't match hash of source ɚ; Validate a hash-based pyc by checking the real source hash against the one in the pyc header. *data* is the contents of the pyc file. (Only the first 16 bytes are required.) *source_hash* is the importlib.util.source_hash() of the source file. *name* is the name of the module being imported. It is used for logging. *exc_details* is a dictionary passed to ImportError if it raised for improved debugging. An ImportError is raised if the bytecode is stale. ɚ; @ P@ @ @tD @K `dK `dK @ t | dd |dz k r-d|}t d| t |fi ||.t | dd |dz k rt d|fi |dS dS ɚ; source_size ɚ; source_mtime ɚ; _validate_timestamp_pyc ɚ; bytecode is stale for ɚ; Validate a pyc against the source last-modified time. *data* is the contents of the pyc file. (Only the first 16 bytes are required.) *source_mtime* is the last modified timestamp of the source file. *source_size* is None or the size of the source file in bytes. *name* is the name of the module being imported. It is used for logging. *exc_details* is a dictionary passed to ImportError if it raised for improved debugging. An ImportError is raised if the bytecode is stale. ɚ; P@ @ @ @tD @K jK jK `@ | dd }|t k r0d|d|}t d| t |fi |t | dk r/d|}t d| t | t | dd }|d z rd |d |}t |fi ||S ɚ; magic ɚ; exc_details ɚ; _classify_pyc ɚ; EOFError ɚ; MAGIC_NUMBER ɚ; in ɚ; invalid flags ɚ; ( reached EOF while reading pyc header of ɚ; {} ɚ; : ɚ; bad magic number in ɚ; T Perform basic validity checking of a pyc header and return the flags field, which determines how the pyc should be further validated against the source. *data* is the contents of the pyc file. (Only the first 16 bytes are required, though.) *name* is the name of the module being imported. It is used for logging. *exc_details* is a dictionary passed to ImportError if it raised for improved debugging. ImportError is raised when the magic number is incorrect or when the flags field is invalid. EOFError is raised when the data is found to be truncated. ɚ; { @ @ n P@ D @K @qK @qK @ t j dt | | \ }}|Dt | r5d}t j | |d t |S ɚ; portions ɚ; _find_module_shim ɚ; find_loader ɚ; , Not importing directory {}: missing __init__ ɚ; Z find_module() is deprecated and slated for removal in Python 3.12; use find_spec() instead ɚ; Try to find a loader for the specified module by delegating to self.find_loader(). This method is deprecated in favor of finder.find_spec(). ɚ; - P@ @ O Ѓ@ @ @K tK tK @ d fd }t t j }nd } || |S ɚ; _check_name ɚ; V Ђ@ p@ d 0@ CD @K L vK @ dD ]1}t || r t | |t || 2| j |j d S ɚ; _check_name.<locals>._wrap ɚ; @ Ѐ@ @ W 0@ /D @K xK xK @ || j }n'| j |k r t d| j d|| | |g|R i |S ɚ; method ɚ; ( _check_name.<locals>._check_name_wrapper ɚ; _check_name_wrapper ɚ; cannot handle ɚ; loader for ɚ; Decorator to verify that the module being requested matches the one the loader can handle. The first argument (self) must define _name which the second argument is compared against. If the comparison fails then ImportError is raised. ɚ; 0 P@ @ ~@ C ~@ \D @K |K |K ~@ t | j }n# t $ r d}Y nw xY w|dz }|S ɚ; _calc_mode ɚ; 3 Calculate the mode permissions for a bytecode file. ɚ; t D }@ `}@ 7 pB @K L L |@ | t t r! t | S # t $ r Y d S w xY w| t t r| S d S ɚ; tuple ɚ; p|@ |@ {@ $ p{@ D @K z@ t | dk rdS | d \ }}}|r | dd dk r| S t | }n!# t t f$ r | dd }Y nw xY wt | r|n| S ɚ; source_path ɚ; extension ɚ; bytecode_path ɚ; lower ɚ; py ɚ; Convert a bytecode file path to a source path (if possible). This function exists purely for backwards-compatibility for PyImport_ExecCodeModuleWithFilenames() in the C API. ɚ; y@ x@ px@ _D @K K K v@ t j j t d t j | } t | \ }}d}t j Zt j t }| |t z r|t | d }d}|s6t | \ }}|t k rt t d| | d }|dvrt d| |d k r| dd d }| t" st d t" |t t" d }| st d |d | d d } t) || t* d z S ɚ; base_filename ɚ; opt_level ɚ; dot_count ɚ; pycache ɚ; stripped_path ɚ; found_in_pycache_prefix ɚ; pycache_filename ɚ; source_from_cache ɚ; SOURCE_SUFFIXES ɚ; is not an alphanumeric value ɚ; optimization level ɚ; 5 optimization portion of filename does not start with ɚ; expected only 2 or 3 dots in ɚ; not bottom-level directory in ɚ; n Given the path to a .pyc. file, return the path to its .py file. The .pyc file does not need to exist; this simply returns the path to the .py file calculated to correspond to the .pyc file. If path does not conform to PEP 3147/488 format, ValueError will be raised. If sys.implementation.cache_tag is None then NotImplementedError is raised. ɚ; Pu@ 0t@ s@ $C @K K K `q@ |3t j dt |d}t | |rdnd}t j | } t | \ }}| d \ }}}t j j } | t d d |r|n||| g } |)t j j dk rd}nt j j }t | }|dk rR| s"t# d | d | t& | } | t( d z } t j t- | s!t/ t j | }|d d k r|d t2 vr |d d }t/ t j | t2 | S t/ |t6 | S ɚ; almost_filename ɚ; tag ɚ; rest ɚ; head ɚ; debug_override ɚ; cache_from_source ɚ; _PYCACHE ɚ; lstrip ɚ; pycache_prefix ɚ; BYTECODE_SUFFIXES ɚ; _OPT ɚ; isalnum ɚ; optimize ɚ; cache_tag ɚ; fspath ɚ; {}.{}{} ɚ; {!r} is not alphanumeric ɚ; $ sys.implementation.cache_tag is None ɚ; 2 debug_override or optimization must be set to None ɚ; F the debug_override parameter is deprecated; use 'optimization' instead ɚ; Given the path to a .py file, return the path to its .pyc file. The .py file does not need to exist; this simply returns the path to the .pyc file calculated as if the .py file were imported. The 'optimization' parameter controls the presumed optimization level of the bytecode file. If 'optimization' is not None, the string representation of the argument is taken and verified to be alphanumeric (else ValueError is raised). The debug_override parameter is deprecated. If debug_override is not None, a True value is the same as setting 'optimization' to the empty string while a False value is equivalent to setting 'optimization' to '1'. If sys.implementation.cache_tag is None then NotImplementedError is raised. ɚ; optimization ɚ; .pyc ɚ; .pyw ɚ; opt- ɚ; __pycache__ ɚ; q@ pp@ o@ o@ @tD @K K K n@ d | t | }t j |t j t j z t j z |dz } t j |d 5 }| | ddd n # 1 swxY w Y t j || dS # t $ r( t j | n# t $ r Y nw xY w w xY w ɚ; fd ɚ; path_tmp ɚ; _write_atomic ɚ; unlink ɚ; FileIO ɚ; _io ɚ; O_WRONLY ɚ; O_CREAT ɚ; O_EXCL ɚ; wb ɚ; Best-effort function to write data to a path atomically. Be prepared to handle a FileExistsError if concurrent writing of the temporary file is attempted. ɚ; m@ m@ PD @K K K `m@ | t S ɚ; p m@ l@ pl@ \D @K K K k@ | sdS t j | d dd }t | dk o)| d p| d S ɚ; _path_isabs ɚ; \\ ɚ; Replacement for os.path.isabs. ɚ; & k@ Pk@ PD @K K K j@ | st j } t | d S ɚ; _path_isdir ɚ; getcwd ɚ; Replacement for os.path.isdir. ɚ; j@ pj@ PD @K `K `K j@ t | d S ɚ; _path_isfile ɚ; Replacement for os.path.isfile. ɚ; 1 i@ i@ `i@ 0i@ CD @K `K `K h@ t | }n# t $ r Y dS w xY w|j dz |k S ɚ; stat_info ɚ; _path_is_mode_type ɚ; st_mode ɚ; OSError ɚ; 1 Test whether the path is the specified mode type. ɚ; ph@ 0h@ PD @K K K g@ t j | S ɚ; _path_stat ɚ; stat ɚ; ~ Stat the path. Made a separate function to make it easier to override in experiments (e.g. cache stat results). ɚ; C g@ Pg@ g@ 6D @K K K f@ t fdt D }|dk rd fS d| |dz d fS ɚ; i ɚ; _path_split ɚ; max ɚ; ! D Pf@ 3 f@ @:C @K K e@ K | ]} | V d S ɚ; _path_split.<locals>.<genexpr> ɚ; rfind ɚ; Replacement for os.path.split(). ɚ; % pe@ 0e@ ~ d@ @K K K d@ t d | D S ɚ; # Pd@ d@ \D @K K c@ g | ] }|| t S ɚ; part ɚ; b Pc@ b@ ` Pb@ D @K K K `@ | sdS t | dk r| d S d}g }t t j | D ]\ }}| t s| t r(| t p|}t |z g}a| d rF| | k r|}|g}| | |p|}| | d |D }t | dk r|d s |t z S |t | z S ɚ; tail ɚ; new_root ɚ; root ɚ; path_parts ɚ; _path_join ɚ; casefold ɚ; path_sep ɚ; endswith ɚ; path_sep_tuple ɚ; _path_splitroot ɚ; map ɚ; # Pd@ w p`@ \D @K K `@ g | ] }|| t S ɚ; p ɚ; _path_join.<locals>.<listcomp> ɚ; path_separators ɚ; rstrip ɚ; Replacement for os.path.join(). ɚ; 1 _@ _@ Y P_@ @K @K @K ^@ t | dk sJ t | d S ɚ; _unpack_uint16 ɚ; / Convert 2 bytes in little-endian to an integer. ɚ; 1 ^@ _@ T P_@ @K @K @K ^@ t | dk sJ t | d S ɚ; data ɚ; _unpack_uint32 ɚ; from_bytes ɚ; / Convert 4 bytes in little-endian to an integer. ɚ; ' P^@ ^@ O ]@ @K @K @K `]@ t | dz dd S ɚ; _pack_uint32 ɚ; to_bytes ɚ; int ɚ; * Convert a 32-bit integer to little-endian. ɚ; Z ]@ \@ < p\@ \@ @K K K [@ t j t r/t j t rdndfd} nd } | S ɚ; _make_relax_case ɚ; # _CASE_INSENSITIVE_PLATFORMS_STR_KEY ɚ; _CASE_INSENSITIVE_PLATFORMS ɚ; [@ G @K K K Z@ dS ɚ; 5 True if filenames must be checked case-insensitively. ɚ; " Z@ 0Z@ C @ @K K K Y@ t j j o t j v S ɚ; key ɚ; % _make_relax_case.<locals>._relax_case ɚ; _relax_case ɚ; environ ɚ; _os ɚ; ignore_environment ɚ; ^ True if filenames must be checked case-insensitively and ignore environment flags are not set. ɚ; PYTHONCASEOK ɚ; darwin ɚ; cygwin ɚ; win ɚ; Y@ 2 pY@ \D @K Y@ h | ]}d | S ɚ; s ɚ; : ɚ; tB X@ # . X@ \D @K @X@ K | ]}t | d k V dS ɚ; .0 ɚ; & <frozen importlib._bootstrap_external> ɚ; ^ Core implementation of path-based import. This module is NOT meant to be directly imported! It has been designed such that it can be bootstrapped into Python as the implementation of import. As such it requires the injection of specific modules and attributes in order to work. One should use importlib as the public-facing version of this module. ɚ; object ɚ; _ERR_MSG_PREFIX ɚ; 3 pN@ N@ P M@ L K K `M@ ddl } | a| t j t dS ɚ; _install_external_importers ɚ; _frozen_importlib_external ɚ; 9 Install importers that require external filesystem access ɚ; [ 0M@ L@ H L@ \D L K K L@ t | | t j t t j t dS ɚ; _install ɚ; 0 Install importers for builtin and frozen modules ɚ; # K@ K@ # J@ _D L K K I@ |a | at t }t j D ]\ }}t || rw|t j v rt }n#t | rt }nNt || }t || |t u r| | t j t }dD ]C}|t j vrt | } nt j | } t ||| DdS ɚ; builtin_module ɚ; builtin_name ɚ; self_module ɚ; module_type ɚ; _imp_module ɚ; sys_module ɚ; _setup ɚ; Setup importlib by importing needed built-in modules and injecting them into the global namespace. As sys is needed for sys.modules access and _imp is needed to load built-in modules, those two modules must be explicitly passed in. ɚ; > H@ PH@ H@ \D L K K G@ t | }|t d| z t | S ɚ; _builtin_from_name ɚ; no built-in module named ɚ; PG@ F@ PF@ @bD L E@ |dk rt | }n&||ni }t | }t | || }|s|dk r(t | d d S | s|S t | t | d d z }t j |j dt |j |z S t |d rt ||t S |S ɚ; cut_off ɚ; globals_ ɚ; locals ɚ; partition ɚ; Import a module. The 'globals' argument is used to infer where the import is occurring from to handle relative imports. The 'locals' argument is ignored. The 'fromlist' argument specifies what should exist as attributes on the module being imported (e.g. ``from module import <fromlist>``). The 'level' argument represents the package location to import from in a relative import (e.g. ``from ..pkg import mod`` would have a 'level' of 2). ɚ; pD@ D@ C@ CD L K K B@ | d }| d }|=|9||j k r.t d|d|j dt d |S ||j S t d t d | d }d | vr| d d }|S ɚ; globals ɚ; _calc___package__ ɚ; Y can't resolve package from __spec__ or __package__, falling back on __name__ and __path__ ɚ; stacklevel ɚ; ) ɚ; != ɚ; __package__ != __spec__.parent ( ɚ; Calculate what __package__ should be. __package__ is not guaranteed to be defined or could be set to None to represent that its proper value is unknown. ɚ; 0B@ pA@ A@ @@ @D L ?@ |D ]}t |t s6|r | j dz }nd}t d| dt | j |dk r+|s(t | d rt | | j |d t | | sud | j | } t || # t $ r;}|j |k r*t j |t Y d }~ d }~ww xY w| S ɚ; exc ɚ; from_name ɚ; where ɚ; x ɚ; fromlist ɚ; * ɚ; must be str, not ɚ; Item in ɚ; ``from list'' ɚ; .__all__ ɚ; Figure out what __import__ should return. The import_ parameter is a callable which takes the name of module to import. It is required to decouple the function from assuming importlib's import implementation is desired. ɚ; recursive ɚ; > >@ >@ P>@ CD L K K =@ t | || |dk rt | || } t | t S ɚ; _gcd_import ɚ; 2 Import and return the module based on its name, the package the call is being made from, and the level adjustment. This function represents the greatest common denominator of functionality between import_module and __import__. This includes setting __package__ if the loader did not. ɚ; p=@ <@ <@ P<@ pD L :@ t j | t }|t u s t t |dd dd rt | 5 t j | t }|t u r t | | cddd S ddd n # 1 swxY w Y t | |&d | }t || |S ɚ; _NEEDS_LOADING ɚ; ( import of {} halted; None in sys.modules ɚ; Find and load the module. ɚ; P:@ 9@ 9@ ` 8@ _D L K K `6@ d }| d d }d }|r|t j vrt || | t j v rt j | S t j | } |j }n># t $ r1 t dz | | }t || d w xY w|j }| d d }t | | }|)t t | | |r|j | t | } |r|j n!# |r|j w w xY w|r]t j | } t ||| n8# t $ r+ d|d|}t |t$ Y nw xY w| S ɚ; child ɚ; parent_module ɚ; parent_spec ɚ; import_ ɚ; _find_and_load_unlocked ɚ; ModuleNotFoundError ɚ; _ERR_MSG ɚ; for child module ɚ; Cannot set an attribute on ɚ; ; {!r} is not a package ɚ; {!r} ɚ; No module named ɚ; 5@ 5@ M P>@ CD L L L 4@ t | t s/t d t | |dk rt d |dk r5t |t st d |st d | s|dk rt d dS dS ɚ; _sanity_check ɚ; ValueError ɚ; TypeError ɚ; str ɚ; Empty module name ɚ; 6 attempted relative import with no known parent package ɚ; __package__ not set to a string ɚ; level must be >= 0 ɚ; module name must be str, not {} ɚ; Verify arguments are "sane". ɚ; 04@ 3@ 3@ 2@ _D L `L `L 0@ t j }|t d |s t dt | t j v }|D ]}t 5 |j } || || }n0# t $ r# t || | }| Y ddd QY nw xY wddd n # 1 swxY w Y |L|sF| t j v r8t j | } |j } | |c S | c S # t $ r |cY c S w xY w|c S dS ɚ; is_reload ɚ; _find_spec ɚ; meta_path ɚ; sys.meta_path is empty ɚ; 5 sys.meta_path is None, Python is likely shutting down ɚ; Find a module's spec. ɚ; ] P0@ /@ /@ D L L L .@ t | d}t |t | || }|d S t || S ɚ; finder ɚ; _find_spec_legacy ɚ; 5 .find_spec() not found; falling back to find_module() ɚ; ^ .@ 0.@ -@ D L @L @L -@ | d|dz }t | |k rt d |d }| rd || n|S ɚ; base ɚ; bits ɚ; level ɚ; package ɚ; _resolve_name ɚ; rsplit ɚ; {}.{} ɚ; 2 attempted relative import beyond top-level package ɚ; 2 Resolve a relative module name to an absolute one. ɚ; ,@ p,@ L L L ,@ e Zd ZdZd Zd ZdS ɚ; +@ +@ 0+@ pD L L *@ t dS ɚ; exc_traceback ɚ; exc_value ɚ; exc_type ɚ; _ImportLockContext.__exit__ ɚ; < Release the import lock regardless of any raised exceptions. ɚ; *@ p*@ ZD L L *@ t dS ɚ; _ImportLockContext.__enter__ ɚ; Acquire the import lock. ɚ; $ Context manager for the import lock. ɚ; _ImportLockContext ɚ; )@ (@ $ L ?L ?L '@ e Zd ZdZdZed Zed Zedd Z edd Z edd Z ed Z ed Z ed Zeed Zeed Zeed ZdS ɚ; &@ &@ p&@ \D L L L &@ t | S ɚ; FrozenImporter.is_package ɚ; . Return True if the frozen module is a package. ɚ; %@ p&@ \D L L %@ dS ɚ; FrozenImporter.get_source ɚ; 6 Return None as frozen modules do not have source code. ɚ; p%@ 0%@ p&@ \D L FL ` L &@ t | S ɚ; FrozenImporter.get_code ɚ; - Return the code object for the frozen module. ɚ; $@ p$@ $@ lD L @eL L @#@ t | | }t | }|J |\ }}}||_ t | dd |rg |_ | | |S ɚ; FrozenImporter.load_module ɚ; _ Load a frozen module. This method is deprecated. Use exec_module() instead. ɚ; @ D "@ "@ pD L lL "L "@ | j }|j }t t j | }t || j d S ɚ; FrozenImporter.exec_module ɚ; exec ɚ; get_frozen_object ɚ; > !@ !@ @!@ !@ CD L lL `$L @ t | j } | j j }|r||_ n# t $ r Y nw xY w|S ɚ; FrozenImporter.create_module ɚ; Set __file__, if able. ɚ; ? P @ @ @ CD L ML `&L @ t dt t | r| ndS ɚ; FrozenImporter.find_module ɚ; i FrozenImporter.find_module() is deprecated and slated for removal in Python 3.12; use find_spec() instead ɚ; ] Find a frozen module. This method is deprecated. Use find_spec() instead. ɚ; @ 0 @ @ 9D L PL @*L @ t t j | }|d S |\ }}}t || | j | }| ||| \ } } t t j | | |_ | r|j d| |S ɚ; info ɚ; FrozenImporter.find_spec ɚ; find_frozen ɚ; @ p@ @ @ @D L 9L .L @@ |rt t dd sdS | j }n+# t $ r t j dk rdndx}| _ Y nw xY w||k r)| d r|dd }|s| d}nd }| d | }|rt j | | }| | d }nd }t j | | d }||fS ɚ; relfile ɚ; sep ɚ; alias ɚ; FrozenImporter._resolve_filename ɚ; platform ɚ; _SEP ɚ; .py ɚ; __init__.py ɚ; .__init__ ɚ; < ɚ; / ɚ; \ ɚ; win32 ɚ; _stdlib_dir ɚ; @ @ @ : 0@ _D L 8L @ |j }|j }|tt | dd }|s J d t |d }t |j |k s J | | ||j | \ }} t t j || |_ |j }|r.|g k s J | |r|j d| n | J | t |d rJ |j |r ||_ n# t $ r Y nw xY w|r?|j |k r4|j g k sJ |j |j | nu|j }|d u}t' t | ddgk s J | |j rk| |j |j | \ } }|j | k sJ |j | f |r||gk s J ||f nA||rg nd k s J | n,d } |j J |j ||rg nd k s J | | r/t |d sJ |j | k sJ |j | f n t |d rJ |j |r/t |d sJ |j |k sJ |j |f n t |d rJ |j |j rJ d S ɚ; pkgdir ɚ; ispkg ɚ; state ɚ; FrozenImporter._fix_up_module ɚ; sorted ɚ; insert ɚ; implementation ɚ; _resolve_filename ɚ; is_frozen_package ɚ; vars ɚ; origname ɚ; ' see PyImport_ImportFrozenModuleObject() ɚ; __origname__ ɚ; F @ @ / P@ L L =L @ t dt d | j t j S ɚ; m ɚ; FrozenImporter.module_repr ɚ; P FrozenImporter.module_repr() is deprecated and slated for removal in Python 3.12 ɚ; frozen ɚ; Meta path import for frozen modules. All methods are either class or static methods to avoid the need to instantiate the class. ɚ; FrozenImporter ɚ; 0@ p@ L VL VL @ e Zd ZdZdZed Zed d Zed d Z ed Z ed Z ee d Z ee d Zee d Z ee ZdS ɚ; classmethod ɚ; staticmethod ɚ; @ p&@ \D L L BL @ dS ɚ; BuiltinImporter.is_package ɚ; 4 Return False as built-in modules are never packages. ɚ; P@ p&@ \D L DL %@ dS ɚ; BuiltinImporter.get_source ɚ; 8 Return None as built-in modules do not have source code. ɚ; @ p&@ \D L FL EL %@ dS ɚ; BuiltinImporter.get_code ɚ; get_code ɚ; 9 Return None as built-in modules do not have code objects. ɚ; @ @ HC L lL GL @ @ t t j | dS ɚ; BuiltinImporter.exec_module ɚ; exec_builtin ɚ; Exec a built-in module ɚ; \ @ @ P @ L lL `JL @ | j t j vr.t d | j | j t t j | S ɚ; BuiltinImporter.create_module ɚ; create_builtin ɚ; Create a built-in module ɚ; B @ @ p@ pD L ML LL @ t dt | || }||j ndS ɚ; BuiltinImporter.find_module ɚ; find_module ɚ; j BuiltinImporter.find_module() is deprecated and slated for removal in Python 3.12; use find_spec() instead ɚ; Find the built-in module. If 'path' is ever specified then the search is considered a failure. This method is deprecated. Use find_spec() instead. ɚ; 4 0@ @ P @ pD L PL `PL @ t | rt || | j S d S ɚ; target ɚ; cls ɚ; BuiltinImporter.find_spec ɚ; find_spec ɚ; is_builtin ɚ; 9 @ 0 @ HC L L RL @ t dt d| j dt j dS ɚ; BuiltinImporter.module_repr ɚ; )> ɚ; ( ɚ; <module ɚ; Q BuiltinImporter.module_repr() is deprecated and slated for removal in Python 3.12 ɚ; s Return repr for the module. The method is deprecated. The import machinery does the job itself. ɚ; built-in ɚ; Meta path import for built-in modules. All methods are either class or static methods to avoid the need to instantiate the class. ɚ; BuiltinImporter ɚ; > p@ 0@ @ P @ L L L @ t | j 5 t | cddd S # 1 swxY w Y dS ɚ; Return a new module object, loaded by the spec's loader. The module is not added to its parent. If a module is already in sys.modules, that existing module gets clobbered. ɚ; b @ @ `@ 0@ CD L \L \L @ | j [t | j d sFt | j d}t |t t | S t | }d| _ |t j | j < | j | j t d| j n| j | n*# t j | j = n# t $ r Y nw xY w xY wt j | j }|t j | j < t# d| j | j d| _ n # d| _ w xY w|S ɚ; _load_unlocked ɚ; import {!r} # {!r} ɚ; j 0@ @ @ v @ \D L ``L ``L @ | j | j nQ# | j t j v r8t j | j }|t j | j < xY wt j | j }|t j | j < t |dd | j |_ n# t $ r Y nw xY wt |dd S |j |_ t |d s%| j d d |_ n# t $ r Y nw xY wt |dd | |_ n# t $ r Y nw xY w|S ɚ; _load_backward_compatible ɚ; ? ? `? X ? pD L @L @L ? | j }t | 5 t j | |ur&d | }t || | j 0| j t d| j t | |d nt | |d t | j d sRt | j d}t |t | j | n| j | t j | j }|t j | j < n=# t j | j }|t j | j < w xY w ddd n # 1 swxY w Y |S ɚ; pop ɚ; load_module ɚ; ImportWarning ɚ; 7 .exec_module() not found; falling back to load_module() ɚ; missing loader ɚ; module {!r} not in sys.modules ɚ; F Execute the spec's specified module in an existing module's namespace. ɚ; ? P? G ? \D L L L @? | j dn| j }| j 7| j d | S d || j S | j rd || j S d | j | j S ɚ; <module {!r} ({})> ɚ; & Return the repr to use for the module. ɚ; ? ? 6 @ \D L kL kL ? d}t | j d r| j | }n$t | j d rt d |t | j }t | | |S ɚ; module_from_spec ɚ; B loaders that define exec_module() must also define create_module() ɚ; exec_module ɚ; create_module ɚ; + Create a module based on the provided spec. ɚ; p? ? ? ? D L qL qL ? |st |dd | j |_ n# t $ r Y nw xY w|st |dd r| j }|P| j It t t j }| | }| j |_ || _ d |_ ||_ n# t $ r Y nw xY w|st |dd | j |_ n# t $ r Y nw xY w | |_ n# t $ r Y nw xY w|st |dd %| j | j |_ n# t $ r Y nw xY w| j ri|st |dd | j |_ n# t $ r Y nw xY w|st |dd %| j | j |_ n# t $ r Y nw xY w|S ɚ; _init_module_attrs ɚ; _path ɚ; NamespaceLoader ɚ; override ɚ; ? ? `? ? @D L uL uL ? | j }||S n# t $ r Y nw xY w| j }| | j }n# t $ r Y nw xY w | j }n# t $ r d }Y nw xY w||t |dd }|s||} | j }n# t $ r d }Y nw xY w t | j }n# t $ r d }Y nw xY wt ||| }|dn||k |_ ||_ ||_ |S ɚ; location ɚ; _spec_from_module ɚ; list ɚ; __cached__ ɚ; ? 0? ? ? @tD L L L @? |t |dd }|sMt |d r=t t t j }| || | S |rg nd} || || S |;t |d r) | | }n# t $ r d}Y nw xY wd}t | ||| S ɚ; search ɚ; spec_from_file_location ɚ; get_filename ɚ; _ORIGIN ɚ; 5 Return a module spec based on various loader methods. ɚ; X ? ? @ L L L ? e Zd ZdZdddddZd Zd Zed Zej d Zed Z ed Z e j d Z dS ɚ; setter ɚ; property ɚ; D p? YD \D L L ~L ? t | | _ d S ɚ; value ɚ; bool ɚ; D ? ZD L L ~L ? | j S ɚ; ModuleSpec.has_location ɚ; / P? ? ZD L L ? | j | j d d S | j S ɚ; ModuleSpec.parent ɚ; rpartition ɚ; The name of the module's parent. ɚ; D p? 0? \D L L `L ? || _ d S ɚ; O D ? ZD L L `L ? | j @| j 9| j r2t t t | j | _ | j S ɚ; ModuleSpec.cached ɚ; _get_cached ɚ; NotImplementedError ɚ; _bootstrap_external ɚ; { D ? @? | ? CD L L ? | j } | j |j k oJ| j |j k o:| j |j k o*||j k o | j |j k o| j |j k S # t $ r t cY S w xY w ɚ; smsl ɚ; other ɚ; ModuleSpec.__eq__ ɚ; NotImplemented ɚ; has_location ɚ; cached ɚ; ? P? r P\D \D L L `? d | j d | j g}| j -| d | j | j -| d | j d | j j d | S ɚ; ModuleSpec.__repr__ ɚ; {}({}) ɚ; submodule_search_locations={} ɚ; origin={!r} ɚ; loader={!r} ɚ; name={!r} ɚ; ? _B ? e ? @tD L L ? || _ || _ || _ || _ |rg nd | _ g | _ d| _ d | _ d S ɚ; ModuleSpec.__init__ ɚ; _cached ɚ; _set_fileattr ɚ; submodule_search_locations ɚ; is_package ɚ; loader_state ɚ; origin ɚ; The specification for a module, used for loading. A module's spec is the source for information about the module. For data associated with the module, including source, use the spec's loader. `name` is the absolute name of the module. `loader` is the loader to use when loading the module. `parent` is the name of the package the module is in. The parent is derived from the name. `is_package` determines if the module is considered a package or not. On modules this is reflected by the `__path__` attribute. `origin` is the specific location used by the loader from which to load the module, if that information is available. When filename is set, origin will match. `has_location` indicates that a spec's "origin" reflects a location. When this is True, `__file__` attribute of the module is set. `cached` is the location of the cached bytecode file, if any. It corresponds to the `__cached__` attribute. `submodule_search_locations` is the sequence of path entries to search when importing submodules. If set, is_package should be True--and False otherwise. Packages are simply modules that (may) have submodules. If a spec has a non-None value in `submodule_search_locations`, the import system will consider modules loaded from the spec as packages. Only finders (see importlib.abc.MetaPathFinder and importlib.abc.PathEntryFinder) should modify ModuleSpec instances. ɚ; ModuleSpec ɚ; ? ? ? & P? D L L L ? t | dd }t | dd x}rt | S t |d r& | | S # t $ r Y nw xY w | j }n# t $ r d}Y nw xY w | j }d || S # t $ r2 |d | cY S d || cY S w xY w ɚ; loader ɚ; _module_repr ɚ; Exception ɚ; _module_repr_from_spec ɚ; <module {!r} ({!r})> ɚ; <module {!r}> ɚ; <module {!r} from {!r}> ɚ; ? ɚ; module_repr ɚ; , The implementation of ModuleType.__repr__(). ɚ; ? 0? ? D L L L ? d}t |t t || }|t j v r4t j | }t || t j | S t | S ɚ; module ɚ; spec ɚ; _load_module_shim ɚ; _load ɚ; _exec ɚ; spec_from_loader ɚ; DeprecationWarning ɚ; warn ɚ; _warnings ɚ; g the load_module() method is deprecated and slated for removal in Python 3.12; use exec_module() instead ɚ; Load the specified module into sys.modules and return it. This method is deprecated. Use loader.exec_module() instead. ɚ; ? ? p? 6D L L L ? fd}t | |S ɚ; _requires_frozen ɚ; L ? p? 0? @:C L `L L ? t | s$t d | | | | S ɚ; 2 _requires_frozen.<locals>._requires_frozen_wrapper ɚ; _requires_frozen_wrapper ɚ; is_frozen ɚ; {!r} is not a frozen module ɚ; / Decorator to verify the named module is frozen. ɚ; p? ? 0? 6D L L L ? fd}t | |S ɚ; _requires_builtin ɚ; @ ? 0? 0? @:C L `L L ? |t j vr$t d | | | | S ɚ; fxn ɚ; fullname ɚ; 4 _requires_builtin.<locals>._requires_builtin_wrapper ɚ; _requires_builtin_wrapper ɚ; ImportError ɚ; builtin_module_names ɚ; {!r} is not a built-in module ɚ; 1 Decorator to verify the named module is built-in. ɚ; W P? ? ? CD L L L ? t j j |k r?| d sd| z } t | j | t j dS dS ɚ; message ɚ; _verbose_message ɚ; print ɚ; startswith ɚ; verbose ɚ; flags ɚ; file ɚ; # ɚ; import ɚ; # ɚ; = Print the message to stderr if -v/PYTHONVERBOSE is turned on. ɚ; verbosity ɚ; ? p? CD L L L ? | |i |S ɚ; kwds ɚ; f ɚ; _call_with_frames_removed ɚ; . remove_importlib_frames in import.c will always remove sequences of importlib frames that end with a call to this function Use it instead of a normal call in places where including the importlib frames introduces unwanted noise into the traceback (e.g. when executing module code) ɚ; L ? ? @? ? \D L ? t | } | | dS # t $ r Y dS w xY w ɚ; Acquires then releases the module lock for a given module name. This is used to ensure a module is completely initialized, in the event it is being imported by another thread. ɚ; P? ? `? 0? CD L @L @L ? t t | }n# t $ r d}Y nw xY w|Nt t | }nt | }| fd}t || t | < t n # t w xY w|S ɚ; _weakref ɚ; KeyError ɚ; x D ? `? 0? \D L L L ? t t | | u rt |= t d S # t w xY w ɚ; ref ɚ; _get_module_lock.<locals>.cb ɚ; cb ɚ; release_lock ɚ; _module_locks ɚ; acquire_lock ɚ; _imp ɚ; Get or create the module lock for a given module name. Acquire/release internally the global import lock to protect _module_locks. ɚ; 0? ]D L `L `L ? e Zd Zd Zd Zd ZdS ɚ; D p? 0? CD L @L ? | j d S ɚ; kwargs ɚ; args ɚ; _ModuleLockManager.__exit__ ɚ; 5 D ? ZD L L ? t | j | _ | j d S ɚ; _ModuleLockManager.__enter__ ɚ; _get_module_lock ɚ; D ? pC \D L L ? || _ d | _ d S ɚ; _ModuleLockManager.__init__ ɚ; _lock ɚ; _name ɚ; _ModuleLockManager ɚ; P? ? L @L @L @? e Zd ZdZd Zd Zd Zd ZdS ɚ; ) ? ? ZD L L `? d | j t | S ɚ; _DummyModuleLock.__repr__ ɚ; _DummyModuleLock({!r}) at {} ɚ; - ? ? ZD L L L `? | j dk rt d | xj dz c_ d S ɚ; _DummyModuleLock.release ɚ; 0? ? ZD L L L ? | xj dz c_ dS ɚ; _DummyModuleLock.acquire ɚ; \D p? pC \D L @L ? || _ d| _ d S ɚ; _DummyModuleLock.__init__ ɚ; V A simple _ModuleLock equivalent for Python builds without multi-threading support. ɚ; _DummyModuleLock ɚ; ? 0? A L L L ? e Zd ZdZd Zd Zd Zd Zd ZdS ɚ; ) P? ? ZD L L ? d | j t | S ɚ; _ModuleLock.__repr__ ɚ; id ɚ; format ɚ; _ModuleLock({!r}) at {} ɚ; ? ? ? } ? \D L L @L `? t }| j 5 | j |k rt d | j dk sJ | xj dz c_ | j dk r7d | _ | j r)| xj dz c_ | j d d d d S # 1 swxY w Y d S ɚ; _ModuleLock.release ɚ; RuntimeError ɚ; cannot release un-acquired lock ɚ; ? p? ? d ? \D L L @L `? t }| t |< | j 5 | j dk s | j |k r-|| _ | xj dz c_ ddd t |= dS | rt d| z | j d r| xj dz c_ ddd n # 1 swxY w Y | j | j # t |= w xY w ɚ; _ModuleLock.acquire ɚ; release ɚ; acquire ɚ; deadlock detected by %r ɚ; Acquire the module lock. If a potential deadlock is detected, a _DeadlockError is raised. Otherwise, the lock is always acquired and True is returned. ɚ; y +D ? O ? D L `L L ? t }| j }t } t | }|dS |j }||k rdS ||v rdS | | I ɚ; seen ɚ; tid ɚ; me ɚ; _ModuleLock.has_deadlock ɚ; has_deadlock ɚ; _blocking_on ɚ; set ɚ; get_ident ɚ; [ \D ? G pC \D L L ? t | _ t | _ || _ d | _ d| _ d| _ d S ɚ; self ɚ; _ModuleLock.__init__ ɚ; waiters ɚ; count ɚ; owner ɚ; wakeup ɚ; lock ɚ; allocate_lock ɚ; _thread ɚ; A recursive lock implementation which is able to detect deadlocks (e.g. thread 1 trying to take locks A then B, and thread 2 trying to take locks B then A). ɚ; _ModuleLock ɚ; о? #A = L @L @L "A e Zd ZdS ɚ; _DeadlockError ɚ; D ? 0 P%D L L L @? t t | S ɚ; _new_module ɚ; sys ɚ; V ? p@ ( 0@ CD L L L ? dD ]1}t || r t | |t || 2| j |j dS ɚ; old ɚ; new ɚ; _wrap ɚ; update ɚ; setattr ɚ; hasattr ɚ; / Simple substitute for functools.update_wrapper. ɚ; - D P? ? p2B L L L ? | j S # t $ r t | j cY S w xY w ɚ; _object_name ɚ; <frozen importlib._bootstrap> ɚ; type ɚ; AttributeError ɚ; S Core implementation of import. This module is NOT meant to be directly imported! It has been designed such that it can be bootstrapped into Python as the implementation of import. As such it requires the injection of specific modules and attributes in order to work. One should use importlib as the public-facing version of this module. ɚ; D PD D D d Z ed dS ɚ; D PD D D d Z d Zedk r e dS dS ɚ; D `D D d S ɚ; D D D d S ɚ; PD PD D D d Z d Zedk r e dS dS ɚ; A ЅD pD D D d Z G d d Z G d d Z G d d Zd Zedk r e d S d S ɚ; ɚ; ЁD D @D `~D d Z ddlZddlZddlZddlZddlZddgZ ee Z G d de Z G d de Z dd Z dd Zefd Z G d d e ZddZ ddZefdZd Zd dZedk rH eej dk r edej dS ej d= eej d dS dS ɚ; R pTD SD D @RD d Z ddlmZ ddlmZ ddlmZ ddlmZmZmZm Z m Z ddlm Z ddlm Z ddlm Z dd lmZ dd lmZ dd lmZ dd lmZ d ZdS ɚ; MD PLD E JD d Z ddlmZ ddlmZ ddlmZ ddlmZ ddlmZ ddlm Z ddlm Z dd lm Z dd lm Z dd lm Z dd lmZ d dlmZ d dlZd dlZd dlZd dlZd dlZd dlZd Zd Zd dZd dZed Zd Z d Z d Z G d dej Z G d de Z!dS ɚ; D D D CE D d Z dZdZdZdZdZdZdZdZd Z d Z d Z d Z d Z dZdZdZdZdZdZdZdZdZd Zd Zd Zd Zd Zd Z d Z d Z d Z d Z d Z!d Z"e"Z#d Z$d!Z%d"Z&d#Z'd$Z(d!Z)d"Z*d#Z+d%Z,d&Z-d'Z.d Z/dZ0dZ1dZ2dZ3dZ4dZ5dZ6d Z7d'Z8d&Z9dZ:d(Z;d)Z<d*Z=d+Z>d,Z?ed-fed.fed/fed0fe d1fed2fed3ffe)d4ffe*d5ffe+e!z d.fe!d6fe+d7ffe-d4ffe.d5ffe/e"z d.fe"d6fe/d7ffe1d4ffe2d5ffe3e$z d8fe$d9fe3d7fff Z@d: ZAd&ZBd ZCd#ZDd'ZEd ZFdZGdZHd"ZIdZJd)ZKdZLdZMd ZNd ZOdZPd!ZQd(ZR dd;lST d<S # eT$ r Y d<S w xY w ɚ; D D E D d Z ddlZddlZddlZddlZddlZddlZej ej ga da da da d Z d Zd Zd Zd Zd Zd d Zd Zd Zd Zd Zd Zd Zd dZd dZd Z d Z d Z d Z d Z d Z!d Z"d Z#ej$ j% s e# d Z&e'dk r e& dS dS ɚ; C C C F C d Z ddlZddlZddlZddlmZ eee Z ej Z g dZ d Zd Zde v rkdZdZdd lT dd lmZ e d n # e$ r Y nw xY wddlZ dd lmZ n # e$ r Y nw xY wddlZe ee [nyd e v rjd ZdZdd lT dd lmZ e d n # e$ r Y nw xY wddlZddlZe ee [ dd lmZ n# e$ r Y nw xY w ed eej d< ddl m Z m Z m Z m!Z!m"Z"m#Z#m$Z$m%Z% [ ed rW e& Z'd Z( e) Z* e(dd e(dd e(dd e(dd e(d d e(d d e(d d! e(d"d# e(d$d% e(d&d' e(d(d) e(d*d+ e(d,d- e(d.d/ e(d.d0 e(d1d e*Z+ e) Z* e(dd e*Z, e) Z* e(d2d3 e(d4d e(d5d e(d6d7 e(d6d8 e(d9d: e*- e e(d;d< e(d=d e(d>d e(d?d@ edA r edB r e(dCdA e*Z. e) Z* e(dd e(dd e(dd e(dDdE e(dFd edG r e(dHd e(d d e(dId e(dJd e(dd e(d1d e(dKd e*Z/[*[['[(dZ0dLZ1dMZ2ddPZ3dQ Z4dR Z5e g dS ddUZ6dV Z7e dW e8ehe+k r(e9ehe.k r ddOddYdZZ:d[ Z;e d\ d] Z<d^ Z=d_ Z>d` Z?da Z@db ZAe g dc dddZBddeZCddflmDZDmEZE G dg dheD ZFdi ZG eG ZH[GddjZIed k ZJe dk eJr1dl ZK eFeHjL eKeMeKeM ZN[KddmZOe dn do ZP eP \ ZQZR[P edp rY edq sN edr rCdZSdLxZTZUe g ds dt ZVdu ZWdv ZXdw ZYdx ZZe g dy edq r dz Z[d{ Z\e d|d}g ed~ r d Z]d Z^e ddg ej_ dk r&ddZ` G d d Zae d ddZbd Zc ed s ecZdded_e G d dejf Zged k r G d d Zhd ZidS dS ɚ; EC 0DC CC F `AC d Z dZdZdZdZdZdZdZdZddl Z ddl Z ddl Z ddl Z dd l T g d Z d Zd Zd Zd Zd Zd Ze j j e_ d Zd Zd Zd Zd Zd Zd Zda da d Z ddl m Z d Z!n# e"$ r d Z!Y nw xY wd Z#d d d Z$d Z%e j& d!k Z'd$d"Z(d# Z)dS ɚ; - P C PC C ^G `C d Z dZdZdZdZdZdZdZdZdd l Z dd l Z dd l Z dd l Z dd l T g d Z d Z dd lmZmZmZ d Zn# e$ r d ZY nw xY wd Zd Zd Zd Zd Z e j j e _ d Z d Z d Z d Z! ddl"m#Z# n # e$ r d Z#Y nw xY wd Z$d Z%d Z& dd l"m'Z' d Z(n# e$ r d Z(Y nw xY wd Z) dd!l"m*Z* d" Z+n # e$ r e)Z+Y nw xY w dd#l"m,Z,m-Z. d$ Z/d% Z0d&d'd(Z1n # e$ r e+Z1Y nw xY w e2e d) o e j3 d* d+k Z4d/d,Z5d- Z6 dd.l"m7Z8 d S # e$ r Y d S w xY w ɚ; 8 B лB `G B d Z ddlZddlZg dZd Zd Zd Zd Zd Zd Z d Z d Z d Z d Z d Zd Zd ZdS ɚ; 3 PB B G B d Z ddlZ G d de Z G d de Z G d de ZdS ɚ; pB B H @B d Z ddlmZmZ ddlZ eee Z ed Z d Z ee Z [ g dZ dZ e ed Z e e e Z e ei Z e ei Z e ei Z e eg Z e e eg Z e e ed Z e e ed d z Z e e e Z e ed Z e ed Z! e e e" Z# ei Z$ ei Z% ei Z& eej' Z( e d Z)d Z* e* Z* ee* Z+e*, [*d Z- e- Z- ee- Z.[-d Z/ G d de Z0 G d de Z1 G d de1 Z2e23 e+ G d de Z4 G d de4 Z5 G d d e5 Z6e63 e. G d d e Z7 G d d!e7 Z8e83 e e83 e e83 e e83 e e83 e e83 e e83 e e83 e e83 e e83 e e83 e e83 e! e83 e# G d" d#e7 Z9 G d$ d%e8 Z:e:3 e) G d& d'e Z; G d( d)e Z< G d* d+e;e7e< Z= G d, d-e Z>d. Z?d/ Z@ G d0 d1e ZA G d2 d3e= ZBeB3 eC G d4 d5eB ZDeD3 e G d6 d7e= ZEeE3 e( G d8 d9e; ZF G d: d;eFeB ZGeG3 e$ G d< d=eFeB ZHeH3 e& G d> d?eFe= ZIeI3 e% G d@ dAeE ZJeJ3 eK G dB dCe9e= ZLeL3 eM eL3 eN eL3 e eL3 eO G dD dEeL ZPeP3 eQ eP3 e G dF dGeL ZReR3 e eR3 e dS ɚ; PA A A H A d Z dZg dZddlZddlZddlmZmZmZmZm Z m Z m Z m Z m Z mZmZmZmZmZmZ d Zde_ dZdZd Z G d d ej ej Z G d dej e Z G d dej e Z G d dej e Z!e " e e e eeefD ]Z#e " e# e efD ]Z#e!" e# [# ddlm$Z$ e " e$ dS # e%$ r Y dS w xY wɚ; A A A @I A d Z ddlZddlZ ddlT n# e$ rZ edez dZ[ww xY wg dZdZdxZ Z dxZ Z d Z d Zej d k re xZZe Zne xZZeZe Ze Ze ZeZ G d d e Z G d d Z G d de Z G d de Z G d de Z G d de Z G d de Z G d de Z G d d Z! G d d Z"d7d#Z#d8d$Z$d% Z%d& Z&d' Z'd( Z(d) Z)d* Z*d9d+Z+d9d,Z,d- Z-d. Z. e/d! Z0 e/d/ Z1 e/d0 Z2 e/d1 Z3 e/d2 Z4 e/d3 Z5n# e6$ r dZ0dZ1dZ2dZ3dZ4dZ5Y nw xY wdZ7e7rddl8Z8e9d4k r0 e$ej: d5d6 e_: e$ej; d6d5 e_; dS dS ɚ; A A A I A d Z d Z G d de Z G d de Z G d de Z dd lm Z m Z m Z m Z m Z mZmZmZ G d d e Zn# e$ r dd lmZm Z d e_ Y nw xY wd Z G d de ZdS ɚ; nA PmA `ZJ jA d Z ddlZddlmZmZ ddlZddlZddlZddl Z ddl Z ddl Z ddl Z ddgZ ej Zej dd Z G d de Zi Z ee ZdZd Zd Z G d dej Zed z d d fedz dd fddfZd Z d Z d Z d Z dZ da!d Z"d Z#d Z$d Z% ee%j& Z'd Z(d Z)d Z*d Z+d Z,d Z-dS ɚ; ) A A @K A d Z daddlZddlZddlZddlZddlZej dk Zer ddl Z ddl Z nddl Z erddgZ ndgZ ed e D sJ e d Z ee Zd e Z d e D Zd Zd Zeez Zd Z e Zd Zd Zd Zerd Z nd Z d Z d Z d Z d Z d Z!erd Z"nd Z"dOdZ# e$e#j% Z&d' dd d z Z(e)* e(d Z+d Z,d Z-d gZ.ere./ d! ej0 Z1d"gZ2e2xZ3Z4dPdd#d$Z5d% Z6d& Z7d' Z8d( Z9d) Z:d* Z;d+ Z<d, Z=d- Z>dQd.Z?dRd/Z@dSd1ZAd2 ZB eC ZDdPdeDd3d4ZE G d5 d6 ZF G d7 d8 ZG G d9 d:eG ZH G d; d< ZI G d= d>eIeH ZJ G d? d@eIeG ZK G dA dBeIeG ZL G dC dD ZM G dE dF ZNeNZO G dG dH ZP G dI dJ ZQdPdKZRdL ZSdM ZTdN ZUdS ɚ; V@ 0T@ L O@ d Z d ZdZdZdZdad Zd Zi Zi Z G d de Z G d d Z G d d Z G d d Zd Zd Zd ZdddZd Zd Zd Zd Z G d d ZddddZd>dZd d d Zd Zd Z d! Z d" Z d# Z d$ Z G d% d& Z! G d' d( Z" G d) d* Z#d+ Z$d, Z%d?d-Z&d. Z'd/Z(e(d0z Z)d1 Z* e+ Z,d2 Z-d@d4Z.d d5d6Z/d7 Z0dAd9Z1d: Z2d; Z3d< Z4d= Z5dS 8 x/ 4 h* 2 G G 3 7 @ = H @= A g* : B + 8 y/ 4 @( 2 : G ( 3 6 @ @= H = A ( : B + 8 `{/ 4 + 2 + G x 3 + @ = A + : B + {, ͝, N+ |, N+ , , 4 p' B `P+ 2 0' : E 8 @/ G p( 3 ' @ 2M H = I @2M A ' J 4 P( 2 @( : G *) 3 ( C ( H = {, 4 ( B > @ @= / A P' H = G p' , / , + / g, ( @/ H, ;( / , + / , s( @/ , ( / , p! / , / , + / ˟, + `/ , , c, ! / ?, ( / O, p! `/ c, `( / Ò, ! / ˤ, K* @/ o, / , + p/ ˟, 0+ @/ , , ̥, `( @/ ͝, Pj+ / |, k+ / , , 5, @g" @ @/ p" g" = ~+ O, ( Щ* @ / X+ * b" = }+ ^, t" @ d+ s" `= u+ q, @ d+ D / d+ q" = ]+ , @) 0}+ D / 0* `8" @> ) , 0 P' D / p+ n! = ' , @ ' D `/ S+ ' > ' , x+ D / y+ w+ pw+ Ц, 8 * D @/ P* `" > * , ( ( q+ D / ' ) > ' , ( D / + ( > ( , e+ D / + t" > e+ , ( D @/ P* ! `8M ( /, i* D / + Pi* = h* A, 8 * D `/ o+ _" = p* R, ( 0c+ D / z Pb+ = a+ f, ( d+ D `/ 7 pc+ = b+ z, 0 P`+ D / _+ `= _+ x. 8 l* D @/ p+ n+ > `+ , 8 pl* D / Po+ \" = `k* , 0 g+ D / f+ > e+ `}, .& D 0 0% /& `N > > > % r, ( 1& / @ > > p & ¨, 0 zt D @0 0 Q6 ( > > k ը, 0w% % D @0 % 6 > > > % , 0w% % D 0 % 6 S) > @ > > 0:* , 0w% % D 0 % 6 S) > > `> pd% ?, @ #" D 0 + 26 0 V= "> "> ( ` " 0 " l, 0 d% D 0 @% 6 @'> )> )> ( _% ^% {, , P) , ) D 50 5 `& p) *> hM @ , ) a0 , @ a0 , @a0 , q a0 %, q a0 O, 62 `0 *, + ``0 1, `0 , 2 _0 , ] @_0 H, }) _0 <, ` ) ^0 ͝, b0 h, ) ^0 D, Jh @^0 Q, / ^0 , ]0 ڥ, 2 `]0 , , Y, ( @c0 %, 2 c0 , 2 c0 ͝, + b0 , , @. 8 + @ 50 , 2> ? , 8 + @ 50 0+ 2> Ý , 8 @( ; 2> D d0 ( b lM 2> ( Ѫ, ( 1> D b0 ' P ( + @jM `1> p' ' , ( @0 , \ 0 , `0 ȝ, * 0 , 0 0 , / @0 , , 4 `( P ( > ? ж( @ @G> , +, , [, m, , u, , sA, , ?, , ?, , q, Y, Y, , ǝ, Q, , y, ', U, /, 4, 8, o, /S, #0, >, |, ( j @ T1 P"& @* > > > B , x "% > , ( * @> > @ * e5 "i @> n , > @ + 5 , > @ + 5 , > @ + 5 , Q @ * , ݨ @ O* , 0* @ * , й* 1 br, * 1 %, Oq 1 , , , , 1, ?, 0 0* p @ ) P* M > n R, @ q p* @ I) (5 M > 8 j, 0 gA > > @ @* A >i > q P, 0 D 1 `* p! @> , 0 D @1 P*) > ` , P( D `1 Ѐ+ ! > ˺ М( A 4 5 : > ? {, 4 p! : E G 3 + H > @ > I M < / A J , , , @ ^) > > > g s ]) + @ 3 @p* ? , @ ^) > > > s ]) + @ 3 @p* ? @> , @ 8 L 3 @p* " M > $ @$ $, ` & 0( > > ӕ p( @ (. ( > @> l 0 R, 8 + P d, 0 p+ `P v, % @ ~+ ( > , % @ ~+ > > 4, P p > M > * @ 3 % > , ( ` D 3 % > R " V, ( p& c$ > ` $ L `3 4 & p > @> > Pg# W# , n, 8 ' 3 > > @ , p+ P3 , ( 3 O, + `3 , , , p @ % > i, > > p D@ 3 ) 0? M % % }, ( > L, ( `} E @ @3 ' kW > `> N) , 3 , ' 3 , $& H 3 %, + 3 , P!) 3 , c* 3 2, 0' 3 , PK* 3 , + 3 , + 3 , & 3 , ( 3 H, 1' 3 ͝, p+ 3 h, %) 3 ڥ, 5 3 , e* 3 (, @e* @3 D, J* 3 t , X+ 3 , , , $& H 3 %, ? 3 , c* 3 , PK* 3 , + 3 , & 3 , ( 3 ͝, p+ 3 ڥ, 5 3 , e* 3 D, J* 3 , , J, . [, 0 $ @ Y+ U `> br, V ( > > D@ @3 & @$ @M * * , V ( @> > D@ @3 & @$ M + | h, 0 % c* > l, 0 `> Q, 0 ` @> > > T 3 + @ > > . , : `> > , m ! > 9 , # + D 3 # + > > !$ @N# , h 0+, 8 8& @) ! D `3 @:& ( > > > 0$ $ , @ , 8 0 P\+ & { H 0, p/' ( > `> `> `, 0 0+ @ + , * > P> `+ @> @ 3 @% \* + > > w% p, p % @ % ^9 {, , * @> , * > , ( > , p `( + > > D 3 * + 0j* h a* > `M ` ( , @ ( @ + `( > , H 3 m, 0L H p3 ڥ, Ч+ @3 , ` 3 U, 0(' 3 H, $ 3 ~, p* `3 , p% 3 , 1 3 , % 3 t , # 3 n\, @' 3 , ( 3 %, ( 3 D, t @3 , , y , 4 + > @ p& % > `> , 8 @ f' . > , 4 + `M > @ p& q 3 > `> , 4 + `M @> @ p& q % > `> , 8 @ f' 0 > , 8 @ f' P5 > , 8 @ f' xX > 2, 8 @ f' xX > K, 8 @ f' xX > @4, 0 Е ! `> M @> @D@ 3 `- `$ Х( M $' +' !, P ? @ 4 Ё @> `> p m, 4 H E, D, 0% 4 ڥ, 5 @4 , p( 4 %, ) 4 , P `4 , p% 4 *, `b 4 H, 4 h, @% 4 , P*( 4 O, Q) 4 Q, ' `4 [ , J 4 , , d, ( ` ? `? D@ 4 ( p& @V `M 0) X `, p% @ n* /& `? u, `_ @ % X ? , w" @M @ + : ? , p! @ ( ! ? r, % @ ' ! ? , 9 q `? . _ 4 . =, % L) .d, ( ( h, p( -, # & {, f, # p# h, # # , @% {, , P% {, , & 8h D 4 4 ' ? M 0 # , >& D `4 ' ? M ~ `# 4, = x ' H 4 G ` ? M 0 X X, x `t @ $& " ? ` ? ? , ! ? ' @ '4 @ ? ? * !! , ? `? , ~ )4 , * `)4 , )4 ڥ, !6 (4 , , p%( ~, ? @ `' w @? ? ? , g7 @ `+ , ( 7 N @ R. @? , )8 @ . - `? , ( -7 N @ 1 ? , N @ ) N ? ? /, @? @ `' ? ? ? @, 8 @ P+ + D_ @? W, @ % 8 ( ? `? ( L +4 ( ( ( ? ? ? {, D, ( j, % i x, P* , , pP* , , , K, { , G R, , H > 3 q' D @ `. $& < ? ? N = ; ͝, 8a .4 , , , 8 #' D `,4 .' L N & , ( D .4 p' ( ? , 0% , 0' . , -' . , ( . , P% @. %, u . , , D, f . , 8 f! @ @3 ? ? ? , 0 @ @3 ? ? # , 0 @ @3 ? ? ? a , 8 @ @3 ? `? , 8 0 H @3 ? ? `? n , @ # D @04 p ' ? ? ? v $ `# *, % ? ? ? Pv @@ `& R @K* N I' 7, P + C4 @ ' k ? `? `? , P) ? ) 44 0 * ? ? 0 * Z, 1 D p= 64 ]% ? ? ? # k, @ 4 V y, P 0* * , 0 ( + P! H 84 , G ? ? @? \ , 0+ Ah @ 84 0+ ? `? ^L, @ 84 p ' ? , 0 % 94 , @% @ ) ? g, ! ' ? `? 0? 0 @) ? @ @T4 ^ % ? ! Z `) P) 08" _( , % @ ) e) ? Sq, 8 P ' ? ;N P? p) @? @ u4 pl) P% `? , p( ? `4 Y ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ! ɚ; " ɚ; # ɚ; $ ɚ; % ɚ; & ɚ; ' ɚ; ( ɚ; ) ɚ; * ɚ; + ɚ; , ɚ; - ɚ; . ɚ; / ɚ; 0 ɚ; 1 ɚ; 2 ɚ; 3 ɚ; 4 ɚ; 5 ɚ; 6 ɚ; 7 ɚ; 8 ɚ; 9 ɚ; : ɚ; ; ɚ; < ɚ; = ɚ; > ɚ; ? ɚ; @ ɚ; A ɚ; B ɚ; C ɚ; D ɚ; E ɚ; F ɚ; G ɚ; H ɚ; I ɚ; J ɚ; K ɚ; L ɚ; M ɚ; N ɚ; O ɚ; P ɚ; Q ɚ; R ɚ; S ɚ; T ɚ; U ɚ; V ɚ; W ɚ; X ɚ; Y ɚ; Z ɚ; [ ɚ; \ ɚ; ] ɚ; ^ ɚ; _ ɚ; ` ɚ; a ɚ; b ɚ; c ɚ; d ɚ; e ɚ; f ɚ; g ɚ; h ɚ; i ɚ; j ɚ; k ɚ; l ɚ; m ɚ; n ɚ; o ɚ; p ɚ; q ɚ; r ɚ; s ɚ; t ɚ; u ɚ; v ɚ; w ɚ; x ɚ; y ɚ; z ɚ; { ɚ; | ɚ; } ɚ; ~ ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ! ɚ; " ɚ; # ɚ; $ ɚ; % ɚ; & ɚ; ' ɚ; ( ɚ; ) ɚ; * ɚ; + ɚ; , ɚ; - ɚ; . ɚ; / ɚ; 0 ɚ; 1 ɚ; 2 ɚ; 3 ɚ; 4 ɚ; 5 ɚ; 6 ɚ; 7 ɚ; 8 ɚ; 9 ɚ; : ɚ; ; ɚ; < ɚ; = ɚ; > ɚ; ? ɚ; @ ɚ; A ɚ; B ɚ; C ɚ; D ɚ; E ɚ; F ɚ; G ɚ; H ɚ; I ɚ; J ɚ; K ɚ; L ɚ; M ɚ; N ɚ; O ɚ; P ɚ; Q ɚ; R ɚ; S ɚ; T ɚ; U ɚ; V ɚ; W ɚ; X ɚ; Y ɚ; Z ɚ; [ ɚ; \ ɚ; ] ɚ; ^ ɚ; _ ɚ; ` ɚ; a ɚ; b ɚ; c ɚ; d ɚ; e ɚ; f ɚ; g ɚ; h ɚ; i ɚ; j ɚ; k ɚ; l ɚ; m ɚ; n ɚ; o ɚ; p ɚ; q ɚ; r ɚ; s ɚ; t ɚ; u ɚ; v ɚ; w ɚ; x ɚ; y ɚ; z ɚ; { ɚ; | ɚ; } ɚ; ~ ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; <dictcomp> ɚ; <genexpr> ɚ; <lambda> ɚ; <listcomp> ɚ; <module> ɚ; <setcomp> ɚ; <string> ɚ; <unknown> ɚ; } ɚ; , ɚ; }} ɚ; {{ ɚ; %% ɚ; . ɚ; .<locals> ɚ; ɚ; list index out of range ɚ; ɚ; { ɚ; % ɚ; utf-8 ɚ; False ɚ; Py_Repr ɚ; TextIOWrapper ɚ; True ɚ; WarningMessage ɚ; _ ɚ; __IOBase_closed ɚ; __abc_tpflags__ ɚ; __abs__ ɚ; __abstractmethods__ ɚ; __add__ ɚ; __aenter__ ɚ; __aexit__ ɚ; __aiter__ ɚ; __all__ ɚ; __and__ ɚ; __anext__ ɚ; __annotations__ ɚ; __args__ ɚ; __await__ ɚ; __bases__ ɚ; __bool__ ɚ; __build_class__ ɚ; __builtins__ ɚ; __bytes__ ɚ; __call__ ɚ; __cantrace__ ɚ; __class__ ɚ; __class_getitem__ ɚ; __classcell__ ɚ; __complex__ ɚ; __contains__ ɚ; __copy__ ɚ; __del__ ɚ; __delattr__ ɚ; __delete__ ɚ; __delitem__ ɚ; __dict__ ɚ; __dir__ ɚ; __divmod__ ɚ; __doc__ ɚ; __enter__ ɚ; __eq__ ɚ; __exit__ ɚ; __file__ ɚ; __float__ ɚ; __floordiv__ ɚ; __format__ ɚ; __fspath__ ɚ; __ge__ ɚ; __get__ ɚ; __getattr__ ɚ; __getattribute__ ɚ; __getinitargs__ ɚ; __getitem__ ɚ; __getnewargs__ ɚ; __getnewargs_ex__ ɚ; __getstate__ ɚ; __gt__ ɚ; __hash__ ɚ; __iadd__ ɚ; __iand__ ɚ; __ifloordiv__ ɚ; __ilshift__ ɚ; __imatmul__ ɚ; __imod__ ɚ; __import__ ɚ; __imul__ ɚ; __index__ ɚ; __init__ ɚ; __init_subclass__ ɚ; __instancecheck__ ɚ; __int__ ɚ; __invert__ ɚ; __ior__ ɚ; __ipow__ ɚ; __irshift__ ɚ; __isabstractmethod__ ɚ; __isub__ ɚ; __iter__ ɚ; __itruediv__ ɚ; __ixor__ ɚ; __le__ ɚ; __len__ ɚ; __length_hint__ ɚ; __lltrace__ ɚ; __loader__ ɚ; __lshift__ ɚ; __lt__ ɚ; __main__ ɚ; __matmul__ ɚ; __missing__ ɚ; __mod__ ɚ; __module__ ɚ; __mro_entries__ ɚ; __mul__ ɚ; __name__ ɚ; __ne__ ɚ; __neg__ ɚ; __new__ ɚ; __newobj__ ɚ; __newobj_ex__ ɚ; __next__ ɚ; __notes__ ɚ; __or__ ɚ; __orig_class__ ɚ; __origin__ ɚ; __package__ ɚ; __parameters__ ɚ; __path__ ɚ; __pos__ ɚ; __pow__ ɚ; __prepare__ ɚ; __qualname__ ɚ; __radd__ ɚ; __rand__ ɚ; __rdivmod__ ɚ; __reduce__ ɚ; __reduce_ex__ ɚ; __repr__ ɚ; __reversed__ ɚ; __rfloordiv__ ɚ; __rlshift__ ɚ; __rmatmul__ ɚ; __rmod__ ɚ; __rmul__ ɚ; __ror__ ɚ; __round__ ɚ; __rpow__ ɚ; __rrshift__ ɚ; __rshift__ ɚ; __rsub__ ɚ; __rtruediv__ ɚ; __rxor__ ɚ; __set__ ɚ; __set_name__ ɚ; __setattr__ ɚ; __setitem__ ɚ; __setstate__ ɚ; __sizeof__ ɚ; __slotnames__ ɚ; __slots__ ɚ; __spec__ ɚ; __str__ ɚ; __sub__ ɚ; __subclasscheck__ ɚ; __subclasshook__ ɚ; __truediv__ ɚ; __trunc__ ɚ; # __typing_is_unpacked_typevartuple__ ɚ; __typing_prepare_subst__ ɚ; __typing_subst__ ɚ; __typing_unpacked_tuple_args__ ɚ; __warningregistry__ ɚ; __weakref__ ɚ; __xor__ ɚ; _abc_impl ɚ; _annotation ɚ; _blksize ɚ; _bootstrap ɚ; _dealloc_warn ɚ; _finalizing ɚ; _find_and_load ɚ; _fix_up_module ɚ; _get_sourcefile ɚ; _handle_fromlist ɚ; _initializing ɚ; _is_text_encoding ɚ; _lock_unlock_module ɚ; _showwarnmsg ɚ; _shutdown ɚ; _slotnames ɚ; _strptime_time ɚ; _uninitialized_submodules ɚ; _warn_unawaited_coroutine ɚ; _xoptions ɚ; add ɚ; append ɚ; big ɚ; buffer ɚ; builtins ɚ; c_call ɚ; c_exception ɚ; c_return ɚ; call ɚ; clear ɚ; close ɚ; closed ɚ; code ɚ; copy ɚ; copyreg ɚ; decode ɚ; default ɚ; defaultaction ɚ; dictcomp ɚ; difference_update ɚ; dispatch_table ɚ; displayhook ɚ; enable ɚ; encode ɚ; encoding ɚ; end_lineno ɚ; end_offset ɚ; errors ɚ; excepthook ɚ; exception ɚ; extend ɚ; filename ɚ; fileno ɚ; fillvalue ɚ; filters ɚ; find_class ɚ; flush ɚ; genexpr ɚ; get ɚ; get_source ɚ; getattr ɚ; getstate ɚ; ignore ɚ; importlib ɚ; inf ɚ; intersection ɚ; isatty ɚ; isinstance ɚ; items ɚ; iter ɚ; join ɚ; keys ɚ; lambda ɚ; last_traceback ɚ; last_type ɚ; last_value ɚ; latin1 ɚ; len ɚ; line ɚ; lineno ɚ; listcomp ɚ; little ɚ; locale ɚ; match ɚ; metaclass ɚ; mode ɚ; modules ɚ; mro ɚ; msg ɚ; n_fields ɚ; n_sequence_fields ɚ; n_unnamed_fields ɚ; name ɚ; newlines ɚ; next ɚ; obj ɚ; offset ɚ; onceregistry ɚ; opcode ɚ; open ɚ; parent ɚ; partial ɚ; path ɚ; peek ɚ; persistent_id ɚ; persistent_load ɚ; print_file_and_line ɚ; ps1 ɚ; ps2 ɚ; raw ɚ; read ɚ; read1 ɚ; readable ɚ; readall ɚ; readinto ɚ; readinto1 ɚ; readline ɚ; reducer_override ɚ; reload ɚ; replace ɚ; reset ɚ; return ɚ; reversed ɚ; seek ɚ; seekable ɚ; send ɚ; setcomp ɚ; setstate ɚ; sort ɚ; stderr ɚ; stdin ɚ; stdout ɚ; strict ɚ; symmetric_difference_update ɚ; tell ɚ; text ɚ; threading ɚ; throw ɚ; top ɚ; truncate ɚ; unraisablehook ɚ; values ɚ; version ɚ; warnings ɚ; warnoptions ɚ; writable ɚ; write ɚ; zipimporter ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ! ɚ; " ɚ; # ɚ; $ ɚ; % ɚ; & ɚ; ' ɚ; ( ɚ; ) ɚ; * ɚ; + ɚ; , ɚ; - ɚ; . ɚ; / ɚ; 0 ɚ; 1 ɚ; 2 ɚ; 3 ɚ; 4 ɚ; 5 ɚ; 6 ɚ; 7 ɚ; 8 ɚ; 9 ɚ; : ɚ; ; ɚ; < ɚ; = ɚ; > ɚ; ? ɚ; @ ɚ; A ɚ; B ɚ; C ɚ; D ɚ; E ɚ; F ɚ; G ɚ; H ɚ; I ɚ; J ɚ; K ɚ; L ɚ; M ɚ; N ɚ; O ɚ; P ɚ; Q ɚ; R ɚ; S ɚ; T ɚ; U ɚ; V ɚ; W ɚ; X ɚ; Y ɚ; Z ɚ; [ ɚ; \ ɚ; ] ɚ; ^ ɚ; _ ɚ; ` ɚ; a ɚ; b ɚ; c ɚ; d ɚ; e ɚ; f ɚ; g ɚ; h ɚ; i ɚ; j ɚ; k ɚ; l ɚ; m ɚ; n ɚ; o ɚ; p ɚ; q ɚ; r ɚ; s ɚ; t ɚ; u ɚ; v ɚ; w ɚ; x ɚ; y ɚ; z ɚ; { ɚ; | ɚ; } ɚ; ~ ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; ɚ; 3 stapsdt : P4 `P python audit 8@%rbp 8@%r13 6 stapsdt r P4 hP python gc__start -4@104(%rsp) 0 stapsdt r P4 fP python gc__done -8@%r15 G stapsdt " P4 bP python import__find__load__done 8@%rax -4@%edx @ stapsdt 5 P4 dP python import__find__load__start 8@%rax F stapsdt P4 tP python function__return 8@%rbp 8@%r12 -4@%eax E stapsdt P4 vP python function__entry 8@%rbp 8@%r12 -4@%eax ; stapsdt P4 jP python line 8@%rbx 8@%rax -4@%r12d libpython3.11.so.1.0-3.11.9-1.el9.x86_64.debug m7zXZ ִF ! t/] ?Eh=ڊ2Ng/U dud[hDIڷ3٥{ Z,~$ķr_d:)!K8 f"Qn_H̄՜Z?0.oMǎ? $Y\9/zLצ'juM_\,6Lk6ea!U}3F2 PF(.TJ Qo1Bm76Ii#rrAwi]ꀭ r } [w}C' ]uWDx s-MKp~订3DhTTF'%MO&\YF Uf"궋){znq_Kt Lw92"gvBXk"Ϗ"ĶrR' . Tq,o\O⏨ۤw HGcnZ >'l%0_m{X@ky {9=Y .<@0xۈ ; UU3eX̛ fm@O˂ -` ,S T~ M =H 6^M /gSoZaȤ=ԭnM /nd(" &of HwJ9xdZ -Dqy7\0Ƞ|J Xt@^N# 80ulζS" (~td^p;GŜ=o.iugu/vKe-Лc4Vϝ }R%M}t+Z& <.۲oaPszшtIg6Rm7N 2V:؝GtK\ fuTdk/^&2a'o+/ah:[ 7@h 3UWpA A?F;a3}c8 Hy)vPs! +Zc_<ei+Ukη0Dz-tD["hCWUabHX1#˴魲M l6|^~R) Y -C-?_e4BP<ZB EC@ڔش$ D0/]8al=tu+7J_ 5F).hEGަOSgm,LYFB F"gWhT)6w>jJ#x= L18$˜ 6=,̻3 O5aҰ:qs뇚<ZB?dg3hAŃ] cpc]R _(hK /'i8Ea SGsH|ڽ6I97 t =U@ns س]InM$.I hY^b Q0X&$ΖcƮِt)lO5lT r3 A!s1iٜ!wLp'07Ŀu U+t A1LTuc㫔PVZEnICi\xC w+ Tc?jTNbDtlsXXs)|ڿk |AQf8g%~ήv;4jZ!k}t[aՑi# )_,46WMq** h eEBf 8_+z=K46J"W&; pʲĂ9N ayQBX ?(C7r"t_]s D7; ,.*|/;,>,I$PS'*-ɱz;e{[_gvZ\+ ߲Sv}* q.&ɆU b00 P`L<Ae>r!.(Soҋ0 T7^-_Yz D h}3 ) " 5)UD 'C=(M1# %ZߩtF1[2s &ˋpjmSIy2^&{PzƏHwy_Gf(:h=T\/ _@0S٭2$6 | >~gyXs*Jx<.v df a!LLnVJje?Ci @]77},7Jm/]ZTkCznpHr&L^ 'GxnΡ;W\vhqe #T;7sj2_wdE b^* Z$ +'ٌ uUS"t".5.,!.6_a% w~\7"3[ﶛ 4CJ>{VR(h)/m^r9]/ŸQptFa*h,7V,E 7~QQò iGJ{@ e:DYgqi:˙+hv\=FGOy͐ B,9J 8 n?B#QV+n{>mg Zu3 Dê\h3TOk+ 1[)TĢV m:>NelCzri%y`> U䟭"Ҷ4>*6P :"<Vg. +2Ԏ2 I$9fxT,Ojhaؓ8?hA{ su, /{ ,Qӣf쒒gs8г ؉}Y,xiZ2BS8>{ FBL[ٝ *f,Qd[ >mRU-jD@ SRQXfy!Fݲj5vx$ŠzUbz> ]uT)bMAwǺaP!-Bqg ѸG֨PלZy P\,703gqT,f7,DnbQV<c(qj Lnqϩ\a&JQ ȇmE ~T2!0):%`dJ Hx9MBs#I&@?.{X~d nitHsj!H6'{\tO %rҪc y(; v~ EfW+zzCEV)fQ(ay#Y-"qKcjbI5+A&*-?˂i*Y Y3l?Mf]ܺj=^BP n '8L"[ *~hrc:g ^;c$mR$IL4㩶p]uH`pΑ2SZW |M#LG:6ϛ~#~ ێ laldR7sy˽+T{D !={ڲb>}BǃYUʂ'uuS6pc^~ڮ.CW^7YwzN o K:@,wt>:CA e:ثJnx1¯!R[o,kKRy@<嫇Jѡ^d"E韈G'bsM7WM-k,`Ku,϶hxN*q c 7'XvS~}"Sw lM@lT>da ܴbN!9V[.fͿ ݫ̰Y &R* 7^lcN 2ad ,D o||UZO@r װ`ߚ6i>qe pG9!}, IP4D - ߚjP@6lA hZDjtjqF`?Qu!۔gu {~ᅂtaC馔* ؊) cT9-INb8I qNegwW p9md"ݤ5.^~cZEb&YTjv9!HS@) k/ui +R{6]/>!!AX?˲;s˨ JNѢWH-FC%AÈk'^TV&Gq~Ȩ/M*^G_L o] `eݖiNr'@\`=*GVh-38t |gbmu7}vY{ lgg"a957~`R2sA Fa4Ł3<bEVXRo-i4}F 75Ǯ& Y765 R^v \ VJK_G2R( wJUiE>* 7+^8.NGoӹkr`,TH§zw:<ybIX5jv믨ҳY<+00q9Ir~άT/a˱|'~ڄ Ny(Ki@% fP^J읍?$]6k?._o݇E=7i <pZq@# (A/DzE7 W@bf^-Vryrt"e̾O[)E]VՁM؟'iҌݼqc 3]|Gbg38}&{d:lү rxYȩduu*- Gw=(i<<08 tU$#,s;u = FZBoqDx0Fo*[Př:4z5M??Z<ܗɥ 闾cmI5y-֥>RCf/ 2Cy }A1WEH R/ D#E<J+鐻f UԳ{@YG7%)_젣huBBZi/)m~Ԛ )VEQ~5@%̔qA:@컴MےvvwPϡw1dxu:kZMMY +큭~yh BITH]CG v(W7 o6 nZPS*1U8$2]ӶvvIREiUSW!1Oy OmoZp gaX{]buY~g- M0|*3tYA~8ۧƌ|z (P}A ^puϊ[y v١<HWGZSK58^q@US^c:ׇ+G .:qT1᭲<бv#k CedD?׳ p ?0(0^*ka#b{K O- r 101qf2r|'MЪD4kMVN<,cP1=A[R0RVxxAq ?>?arHt ױ4S ğ;3;^^D^J: 31MƜD3@z+7=:#?&9[]*h_FA6;8 eH M눲N;F/ 1{^A4HZ!قtcDh@nL2B4j2 4 ݊NYNz:lW Lr7o%rV0D17 ~.( D"x?,?bp(rv\R/άwղad6W?<"7O!s72v)BEnr>̓g\fgY#hzE݄InwX>{:B|IMBk)C 5~@atgX_1ML#$W gqR;B\!LZ. Ю5 `Û'l\)Xald:8:s9mp߷IC_ 5` GљRͧuz.HfsgV'|}HwZaH+T%-XrL0X d+ %= !#nd P1 sa,{4gcݕV8?l;WѶ֥-<6XW+>/z/E@rB^O>=!83w6] ¤g&)~%g?= [[Hi}DO.M9dB c߀;mP'zx~Oo5C@b@ǮZPmW&>ҿ UF;?F-ỹsxȵndyf{ Ò2 ZjDӫޯh |f5 ^K-( |K+^R]úȂ6DPizDUq̙PhV0)A[B~Cn@ =lFkA+,oH .Cb m + ˃\ wUg MApY"~ZB.Yaj|) aqw.;kAgB [V mNZ|ޘ&Nu k椶yCm XSI՚w$51v$Sh_([,ʂƉݎ7X K e'Jhwo"/ƫ G-uW :GX> Q90GҩR,7!jEi,s<xK%ﰠ{r</2Fj3QqlNq e (ߔnF^$1N;yW /US/onߘ G]Z0A͑ٹIgP~w<Pz[I\ LS!Ka k= !)R <+ a3M"2vB'IBkQ}a<? v4]j\7' ;5Yeu e-8Q^Fekb6)b<̚Nm{j8,bBk̡v0#̕&֥'. 2xj_FP5鸤;昙 -A|&#dafbo曶Rz1ʑK`UkӞZmÓw N % Й/Ba;;e`OD y"'&ˀ_z|lv ̆{P"p;qwȾ!e-BҞ uf7\sXEB',ObN\E[a/ÆF'|{B~Pk9Wzwz"^ipa"sW|#01qK桪^'ktI" }Ͳ,P3030% ZViagK 1՚/@m不k5b")#Jh%Nxz!N R!+*?˖Ɵ^Y |@ ̹ rNFPG$͔.` mM 'o~>fr}ɬ[Hivpzlk ȗ!O7#<hw2uNL2c EVΥ|>۵v*:#E e040g Lq ]~<NL];XP@x˔QC7@OuNHx u#Qdwڭ_8 0 i6B|d:0 Ύ&&H;4JOC)j vs2[ʩjlB-݅mPk's W$0G+ uGnGY%gwcZ: td :s/s֩ɒ۽"nh +T6p#b_Q뻘 ?A N(CuqR6m0r*PhQg!?`kʑ G#Q| 48%¯ qk"p8>`,9 TtA1.ɹف/cK%hKIɘݧȋھyk3x_Sk/ #{Ck^k`2'$?ͨn]՛_y Bt|b 08&.J3#S~ITiaF4/LdCed9p=oX5dZ~Z-GR*Jwo zT0U. Lۏw GJIVm[ 0#zSBC b:%v Ӭց2Σ U<s_gb(3-s4 Q3h@!+0*m/|q ]e]D}Œz&qaMnH,d> Rls} nc0bm6; ~ ]T$Hϟ jMs<<zG[#ؤ{_B\ _+xxhgQw%W3dRR7c[ܙ{7ْ. Ԗe9aI`~ MmAs{ |9>ts7U ֩ ՜ 'Ȣ3ʺQFp b^x}m 5ﾰ >&r-?FI쮯{+m",cH(po$ڄ6Y i"#YDT\ڍ?! \KTC9B/X, %GS%E7q670p5L\ FJPu|$Na[H xT\g =KJKI1QP`#}K( c_&S[L}Ԡ) > Q6%Uu4DDHK+"HBW DT Au$R99: yeYD#r('6DXCЛEE#G ]'B*;ز v]`iI)ٴ=PL{N1,* MÂMrFkPM} nf#+CT 4 :IEbO JFx4W~._Ư8?-?3*fLnR;=g NQy?Y{aQfb%\=`VӸɭ <U wLNO6ssK` h> )p:/x1#ԹP#a/Ц%͔GBF=k˖ CGfvţUS%SA,^X^; ߹ʁ P]d7":Ndg!rq4`0Vi&&j#AjĴ_@*Eඨ&mvx;69mh?N<-躍6XO{N5:Vp @A/$ rNĆf[erƶw#nX>lUrI$hR)?} D\ ]RxC*ie] ~<!.J~V.Lj\iZ_g\XҔEÜ"wz1E$|| ={"Vf7lWW! [Y]SkA SPmR f IF' ]v]!7WfP]udq~9V| #5`YFה Ds[V8N/nsev{zDH] \!Ԟfrq^m(᧽̕O<&(\*c%zMJ6I.*n}w^t.HA|RI6EX71CUDTs`ԌK|Er! k߉QͪؐhRiYP6)%5h8\Z F ةw&QE`}U)^V ];6fsX{RːvYpZ] q^*qO t[2cVaD<WsPo#; 2 |PDL2~ׂL=en}e>y77 ԋѾ1 Ɇtd_cj͝qWlef 6`y=tdE @{(;z;3',`@sOj82UuIHKw}w]9?lj{5cK 7(KgX le~ i{7 Y>Թdw P tbGsV`i&i_BGzGv$Y G UmCMYRG@r25(ث]+rq;. #Y/]A=b%yz,lil A!{KJ5\5K/c_TN2'5 l +ا yu)jWgL i"T *nAmyv :ӿGԋ:)rgђ vpƠI1Y e`Zn̮_A楋 ;;j}qT`EzoT֘:RIk=@^N :햺CuNHğ8k-2m`n5ȹ1i%/>@Gor? ) vT:{sB_@r&'@ k JKJ] V ]~_D?k8aqt/F1'oz,־:l M|%[)dp o'*R[c;k9=C*`1u# r$O>hyTM/De 0ivO+UԬ帳9 w=Y_: D+RKWǶaQB$Uz(8Fhbq2:33G= !H BMjc+S =m|Rx{>wYF n#l}n(@x"a]dR\AY/e?g֣_.a{)<w*Ҥ$ bfW& +> lPI0JufG&$/KEӪ+x>iYKe3Z# x6ݙUϐ]0Dπ'~%B yP÷-4TeHY+FԈe2@bEJlqH M+ ǣmJޗ#'JN@p"INTشĮڄPb팴jm̟hŒ ir& YpCzXh/ 3T.fgi(LDaU7 ф+*ߡOr8lFj7<s5ET^||)Jyޖ %eW'N`^},|BߪNuHP^4Z)6WOEcxZH,=n.,A ?xyB;M ZT=.RbQ7r>;Ӡbz@ǣ9j!9cm8kb/'Y e #96 eBBi8~G8h c˷,\K~{J9Ql?<DW& k +B_ T|ʹ[S+8G{9fM' eruzE-Y9W`ԣkzK :wm]łN(R1P1pߚJ Rs^:p;;T}i66le9gїvԠ -x[/3# GۂS(oG&҂ߠ ՛`1?vظ=~!8ՎE&`Kٯ/f^K z/S^@t %wڃ''EA1[*aN)GAg0;Y4jm,Ul%)O NK&?KD#Gآg kлRpRR7#vtWVS @39 CKζQ+f7M"g8gQ y:}?n}:i>p!ܭi BSOpCTLጐɍq&бRGv>i̎aD¿+Eo : [e [o,wL`b-At=ɫ u ztZֆ#43} E Qq h0 O&6R*J8$2*8$ 'ҲVc_\ ִ}m85; uP1؆hh1i87 愸;w^7DAo @Jީy<y}6焕/d P|Kȏ+4gMv$*zy.?,2 8moJG7Nj7 nz}20)71 _"-Y*:a N[zڎJK/tsM O iXjIEzʎ? f}7ooO-]96}KGKD^J27tr z rcy:/ %nX\ VH=):/"м#x sF?%2eSOg47>UFm N\v<AO 7 WX%>{$KfA4n' HKQE"/W QǮ FD-* XBX %JMVOQAD Cu.(/>d no[֯̒`CA, .A}sU|IWzu CJoO2/CnݲTc1\. ۑ_DW=8qOm7xҝI$l.ޑ "Wɱ\ xqS)ˎMx:Q Q,)`YB@RG?7Έ(@/8iS8^(F7jkƭN)yS?e^iXfϺE$,] ct JqD?ٝԫ/Į3[8(`9 <ԵoI5 q2Z{5l2FIݮ]؞;ٱ [|q32 i>U~ >^`1:Q"Q|,*3U HZ5`hȚP~'b ʣ)IN(EXtgtR4|7Z:)יCm#30tG6OŪ# ftX% Xl>GUa&hMg6vG4r!- 2{5_ͅʅ{ ac$6%fl#x$AJ^ k ̶`v}5,Gp\H58 QКZz+%G63W 8qcB %4G`!0O "][:g$ww~PUXxm"R!+P1NFfxA# YHKG_V6٧D\ۍY7 = qU?vC27D$LR0R-Wh_vXNU=m+!< XoxS}:vCª VW_ͨ"UaQpQy {z gv$$$8otYӛy:)uq3AloN@7WijXI +CBP2apy[ߕ, *E{4mݬ ' 18b.7e$%6Caz_iB+N҃RYf\5)/bOa$Y1[h/:2>TsyWOv|0Q #F0Ί"x 7@pϱ$ wfp ُ-9>3)rD1Bt@l!g Y.Pĩbe.-J@j C|#Wk41Cp-|Za(>ѾI:lH8: aDHw(Z NK3nͩMɓ LפŐ4Mb˖RHIXbˮqޅ|) Ū=0ҵc艎 64ŢxUt:HLt6hmtDmAys؟B3e:ii`l쒜˜b69&}04al4.(Nr[p|]x>wW`hB+ W(H}Ϲ:*ܕ i851'qtȱ͏5K y2P-Mq^'*@aoICu:>id<D Jz?%ɚp0#0,Qk9'p>fH㌺lc E Y*zqefΙn%#mffdC}|Q-zc \5᩸/8_'lc?!~%c"ٓp yi9ϡ1U" V)+R{{4Q~ 3<xrgq8,^k]jܠ^] ∢ B ga )Sջ8v0>WcN, 5まmSib^f: t;0@qu7Uj}1V(/[!1t_5;ǟ[$تilT}7l^Ӳ'3S m2 ~gڀ:P 07] 5z*@%E5ȃdPCu@ƛY@=ބ{$kfxEt2Im1\^iș X)'чlH0j뢗 MwUD +pWx h9ufp>Ē>Lgdnm Iz$0gZOr~qp,M6 >CP엀[| 8{s-?LYFa>-z<3$T*ԄI>GUpn-.3n zT1yV hMEKË%׳np6=#$YfZ# (-@V,gV0ܾX'id z]]?5c^W+2KB ϗOs $#SZ.D#ZmEpj9,?dE & q1p@3AYsvR*e:_]Yܑ^% BOnS4?1D_Q#jߙm v+܅oi+h?WZ ȅ<5 ];C@K.yMsȗ3S&B$ KLb&xN[U.9A`QYU m?45Xv<ˎ`!ZX /$9F Ny6<6 8>r2h˨~q,h= 9^sw ʦvV!>ےm=彚_y" S-{:GhIh䆍S}Y*& ɏo',0 E # zzAvV'DXJ q ?a>?{C3 TN> nRIõ!ߗB$YT./#gqRI!<vnPp&q_B+gzd Trℶ EYNY,,@ΛKo9ȱwϔn[=ND .q/ϭ" 8Xy'Fө-I͇qm[=ϑuڞgf; >FrńoWe Ԅ ky.lpP&NbBS|{"lV, whhk }챎|,!! [:q/ ]sBT u t~X12@ $erȆ.`^Ʀ.녓P ap7t`ΜB2/q jTj:O73NIP̻.v1(r\cyO^O_._mlCpkkMeW.k T^2U1[Bo<-*|?cI 1uX..<W+L)l`h|UoŽ!<V1 Ht2 (RaJ{䇕t<TP酯+mxZ AX' 703_ h8Ŀ \f+ IP:P?!33u e7M}b8vK =%o$K5XIbc=X=Y Ozr6p5T>X]_ lUTWB;ITFiu|f/,YO枑ʥ B.Dʽ P F%Qs!v9u8PЮ)xNܷj{w|{tE#UPoM7}Avۮ9p =?ׯGNtﯿ:)KW"C' rMDjt+ßF2AK,C<^a~N~o u R=u$\ rQ@nuɷ̗)&ژ=lvG"e µΙ6T# 0a|Ikzr?D~,t|| =Sn7kg^'nVw3)=b4 ,yLDv6_# f 3SZt<҇ŷ ɍA Ì:YFB>mUr|ufxY )bk9Ă~ѧjk^n~Jag(Ah|peɮ4ͅ &CWD!;%)앃:s]ӱ \VR14DYM2<r|#F#IDQFr%T+C=iTLk)Zda)-8yى?EޓHŘagɮCdg>ʚjy?2D}jg^K Ġhoi)upB`ZşnY|q _ p$H49+|&@s>^ <2#\ O&> ߳S EyvȻxc=x @TEJmdis 4JgCp{`q2D ڿ h<pOaE'Ӫ_tZ㤼=: $Q] Xml 30%?e'v0MHBTlY +ۥ֖Rw!<' f_d O7)TrP C1\Wgi: P`<YyX>sOFXcX>M -)&2s/ WeR@߇JU;+˛qGF4̶Z W@z`yi?+w۵@Hq>Agos|)$P O/4N9NA>rys E>p%nQw |"{_},AHEl< 2 %g Y<B쌱KD=׀Ȟm: D,KKlLF&xK DGRH/Ş)K|ԅ Iya /FJNJ/)\Uj'kT"'^c-6)CiQTk>]Awi{&%GkVi'.:P0g[l"h- LK- s '*Ȫp2,0gИyL |Cqď>Skeϱڛp!wyvIoZCL2}yn KE]DHcf)Ȯ wEj6 ߐ11SM S@z2 /O㒮q>|} 3%Ɲ1*{rIζÙ|AE/њXO lڶu ( ~SfN0jv>tKEqypdVr+/1 {}!cl`S M\:( pHϢD HSݳOGoq*f,E Jx@6@AtB-0{bA yuxfN P*p!1g}jaB(~<2lBb@ _;P U,$ۄ`&Uk +a 궞_ :T#25+љ ֱC8HfJ=oTDwyZD!Ԛg #w}&*1~bD1nuF:)}ނxd|PB?bh"6ň}n: 37LoӺ߯+ZY*g6>T hzk J rK \ZWO1'Z*ׯDߚң[!?zr`Rr !Ͻz݂:I -Vuyi.KgbTz+la5YS;ap uB{i\ y% pF}UGŅ12? (&3 s LBrQي0Ue9rڠBR6 Rij17 c5v0-Vo^7 s'J槫ƼՆh,&[Dz}zTMMqbQ~UGJzm];\Qn_轐@'/k^W'ܞPd*H$pP<. Ov9Gou8` (]D)Jg vU-Μ<KM1jTݥ^Wq Ƌke!T;չ N% zXi?aFhZBzTTJڙ1q']u]vק302 >v2:AIAHk.I9pu[@Qa䌱|]ZL @7l#·n! ]ݐ[; ]qha%e]: 2e|LiATjG (o{&a?W x:>Xrp ZPPyԧ. c<rC|F$хS+ # Բ]pisO{WH-}Xm̟ 5 [ Ż6aEuDMP w D =1fo Q&ő&6uG$-ż)BK#$"Y am;h<OY Фv(aӼgٿy'(<1A+W Jnb\S^G$B$ <G}p`ۃ&}h\.6z;tY|;*"nz7 '% D^hj 1g Փ#:ܸ#ͿlAbRAD+QK ` 2bjaV;[k\I;DvH֦J fT:B(RR+ ?3Ol$Z!F) :ļG{ DQB0$]b'Ri^m Y4ﹱzݖ^MqCėm =iѨ(&Υ0cdnjrDмUCS`k?B mW^X[A] y]KY} ttl%Df>H+3;U"vTN+ ZX.6VE,dI Pi:}AxLh52=<%ZM*``R=ׯ Y]T7?Tr}d Lם 6}!>Z==B\q`~_|(/2{ Po1 1,FF>'{]~FTiLOoktT6"RT'P)8TjG&(ƔM&v`gלx&#+ßjR&4S;73!iy3ۡ\TM/xN ݖucmqZxAVOn53Q)R$N .}zerI=QQ~bd?OW7LYnCZnEcn8.W\`o91j,-||;)R*@K%)@2#DwPϳ\S %%NjdFBM ,?e~'QCRaVK4qwj96W;i |D\0^Жl+ ^5=W_.- AP1p=P!%G?m V+ko,(]3Z AIAyC'hE,AVG'!9?dܰCWrMX *Kӷd̎_@<'CިsT %8*)L:TM_V5ڹ9@(q(J.Q1Zwo{tcNki떌.& 2ݸ|IdƼV͊p]7#t@GDC6z\ j6PJ,dqk+ETQXa*9*%@Nmnh(* mdּKsE;SdXq+v E(Z+Jz3<.*{ZNOU.M4F{RL*:fjXZJH/<(1yڳ $Q@k{ >i)f)9Thj ٨-8Yv CQNqRb_*drV?2ӴɄuҹ> 9>7ܝ.=A8'j]EFŋ20WiUfn >leH*\ ZKi<A3v٥BRj@`@dI{ <pE DFU%W!0 0 f6f|jiefǣnO9 Y_|\>rҚJ'[p{x71J4, R&ɳ& Fte0tCW1DUp #*D<ɲLNW BY\S |Ndֹ+Ԁm/J[7EáMN5EzJW3A#q.e Q Iע{'¥ d` o@!np#+Y>ݍRAP9ji ⫩7]<e驋 *,.2 *hPĞP^3& |GZB$4hv (!E]'WT/S6QK\捞6LQ^vͬC(;^U}?t()"t!'PK |?VC#݁(Qh2cʘ}QEq3TQ|m{e h ӷq5]9p! fv= I/s lhbRV TƖ$%~ZJ7bY-ă#xB-j\;A aڌ $8_p8lq]ޫp/q *J}힖WRf#&Ò0 3+?j LH Toq ?zmna'g}g^%8 Ip,\B eTY^{\DJ猒}B0ۂR oyъ jo9I'Sp1@;s P+Vbbjho5ى v'[ dSjHc.=[r=hPP-UV1yU'Ӿ@Ґ0gާi v1A@,OhVBhwqT|LrQDY4F Ě^CL?]Z8x,2Wbɏ=/d+c!6lL5CUǗ9ÖJa$ݥLu|d9Y1 ԶǍ6_H ;> Y2 <@*|b3'm7a% }i>%X,.) h'Sq+$WA{a=sLM_XB(rQUMwK+_? JU9x`2=Yۦz44eckxV jʌTIp7exVҭ뙠t*Zh'5ܢP+淹&7/ysGۗ* `/0D{ⷧQm9pԷz p=UFQnY 'SIq!jH2j0t فuنHEgݲjWjmzklF)JH֞X.pbO¢}i[\~ 61 uw-M« "d8V{ }UvMwK.mp 1 %hwaD!)` ޑ=xہIuUER..pCoF%yB`>#JK6KyVq=e?%83u t %Y#J sh5;3ʺ;zσQd`SA_;80 :)>($t{9|] uĨ}JE@M@o+mwʞw 1~~d:]ݎ { .%Fs#փc+`4sI-Y@ /83R9oNEQ"u#I~_SsB.U2irhvE+r 6Mex̒a 8>%c[珜އ6Ɲj}i%<V%v9X6ܯO lCa q1+ HcLvk1Zđ [I,HHJ=}m10($i[ ^ݡNKF^"ş.^os,'d˄b5ʏ:O $N.'Q -)[am< Bku D v33 [hJźS0HJ?\AX1!h=)ҳ \?p5G+%k*IVVah@3.8ױ+c"oqhh,쭀FO[,{{,|/BTA#xo uvMp ,: 'x;" h H Z2^;lO97 kN߲Emn5[D TIݬOP(NÞFxˡ4?1&@% |7:89.J[>Ԫ{HխpkOtn<q1T@GH!jPT4"V14vL:J__ 98]x7!Q%fyh8(YE^^.^&<+&эQ)RaI쒕8u5fM ʄfIa"Pӵ$x3+!@bMJ(7~YHzmx? sK3AsPd_j } >ԤSR{<xNU N|>y2FZ `:9A y*Y={ *\$t_: ,:H5\ R Pףv X > q> e )j &ѷ?aIF/ d4 &f<0<A1!UQԍTĮ#ʩdaR4[A{@uua3TPR3 S NE-P(]հ sb ?gZ6t:8$ p~R&lW , 1Fֿ D?g&~^u%pS \Logٖ涊~Q+ 'Ql(THSK=o!OE-9Է0=x|EJ%@'C > BhUIv (J8 :5f kH^1ܸɅȹNm7U͠k ȴN^a%!i\ \G:dfufV6=R-ar1 B )L ,/6Xઘ|\My"2F ^ *Qu -(1/ P.y"<95Bf/y{6%5%鎌c:3c{CΩN\ba d-Ǩ .~MF !O {j샗ѤaùsK=9cTM00DJޒp/Q7fϤviBr7y#2D>e '4Joȫ;%tm:lu.ց-(<OU+} C xPzR.=\}B'RU<m.;?؆Eh g'e" pwik,t%<;ΐq(OC}U3:ϺS ߮:L(SRc|~eiR7s_2"+)!rU˫F!a~ARW> u7)E)B0tzT?= l <htB[~ʧ 2 d?:0:=$ײv۴|GQA;SS3T_}ԯkԝ3JϘ!9YPӭ91tV=F<Bt7ͦs3鶼^-ێ^i KAWKÏ!oT.C̞s/Nr;c06 QRB6P,Si`r. նwCiϼ\ /ǀ>|1 vV?)@*ʗ{?,4Bk"x ]yxh EaPڧhT(h۲$= HVd cT XWbqY-!93g'%FY< R zd?лz=?sʸ 0' -ȵ*9ePaf w/G7vͫv6IJAP'p'rҌleb PRi(a 2bHej Ѫ*t1LbOիmr'`| mAcJv * l/$Q+ SaJ0T#OܻÛ E8JtS>pv1 ȻJKu@CǏ,EZj,@E14!{"q` ѹ p%ފL}'bCB} Zg)# ğ =G#] %b=I䰗MQb\B f68< t{Xs0s01b ?|Fۭօy1MDWReS끰JC$k{1^QNOxKs)!'`Çޘw)./Ҋyմ.N,G ܃ nY@x{֥qC#ם)xT\˥Е<ޭj)9qB ӗF5 Hz1#-kܴ47=IS4%`6j&<[eaD{MGȄ"өkI4r;=MV&' d| 3 &))^KnKļ I#g3_G#~C kA$Xa18Egǁ`pNn X|.jƩ= 6'9sJhKY,rٺZEroKML{8 {칵~o4_q!bMvҾʶ^&:wD3 7wvAMvp{*E2)Χl4ɐ8Z0P\X78MJ1&-2̦mb,R#5]LrOMTo% aA+`w`?f,RB6 {7;&gY x -$LzR x_jhHhp,7/s*^QvF>>Uʣ/rGHtFʕXY|,hR3ѱ`\ dyH\8 ?׳@gW X[|FK G⦬ o~9y˅zo3rVہdžHq;&AI3<B+0h[ ax@_<0'-@FW 81R'b3lF 5^ )]"1R8cJ\.p]EjWiItB{02#} `\(y}/@DZ1iJ/ i-]1"} ;<ìM+èsƩ-C,+$ - ?(P&?(F⡂.ñز}oI1 ƈɇKXe;dMgNJ"tT2o){Ȑ7-KK m0ν(jT9.LsDcזa!SWX /DbVi ؼ> Oљ kzCz,B6&>IDǹd;Ě|IIhmbZӰG$jdN7 c\]ZuUm1] ncCx+; }EڜbhQ _$*6R! učsA,>g@[`:FbsSk b~wZP#֒ֆߪV;2eQlձz)?O L%J!yZT}u|R|_Dx%^8}f-ӸR hTB ÀtlJ aG TӘ?x'RC 6mz@yFا@p1(Cà`*Qi}v2 n vГH$Gj}_˪RT[(Ya$w@)5rDfy;,S9,RYK t u}eeì@[q2^0:5zR(.(@L%X4])R`וC,ByuM<./ԆQc=XbOՁjO ERdW-\'TXpշɎx/ CsҿALhy撌U@z<ii p v7eaZت HPhOy9EeD\ /ҥM&| jbiʌg%fBbbYJ i4XL |r>V~=.+D y . ag['^7 ^D}Y,eB3~̸G XV5x)@ڕ R D$ %"K mW kGIbЭ45 ,ZZ4<̘ ɑM=7?A<c#Ѕ_h+W^W\L⢬jH`: {jɁtjY;^[8^U!J*k" Z O= r2< ^]ĵg xl*G%37t 2H}Yww}[${ kt܆jQǡXF C. +u ~6.IYt7 ~)UuyXuiRsa CA,<en\|v՚) jI$*Gs?}NٺjJ+[ ÎgS 8JTs6vBR9C&ro>$zP'.{Z !f ЉG-\o8!!Sj}|^[_N75GVQtYEhsS&!S1@ 5nUE9~$Kͭ]2uiu|6`;{5+0&Ǐᢑuc4z5 ŝ: j߰' ]a;=Է !Ь/B#\&5# 1'rK)[? peR5Pd瞼TkWds{8ȓ"W=+p .GƼeKիtخ] 1[otXcjR 70?۽ 5R.5RAyc, Y0Ջk9B}Wxk띃 %fvjo- Gj2ـ`[PV 0O+Ӝe+̽D ЉFў$w-x`GvIr JkpN ]n"n*4H\R )<D $>ǰe)3W ;H t( %g^0rδwh4 ;i6ڈ7uD2pVwaT:JXʣ:'3_07+ۚ+='ΜR66 q/3DVP^Ճ+k0>;.THTW6*ی*e\o* "6 UyH9h pI߸<з;;@3kySronK P܁ UR&_ -}7 V}Fs z 0ٮe md'ID0 b0o d+i;/- ^%ygʔ" gƄ+Y{'Ν-[S*GX멾ÍI5Hjc.sO 9|4{h]gǛ<y3ȋQY͜' ?:<uwv%]) \O ~@?0ô6Ο7ة& =ѐ }r|pQhΈˣ + y⺲=dO(|9Pzap_Ҍyc;-[ʖЫN7TJb{ _A45<繬m"7'-s2( I~E ܇~!'^nm"?Ag d0xo~yt1Ę QNLTcUB.JD)Z hE+SvL˷;p2'Crf猉Ȏ g VP?tH x2Ї2p"zh@d1o4B&; m+ IDj.cez [F0M,&em nO[$BZsE+:WTX;۪<|F'PnCS 1'LryOQ@Bc (7 )} Ɠ3pTlǤ%Qj xazJsdm˙q?3¹ q7!gZvșV{ö"GF) GU''UW[riJp\n<t(lw%J3 \E-T1G)[əzۗ\qәG zN{jԲ ; tkE46%Z8`?\.NybYGKMK9+WO$%.j +!6rkTBtƁ~M wlf_Gl"o\Xz]-邢A(ItL7#t>3Fy|"Nt|WBIqoϟ`AaۧK8ZW{Jn$ʤZCEV5n;1 fI3kHK+v.ԣW:S.rh(ϰЯm Z/^% <Eu^h"L^6A J55a,^{样H aInLo4"ԕ[_$o9PEP<iLޖ u72_,6/u\^ Z/=jϡ؍<TH<Gnr ZF5M<q \rRg̔ZDmJ]=mn>p|9dy b@\nTL sҙvQo&~^ BL ` vq ə 5CczG /,{] 6H@O,ኗAQ" V5oNꚏW ê+>5 c _@|s(,8GV/eܑpM3[Wo}Qm8`OVU/lqʱ֕LRB;P$ 2"@V-*0l͐T=kdq0Õ'`|KsD*Ʋ{75c|yfUQ'7i,p[+H'ǘ\?*v %ñ uS)eA4 )B t9ճzrX-/aWx6Ú )}VlZFcR]$ <D -nc>g Vu 6$궳<lZN Cò PzC OL'y!]Xi)u.Xwa>E+h T)2k5RJB]qR.x 3$O{ʞ^^X9EYZng 9ļvA ǃ*[>};sQXz ΟsKieb E:NgzDvH Rd[}$⍠<m +Q^J̀"*#-%j|"Zhm =ɪ *] K"0)֘ lXd4\(I;ԑB *_ 俁@U>fB: uo@cv?P&(uO A>@Eh!a &AU!r]VyZY(` MQ2Ј) G"O-v89~}*wk ^?9}hƶN]|J]/Wт۳v1BRGvF`UJ ʅ/&`26TqG,C(qU:nV4[ /Uѯ˛?9=Ab?⿺ V$K}=C UЎ~AY˶8@μļ DZ klJ+ ބQD rUAA ۖB@C: ʨ oLr + ؆!tCK}[jr 7Y xHGL\JQz)E_ z]_w~f+ T#h\DF =ltOEC5v1 e 5i&+I@ ^.1?PXrRzXo1YE ]Zlu,&. (3K$->/[cWܾ1& hcۋY|5#:+ @* c#xyr)RoKX%iL^azZ6%mG>- gD4 R{Afk.4.w~ WԚ ut )hGEl64pE ;PE,L$٪(>B+_~ "i=_}tMAFBVY5j["kږ*gz<K"MP?gym-l+|9'^ ծ b>C5\"؟eDJq0!ԁ'_63vW?; DH?_ O|\u[g?sy)H " C;[ئ9+T +<WIj 8~6w&3> V ` #&*na-"kRGrJwFP&1w^ 3EF 2 _s5ћ2 RQI 4 Zͥe(W)3A!jJ4j7T"Z;\Hoj%{ rt]\w<0K/I/'ӴGh\;BPWTcH,X?#sv<|M,1Ed[ϣʉ^x&D5 /4cp+z\]OR+QDcG'sL]Q/̐˱95lh¹V;gR)^h8QnyidtUSd\+Wt: S͓<<YrU2f)%/ }h=c`aYBW72% J/hA nW< t6Rz 2Y2{#]xn>71Kt:ޠ' y: Ybȿe DW?aղEhZxS0 (<-g+ZW v0hSd|Wrޚ ΆLG_r橘M[" ^ˢ)Jq /&I~cg}4 w2q1j܂3Lgw@cA{a9]@ ҲxZ{~l ;:2cV9qm< Ƶojl+L8RRn7 ._MGm@T*h _Rַ݅W|0k V K(`NPq?3!qA!& n=GMB(l B"vV JO]fhwlQѠ 2|V0 " {D %BNr j4kJ&LQo('\@M Mwcð6yelQh=rx VNb ۹ O|4g,9'ԍ,M&E4x͂}Ћ.~g!4t c5NG 9sX3= ,9 As fo*M-'r̤虴#%$ 'vf: `:JaP0wA%8NBBm*{Q9Q *۫Ї ÛwN;n-]l9!Hjե jJҥ \3ʏ_[滍!mFeuu= |Z{ϗ1?ߌ W5ǸT4Qg190'^}AR$W/l#\uG E|dLJ:.䛲 /k2WeXJϐ?r\ 7WY s2kVU7X(Z$~ ^8Ê<^> 1V`QBU@[m,Χ~lPFUY j |& b9LcB!0DP9 WLvI+!\љ$i4ACuOյ|E8{= +uX~ v V)T Ҍ70 *V9gX8on>z6;~H WB7, Ҁ^+ z7׳[ p._d-R</|6-3.2dlͼL;"Dmrl6ځK GT5ʑ<E79oONh0tlyM%>+Re9Ӆtٽ9Դ Jg=ܹیϳ>|3Ѡ! ʴGk1i1H3 œˢ="ҐrYO4o'7\ʨcB8 LFCs+ -(ÍУ&w z۳|r̥ se^k?|6NGmeY(YA hGYb!HQ \d Wu11}?b{ר $ )'FSR(vG S!ij5!ΟxPWmOA74 ^.BLXmŹ֫V1.G@'S@wyXuaVRBs/D9ԚQ`k |opr} %V .=vK$$+mcڀB2Tw,YSnʰa)6 A3 C:}0[DC ZFgŃ m߷ۖ>TN:*W$t~ o))@6oG? Aa[P9]]A:(l8 ['`K25:EI1#c~jppJzYpk*-D.:S oF˃ށZI"_pܣQvGoBL9Tկ(UBWhB [n Ciaȍ f<Zbg.٢kS|L ܿO[ATNO D̸oN$XV]okQ$ sRqE-E14G:|~Iw( sTx80 \c _0A ΗC. ?,r#72rB4? qE@2!{_lJ[`~'Ahf`V9 >PhD$7Ş)7<(/P xG7]R/(G6靉X\:M z, .5sR&:fpn j#Zl ;'5Tfm^rvb6MRG ^A)ȧ =%P>wyI.Oېg:ױB3" s>5'F/ l`y Ʒ\'#!]M9hF ^eS7hxd}ou'PovRp/-NZ gNsYX6)IaF$dc%]K+ _vj3?_'4|.HA۠;ULysT³ uTK^U x̞REU~.*7t|w<y:%P+ f?bjr<3c- T (lnYN Yi :tMѱԧ\CEyOgmaj@EY8^c"t7| s6fw 7> AF\3pmEtI Ho 2mЋH;%aE} `]5v(_3C< Xmy),1-HT SP# ] i32( 3-F:]AQrPJe:y 7 6PI gh$膠q_clc{ecζvl:<*^"xl0wǙ\$ O 5 %ˑ->z!j9em_Q4Wr6!\yf_I5Wu^ [nJ3]-K E{8I5WWrNQ+={" rSқB瑥#TAFn5 =S ˨l9)uR;{ۢZUsLƷ8e!r/Hvj .TvRUls@cK5\xT6% cZTf V8!6pr93 ~jq'UgPNv:}9ڍ"0`SFۇU.jc/9*Tj#SH;G}Ɲ5]X w^ R:u74S?WA K,ݼ qcm?|Nfb: L{g-שJ+Й|Gno*w[[솋F25?sVK=Vd _Tގs":Jl痴m3U LS-?g}]m *ER><Zhy Mp( myZσd 1GlfB5Õ "g mޯU|Ͳ9LLX=Nr pߗBT]#m ERAZjcq&S~ZToZ= $dNm 3ٛ (9oQ@t5Ha&E]FVQ`?˅!㰙{\58 ] O;Ao Ktb.tj!UO*"ȒqB 2mnA?\=&e)6 x9T"}2Z.Ep:UavCCCh O 7m8f2H:.m x!pKFy0Kf (i6 x7^qV т@,<dK: QvVZעĪC]ȪNv1vggqfu|fܯ] c^$,xw'vNxXBi /"=&#˟" ¾;4\~(Lo1>t4*d7s,d]`V6-e;k5Zscʡ]nMOM XD g^]4,y<,UG6RVjl8hHSA"3hꔩW`mS%WѮԌvn 4.Ƅ2Wiػ D1%~PU!VpRU48,Vt|Qsk2nt@-{7xpݞkZ/%q'?U<j;%FO]<ҧP%EPMz.H ivh祄w<BGz%/G Jg2RXgԡ py+K8v@ ) ʐd+8q!ejky+# &%t<^*ē[[&SigžQD9y) UYdp'93'ybה6MMy Mw H ώ2Z8a$A4zp{͡`% 8!?דkuIm\\2*oF7bP%(Q䲖 {2IGMҩ ߈ѨoFodC(YFO2Cfq PQUӉ+W BXD4v< '}cOr4ɹ7:ŵTؗe\1<*zv B J-=$X,O<Ze@0> 5,jK s(~7W]K!) D+{K7j~alMh<Eg)-D9kuXDIQ^XWyǩJQ k-Ca C`-҇e4~3ޗ? ܗiܡݛT <F2(i0cW7ݧ:Fy| "=q/$ QHX cN;\*<炩v2.<%ĴT; ߭iq 6 ,ĉ >uCa;?pMʒa24dr2, #dx )@{Gt { Vf{ }]5,6Ms3 V'!,WÂl?JiFP v5LDaèQA <}\%<l2JD|xM \OC<{ΞW|U3U1ˬ%Feg1ck2*Ћ*wӘ!Eϣ)رj弇\ : LRdl#(CMb܆(*W|Ac1!^w. .ԍh W K6εGhN5̾gV?m.n$'$98Cl䊙؉߀V 5I(1 \Wa?k呂Z%>IF j~n UTA Sl8E' qc5i M +B?:Ds\%jr^P)n\ZRXd4gQ'-4ޚ W|W*#Gң%ձogvZlp3VL#E" =k X\@ڪ#ٚa{͓ {lA L@" y |@>Cu<:7p?H f@fYeң8?@* P˰AſݭOy7X @&o^&+(.Y j ZQ",ũ FQ0\v QKvkhy#EyZl ]4tC<FuU$NBr7La, l;L[0犩(7N鱗Ӂ-Ks 3=[7=ak.aA=,mU$%-nL,X G8Vϱ-̰xl M&I'$UML"~P)w$Rm[dS`wA66Ɖ@7Vu{H7'd MB~ՃC'x}R s@߲%{DƑwe`J,XC#$B"k#|S`282F8J,1;rw!7iHR6ԯ$/{^\t.M=Kc2ڛ Ϳ.=4v}N3q"kM'Km(_n <[CM˶gnѫN0qHT+ʴE_q Pv]uԇ!v]wz`1{CIa!9F+-y-V"X"{ۍxH"s5L5Yةt&= NfeKaLmSNEW Ҳ|@P nzd:YGſIhT.Z :)MQX {o9ǣĞPyo'x=oP# *e6ȅU[m5g8 =E%F N۶W|\o2\]vISi%J#udԠx %@Cb9vCA3\1쩇oBfhw0aT Xd'Ro+?}Rѽ:o558a1sug90̑&kYdWҭ"-8 mز|y(b2x]vR砓FʷWVhXC ihhm >wy.0۔WDO$AvvXO|Z;FTHU(><I 47QQ\ۚ`Z ) 4&*hU&*~<ugJlwn^!xobz&w4:G _ySjG{,Kx^tC݉/t]JF_ idz'%)`j,W {9\-SS.cǷ@ <]E}W9-Ft B{:.>0`D Sד&t#MSx.D)q_gz_X <3 Y VŶz /r ʗx 7\h(v^ $Y~3t_wcp H8^<Lxg%e9vpB[_N|[xӮ.A4 KO- E~cΑX_R!T,|AGݥ =h!(ץSw^$a4E6BG=2 G5<ˈ6v\ѩY( Ifvh4YK+*EБ*MۉݻZT@a#+2<A2g!! -fj VyRQۤ`,S>n,Ndųt*Z%2"?ׂ "a(:$E-6xf%&.8TrRo:w?bh7rHK=!#]|Q|3flȕ"˔ K1+)%K ʡJf^?VNիz F> xEHa z &}.dzuݍQjYCN#;x.*#e[^KuG6; +go2,^ S ӷxDC1$zMU3xW d3:po5:H/Ԏ5a:ҫ4m9ADg6ޯ25L/s ML.NF3*=S@Wf6&VwlM H8Z 듐6M(6\:(Y bTI?%I^ M/S :[s3̼_ξhR^0wN+rMꂥ#摧'<ȁp)79 c*nж)̽3˝rD[P6U+;i 5&~P5ima< Y|JNJ aӺ9ݖp>Wk ݜ]h_bf6ŤhEؖvXo:Tx\%})" E$;I_Զ ҽX 2m<c^Np_&Ix '-O[=T uF` 6$y̦#2ܲ7SIHJB(k8].qb F\z!}j](w֟J |ټK,rE/Q6tY[p{'Y:M%?ϕAl˨ȱ[;$[&>=<.4pR X >Av[U=cH WXrR$) z Rr b?B ܭt Z]j{Lc\槠ur30MCwhښ',XP]፴24qr d Ć`Dy TL^L7.cI.bȜJ^C0, 5?" g _%Qk獉ViT __쒕>PL[v6ކ}7P8:=K)w`8j|?-[wY/@2f G L7FPsS^^klJjf༿pQ˦ UWh3_jbG rG*7k0?(LV0mWdi٠ևuX4< jD c% $S~'"j^Oe % T[ & odd'b*8"cƝi= r~ b6/j;#X_ M !T|߉Yt`|B5.J*"Aɿӷå--˕ /1++I5P b13jOs"W1)a슗l;M&Ĩ b]OįU= 7lg6'/sl:+/90 uC;.%Z&o}b꿀u4p~,5!b1 ogB Bq;߫ [P<E@44SY,xlS`&qF'fY=ϼpF|(pJb;^`T_b! |^!OjY{}|Tu W{ ¨\-b'Evy︉A$Vt=m.Ns+ z%|ch`!SJ_ i]R`PDxXrQRt/~ZفGmyIDW(ց~:}=!6P Ժ f6r l+^o?}D 3Jby J6-VmcE: B7y>8@^prA gn_`(P> K {4Vu`=*^ f6")d;^xH`9XSV|V:'9&~5LiVkP,<MBITefj9)uGN9GsZt폻 Z!\ aH*x ^1G3i)lUKÅW n<i+HS@!jPpMt SUU?WM7T\l@])O/QBvΆl{XQQZ52 Ľ6Gk m" hx}Q+)&+ɃIL AԪW| h_0Ҟ~+ 3)B$r_+Ft#,1CO_L9pJ&@Kp54afÇ)&e5PR ͋<{ ,wi9 b.M-,cW34 ıז*RkK5jo)A;᎔E^5xlh%4 IOoswDks趦}# P3")r]) pBd軛a 3]cVR{?-L xt\K, fol>02b B(?sE q2fx RϮx&ȍ̅!yp8-ӎ~1| (aƢۛ } YoA;N3 Z'w#$ miT~VF&h|,ya^j?ksyͽ; 2kO@(E Qg ΠH? _3cn# F>ƣRot <8lnY:* IEtEf3iɨYsfR }lP, N+tgULaeQtJ͑tbn Q%*֦8QiXrh{,"Dt48a #vynIU%Tt #UueM tZڡc2F2Df#c:$8&z.bkPPY!'mR -3ׁY-9`o3VV,RW T{fleG/ !Ύy 1MPM%Wߖ$딘jis.r fS58KF?P0jP% 4MLy&o գGp(5h$ %|Sv>i6-蘚ȏ-RcFCxX|/EM/}g]+ysu,ǾVMWC0 t(e_nnU(Ǎ< j3{de*셏GKŲPCb~"Է[ycv^)IM~hz"Y? I{ '*ɴI/rPG*Oi6+o{ nW A|Pݣ+DXOO.{(& ]tg; Z{|#x5d3f>ҍpDĖx |l6 W EXh}tNFYrC8Մr`^ԝ(?Xr @ʒN&mr wp/C8/8]J;͞ Q#0ˊH !W=l;0a*0X 5!o\Vũ?'(}iLdL5TXr"E;A'F-7< tx;Q5H)A2BӨ샇wyUz !Jś*8["~@ !mRwUr3W\O.8 v|Ȫ|aȖhJ^=HDBT}9 u fBBB~Tj-}+HWIhL<yz^a;>8(SHz>Yl .p lbЈ x[{]EИbG4J $ <V6F0iÑD][! -Ws} l»u'/Zǖ'ژZeIr(Nr<B<K8pfk@nc9 wV<UrN I >w3\A Uv6!==$TEE^=f B@ W\iWmea@ tw+ H~dLiV93J\1Iƃ32yM08[¾uA7^çFM eɊm x"Pq3Pf:.Q@f,m;W`ӨGٿ M?BAj1XN9ן?&mYe[Վ@=ӣFɜGarEKG+Ϸ*8_ξE f `ߝwߑt.G_ ,Q3zrLMk$췣"$!d;ӚU2{c[ft`p^?d;t4 V7Kpg ܯFAnVt /?tn_50 g^}3J5.<"c6vI3G ,UE' 퀒ݺr.S|&m.TKl.$+d Sʦ;Ä@>um2勾ٛ%@_XrzvVXX Ez~@Z@H#Xm<iHeA 7@}hJylm~U~ݻ|Bq (*3r#P[q^3# L")ۦb2WN ժM x <]{e^[W^' -y&+)%JׯU] E :Hզ+|KHŏg֏1y l܇#ԾМ~Cv9R)'9k`G) OI妧)ZÍTxJVWXLd7%*jn We.A ]IJ~.V 2p(1AE rVVv{bQX j,5i1x"<0ϡmR '")sri V~Nw1l/+q M4 C*^?` v "`I Jv7<c } ҝK|K~aرDHvܣɅC ?H<FB5<;C:'KG-Gt`qXUeӵa}(2K]ˈ0e\hVLod9J!OdbV۫RC4g&7;zxZJUhM== ]wl6%v(~3(;`UA𡗿6^f B&GLvo6֎|L!U(MPN ݞ(c>Y q 僖9~.#s"~G_ | 5Ր%u6aii' f!x ,?*}iV R!$i!X̳ < y+C_6ܿ= [a"Jeb SN,Q$ xek(S6yoD ;k?zݹqDZZ=Q/fhxfkS $n xTv _6fzQFÊ-[nwJ-TAC6v x3H n"LNz/H :C2;Y-$b .FsřgoF@ 덙 ̺t{>$Z_9瞀\0)SV6z;m~.IkL ӌUӇɒaZ%43 5^a\|yy{mDx;yWj5YќnKS ^NJcv k<saņ6//j]sXW dl*섩~ :jM뵧;NQ08,%- |iMw&M X1ȅp%xS1$TG^Ntp>d&1*I5M7lk.Ǹ:GR WQB4X8KaUI;T_pa{+ سN\?a)nsu*dJZd=(ϪHpS Ri,2OH/:Cm=9Nj'F^ lY~ fwÎՇ ̀ eٗbZtu<)zA6mykȤz,+ Xь :W|ZvL{ E<~ Hl*Z(kݑUБ1#HsU2Wf2. Ubi.s}r |m?*:B Iľus#{ȍsͥ"8f4cQ 8| f1] o-TH(hW[١i>`jq9!аl":OMO)hHى0)#ZV2nWRwYN=q4-tw.1[gsG07iw{cJxX' |ν/ 11UT r (w)) |@J>wGg<YV1Cy6|9_qgu&j-@p0pi(vy\O \Z d@X mY`T3a)(VdzٚtK$q*c1hs,ggX÷X(Dx_z?<Y0AqZow~ 4YG) tG'g!=:ub nD2ޤ;((HG9)yN@,_HHv h}4vҹ[ k8 ǂ79fѧ[cYo,GLy%VX? *e W= u)gI{"9d: "℟wOX U _D|iY7/?`/_0>s\NfP/0 7IKV7!ݰ{> 8<bHvTmn{~Oѧ1?G{d䑊m k.^9p4S)ZC => Pz5S} +DxPoq` ³MҞFsRĮE Ǣ &1F d>9ZFVBP#l(+# ?FMo!bioVˋK8o翧]-VsS^hfñUOe<~jZ 9{W^ T|j^ `јCiviJtn'CIDn{6ǪW_PudĐlK:s!FnQKQluNF"̸Ik 'T|aH6\Ե)*6k);6 vrJ_ 2G1 EW0pljg18x Fh<K0/tcneË́; ҈ē%&0+zY O(ЎB|ނȔ_Ld_Û '\' RclP&OMm2F{57I7R VN]c={ӟNz7'C{ HN?Oѯ2Y uzdfO} whʑA~_īU|4"|8 /::0LNK. |̴a)k j}jhb-ESz(^Ǟvz 9 Xǐ},wb?PT|nSZy3J_zov F,aru^?ԧqu ^AH 9hJ1. $ heF8*_3D݁*Xll{f,2Zr) ,F*CBeǒhXQMd\"HĺuǙDU⅂Uc%( 3`Nj&mp+P?V*f\Yz=;!)MO'%EM>Y_c(Kcdn^ X7q,~3 9n9-T]pQf*C(q F؝Y Ey!+*SԲ+#:n/ 1BeѶO~+> dlVL)w/ g1hO͑/4GLlJu2 S2Ot;<)J(P5=-US_粞PVS RFF? * Cz$^#Vb$OkS)Voآ3 ZfoLPgaqd}1Fľߪ'u j"6,f,G.xۖ l>LL0 ^qu-^ԈFcA0KJ ~a \HɃ sܴq:`S2-1Z\NcEB_a.:5z\sxŷ4\ >ƽܶUjf] -?[b'J*#.kHHItLUcƍe\+ͯ\9x]Lt YpYW7ywX!augGWo*4~!o ^y-!'嶹}n/ ;<YF3%NxJWʧv~jt/$s-"_eEpbcƍ3F/qe}vSٴ%K(}DcGԺ"b;y *يҔӤm w @TIu 0eЭ%GgX4ۇ['ZAQ=]GɵE* k9h* 8 ?"sqL8 Jhg_N8 jxu^74]&b䉫' U`]àeDCrg>LP,Qeu1 f*3ۧ(,7{e-wvy}A/>}IW Fz I2Ly6^l+xն-{i \:Ӵy,*0TNcfBk=BWc] A0gF#阂ݹv# eSUk ND%i`." % 9Ln'8k K\oRʼnߥ5[\R5rUZ%ɣιvЗ Yj%oK:w~EU`O.v'F+iS0T ߀ #0}8X =v'ۤbo BbFS xxe}9SQvsGgsmH#7OyXz*hkiCP Q7WW(:=`c s}̯c C: 5.ɀE|pNO()- YNS%apGGx0g *)/4@d LXvtƪ%Z(uL!!)oEk^(0T6%p Z e ?ySt4TZ ?v;?ㅰ ]NBi츜73:] BJď:&dar"v^)`TF ޝA8#\ޑ+F c /i bpk@jտk8T.FA%1 !=4ˏ/}d9E笗1iFbБE\2po KrVyhhq+\BT., 5Q =i:^%yZ{1;l9KM?w60 'h%y,d@H:ɠI dH iCWW^lqPaoTR:g^:i!ipbzt7+JS6T8$㛕âEbo6bb52 zQɊNdֻةC<(Fk0k AĒ1W\ X }+n\^ 4D'Lo|ˉ @qQr"}/ģ.P$n'zG-ܱC &-c!?@_!6 F*6pi$ f*Q;lAd[|dU^b3aL"ƾ|f+]}*& [^kG~B.\wK\@nof&BDx:{@ֶz3 ۬)/wsd~p*8 j/W} S%@t! O}kK]#)4Uzo[vVJ@ PR9JRۚJv c(y_BB$ib! ]I״7S$t_OD %eM*MP~3AT!{ `D fU:4.G'1P;6H&c3ꉙ ?E?2.!n v+Y|MVβz 5j]{#H. l 'oh*!jTXwNOV^),4:ƀ? /*,NpOZGA˖_[KD IAw·=ږZgpB~-ϝD';v2 s0|4zn`iyԪH ]]@lA"1 H<5B+r) u{=VEF!wF=K(.gAŧi @^"n(@tb 9hKKKk3"ьfwZ+ghLG.keDdah@ U I=gx]t^ $u:s)\ּ=bS:F !{J )6q''ӕ;_l긹NHh`\A3F˨ã 4B ~2 ֮cDrOG+'y0]h'[Rx$@G<dp`~;t{c.EeZD8҄=r~ 4pxF vr 瓊rL#Z. {A&F,c%h]k ΉG ~3 .L%%N'DOlh)] -[dLsc!N[ Zh{5|L*{ W2bWT TdxHFM_VPqڹa8l=]GtE# }cX%MD(i|// Cx^"#HgG:k5hg£H<SUp&5 nXrpeGڜO|%Tj&ۍEtDƨmCE~F% teݫܪV`JgzM<.2m;hL#gp"엇k~XI8A00jԚ{AY|xz/1g C鐻bjVW0E;T}Q-ZL);~ Έv L0ϏMjjj ~-g%v=̙I<.eK ]|<njD| nDL%aJ2G~읔ig6Ԙd %)#~$8cg>q'W>VLx±Q .QqynMᐡ»i3K +F]͒v?\Z0(7þ6I0 05' I[x v˶"`2Oݟ4#PFȗ~f[엑v6@Sڷ ~7)F1jDG Da R`a.{GH=xyDmFA⩽+)a^S>7"jvU:z;yaZ|l"`0 E.,t 9>p`+W}i:]dF !md)FH\4cyx_ rt' 㤋bRj(/G9yG+ܷW8>T|ʮ9eIr8ϥ(; %[w 5P9= SB7"M~$g_,@(2[$] "W t61|Y9oَ 27gIL3$9ea ji )o4@}Y `a$DJe+pn^^ 1 l`Ë*b_ilMȁSV:\47|"ݎA ^AzK aozdh'5d"b>іDzI|k `ʙ I uQgS<̔e =hUlW#%_OdB":@L~RoV K w!SfSj[8Jgب@{SvDe t qp rt s,{+ 5[O\Fp*ZT }PrMЍyV0 i%pQ^?'s ' ^}QQyUK$l8ǒpS°C3(.8\iw*3s@Xr {bVd~v8݆pL! H(a"c=edEQ"#ć!:=[BQ. vN>> 1TeQ I=q! Dǔ x0z,1KNVJ##pl7J\ˤk ^31PU 4 },>u!2 j 6,s"(VY)LsȜ;~3;ȭٸyW)7; DDrwM{0cuc 4j!m`Rگ|./3hƢY; '[?ٳp~˥?M"|\(ɺ[>4@~,hX0ձu`zhBt8nrz>KYhܮ;䎁dz;VAd, jE5Ho+= C֬f F3<.#" ] N }^+Ft"C _P1g}'q>ZR|qQdjZGC Z$ 9]<TKL*oO `WVcIHУqd"nt,XіI W J; &E[ yx*ԝ<¤Ybߦ\ͦj B V ~d:6jzzQ1>l "Ź{>M|x%GbLͰ"ώ+6s3VF4wcU=ܪ .iYhFٗ^bcԹ)$6z yVNCLWMۻ̝|X'urϸO+voS9L6l:ߊ{{9 f1ew!sm$apJl^;<RK2N S6Qf9dn9W_v_ؐJ~@Cl2ԩ_%u䮏l朎E B#=M<}u$^1Q'`Y>%eN̕/n28At+aL/+A m|+GL'dW]2= /KᣋLigy5ؒCtbjH+U䙏ޮ Jcv*;@ϜpPLmMG"dOɞe@MDV !qhx0MxgeI.[{?ӥU?i=d*եjdꙺJE9~6]{ H4`m ZCf O f vH2Uk_ľ즎GWa#9:M$06O1}z2z(V# דfB|$9c'C囇U+yYv`&Op κ=I"hؙo&dHz ,N Uo Y So*2:I}8LSsr~*+U5\@H)"]VIM~ gh?2C r4 @<`qbI:/lHwq G * V6w @n`YQPoG YlApW}ۙSE|8҉]7.=_>l($ apPބi=b}x{4؝mF-ŹwL ά%M\ d( c_6m@zF'c̊1 [u7%t)MپeWjU|, ~ GK??Tlei 76[]@4bh~& (vJ I+ .w5p=/ Oj\ p|ϱ C_`ϟVزytI8> |T{$/bRX9fj1 (JRuщGY `FƂ|-TMlti: 8?8f\ nE6i':(P\UFÒWiޭڹ3 VcAUq{0q Vr_א%;]xDRkRY} u?nl>ph柮l 1h18䙦6iKM3$ ;WhSI Z9q.gĖIfwcLkDž=<u\ЙKI-Z*u(+(i^[",G $) PEwߑT^?(ݱܚxhk| _Ms1dr5y43?BCU% X 5I}9Gp'vEXgۡG4l[kK/Mc\6}ǦfzÁV (B)0 P4` \%C:/v݈`irO)z} j)_P2e *oeW篢 z / &wg;:ΪLM_Δ877~te=]u:NZhޓu&^ݡ~{J7]k=L sq%Q U_:?H?ׄs0czfV` [ڿj ;_/NTo H}5HI/`Vo%&4Y@hP {A.`(aWkӈ韌@^% A!ȣ}|\c̀~( bA) ip8kuwt26 MwǸ_v5%ș]5gz |,dfx?Ǫ|7~oQ߫gͿ !~?Y[y.L?._ iO ȇûKydPVřNųåțdl 8ywmYLs1j3^Nτ S3Ζͼ0Yc#pUgd2OuПb= &^ZiU_89 -H|zGMByg^hNU8 3/}:C{K (w>iG/4Lh(NոYG%=1-D#U¹Cx)QG`kS_V܁5 {܊$3ڙrt KTe|^ 0q#k%3;(ր`j_h 50&x4 B< [̂= ޭ u>M /X˜g}xVy9C\<^+6<dfkrgtN/=ak\63b0A=d Djz3ٌ#]ko=hdKn '0LV5Cr4?^zDI"O [\زT8QwQ/ eNBKn|c . Q71C%N*tM =Fm~4V6dI NcSw!zrݺ>-| [x9L1[k`z!-{:l Hh弬#GHQ^j}?Y K%"}I42rQNS)O{PyU,WCE: ϯU{1; b:_ZՔH s -,@g[} J>>LD+Jv> ~Wj [KY !Wr I2)x1C ZA^akI=M*:I\Qpt§OQ>lZr riRGaRFv шy}VG{20{ kŠIB@x$##_M)Q>M9b=r Ǣ[RUt)u(cw8QH"/z8% r@|u3,֏Q Ɓ^4)A'ؖaPH t [7AC9.N$kkmo܈/NpjQI>k7dgi.BF*fi GɃ(NX S]3"/r{>]3X-+)ō1 O$+{ cf )m| HR>jtI^UB"Qs'R,ܰg[ U1 , t\KX48c"q4gU)$0* ,mf%J`ڞ^Z^ %3MabO*" ! ;jH~Jde1"M08!6X!+@ i*R1Qi^ jMNgixE䘫 oEC4Q87[J+3gוЄ5 JO矕88l :-(p _ejN^'9uN(m TFtobOJoGsϭu> c``~5CJ6! ~}_.xL6gńEưsD9⃕3D--A(ӃVY' txRC\9P&Dx|1=78J/.O&XZ[6ݷs075nx%dзq^`!onڳw2ݽ uxox䷩$7k1t^攒vίj^`+ |U>\vr!@ fD gˠe&м2o(Qh}wԌuf;ަ&VckY xK&DbFJ'Vh#d V:uA^+^nޣ!>z6srp ܅i XEI}Ф $+5MY9\ ?a( Ts<jAm4Zjk`E5tҙ3uŹ,K@.D\x6jJF] O;Ϳpi!J?4 ڎ$buiC j;( 1z|DХ!eX ?I.J ,dio\6_-EeDŽlI "'1C {+1ܥT8AkuA amGL/`PVL(^ x>A^546 n͉9=wYw2/ޏQ}G#sPv#&aVz {Pb[ gIԭkUgNmu}P%{D=2`51* ϧ(9ɉ~U&J\D:}O%Ai M1AYl*-4O1Ð4yEOtzB@\W7>{gg]ÜXqף: Gxt28|^Wf6cI(J*)zžT '4Є} Foԇc&5D!kMX=gX^|:?F{P]V !{Tqfj0Aj_/ ^R`B[1֛t-tWi K QqiX i܅k mgR < 1n":>-33. vn<i+Dd; |yv\̀A#{-) 4) Ɉ'~٥9F_ C$M?; ֮y5B$lYҕ go^nWEkCc yn ƪB68e Gݛx l' )26'<A' m ! ;vFw9Fr~YC Df êD|Y(lΤ秏'j;#xF Gςy.":Η KNIJ ug)["/S(JƔ!߂ qݭ0C) ~u&t;{z> Y۵QeK.Qk5v+𧈋|+.p ENIp ăꜪdyAeCƋ7s,({Y ! "mx]Ќ uyok~Trg<< ʊ 4z P"dva_(WQ:`$wA-YVP*-UB zwk29)4@ï5!Q^w[}iT; Qo$rÀ6$q:*$BF0j0 6%v( ^3]&rx{Ñy$$jI "> b}S4o c84fVdN$g >9PmwBib2UH0s7K:tX(]K!ZqT\ L G9q#L(3 O UVKb 8h<Sr๛b[FoH 0T2Z,N#k#47d^9>jm m#kY&P6fk 8@ UǴe3OuF2SH@ uj{ y@+R`mV5j\lX|[,uI<1ȯu &fѢ_W8P[mjc' Ss.z' T90E<$o?V& 樹519Wƙ㚮k٨M* 5C,'D@,>B&2.3b@HҾ F?ٗk&H-gR#;}b{>tѾjFm`+6St)w`XB9¯om6朊Xm;D#^XT_m:;0yאZ5UWC1Ҁ[Y{`;zQJt xo;HT }H_wGM04ߎȧ N~])Vpn2 E(]ҚfEX;7:\R2 y e8Kޒ<f# RnV::d 6I`飛Py3yu="v i'm.> KO (ɶ I b 3F2}ءkS%.pv 3 b9CލQ5Z-Ph/@ [ܟf^,0yQoO)'|g^QU}&us щ V v`|Y O<(릘\N mR:;@4`7`> H g7OښPǻ`w"iW 3k{}\*):W4m6HA~<O ,o듔vd}|Ba~ؐ):aoL[d<!'|ztZhg%X d]g|jJ<晩] /QP&rn*I9>E0 ?dL5qh{6E)BגtL6^RHY]1ũ5[l8ʲ`,#8 y ZX,[ݞ0 (,k,Eb/\BP>k(y tQu1'o4~ =Q} rKeF[ӑu`,1U>X6Cl% 8q5H oeJ KɚQr9,LZ^Y5i $|Q+!Y c,|JƊW[FiOW\'>2>f{4J] +:}Q gENa9 _ar;c!OEY+=\On <m=sJ16,B 䲷wfIĞ].cXegެ#WbCp<q-d `ƻ3 7|{`*ǧm&-R_- ξb E(" O& =I/tekO1&f$ 95^ f 7|wr8 R ڢP玸{{NѦ#+%x4b }cd (~seˍ' gy>*-B-o^P9慎y^JfϲB([2 Nj *#%ǒM5 \ =F~\ ],9qWc'i$#s1Zp~q x6Un4n:9!3{q$`Pr@YԎ͓ZHL )>N+fmeeHƏH#yѬ ÑͳǪb3pȤ~}#۷/f)THG(RѦ+ήm4|tjу*͞&S17 06E.~p D5Բ#4ʐUڻK)#1@% W\zkܖǀ)>jʼhP哕e3] ·"_=k5`I,CJ NzTp 7S@\3VI]QIDޓf< >!Qc5Dl=GFsu]n3 85hY.CpY|L jj侳,lt+]q,BHE?j[-KCc明tq(8vT'9 \<k+2)`W]"k8-rEʽS|M]兜0/#jDfI2d4v`xwhRd1k |aG.ȃ;AcUz+.oR.O vj6=ˍߝ{ D3q0?03Yr2te ? ΦRjwe1ףJx(& 6,|&Fw;'~8Ufe%Fft2*̟AcQ1 ` fM;wI p/#|#7LQPCjf%NGL-)]yMS3YN``AU qGZ 8ņϗ Yw}G KkAV,{3C^Duy'4G Ymm!T[h4Au( Mc<j# kX &q !N}_4v(J(j*U73i9I6/b A&+`4>3^HP1 LL# ;R j)<7\ :q=Jf[B 'QLfڞ-RY|ʯȿP7 \1jIb 3V dZ)GJ5| ƭpP<(W=T :.;)hTuln%Rp y 1J`K=x1K.f?,Ay,ip*ϛyzt0/ "i%~/q1;`2EKN=)H棷H8G1(Ͷ4aL[9^fB5xD6t;W_ P-V@&/ZK%m;=n PT\w ֣I&ߧ0lE9A, E;SY()%@Q~pr%y{xO}ɋ5-Fb:?!*eLs߱VlDӰ!; *M|mxՅx(dNv8o@8T;7Mn/,?w}VX?%8$A:'FlN.V[:t. *88h #$& s2}RiCT-^=45&._#31QQ% ~ LVdZ4 jDs!?$b5b>cB\= 7:}kbM|7Zt |h?ĩtPOތaǩNrdF,NnUmܮԥ79]g j嶢m0gt Mˎ+`r$N )[丏'rW4mwoƒ _ gT{2}~rT^{iua Gm.+Àsk unUJ-{{E6ޱH 3Țhɗ_h \~\ v&5/_INvfUDQgܔͭd \斉 b AEJ6`Qk~~wwkTeBX *`cOTC}3 7l],7HXϊ j:v ʎ{6οTK-R-eZ]*"K[oJ6pvܑ!H4֏A`yn6 >P6B k#YP7aPS{8l&Akh]FB2RyK'dLy%TW$.a~fsJ}uA 0 Dy t"0[MJXeKf ᷆*]" D]C䣱Ɂ} ldtF9M"^m5 WSTfmG m/Pe6^)Y 2%sJϹr` ;)zZ"Ӛ $o=rr3f}K^w⏸S" r3o(n#kh}ugܿF\:г59XL{ob"`)sXd= T=}95X&AJ2!oE%o viO///3;h!?jQcr Xi7+oÚD44C? s8Q1A{+|py`~4Ͼ _ڭ 8pE39C$ JmDh&|< C6wL!ˆI1\`k{qto)؉*(yZt+dB 0P66!_A ^NڍdG1 Eމb[TKwҳЖX̐ ~39 `uKRemRzw'[t 67x.긃#4<l2Y;9͓,n 哘Yީ3k/ HZAn9BI'Y}`LkCD!u5֜6@2T]ʮ}):ӦozG ^GjEJ~ k !;} fG 舥 C6";`E0)[#yI-Qc B yC?\ }83@l;͍BT5 w0OohEg=Cv_XwDl`x!%ypV{YeK(hk4h(bBY ><hj| jDd)AqgjH/AbYx&ڭ] CN;+,9 LxXO/0 W(fRe`$@pCAڢ. ? I5⚜jZVNS[~J7p) ajYlB$ j%F&JO/~%K֔: sz颴>V! 6,lPX JZ ӖkhDZ34|Z=tT3gI- fXY#8ÓQ%TC㊕pRū XD$ =Ad{h =|l ԊtxNm$?40vY]WwG#xh0|LAji&Ne fW I#3B0pR-xaW9XSG8D⦅Vh1y- #D(1ssk<DU rn&]˩%?zn<7ˑgڱz "&hXp"T*X{ \JwobMm}RxފE}@,YޅͦRLBϧdxRHxVr%W6HX <H22w;Ӈ!g `>]YܲZpZO۾g;<a >fPfbsϊE 8d/ϵ"WE TF<`sOHN5bct$×6@Ä<}}>m$.M*e {sX:ϹI ( 6㲟-= LfY<p&ph$O,d?On )b)2^l_xGD$ke0A1 o@|g%YR9f 7j憯{dHպ[MvMWb2 WD>a vu =9Nw5 T&%>a&qh'& B ' ΠC ]YU\`נ F,ekzn|t2L)ƫpCub& <b}dlLQ|aE~죅4=|c7A,%pk %s$iއBDfviw!ݦ)~ [T MȗbX}zx,5 휤vxʀ 9/؞ ő@"2p j- <nU 鋱+Y(@U2ľasqkѠGn>( J2֊+Gf2㥱m 44:d KU:va;" sӸ}|Ǔ/ph#4öutnƠ9@C[,phDI0 IV]P`E]Ev`rG,1GԥLd )dCBSBq J(nk2G"<[<U!/=59@QNeۅ슟V~ u:}ى D<XI%2MuڏP}[ui<̙w>@Qcm$32Nj< -)Sw!X.iy*pVa?ɬ6RٚjS~3 PЬمe?.}z$ ԩnWdvS "}Nj4AqWjr"ҩOrǑ3&K m S氤8Okm>*%nS 6j: V=$khM=ڕrA1S{+* Rl* NqSP%u]ex3T4&0h* <: j|Gjrs^!8 ( m jE)C " G貢a:`Ux$ e&a Q#A_J?jD@/tQ3&g]s v?eku בBيzQ7 ;:\8P&) AH4&J"tWjh(t]z!PfYOs: )^Ij1:|eʜ'͛ ̲1daKTn+ax36E^(xC L}NZ8 E|: \PXQ r[`Tɞܭ'txt[/-v }'< !/.:~y M!7ޙ_ZOrmtI?WQ[Gqne e M7gtdR,p[?'c^a&8d; 6jI8 UZ<ячh& 㺏q=.|`l!hFKY}x6 )w6ΰZLT$zy4f_},_i",Hr &b ܦ> 9ƺJ(4w( )PHoDKm. $Mʜ` V*.E.?\\FQHAQ GuK YJLs l t976n@w|xE贈p )!E{x1(>7Rkr ;ꕏR6ղѠ 8513/yA6!2`$mI^ɖ2^|ry"-d \}Dœ.Դ spwv:f˛C7k}o<Uʖގ) .ͣׄt@GͲI+rV6myEI\ _i 6ZG.yn٬Vi2@Ǵzx?d `/?c@R >MMa\Z#l'ᔹ)#ԟ24'YTrn[{m8W6Pd~l Y8V?p[Zm-?JC0W| ۈo"n vZOtXũR 6^AcDS gZ+R#_fG 6Dniy!SэL/4(oEby4<# |qXD6(*>/ЌJKuv /nh66]"B^"e)HTM`}ZGn?`V iJQu &%H;+vܞ3ŬLDUz427?t Xp ;O 2xFfdnXB/; A^p# 3/#@ =.`XlNKGX_ǥ{Z]n\t}I]NM|-(уFh2 ~kP8[qicx' :i,oB5YuLn-5524hKI电aD5)`n0"r :%l)ĭVp /\-06$YiVQ0A +SDY32k0;9PN/$O0AOC bjT\\ +nֈD{nѽ2Ug K yD|umt$_GJj3&h-!rnPFͻ P _LM0% _~_(YN.wMEqq(`髱9 Dxc۩T9Xu;0_D ŨD\$E"Ƌ,,%n ^' 1 ۊ6̱XH> @%fO8 t UQ-#SρJ83$TE+_l91{!ا?F ^5+ 2g ēB Vâ//0(4\*p^,G5G & /x.q IOvw֛"?M*UE#@p>i'v;zA@YEعhS/I?4eι8/BY*|F:N^p&R46TX;5_,t/53)HL\AL'ؽTmBQU(1Ŵ-/ΊwD vQT6sXI OsQT N: n}мX`>Kw]dT8V"c)"Wۉ-{bJW,ۊwΉ!0F1ohoKun?ܘE xA>( ΓH&& yٙ fM }/vݟT-'us sQ' vs1Nj0 䋈zKrc 0ۿܘ%-$3'.8 j]Y8a?D<Om}wk?9pIC" fJd#K TuC$"&1a7QD8˴ľ3z( /ȋz{xxH 7ԙ/`3| fL",d SVy^F£Zx;8e@NBt2S >^«rhA܈Aw4#QV!+,cZ`֦"5 X? l} Xdl :[v2~ |'7= 5Y|RrhZIp<hOXWw ]@";*w4~Ĵi^ ;oGSlH姣iEt XQ*<~ˤ.w-FM7[Oȗ M4°6VɠI`T`T yBEUU_jJu*f 9ʱs ge<&glpJQ*[fqަtT\A{=Zz2c4 l}XQB в_4WMX#@-ݠnѰ !y;$<vځ )"MsOШ&Gyޯ[7v8'*y\ *]GƠ z?=M p|(`]"A(gpM>Xqx#/r Y}nE6Sʎ<4جtjZ-S[9tp*RvT #pw Ia73*95X AdG(h c1Gh<f.#^^L'Z\zi&Y5f/9<uֆn"y1!өvɒH%XdQ1ֻ)q IA?.\Jf,>jC7Gv8"Vz$IXIAPz їH>0^3 ,w-S||&_f, KcG!2 ΐJC09Z6Wu6wvzUŔh9W $]By~XC?.ϸRSOH(C[-Hp%X %YH J` 5* a w j zQ\52jxh)ј<K$n$RzU(' ZHg ѿ 6Նok#<0fxRmW|1ZG(BjVIt( ʿp+NkTzʯK^_p.&m2=]JإڗWasFzz[Ys^u= *mb3c#S8& 2g0{q}Z#gj&bFDMer &! :'H{eԚbai{/(ƣ1ܨ+ ۘAݍI+e =0+ . A:P ut=\Xh*Qi jg| q 䣧:b)Mmyu/ p7 e~B '7O'괨QK1 e6HJ2`k4 fCtq%z-wV\"4[ӦJ/Pǜ6&>~n =^ zn#&zbhYMX i1y` \Rge ݥ:O RA糯^:)>в-K,ӧWR]I!o*l#xsp5l[A9#".x{i ~|$HeKl =^@G`ݘ{WKlR/q#(xc NkH W 0Q}KG"wdfX3ڴ=l>*;L}N5z;?l/5 /R}E獁njϘ>eYFתmh @ %ٕGH齇q@ !.` Ѐ gN].`h'^h ӵ3Dƺ;$dpTYomϝpLja,zN@Ǯ&@x5} m||/9h~乡#iҹx`% vJ' ® `ߥQްhgСq|l O< kͅO꧄2x0b<ґB1<_;$st(&柄#9#h**C!ז]p?e "MERo2 3/N`C3PNG R3ۄL麏&FTmhKW zvI%G9geW2 GsJmev@dB<--:G9G$<dy<HYZO'nAB|Lʫx?k2 &TP3:os.:%N_-q)oK]Yc6BkH QUzo WgPY>ބދmIF*c\ρ=JsbGAZP >kyNrg562Ÿ[ 2~G4vY2*iȦY [fT 1/+ 1~&kWH =AhcŤ>t25MAEG9+Jɜ:{3Q̮?}Yq7*;@ ] aa2>Q43! ѮPkc`#Ŵ gk@*p6zU/Vu( UUR 6f"M-ŖxkU|ǘpILzF :vhfҁmQ4쯥\ 0Un# ' |U@#O(XX 0 6b r)GVK=xQ|NǵV6p5V'(78ZR,#R \ء "c vD-? A9{lʧ0O4YGur'SS K<OD_͝vf ez|]v2˧4%Eȫǯ*zdEyM\7k<Ħx2k0KM^Zźa}.Ar&M< V \iЄs{>D P1@yrM -}YVPXf~<qdp`JF+P#8˷Zwc "K@!ǝ1rvz~< $vSp_`{U+ ~B&Z=9EfFJ*LUN?ળ+_l g%/ni-q]*_7 ҲWf(Ypwg~bTGm?|UߨQ)+CkLGCu/Qc^m?)ͳ f]*3C"{lɯQ'?a>4%㭖,6S7M7w?M#I̸%jɓ(L?eKTHey>'d }*l֙՞fFMvX[ &{'d6eQ6tӗWa~i*Sl;Aa{s86 ,} N(8RYh);Țb1Qgrƈ#6ʽ q"v)xX'ųf <Փz3џ 7%VxB0 v33CNԝCt "F3,:jWvHH( PVԅMKi;-RaWklQNG2Ctʎ0l',.{ + JjF@b+ǼDŦ8H.u l5igяn7，7hpʋ40.efNy8d#~Ch^p㖉;gFGip>ɍ?BwM{k6|W`4&$I"]aዽst\{;S% uHh`/rCaɨŶp64R~l vӒ9\0A Cb觱6f\H`[L?K9Щfaiq@OW _]xT.HTܢ/\јٴq-e!Vy^N(^bJ-mԊ=Ske#Q- fjCY[F#h7'@`*EώQLY7\,?R7ĦW(.F}6l3nʤC;O le_m4c!3.obux̭miɖ?uG~ҙ AbkZY3PM8(?:ǖVce}B. Z@@hюOOۓX9aq) Fd/+[<#PP S6 )(ֿ̊>fx^50ohguCvXߛ~kU$DEKa[ 3=#[ q")Pc<.n'[9"4( iYU8@Y)myZ:;LoH<pPZ;eMB AWǚmZD Q p2Y"W@:yWfSY*K]k̺ (¿ ^,f9Z;-yD. 9y_0nFﱯ <?^Hif~|KI$UpT]52>uOF{9E|ٲQګ|Ӊ˝UKr2`txF|(V!̊ba7Z84KX)x5VD~ zvkj(-L4X,}Z 3|⠖da6[ VrfCʹ oiO3HYzv~! 22 9cz!YyS-)rMv&<\^BgnwKL =H ɴaGVe[ }@v[7 "}5қͬ%҂qHF ͺmU"cEkBaןVdKU1S֓qۘ ~3 1S>ڂk(ZϨ^O}~& -QvXM"j -N )鯄%7~+M5&+nnIHpEQ'ʞ (8T\Vey Ay@ϑ )rE6 Ys,.:VP[m `;V6X,U%"O; IFg@ucDBZwMm!О P7QC8y'{p F*Dt0xݳkdL%NJv;Bj7=(,0ur+ !30} <n7\Y_HtfKXwٜXa/:%ZCkK2c:)=bzx#z^4WytZd Py>6KpR 8-2%w W_R6 kI[pJT/c`I[_@t&E -bBn,y>r B `²Zo" 4RD?pj<U<WGv :imuC6 h~ ({Qj O+Y /c Fb3V /nL N3Y4T*H~/j6*E.Vz+PJ{_8} #%K2HYGZ؞g9pZ_Uٴ EVZB@ 3}N$aNcyCV WK<@(CSV6ۏ8ǀɧI,5v1N Y-pvn(ۙ64 J5V<|T}ͧGkrd1xN9 <0L= ?Y8o8Pf%5NOjtmPOۓo ke ;#%CG_Jo5u:KDܿAg<"P;2L<!`ӝ& Q ̾`D#%〴;d &\ RL8 ]+t P&[$972Z`"1MC -K%) a?<!W%VA#9\ohTC4'PjLi8Nˋ $1;R(1tNKe]+5/(F}n [9۶ C;"#>i,h!'9_qXIiK~N>̹O)+=3w̆^yBBqB"&@J(e&J~Ӣ_6 IQa'OP OQ} gjn4Z@Vdwq;j(+8cpY뷝ȃ(ށƑVŸxOl8%"zZ({ffH P{]K.\Y&DU_J?ёv *r q1ϻMU>}!Ҁ^C ]+YJG# wiZSFÜaYd+q"#Hej(ǟc(d|C`QIQϾ3':cn܆E0Um .[r7ckQ#ȫjU4{ }7qmG-eT&CB8H-ˣq1GV⬺$Ӓi BZI gݤ ;; zlt'G" 3T'CM( ј1z@{I!SP*iS;9{!_Ձq4P_ׁS -e! 43蚑hA[b0NN-4@2{56GɈdKY:pKA[2 }6D! . ws =1SgcaڧbrGP_aM|:cؓ>J;Gfbs<^ 9*G>B]p|Y6ﾦE3ߊJ qOK_ʣ|!ߐCB1P᥄607pŤ+at a~=-%. 8n>^-V¦ge wEn 45!@-7"Lajqj4 afۯO5j<'aEdz7zdC!IW/v ꘧m+Iӟ ROCSטUuzy`ęI9Q-L4 bx+)]^9 nU\Uā !%O;} M__ K#%*PՑ2yOK;Q-51Cks g; !W!es0 `1= )bM'dCe1`-Pb]}vsoշ !^ N}kNgk"kw#Ud0zd_iC6?U+4O$]+{;v{ ϳ /#쁹`;;s/+ӷB )%KȰ2R o!¾U˞$ uӳӳV:iUd: __ :|m"5a`R˪Òtꀎ[$NRoqyN\?WϐJvL3R0 l)P 1Й>bdÌG!A`CaQ0& -f2Q*Lиmu5҈V˧̊P"gOBUԡ# H@Yx(˔6*L$BrV4vۺ)m<.KZUv5hթ5=T^8ڦ )HUi6F )֛;8x{9/ <jĢQz ʍ٭^5?Br+ ~.||Jk!< dQ ^TR8Nj*#Y{ KL)- \,I$"nSsdx3KFZj Lp! e=z?Q JF/QaCZc}@6`{JT10ob"#ը 6cS(Uˮ겜6n"**XTq1MO~sb T0-L w =dx@30o +xIkC{?*Xz H<a=E4M,6|ۯ|G ">4;Z70lyR/%M9HLဟ۶2N6-̕.vf^nk @ 3~K2+\d>. cV I&8rXi hy* Q.T"]: stJC;oTx6& Ma~yY)Kd6sO,Y\dDr L jT80j(7intË]@_h A@nNڍlVx2« !$jٌ! g@;Ow^ #+a^sV>0/ )^<eHe HROaPF X<]aAj-BI<g~5bsXYx͎G_0z=)7×Q J A Uܻ?S$$/+50jA)'(3*}+2"J`d5b;i<Ӿ~cwM3!3{FlCOO| 3RSp"tXУLFN#+lt1zvtG 6}"Q 9r9^hoR Sk (2!a,: : _= `҉ k&WӮ-K7q; sAЖ/Yc9(T.(_ L#^iooq\_3@R 2scl-IJm )(Q= ny2bFt% v3l_u.23_'xl%zނʤ C lկ:(J {~%X,T lKWY\kU2 ͍Rq/-8)nj_<YqffOO`ʭ /Z+5v=c\asWl"wN>dfRHK@ëg Ϝ1Svb_H<+fJc B>/b&P<Ox &hYh Ni併A0Db4Maµ5PG) b0WeTBZRZ.B9 o CǁxY֕e5=qnxCJLJ=U)ee=umdd0\!\mFrMʜQB( i v`۳ek5FyLijt/@C$ce=yZ ^=N {6ڎ)LrQiG {:ԏ+gk0+P[vta@L4^?+$s9sn$ /m>\^ӏ*x.: F} :@! ͎Z QTTnN)՞.DٸZghJb) ĈZ":Ci`>:,E ؈A˳*P` g&Y1 vʽ4!qd&^p^wӵ8аRvz?+ |7SX=qTqiP02];x W5Vcrv<֘"T)n \lPpKolMicTe)4D^j5:R;-TzY Vn 4}<n{9PRV=3GQ_ W7D5;fA`,q}..Kh'!cǸ[y#=3>2V( S _n Z: e❭4Ey.pJ o6^(,oH8¤7(HV2,.D'i* DߖNyE & KŚ1D^uQ;3ЫSD9l Ź9 V߁ԉV ;%- Tp6o$>.+,90,vS3 3bＢ f<Yᮟ.&'Ԣұ(P sua 9S쬥5heX̌bV ?}uԖaV L>SA{Et>ɱ&I!ő:+b+ItYcx /1IfC"I`cN\t ȸV/<^xqT蓼!p _aLr-8E!6c~'#Tn 1F!Si!%b_$u*p>5Gi?Fj¿olAo `LX{rO ?5.475 %Z 4Wȇ7Ղ ZԹ i{ ?bW0{c Dv *0ʛH B r9& a !ޝ2;N7T#vw;}8f` +d!8fb/z #" pBGk`Hf> C#ݏzBfI٪( dBtm:,s #%\ j :Ys> 6-EI)SӖS" H+ *WB3c $ \gÕhf`:/KTdbo->ߴ1)uNz MR"a\<Jtz$zsfTJ? ,{}bh|h弅CHFtp @A :Uߗе@_HtCd`2,LOopvV)b$FJhYDf\7sst?5Z".S UE+of?DvfIg'}pP{S {KjT1&L|rMΗ|5 0I6 C lmKv!aGk!ɠT!'WPwswE+W7L<:ElR,P0T-ɺɣ@0M.WLDvs[3p 4"-r3F' YGzu[EڇmkRpU ڨr s1G>, ՐG]mz?Չ'"8y15 -֣76z {7e]iR0gKA Elp2k՝s켝d2 uǍ` ʁPGIO4kf5ZH `d4%K'^Tm-Li@Z^22(-O$ ~|~7]By(ܙ&(F !2,u>Qt@SllPg5uc*;oV*2Rfo^~~Bu_\iw6uUYE|Շ%)tYU{WĴ汼l) 7 P{Ti 6b*C6y3|eq uN"{/*[G2e4Ҧ|Kauk~02e 2ד* ۖ o 'AÊc?hh/odcir 1v&-Sm}oI7Cy)6N{M~%:Im _ |+@cSĮ{q3fj#0"XMv+(C|L$9Oϒ_ӞWNsI5i$ڽy!r,,ey 8GG~, -т*WށQ.B@i&Oε%%z=b*#Ҧ`DX۞mobWڞӛ^Ρ~@Pz8J&鹘\}MիglV:U^Y&́8!ͣbJezD05@#XQ BK"21p'!/FXa%ߤ*wB3׆!k!% 2I"ud2^}I<F Ipf9{5R+b? %y<d!wTyמMnVe;,)2"&,4/vzԭ\rG ΤZ.b*yWyr, u\$̜M /G;`p HŅC:&jW;?YVrD8-4 [ϰK푪i\`nш YDwy@^^8$<77lLe>8@ϰՆ>5on _} A Cn{\I_E8V&C>6qe|r1CM (CyA0u; M|Fw#I![VF }ہ0蛼M^A4T͇~ L^ 'Dt9rsa,M7mElcL6D*6N+weHZO\.E!KEYR@Ƕ$K~kTt( V4遉o-H? {K\(5ن` _!{{{dj2/;W"X)xamo n̮/#y:k[ﳺaVO ee{=0I0LB$`Ƅt }UT#5"]sjMFK% ^?$) Ж ˡHu,@EYV?+v_Se W+#q>`8tg5&zh ÿ^mcYHxS4Joj Y28 bLj՛vJ qCj*\GhGM@D2P*zlsJo`0 s@;},4oT!u4Υ~ lToߦ u_ F]<ɪ6ab?{\Z{ k_ olfc!`3 q* ECiJ\; ?~eA4yÐŲhVH#-`@N 8d!V0q `FȱUQӝ 3wFnoP]zFgW\5P6,iq̴ #uB#Ql`ڄ &1[28] 6BW@UG*K=h<R8I_8@bʆVYR;r Vz\I}Dgx}f_ujo })!r92$Z2h?ȭ,Ygܛ]H'ȏA!#@nR9fSȚQ1$!zw,,??T L}-s*TITA_J kC QG{Qa環Yn}.J_HbyV( =m u̥?TFq, Ҧ-Ad_6Xzo 'X_<Q 5->HpjsD[q>)|[e[c駐:fBHʗ߉W2<ԝQN7qrͥUMm LWfg.u#Y[ZHVR(V\` CC& Rtx9"i95ISLWyRl[Hf ,gtPz_e9--&Oբ6Dvq.|Kyf;ԥ +R? EP~Ͳ_u)6k̓Yw1FJQo4[ԓljn_B &!nc@ [ïe[6 Rr1.AuK K}6J:;7tʜ|gL?R<ћ"82uI$vBx xѲ/7^T0#eŗN{ˢ5Z%$ӎ<7ݯG8ZHi-;u1kow]LJkIE0CO#;' =ajG^CHRaY 0XPv ^g YZ .shstrtab .note.gnu.build-id .gnu.hash .dynsym .dynstr .gnu.version .gnu.version_r .rela.dyn .rela.plt .init .text .fini .rodata .stapsdt.base .eh_frame_hdr .eh_frame .init_array .fini_array .data.rel.ro .dynamic .got .data .PyRuntime .probes .bss .note.stapsdt .gnu_debuglink .gnu_debugdata 8 8 $ o ` ` 2 ( h4 h4 H 0 8 o > > E o T 0 ^ B P P ! h c n t , , z , , P P4 P4 T4 T4 5 5 X P: P: X: X: `: `: = = = = = = @ @AN @1N `P `P P xP ( xP P 4 <P D R %